JP2001508758A - Group B Expression of Neisseria meningitidis outer membrane (MB3) protein from yeast and vaccine - Google Patents

Abstract

  (57) [Summary] The present invention generally relates to a method for obtaining the outer membrane protein meningococcal group B porin protein, especially MB3, and a fusion protein thereof. In particular, the present invention relates to a method for expressing the outer membrane protein meningococcal group B porin protein in yeast. The present invention also relates to a method for high-level expression of the above protein, wherein the expression rate of the protein replaces the nucleotide sequence of the 5 ′ region of the gene encoding the protein, and the sequence has an effect on the codon usage of yeast. Regarding the method that has been promoted by optimizing. The present invention also provides a Group A meningococcal polysaccharide (GAMP) antigen, a Group B meningococcal polysaccharide (GBMP) antigen, and a Group C meningococcal polysaccharide (GCMP) antigen together with a pharmacologically acceptable carrier. It also relates to vaccines containing The present invention also relates to a method for eliciting an immune response in a mammal, comprising administering the vaccine to the mammal in an amount sufficient to elicit an immune response.

Description

DETAILED DESCRIPTION OF THE INVENTION Group B Neisseria meningitidis outer membrane (MB3) protein from yeast Expression and vaccine                                Background of the InventionTECHNICAL FIELD OF THE INVENTION   The present invention belongs to the fields of genetic recombination, protein expression, and vaccine. The present invention relates to an outer membrane from Neisseria meningitidis. The present invention relates to a method for expressing a group B porin protein in a recombinant yeast host. Departure Ming also described Group A meningococcal polysaccharide (GAM) with a pharmacologically acceptable carrier. P) antigen, group B meningococcal polysaccharide (GBMP) antigen and group C meningococci It also relates to a vaccine comprising a polysaccharide (GCMP) antigen. The present invention also provides Comprising administering to the mammal the cutin in an amount sufficient to elicit an immune response. It also relates to a method of eliciting an immune response in a mammal.Description of the Background of the Invention   Meningitis due to meningococci remains a global problem, with endemic and epidemics (Peltola, H.), Rev. Infect. Dis. 5: 71- 91 (1983); Gotschlich, E.C., "By Meningococci. Meningococcal Meningitis ", Bacterial Vaccines, Germania rmanier, E.) Ed., Academic, New York (1984), pp. 237-2 55). Epidemics are everywhere in the world, with a population of 100,000 A high incidence rate of 500 per person has been reported. Treatment with antibiotics Without it, the mortality rate is extremely high (85%), even with antibiotic treatment. About 10%. In addition, patients treated with antibiotic therapy are treated with serious and permanent You may suffer from a disability. These facts are based on the Neisseria meningitidis sulf The emergence of adiazine-resistant bacteria has facilitated the rapid development of commercial vaccines. Lutra, Rev. Infect. Dis. 5: 71-81 (1983)).   Neisseria meningitidis is a gram-negative bacterium, serologically group A, B, 29e, W135, X, Y and Z (Gottschlich, "Meningitis caused by meningococci", Bacterial Vaccines, Germanie, edited by Academic New York (1984), pp. 237-255). H is another group , I and K in China (Ding, S.-Q., et al., J. Biol. Stand. 9: 307). 315 (1981)), Group L in Canada (Ashton, F.E.) J. et al. Clin. Microbiol. 17: 722-727 (1983)). This group Looping is based on the fungal capsular polysaccharide. Group A polysaccharide is 2-acetamido Partially O-acetylated do-2-deoxy-D-mannopyranosyl phosphate (1 → 6) linked homopolymers, which are group B polysaccharide and group C polysaccharide. It has been established that both sugars are homopolymers of sialic acid (Lui, T. et al. -Y.) Et al., J. Biol. Chem. 246: 2849-2858 (1971)).   Approximately 90% of meningitis cases caused by Neisseria meningitidis glue A, B and C. For group A and group C meningococci Successful meningitis prevention was achieved using a divalent polysaccharide vaccine (Gottsch). Rich et al. Exp. Med. 129: 1367-1384 (1969); N. Engl. J. Med. 282: 417-420 (19). 70)); This vaccine has been commercialized and commercialized in many parts of the world during the last decade. Has been successfully used to prevent and stop the predominant meningitis epidemic in the region . However, there is a need to enhance this vaccine. I mean, Significant parts of meningitis cases due to meningococci were in groups other than Groups A and C. This is because of the loop. Group B is particularly epidemiologically important, Group Y and group W135 are also important (Cadoz, M. et al., Vacc ine 3: 340-342 (1985)). Include group B polysaccharide in vaccine Was a special problem (see below); however, groups A, C, W A tetravalent vaccine containing 135 and Y is safe and immunogenic in humans (Kados et al., Vaccine 3: 340-342 (1985)) and are currently used. Vaccine against meningitis caused by meningococci (Jenin Gus (Jennings, H.J.), "Capsular Polysacc as a vaccine candidate. harides as Vaccine Candidates), Current Topics in Microbiol.and Immun ol., Jann, D. and Jann, B., Ed., Springer-Fairra Luk, Berlin (1990) Vol. 150: 97-127).   Just like other Gram-negative bacteria, the outer membrane of Neisseria species is a semi-permeable membrane, Free entry and flow of small molecular weight substances into and out of the periplasmic space of these bacteria Let them go in and out, but large molecules slow their entry and exit (Heasley ley, F.A.) et al., "Reconstitution and characterization of a Neisseria gonoloe outer membrane permeable barrier. (Reconstitution and characterization of the Neisseria gonorrhoeae o uter membrane permeability barrier) ”, Genetics and Immunology of Neiss eria gonorrhoeae, Danielsson and Normark Ed., University of Umea, Umea, pp. 12-15 (1980); Dougla s, J.T.) et al., FEMS Microbiol. Lett. 12: 305-309 (1981)). One of the mechanisms by which this is done is collectively called porins The protein is contained in these membranes. These proteins have three Consisting of identical polypeptide chains (Jones, RB) et al., Infect. .30: 773-780 (1980); McDade, Jr. Johnston, J. Bacteriol. 141: 1183-1191 (1980). ), In its natural trimer conformation, the outer membrane of the bacteria and its integration Form channels that rely on a water filled potential difference in other membranes (Lynch, E.C. et al., Biophys. J. 41:62 (1983); Lynch Biophys. J. 45: 104-107 (1984); Young (J.D.E.) et al. Proc. Natl. Acad. Sci. USA 80: 3831-3835 (1983); Mauro. (Mauro, A.) et al., Proc. Natl. Acad. Sci. USA 85: 1071-1075 (19 88); Young et al., Proc. Natl. Acad. Sci. USA 83: 150-154 (198). 6)). Since these proteins are relatively abundant in the outer membrane, these proteins Quality antigen Neisseria gonorrhoeae and Neisseria meningiti for epidemiological purposes. Have been used to subclassify both strains into several serotypes (flash (Fr Asch, C.E.) et al., Rev. Infect. Dis. 7: 504-510 (1985); Knapp ( Knapp, J.S.) et al., “Epidemiological and serological typing of Neisseria gonorrhoeae. Overview of epidermiological and clinical application s of auxotype / serevar classification of Neisseria gonorrhoeae) '', The Pat hogenic Neisseriae, Schoolnik, G.K., American Society f or Microbiology, Washington, pp. 6-12 (1985)). Today, gonorrhea and Many of these proteins from both meningococci have been purified (Heckels ( Heckels, J.E.), J. Gen. Microbiol. 99: 333-341 (1977); Mz and Heckels, J.M. Immunol. Meth. 42: 223-228 (1981); Judd, R.C., Anal. Biochem. 173: 307-316 (1988); Blake and Gottschlich, Infect. Immun. 36: 277-28. 3 (1982); Wetzler, L.M. et al., J. Exp. Med. 168: 188. 3-1897 (1988)), cloned and sequenced (Gottsi). Urich et al., Proc. Natl. Acad. Sci. USA 84: 8135-8139 (1987). ); McGuinness, B. et al., J. Exp. Med. 171: 1871-1882. (1990); Carbonetti and Sparling Proc. Natl. Acad. Sci. USA 84: 9084 to 9088 (1987); Feavers, I.M. et al., Infect. Immun. 60: 3620-3629 (199). 2); Murakami, K., et al., Infect. Immun. 57: 2318-2323 ( 1989); Wolff and Stern, FEMS Microbiol. .Lett. 83: 179-186 (1991); Ward, M.J. et al., FEM. S Microbiol. Lett. 73: 283-289 (1992)).   Porin proteins were initially isolated with lipopolysaccharide. As a result, Phosphoproteins have been termed "endotoxin binding proteins" (Bjornsson (Bjorns on) et al., Infect. Immun. 56: 1602-1607 (1988)). Studies of wild-type porin show that complete assembly and oligomerization are It has been reported that this does not occur unless LPS from the corresponding bacterial strain is present in the environment. (Holzenburg et al., Biochemistry 28: 4187-419). 3 (1989); Sen and Nikaido, J. Biol. Chem. 26 6: 11295-11300 (1991)).   The meningococcal porins have been subdivided into three major classes, It was known by naming as classes 1, 2 and 3 (Flash et al., Rev. Infect. .Dis. 7: 504-510 (1985)). Each meningococcus tested has a class 2 Contains one of the alleles of either the phosphorus gene or the class 3 porin gene. But not both (Fevers et al., Infect. Immun. 60 : 3620-3629 (1992); Murakami et al., Infect. Immun. 57: 231. 8 to 2323 (1989)). The presence or absence of class 1 genes is Seems to depend. Similarly, all probed gonococci have class 2 bites. Or only one porin gene similar to any of the class 3 alleles (Gottschlich et al., Proc. Natl. Acad. Sci. USA 84: 8135). -8139 (1987); Carbonetti and Sparling, Proc. Natl. Acad. .Sci. USA 84: 9084 to 9088 (1987)). Neisseria Gonoro The fly appears to have completely deleted the class 1 allele. So far sequencing Data from the identified genes indicate that all Neisserial porin proteins With at least 70% homology to the basic theme (Fevers et al., Infect. Immun. 60: 362). 0-3629 (1992)). Recognized between these Neisserial porin proteins Most of these mutations affect these pathogenic microorganisms in their natural hosts, humans. Is suggested to be due to the immunological pressure caused by the ing. However, how changes in the sequence of the porin protein Little is known about whether they affect the functional activity of these proteins No.   In studies of lipid bilayers, the isolated gonococcal porin of the class 2 allele was Class 3 isolated gonococcal porin and electricity with respect to ion selectivity and potential difference dependence It has been reported that they exhibit slightly different physical behavior (Lynch et al., Biophys. 41:62 (1983); Lynch et al., Biophys. J. 45: 104-107 (198). 4)). In addition, various porins are added to these lipid bilayers from intact living bacteria. The ability to penetrate is not only related to the type of porin, but also to the Neisseria species from which it is derived. (Lynch et al., Biophys. J. 45: 104-107 (1984)). . At least some of these functional properties may be attributed to different porin protein sequences. It seems to be related to the area where So far in all gonococcal class 2-like proteins One such functional region identified in is the chymotrypsin cleavage site. Upon chymotrypsin digestion, this class of porin loses its ability to respond to potential differences. Is closed. Neisseria gonorrhoeae class 3-like porin and meningococcal porin lack this sequence. Have been lost and therefore are not subjected to chymotrypsin cleavage, but nevertheless closed. Responds to the applied potential difference by chaining (Greco, F.) Channel formation in lipid bilayer by outer membrane proteins (The formation of c) hannels in Iipid bilayers by gonococcal major outer membrane protein) " , Abstracts, The Rockefeller University, New York (1981); Greco et al. 39: 1813 (1980)).   Neisserial porins are among the most abundant proteins in the outer membrane of these organisms. One and the antigen upon infection (unlike some other major surface antigens) Because of no shift, Neisseria meningitidis and Na The universal presence and surface exposure in both Iseria gonoloe Are vaccine candidates for organisms. Recovering from meningococcal disease Patients produce anti-porin antibodies, and immunization with porin protein The antibodies raised are bactericidal against homologous serotypes. In addition, certain epidemiology In a typical setting, most strains causing meningococcal disease have a limited number of serum Serotype 2 and class 3 proteins in strains having types, especially class 2 proteins It belongs to serotype 15 in a strain having protein. Therefore, class 2 and 3 tampers Quality is a potential vaccine candidate.   A major obstacle to such research is the use of modern molecular techniques to integrate the porin gene. Easy manipulation and biophysical characterization of these altered porin proteins The ability to obtain sufficient purified protein to obtain the protein. In the early days, The cloned Neisseria porin gene is harbored when expressed in E. coli. It was recognized as lethal to the major E. coli (Carbonetti and Sparling, Proc. Natl. Acad. Sci. USA 84: 9084 to 9088 (198 7); Carbonetti et al., Proc. Natl. Acad. Sci. USA 85: 6841-68. 45 (1988); Barlow, A.K., et al., Infect. Immun. 55: 2734. ２７2740 (1987)). Therefore, many of these genes are fragments of the entire gene. Cloned and sequenced as or low copy under tight expression control Acad. Sci. US (Carbonetti et al., Proc. Natl. Acad. Sci. A85: 6841-6845 (1988)). Under these conditions, even if all poly Once the gene has been expressed, it can be further purified and processed for characterization. The resulting protein accumulated very little.   Other minor successes in this regard have been the Paulin gene Into a low copy number, tightly controlled expression plasmid. Introduce a modification to the phosphorus gene and then reintroduce the modified sequence into Neisseria (Carbonetti et al., Proc. Natl. Acad. Sci. USA 85: 6841-6845 (1988)). However, this method also Problems, especially with the sophisticated restriction endonuclease system present in gonococci. (Davies, J.K.), Clin. Microbiol. Rev. 2: 78-82. (1989)).   Vaccines containing Neisseria porin have long been sought, but all blood Effective meningococcal organisms with complete coverage for clear organisms and all humans Sugar vaccines are also needed. In developing such a broad-spectrum polysaccharide vaccine, Some serious problems remain. First, the polysaccharides of Groups A and C are And older children, but its effectiveness in infants is marginal. (Goldschneider (I.) et al., J. Infect. Dis. 128: 769-776 (1973); Gottschlich et al., " The Immune Responses to Bacterial Poly in Humans saccharides in Man) ", Antibodies in Human Diagnosis and Therapy, Hay Bar (Haber, E.) and Klaus (Krause, R.M.), Raven, New York ( 1977), 391-402). Second, group B meningococcal polysaccharides are Is poorly immunogenic (Wyle, F.A., et al., J. Infect. Dis. 1). 26: 514-521 (1972)). The third problem is that multivalent vaccines require each component They tend to be less immunogenic than when administered individually (Insel ( Insel, R.A.), “Exemption by concurrent or simultaneous administration of vaccine components Potential alterations in immunogenicity by combini ng or simultaneously administering vaccine components) ", Annals of the  New York Academy of Sciences, Vol. 754, Combined Vaccines and Simulta neous Administration: Current Issues and Perspectives, Williams liams, J.C.) et al., New York Academy of Sciences, New York (1993) 35-47; Clemens, J., et al., "Hemophilus. Mutual interaction between PRP-T vaccine and conventional infant vaccine against influenza b Action: A course for future research on co-immunization and combination vaccines (Interactions b etween PRP-T vaccine against Haemophilus influenzae type b and conv entional infant vaccines: lessons for future studies of simultaneous imm unnalization and combined vaccines) ", Annals of the New York Academy of S ciences, Vol. 754, Combined Vaccines and Simultaneous Administration: Current Issues and Perspectives, Williams et al., New York Academy -Sciences, New York (1993), pp. 255-266; Paradiso, P.R., et al., Pediatrics 92 (6): 827-832 (1993). ).   Currently available services for Neisseria meningitidis of Groups A and C Kuching is a polysaccharide characteristic in infants as opposed to the immunity produced by most antigens. Insufficient immunogens in human infants because the differential immune response is T-cell independent It has only sex. In the absence of T cell involvement, the immune response is short-lived It is only. More importantly, no immune memory was revealed, and therefore "Booster -"No reaction occurs. In addition, antibody affinity maturation does not occur. These disadvantages are: This is due to the inability of the polysaccharide to specifically bind to T cells. Probably a T cell The structural properties required to bind the receptor are not present in most polysaccharides. Would. Antibody response to polysaccharides in infants due to the T-cell independent nature of the immune response Is limited to antibodies of the IgM isotype; the isoforms required for the production of non-IgM antibodies Ipswitch requires the involvement of T cells. More mature humans (2+ years) Indicate that polysaccharide antigens can elicit antibodies of the IgG isotype as well as IgM It's not much of a problem (Yount et al., J. Exp. Med. 127: 633- 646 (1968)).   Group B meningococcal polysaccharides are higher in humans of all ages than other polysaccharides. Low immunogenicity. Two main explanations have been proposed to explain this property (Jennings, Adv. Carbohydr. Chem. Biochem. 41: 155-208 (198 3); Lifely, M.R., et al., Vaccine 5: 11-26 (1987)) . One is Group B meningitis, which is an α (2 → 8) -linked sialic acid homopolymer Bacterial polysaccharide is rapidly depolymerized in human tissues due to the action of neuraminidase Is Umono. Second, the structure is recognized as “self” by the human immune system. As a result, the production of antibodies specific to this structure is suppressed. Weight of evidence In brief, the latter explanation has a distribution. Because of Group C meningococcal polysaccharide neura Minidase-sensitive mutant [α (2 → 9) -linked sialic acid homopolymer] is human Is known to have high immunogenicity (Glode, M .; P.) et al., J. Infec. Dis. 139: 52-59 (1979)). Further, group B The polysaccharide is converted to a protein carrier (tetanus toxoid) via the non-reducing sialic acid at its terminal. ) (This makes the polysaccharide stable to neuraminidase) The conjugate did not result in significantly enhanced immunogenicity (Jennings and Lugowski (Lugowski, C.), J. Immunol. 127: 1011-1018 (1981)). The above observations Production of Antibodies with Specificity for α (2 → 8) -Bound Sialic Acid Residues Consistent with the theory of avoiding life. This theory further extends to human and animal tissues. The presence of α (2 → 8) -linked sialic acid residues in the polysaccharide was confirmed by the identification. It has been certified. New approach to overcome insufficient immunogenicity of Group B polysaccharide The first step is to chemically modify this.   The T cell-independent nature of polysaccharide antigens in human infants is attributed to It can be overcome by conjugating (covalently linking) to a carrier. Late newborn Bacterial capsular polysaccharide, a major cause of meningitis in children, is conjugated to a protein carrier These include Haemophilus influenzae type b (Schenierson (Sc. hneerson, R.) et al., J. Exp. Med. 152: 361-376 (1980); Sonerson (P.W.), Infect. Immun. 39: 233-238 (1983); Marburg, S. et al., J. Am. Chem. Soc. 108: 5282-5287 (1 986)), group A (Jennings and Lugowski, J. Immunol. 127) : 1011-1018 (1981); Beuvery, E.C., et al., Vaccine 1. : 31-36 (1983)), B (Jennings and Lugowski, J. Immunol). l.127: 1011-1018 (1981)), and C (Jennings and Lugowski, J. Immunol. 127: 1011-1018 (1981); Bobury 40, 39-45 (1983)) Neisseria meningiti. Pneumoniae, and type 6A (Strep. Pneumoniae) (Chu, C.) et al., Infect. Immun. 40: 245-256 (1983)). You. When choosing a carrier protein, most researchers argue that tetanus toxoid Or diphtheria toxoid, and these two proteins are It is used as a baby vaccine. Recent innovations in this theme are non-toxic Diphtheria toxin from one mutant (CRM₁₉₇) (Anderson, Infect. Immun. 39: 233-238 (1983)). The importance of this protein All amino groups because it does not require detoxification by formaldehyde treatment. Remains underivatized, which is a conjugation It is to make the gating process very simple.   The use of other possible bacterial proteins as carriers is less widely explored. Not. However, some serotype outer membranes of Neisseria meningitidis Proteins have been used as protein carriers (Marburg et al., J. Mol. Am. Che m. Soc. 108: 5282-5287 (1986)).   Based on the above, Neisseria meningitidis outer membrane group B porintan It is clear that there is a significant need for methods that can produce large quantities of protein. It will be clear. There are also three major serogroups of Neisseria meningitidis Has full coverage for groups A, B and C, Polysaccharide vaccines that can confer immunity to these organisms in both mature humans It will be clear that there is a need for                                Summary of the Invention   A general object of the present invention is to provide a Neisseria meningitidis group B porin protein, It is an object of the present invention to provide a method for expressing ras 3 porin protein in yeast.   Particular objects of the invention are: (A) in a plasmid with a selectable marker (I) mature porin protein, (Ii) a fusion that is a mature porin protein fused to a yeast secretory signal peptide protein, Cloning a gene encoding a protein selected from the group consisting of Wherein the gene is operably linked to a yeast promoter, (B) transforming the plasmid containing the gene into a yeast strain; (C) growing the yeast in a medium that allows the selection of the transformed yeast. Therefore, select the transformed yeast, (D) growing the transformed yeast, (E) inducing expression of the protein to obtain a yeast containing the protein, The protein thus expressed is the total protein expressed in the yeast Accounts for about 2% or more of Adventitious meningococcal group B porin protein or fusion thereof An object of the present invention is to provide a method for expressing a protein in yeast.   Another specific object of the invention is that the protein thus expressed is expressed in yeast. Mature porin protein or its fusion, accounting for about 3-5% of the total protein An object of the present invention is to provide a method for expressing a synthetic protein.   Still another specific object of the present invention is that the protein is Neisseria meningitidis Mature polinta, which is an adventitia meningococcal group B porin protein (MB3) An object of the present invention is to provide a method for expressing proteins.   Another specific object of the invention is that the yeast promoter is an AOX1 promoter. To express a mature porin protein or a fusion protein thereof Is to do.   Another specific object of the invention is that the yeast secretory signal peptide is Saccharomyces ・ Selevisier (S. cerevisiae) α-mating-factor prepropepti Secretion signal and Pichia pastoris (P. pastoris) acid phosphatase Adventitia meninges, selected from the group consisting of gene (PHO) secretion signals Expression of Bacillus subtilis group B porin protein or its fusion protein in yeast The purpose is to provide a way to make it work.   Still another specific object of the present invention is that the plasmid is pHIL-D2, pHIL -Selected from the group consisting of S1, pPIC9 and pPIC9K, Providing a method for expressing the MB3 or a fusion protein thereof in yeast. is there.   Another specific object of the present invention relates to the use of the above meningococcal group B porin protein. At least one codon in the 5 'region of the gene to be encoded Expression of the protein or its fusion protein, which has been altered to optimize It is to provide a current method.   Still another specific object of the present invention is the above meningococcal group B porin protein. The 5 'region of the quality-encoding gene maximizes codon usage in Pichia pastoris. The protein or its fusion, comprising a nucleotide sequence employing codons to be optimized An object of the present invention is to provide a method for expressing a combined protein.   It is another particular object of the invention that the codon change is (at positions 4-6 of the native sequence). GTT → GTC), (ACC → ACT at positions 7 to 9 of the native sequence), CTG → TTG at positions 10 to 12 of the sequence, (positions 16 to 1 of the native sequence) 8, GGC → GGT), (ACC → A at positions 19-21 of the native sequence) CT), (ATC → ATT at positions 22-24 of the native sequence), (of the native sequence AAA → AAG at positions 25-27), (at positions 28-30 of the native sequence) GCC → GCT), (GGC → GGT at positions 31-33 of the native sequence), (GTA → GTT at positions 34-36 of the native sequence), (position 37 of the native sequence ~ 39 in the group consisting of GAA → GAG), The position is the first nucleotide in the natural nucleotide sequence that encodes the protein. The object of the present invention is to provide the above-mentioned method, which is counted from the code.   Another specific object of the present invention is that the 5 'region of the gene is a Pichia pastoris SEQ ID NO: 26, including codons optimized for don usage. Another object of the present invention is to provide the above method.   Another specific object of the invention is that the yeast separates the protein or fusion protein. It is an object of the present invention to provide a method for expressing the above-mentioned protein.   Another specific object of the invention is that the vector in which the secreted protein is expressed is pHI L-S1, selected from the group consisting of pPIC9 and pPIC9K, An object of the present invention is to provide a method for expressing the above protein.   Another specific object of the invention is the insoluble intracellular and outer meninges obtained according to the invention. A method for purifying Bacillus subtilis group B porin protein or a fusion protein thereof. hand, (A) dissolving the yeast expressing the protein to form an insoluble membrane Release as a co-fraction, (B) washing the insoluble substance obtained in the step (a) with a buffer solution, Removes protein, (C) suspending and dissolving the insoluble fraction obtained in step (b) in an aqueous solution of a denaturing agent, (D) diluting the solution obtained in step (c) with a surfactant, (E) purifying the protein by gel filtration and ion exchange chromatography Do It is another object of the present invention to provide a method characterized by the above.   Another specific object of the present invention relates to the adventitia meningitidis group B obtained according to the present invention. A method for purifying a porin protein or a fusion protein thereof, (A) centrifuging the yeast culture solution expressing the protein, Is isolated as a soluble secreted substance, (B) from the soluble secretory substance obtained in step (a), the yeast Removed by precipitation with 20% ethanol, the soluble secretions Quality remains in the soluble fraction, (C) Precipitating the secreted substance from the soluble fraction of step (b) with about 80% ethanol. Let (D) washing the precipitated substance obtained in step (c) with a buffer to remove yeast contaminants; Removes protein, (E) suspending and dissolving the precipitated substance obtained in step (d) in an aqueous solution of a surfactant; Then (F) purifying the protein by ion exchange chromatography It is another object of the present invention to provide a method characterized by the above.   Another specific object of the invention is that (A) Mature porin protein (B) a fusion that is a mature porin protein fused to a yeast secretory signal peptide protein A yeast host cell containing a gene encoding a protein selected from the group consisting of: To provide the gene operably linked to a yeast promoter. And there.   Another particular object of the present invention is to provide a Neisseria meningitidis composition of serogroup B. A yeast host cell capable of expressing a mature outer membrane class 3 protein (MB3) is provided. It is in.   Still another specific object of the present invention is that the yeast promoter is an AOX1 promoter. To provide a yeast host cell as described above.   Another object of the present invention is to provide a Group A meningococcus with a pharmacologically acceptable carrier. Polysaccharide (GAMP) antigen, group B meningococcal polysaccharide (GBMP) antigen, and It is an object of the present invention to provide a vaccine containing a C-meningococcal polysaccharide (GCMP) antigen.   Yet another particular object of the present invention is to provide a method for eliciting an immune response in a mammal. Administering an effective amount of the above vaccine to the mammal. It is to provide a method for raising an immune response.   Other objects and advantages of the present invention will become apparent from the following description.                             BRIEF DESCRIPTION OF THE FIGURES   FIG. 1: Schematic diagram showing the PorB gene sequencing strategy. PC described in Example 1 R product (Materials and Methods Division) was transferred to the expression plasmid pET-17b using the BamHI -Ligated into the XhoI site. The first double-stranded primer-extension sequencing Immediately upstream of the BamHI site and of the XhoI site in the pET-17b plasmid This was performed using the oligonucleotide sequence immediately downstream. Another sequence data, exo Using the nuclease III / Malina nuclease reaction, a large number of By generating a deletion of Re-ligation and transformation into E. coli After conversion, several clones were selected according to the size of the insert and subsequently sequenced did. This sequencing was performed on oligonucleotides immediately downstream of the Bpu11021 site. The primers were always used from the 3 'end of the gene.   Figure 2: Gel electrophoresis showing the products of the PCR reaction (1% Electrophoresis in galose).   Figures 3A and 3B, Figure 3A: control pET-17b plasmid without insert. Escherichia coli with a primer and the resulting PCR product described in the Materials and Methods section E. coli clones harboring the pET-17b plasmid containing the insert from SDS-PAGE analysis of cell lysates. Both cultures have an absorption at 600 nm. The luminosity is 0. 6 and added IPTG, incubate at 37 ° C for 2 hours. I did it. Add each culture to each 1. Take 5 ml, centrifuge and remove bacterial pellet to 100μ 1 in SDS-PAGE preparation buffer. Lane A shows a control sample of 10 μm. 1 shows the protein profiles obtained in lanes B (5 μl) and C (1 0 μl) is the protein profile of the E. coli host expressing the PorB protein Is shown. FIG. 3B: control pET without insert after 2 h induction with IPTG. Western blot analysis of whole cell lysates of E. coli with the -17b plasmid, Lane A, 20 μl and corresponding containing porB-pET-17b plasmid E. coli clones, lane B, 5 μl; lane C, 10 μl; and lane D, 2 0 μl. Using monoclonal antibody 4D11 as primary antibody, as described Western blots were developed. Prestained low molecular weight standards from BRL were Used in cases.   Figure 4: Mature PorB gene cloned into expression plasmid pET-17b. Offspring nucleotide sequence and translated amino acid sequence. Previously published serum Two nucleotides different from type 15 PorB are underlined.   Figure 5: Monitored by absorbance at 280 nm and SDS-PAGE analysis Wild-type class 3 protein isolated from meningococcal strain 8765 and r3p According to BL21 (DE3) -ΔompA E. coli strain having ET-17b plasmid Sephacryl S-300 color of both recombinant class 3 proteins produced by 4 is a graph showing a system elution profile. The void volume of the column is indicated by the arrow. S Fractions containing meningococcal porins as determined by DS-PAGE And the fractions containing recombinant porin are indicated by horizontal bars.   Figure 6: Homologous PorB competes with reactive antibodies in six human immune sera. 4 is a graph showing the results of an inhibition ELISA assay showing the ability to perform the assay. Thick line for arithmetic mean suppression Indicated by   FIG. 7: Recombinant PorB protein was reactive in 6 human immune sera FIG. 4 is a graph showing the results of a suppression ELISA assay showing the ability to compete with the body. Arithmetic mean Suppression is indicated by a bold line.   FIG. 8: These two obtained using wild-type and recombinant PorB proteins 5 is a graph showing a comparison of average suppression.   FIG. 9A and FIG. 9B: Composition cloned into expression plasmid pET-17b. Nucleotide sequence and translated amino acid sequence of mature class II porin gene.   Figures 10A and 10B: Cloned into expression plasmid pET-17b. And translated amino acid sequences of a fused fusion class II porin gene. .   FIG. 11 (panels A and B): panel A shows restriction sites for pET-17b plasmid. The figure is shown. Panel B shows the region between the BglII and XhoI sites of pET-17b. Shows the nucleotide sequence. The sequence provided by this plasmid is As shown, the sequence inserted from the PCR product is shown in bold print. From this plasmid Amino acids are shown in normal print, but amino acids from the insert are shown in bold print . Arrows indicate where the sequence that matches the sequence of FIG. 4 starts and where it ends Is defined.   Figure 12: Clone pnv322 (expression vector used is pHIL-D2) 2) is a graph showing the expression level of MB3. The expression level of MB3 was expressed in mg insoluble M Shown as B3 / g cell pellet / unit time.   Figure 13A: pNV15 (pE15) prior to codon preference optimization. DNA sequence and translated amino acid sequence of MB3) in T24a.   FIG. 13B: Men. Class3 opt. (M optimized for yeast codon preferences B3) DNA sequence and translated amino acid sequence.   Figures 14A and 14B: Graph showing elution of MB3 from size exclusion column. . MB3 expressed in intracellular form was purified using a denaturation / restoration protocol followed by gel filtration and And purified by ion exchange chromatography. The purified protein obtained Is a recombinant class overexpressed in E. coli by size exclusion chromatography. The elution profile is similar to that of protein 3 and both are wild-type counterparts. Gives the same elution profile. This implies that MB3 is regenerated and oligomerized To achieve a complete natural conformation. 14 (A ): Elution profile of MB3; 14 (B): expressed and regenerated from E. coli inclusion bodies Elution profile of class 3 protein.   Figure 15: Sue connected to HPLC (Hewlett Packard model 1090) Size exclusion of purified MB3 on Superose 12 (Pharmacia) Graph showing chromatography. Comparison and analysis of MB3 with its natural wild type counterpart The elution profile was based on calibration using the Indicates a (trimeric assembly). The molecular weight marker is 1 = thyroglobulin (6 70,000); 2 = gamma globulin (158,000); 3 = myoglobulin (17,000).   16A, 16B and 16C: DNA sequence of clone pnv322. This Clones were obtained from pHIL-D2, an expression vector for Invitrogen. It has the MB3 gene inserted at the RI site. Therefore, MB3 is the AOX1 promoter. Inserted immediately downstream of the motor. This construction allows for intracellular expression. Vector sequences are shown in upper case, while MB3 sequences are shown in lower case.   17A, 17B and 17C: DNA sequence of clone pnv318. This Is a clone of Xho from pHIL-S1, an expression vector for Invitrogen. It has the MB3 gene inserted at the I-BamHI site. Therefore, MB3 is PH Secretion signal for secretion of expressed protein immediately downstream of OI leader peptide Inserted in open reading frame and in frame. Vector sequence Is shown in upper case, while the MB3 sequence is shown in lower case.   18A, 18B and 18C: DNA sequence of clone pnv342. This The clones of pIC-9, the expression vector of Invitrogen, are EcoR It has the MB3 gene inserted into the I-AvrII site. Therefore, MB3 Immediately downstream of the α-factor prepropeptide secretion signal for protein secretion Has been inserted. Vector sequences are shown in upper case, while MB3 sequences are in small text It is shown in letters.   19A, 19B and 19C: DNA sequence of clone pnv350. This Clone was obtained from pPIC-9K, an expression vector of Invitrogen. It has the MB3 gene inserted at the RI-AvrII site. Therefore, MB3 is expressed Immediately downstream of the α-factor prepropeptide secretion signal for protein secretion Has been inserted. Vector sequences are shown in upper case, while MB3 sequences are small. Shown in letters.   Figure 20: Absorption of GAMPNTT-monomer and GAMP-TT conjugate The graph which shows a degree spectrum (electropherogram (electropherogram)).   Figure 21: Absorption of GCMP, TT-monomer and GCMP-TT conjugate 4 is a graph showing a degree spectrum (electropherogram).   Figure 22: Monovalent (A) and trivalent (A / B / C) meningococcal conjugate vaccines Graph showing A-specific IgG ELISA titers induced in mice by tin H.   Figure 23: Monovalent (A) and trivalent (A / B / C) meningococcal conjugate vaccines Graph showing B-specific IgG ELISA titers induced in mice by tin H.   Figure 24: Monovalent (A) and trivalent (A / B / C) meningococcal conjugate vaccines. Graph showing C-specific IgG ELISA titers induced in mice by tin H.   Figure 25: Monovalent (A) and trivalent (A / B / C) meningococcal conjugate vaccines. FIG. 4 is a graph showing A-specific bactericidal action induced in mice by tin.   Figure 26: Monovalent (A) and trivalent (A / B / C) meningococcal conjugate vaccines. FIG. 4 is a graph showing B-specific bactericidal action induced in mice by tin.   Figure 27: Monovalent (A) and trivalent (A / B / C) meningococcal conjugate vaccines. Fig. 4 is a graph showing C-specific bactericidal action induced in mice by tin.                             Detailed description of the invention   Neisseria meningitidis outer membrane group B porin protein It is possible to overcome some of the difficulties in expressing and purifying them. Success Mature porin proteins such as class 2 and class 3 and fusion proteins thereof The DNA sequence of the protein was amplified using the chromosome of N. meningitidis as a template for the PCR reaction. I let you. The amplified porin sequence was ligated into an expression vector containing a T7 promoter. Gated and cloned. E. coli lysogenic for DE3 lambda phage Strain BL21 (Studier and Moffatt, J. Mol. Bi ol. 189: 113-130 (1986)) to remove the ompA gene. One expression for the pET-17b plasmid containing the porin gene. Selected as host. When induced, a large amount of meningococcal porin protein causes host Accumulated in Escherichia coli without any apparent lethal effect. Manifested meningitis Bacterial porin protein is extracted and processed by standard methods, and finally the molecular sieve Purified by chromatography and ion exchange chromatography. Molecule As can be seen from the protein profile from Rai chromatography, Meningococcal porin eluted from the column as a trimer. Such high expression is possible That the PCR artifact is not introduced into the meningococcal porin gene To confirm the sequence, the inserted PorB gene sequence was determined. Expressed recombinant port Protein is regenerated to its native antigenic, trimeric conformation A suppression ELISA assay was used to obtain further evidence that   As an alternative to the bacterial E. coli host system, N. meningitidis B class 3 porintan The protein (MB3) can be expressed in yeast. The preferred host is methylot Loaf yeast Pichia pastoris, opened by Invitrogen The resulting Pichia expression kit may be used for transformation. Yeast produces heterologous proteins An attractive host for Unlike prokaryotic systems, the eukaryotic subcellular machinery of yeast , The post-translational regeneration and proteolysis necessary to produce "intrinsic" and bioactive proteins It allows you to perform many of the sexing and modification events. Pichia as a eukaryotic cell Pastoris has many of the advantages of advanced eukaryotic cell expression systems, while E. coli and It is as easy to handle as Calomyces cerevisiae. Pichia as yeast Pastoris has similar molecular and genetic engineering advantages as Saccharomyces Along with 10 to 100 times higher heterologous protein expression levels and higher eukaryotes It also has the advantage of protein processing properties of the organism.   Expression in Pichia also has advantages over expression in other yeasts. Because Pichia glycoproteins too much like Saccharomyces cerevisiae does Because it does not In addition, proteins expressed and modified in Pichia The protein is therapeutically less than that produced by Saccharomyces cerevisiae. Layers are useful. The oligosaccharide added by Pichia is Saccharomyces ・ It seems to be the main cause of high antigenicity of proteins produced by S. cerevisiae This is because they lack α1,3 glycan bonds. Hepatitis B used clinically Several vaccine antigens, including surface antigens, are produced in yeast cells (Creg ( Cregg) et al., Bio / Technology 11: 905-910 (1993)).   Unlike the porin protein of E. coli and a few other Gram-negative bacteria, Changes in the primary sequence of porin from ceria depend on its ion selectivity and potential difference Gender and how it affects other biophysical functions Little is known. Recently, two E. coli porins, OmpF and P The crystal structure of hoE is 2. 4Å and 3. 0Å (Cowan ( Cowan, S. W. ) Et al., Nature 358: 727-733 (1992)). These large Both enteric porins have their extraordinary stability and easy manipulation of molecular genetics It has been studied in detail for that. About the genetics of these two porins The data obtained showed a good correlation with the crystal structure. Neisseria Pauline Several studies using monoclonal antibodies to select The surface topology is very similar to the topology of these two E. coli porins. (Van der Ley, P. In) fect. Immun. 59: 2963-2971 (1991)). (Kowan et al., Nature 358: 727-733 (19) 92)), a change in the amino acid sequence in a specific region of Neisseria porin is Almost no information is available on how they affect physical properties Not.   The two main issues that have hindered this study are: (1) The genetic manipulation of Neisseria cannot be easily performed by modern molecular technology, and And (2) further purification to obtain biophysical and biochemical characterization data. Insufficient amounts of Neisseria porin cannot be expressed in Escherichia coli or yeast thing. In fact, most of the DNA sequence data for gonococcal and meningococcal porins Clone the duplicated fragment of the porin gene, and reconstruct the obtained information. It is obtained by constructing and elucidating the entire gene sequence. Julich et al., Proc. Natl. Acad. Sci. USA 84: 8135-8139 (1987) ); Murakami et al., Infect. Immun. 57: 2318-2323 (1989)). Mosquito -Bonetti et al. For the first time using a tightly regulated pT7-5 expression plasmid The entire porin gene of the fungus was cloned into E. coli. The results of these studies are Porin protein accumulates very little when the porin gene is induced. This indicates that expression of this protein is lethal for E. coli (Carbo Netti and Sparling, Proc. Natl. Acad. Sci. USA 84: 9084-9 088 (1987)). In another study, Carbonetti et al. (Proc. Natl. Acad . Sci. USA 85: 6841-6845 (1988), for the porin gene of Neisseria gonorrhoeae. Changes in this system in E. coli and then reintroduced into Neisseria gonorrhoeae. And can be done. However, these operations can be easily performed And sufficient poly for further biochemical and biophysical characterization There seems to be a limit to the availability of protein You.   Fever's et al. Reported that the consensus sequence at the 5 'and 3' Using two synthetic oligonucleotides from a wide range of sources A method for amplifying a phosphorus gene by PCR has been described (Fevers et al., Infe ct. Immun. 60; 3620-3629 (1992)). Oligonucleotide structure Construction was performed using amplified DNA with restriction endonucleases BglII and XhoI. In such a way that it could be forcibly cloned into a plasmid.   Using the PCR system of Fever's et al. The DNA sequence of the mature PorB protein was amplified and the T7 expression plasmid pET-1 Ligation into the BamHI-XhoI site of 7b. This allows the mature P The orB protein sequence is a φ10 tag containing the T7 promoter and leader sequence. It would be placed in frame immediately after the 20 amino acids of the protein. When IPTG is added to the culture solution of E. coli containing this plasmid, a large amount of PorB Protein accumulated in the bacteria. Why the construct is not lethal for E. coli, Future explanations about whether large amounts of porin protein are expressed will be studied in the future Have to wait. However, one possible hypothesis is that these A. Promoter and signal sequences were replaced with those of T7 and φ10, respectively. Did that the porin product was directed towards the cytoplasm rather than the outer membrane. That is to say. Henning and his colleagues report that E. coli Products found in the cytoplasm when pA protein and fragments thereof are expressed Report lower toxicity than products directed to the periplasmic space. Rose (Klose, M. ) Et al., J. Biol. Chem. 263: 13291-13296 (198 8); Close et al., J. Biol. Chem. 263: 13297-13302 (1988) Freudl, R .; ) Et al., J. Mol. Biol. 205: 771-775 (1989) )). Whatever the explanation, once the PorB protein is expressed, It is easily isolated and purified, and appears to regenerate into trimers just like natural porins . The results of the suppression ELISA data using human immune sera were thus obtained. PorB protein was purified from the wild-type PorB protein purified from N. meningitidis. Suggests to reacquire most, if not all, of the antigenic properties You. This expression system is itself a Neisseria porin gene by modern molecular technology. The operation of the child is facilitated. In addition, this expression system is pure for characterization. It makes it possible to obtain a large amount of smart porin protein. In addition, this expression system Similar way to genes from many strains of Neisseria, both Neisseria gonorrhoeae and Neisseria meningitidis To be examined and characterized.   Neisseria meningitidis outer membrane class 3 protein from serotype B (MB3 ) Also converts the MB3 DNA fragment into a strong Pichia pastoris alcohol oxidase. Methylotrophic yeast Pichia under the control of AOXI promoter -It was also expressed in Pastoris. When induced with methanol, forms with recombinant plasmid The transformed Pichia pastoris strain may be a native MB3 protein or a fused MB3 protein. Produces any of the proteins that are produced against their wild-type counterparts. It was reactive with raised mouse polyclonal antibodies. Shake flask culture smell hand, Genetically engineered Pichia pastoris can be used at about 1 to 1 g of pelleted wet cells. Produced 3 mg or 100-600 mg of expressed protein per liter However, this is 10-15% of the yeast cell suspension or about 3-5% of the total cellular protein. % (Table 4). Full-length MB3 NA developed by Invitrogen Each of the four Pichia expression vectors was cloned. Complete monomer In order to express a 34 kDa MB3 protein, intracellular pHIL-D2 Was used. The map of pHIL-D2 vector is shown in Pichia Expression Kit, version E's Invitrogen Manual, the entire contents of which are incorporated herein by reference. On page 19). This construct has the highest expression level (cell 1 Up to 3 mg MB / g) were given (Tables 3 and 4). The expressed product is It was not excreted, was primarily (95%) insoluble, and was tightly bound to cell membranes.   To further increase the likelihood of secretion of expressed MB3, different secretion signals are used. Three other vectors with were also used: from the acid phosphatase gene PHO1. PHIL-S1 containing the native Pichia pastoris signal sequence, and Saccharo Contains secretion signals from the prepropeptide of the S. cerevisiae α-mating factor Vectors pPIC9 and pPIC9K. pHIL-S1 and pPIC9 vector Map of Pichia Expression Kit, Version E, Invitrogen Al., Pages 21-22. pHIL-S1 / MB3 construct is apparent Has a molecular weight of 36. Expressing the 5 kDa MB3-PHO1 fusion polypeptide, The polypeptide is partially processed to produce a mature 34 kDa MB3 I found out. About 5 to 10% of expressed MB3 is secreted into yeast growth medium 36. About 40-50% of the 5 kDa fusion polypeptide was cleaved (Table 4). Transformed with pPIC9 / MB3 or pPIC9K / MB3 construct The resulting Pichia recombinant expresses only MB3 fused to the α-factor and has an approximately 45 kDa A fusion polypeptide was generated. For cleavage or processing of this fusion protein There was no evidence of it.   For isolation and purification of recombinant MB3 (transformant containing pHIL-D2 / MB3) Preliminary studies have shown that MB3, when expressed in Pichia pastoris, Under conditions, it forms a trimer, and the native protein undergoes tryptic digestion. It suggests that it is resistant to. These results were observed for wild-type counterparts. It is the same as the observed result.   Increased expression yield of MB3 is due to the strain of Pichia containing multiple copies of the MB3 expression cassette. It is obtained by using. Strains containing multiple copies contained <1 in the transformed cell population. It occurs naturally at a frequency of 0%. These strains are either SDS-PAGE or Imnobu A number of transformants were directly screened for MB3 expression levels by rotting. To select clones containing multiple copies of the MB3 gene Indirect screening by "dot blot" hybridization (Cleg et al., Bio / Technology 11: 905-910). (1993)). Alternatively, construction of such multi-introduced clones can be performed by cassette insertion. Multiple copies of the desired gene can be cloned by repeating the insertion process Using a novel pAO815 vector (Invitrogen) (Id., P. 907). The scale-up procedure using a fermenter is based on the yeast cell density. And therefore improve the yield of expressed protein by at least 5-10 fold. U. Optimization of protein expression (ie, growth medium composition, buffer capacity, casamino acid Replenishment, increase in methanol concentration, etc.) can be carried out by ordinary experimental procedures. .   Another method for identifying Pichia transformants with multiple copies of MB3 is from Pichia Kanamycin resistance gene to which the current vector pPIC9K confers resistance to G418 Exploits the fact that it has a gene; otherwise, pPIC9K is Corresponds to IC9. Next, the spontaneous occurrence of the multiple insertion event indicates the level of resistance to G418. Can be identified by Pichia transformants were selected on a histidine-deficient medium. Selected and screened for the level of resistance to G418. Against G418 Increased levels of resistance indicate multiple copies of the kanamycin resistance gene.   Therefore, the present invention relates to outer meningococcal group B porin proteins, especially The present invention relates to a method for expressing class 2 and class 3 porin proteins.   In one embodiment, the present invention provides (A) a selectable marker and (I) mature porin protein, and (Ii) T7 gene fused to amino acids 1 to 20 or 22 of φ10 capsid protein A fusion protein comprising the combined mature porin protein, Vector containing a gene encoding a protein selected from the group consisting of: To transform At that time, the gene is operably linked to the T7 promoter, (B) culturing the transformed E. coli in a medium containing a selection agent; (C) inducing expression of the protein, At that time, the protein thus produced is a total protein expressed in the E. coli. Accounts for more than 2% of protein Characterized in that the outer membrane of meningococcal group B porin protein is It relates to an expression method.   In a preferred embodiment, the expressed meningococcal group B porin protein or Or fusion proteins account for about 5% or more of the total protein expressed in E. coli. You. In another preferred embodiment, the expressed meningococcal group B porin tamper Protein or fusion protein accounts for about 10% or less of the total protein expressed in E. coli. Occupy the top. In yet another preferred embodiment, the expressed meningococcal group B Porin or fusion proteins are derived from the total protein expressed in E. coli. It accounts for about 30% or more of the quality.   Examples of plasmids containing a T7 inducible promoter include the expression plasmid pE T-17b, pET-11a, pET-24a-d (+) and pET-9a And these are all Novagen (Wisconsin 53711). (Madison, Science Drive, 565). these The plasmid contains, in order, the T7 promoter, optionally the lac operator, Binding site, restriction site to allow insertion of structural gene, and T7 termination sequence Contains columns. See Novagen Catalog, pp. 36-43 (1993).   In a preferred embodiment, E. coli strain BL21 (DE3) ΔompA is used. Up This plasmid can be transformed into this strain or the wild-type strain BL21 (DE3). Can be. E. coli strain BL21 (DE3) ΔompA is preferred. I mean, This strain causes unwanted immunogenic side effects when incorporated into purified porin protein This is because no OmpA protein may be produced.   The transformed E. coli is transformed into a selection agent, such as ampicillin, which is sensitive to E. coli. Grown in medium containing β-lactam. The pET expression vector is transformed Selectable markers that confer antibiotic resistance on isolated organisms.   High level expression of meningococcal group B porin protein is toxic in E. coli Can be. Surprisingly, the present invention provides that E. coli comprises at least Nearly 30% makes it possible to express proteins as high as> 50%.   In another aspect, the invention provides: (A) In a plasmid having a selectable marker,   (I) mature porin protein, and   (Ii) a fusion containing a mature porin protein fused to a yeast secretory signal peptide Synthetic protein, Ligating a gene encoding a protein selected from the group consisting of: At that time, the gene is operably linked to a yeast promoter, (B) transforming the plasmid containing the gene into a yeast strain; (C) by growing in a medium that allows the selection of the transformed yeast Selecting the transformed yeast, (D) growing the transformed yeast, (E) producing a yeast containing the protein by inducing expression of the protein; obtain, Characterization of outer membrane meningococcal group B porin protein in yeast Regarding the current method.   Transformation of a yeast host can be accomplished by any of several techniques familiar to those of skill in the art. It can be carried out. These techniques involve partially or completely destroying the cell wall. Direct or liposome-mediated transformation of yeast cells that have formed spheroplasts, Treatment of the host with the Lucali cation and PEG and combined with PEG treatment Freezing-thawing (Weber et al., Nonconventional Yeasts). : Their Genetics and Biotechnological Applications, CRC Crit. Rev. Biote chnol. 7: 281, 317 (1988) and references therein, all for reference. Cited herein).   In other preferred embodiments, the expressed mature porin protein or fusion tag Proteins make up about 2% or more of the total protein expressed in the yeast host. Further In another preferred embodiment, the expressed mature porin protein or fusion tag Proteins make up about 3-5% of the total protein expressed in the yeast host.   In another preferred embodiment, the mature porin protein is from serogroup B Neisseria meningitidis mature outer membrane class 3 protein.   In another preferred embodiment, the invention relates to an adventitia meningococcal group B porintan In the above method of expressing a protein or a fusion protein in yeast, the yeast may , Saccharomyces cerevisiae, Schizosaccharo myces pombe), Saccharomyces uvarum, Sacchar Saccharomyces carlsbergensis, Saccharo Mrs. diastacus (Saccharomyces diastaticus), Candida tropica Squirrel (Candida tropicalis), Candida maltosa (Candida maltosa), Can Candida parapsilosis, Pichia pastoris, Pichia -Farinosa (Pichia farinosa), Pichia pinus (Pichia pinus), Pichia ・ Pangia varijii, Pichia fermentance ans), Pichia guilliermondii, Pichia sci Pichia stipitis, Saccharomyces ellur is), Candida utilis, Candida gilielmonde (Candida guilliermondii), Hansenula henric (Hansenula henric) ii), Hansenula capsulata, Hansenula Polimo Hansenula polymorpha, Hansenula saturn us), Lipomyces kononenkoe (Lypomyces kononenkoae), Kluyveromyc (Kluyveromyc) es marxianus), Candida lipolytica, Saccharomi Copsis fibrigera (Saccaromycopsis fibuligera) Ludwigii (Saccharomycodes ludwigii), Saccharomyces kluiberg (Sa) ccharomyces kluyveri), Tremella mesenterica, Zygosaccharomyces acidofaciens , Zygosaccharomyces fermentati, ya Lowia lipolytica (Yarrowia lipolytica) and Chigosaccharomyces ・ Relating to performing a method selected from the group consisting of soya (Zygosaccharomyces soja) I do. Many of these yeast hosts are from the American Type Culture Collection Available from Rockville, MD.   In another preferred embodiment, the mature porin protein or fusion protein is The nucleotide sequence of the encoded gene should be a codon optimized for codon usage in yeast. Including don. In yet another preferred embodiment, the codon usage of yeast is optimized Of the gene encoding the mature mature porin protein or fusion protein The otide sequence is the nucleotide sequence SEQ ID NO: 26.   In another preferred embodiment, the yeast secretion signal peptide is Saccharomyces Secretion signal of P. cerevisiae α-mating factor prepropeptide and Pichia pa It is selected from the group consisting of secretion signals of the Striss acid phosphatase gene.   In another preferred embodiment, the yeast secretes the protein or fusion protein I do.   In another preferred embodiment, the yeast promoter to which the gene is operably linked -: AOX1 promoter, GAPDH promoter, PHO5 promoter Glyceraldehyde-3-phosphate dehydrogenase (TDH3) promoter , ADHI promoter, MFα1 promoter, and GAL10 promoter Selected from the group consisting of: Examples of plasmids containing the AOX1 promoter Are the expression plasmids pHIL-D2, pHIL-S1, pPIC9, and pP IC9K. These plasmids are, in order, the AOX1 promoter, Artifact Restriction site allowing insertion of the gene, AOX1 transcription termination fragment, HIS4 (Histidis Nordehydrogenase), an open reading frame encoding ampi Includes the sylin resistance gene, and the ColE1 origin of replication. Furthermore, the plasmid pP IC9 and pPIC9K are α-factor secreting signals of Saccharomyces cerevisiae. The plasmid pHIL-S1 contains the PHO1 secretory signal of Pichia pastoris. Including null. pPIC9K also contains the kanamycin resistance gene, which is Imparts resistance to G418. G418 in Pichia transformants Resistance levels can also be used to identify cells that have undergone multiple insertion events. You. This occurs at a frequency of 1-10%. The increased level of resistance to G418 This shows the presence of multiple copies of the kanamycin resistance gene and the gene of interest. Novagen See Catalog, Version E, pp. 19-22 (1995).   In another preferred embodiment, the mutation causing the particular auxotrophy is A yeast host strain having the car gene is used. Then the functional of the mutated gene Copy and copy of meningococcal group B porin protein or fusion protein The expression plasmid having the required nutrients is transformed into the yeast host strain. Transformants are selected based on their ability to grow on lacking media. Suitable marker inheritance As a child (with Saccharomyces cerevisiae notation), imidazole glycero Malate beta, a gene encoding phosphoryl dehydrogenase (HIS3) A gene encoding isopropyl dehydrogenase (LEU2); Argininosuccinate lyase, a gene encoding guanosine synthase (TRP5) A gene encoding (ARG4), N- (5′-phosphoribosyl) anthranyl Histidinol dehydrogena, a gene encoding acid isomerase (TRP1) Gene encoding orotidine-5-phosphate decarboxylase A gene encoding dihydroorotate dehydrogenase (U3) RA1), a gene encoding galactokinase (GAL1) And alpha-aminoadipate reductase (LYS2) Genes. Growth of transformed yeast host cells in media lacking appropriate nutrients After selection based on the ability to do so, the meningococcal group B poly at the correct locus Child Cells are screened for incorporation of the protein or fusion protein. This screening can be performed by methods well known to those skilled in the art, for example, AOX1 promoter lacking nutrients from adventitious meningococcal group B pollinator In a medium containing methanol to induce expression of the protein or fusion protein This is done by selecting transformants that grow slowly. Then these traits The transformants are grown in glycerol-containing medium and then added to methanol by addition of methanol. Induces the expression of Memobacterium group B porin protein or fusion protein .   In a further preferred embodiment, Pichia pastoris host strain GS115 or K M71 is used. These strains contain the histidinol dehydrogenase gene (his4 ) Cannot synthesize histidine. Expression plasmid pHIL-D2, pHIL-S1, pPIC9 and pPIC9K are HIS4 Transformation in a histidine-deficient medium supplemented with the host his4 to have the gene Enables body choice. Transformed Pichia pastoris host cells into histidine After selection on the deletion medium, the his^-,methanol⁺Grow slowly on plate Meningococcal group B at the correct locus by selecting for transformants Screen cells for incorporation of porin or fusion proteins To run. These transformants were transformed into A when the MB3 gene was inserted into the host genome. AOX2 gene that is mutated at the OX1 locus and is less efficient Can grow only slowly on methanol to metabolize methanol with gene products Absent. The transformants are then grown on a glycerol-containing medium, Adding meningococcal group B porin protein or fusion protein Induces expression of proteins.   In a most preferred embodiment, the present invention provides an adventitia meningococcal group B porintan. In the above method for expressing protein in yeast, the yeast is Pichia pastoris. Related to doing the method.   In another preferred embodiment, the invention relates to a pharmacologically acceptable diluent, carrier or carrier. Or excipients, together with the adventitia meningococcal group B Induces immune response in animals, including phosphoproteins or fusion proteins thereof Vaccine, wherein the vaccine is administered to an animal in Neisseria. It is administered in an amount effective to elicit an immune response to Meningitidis. Preferred In another embodiment, the animal is a group consisting of humans, cows, pigs, sheep, and chickens. Selected from. In another preferred embodiment, the animal is a human.   In another preferred embodiment, the present invention relates to the method of the present invention, wherein the outer meningococcal group B pollinator is used. Protein or its fusion protein binds to meningococcal group B capsular polysaccharide (CP) The combined vaccines above. Such capsular polysaccharides are available from Ashton, F.E. .) Et al., Microbial Pathog. 6: 455-458 (1989); Jennings et al., J. Immunol. 134: 2651 (1985); Jennings et al., J. Immunol. 137. : 1708-1713 (1986); Jennings et al., J. Immunol. 142: 35. 85-3591 (1989); Jennings et al., Current Topics in Microbiology.  and Immunology, 150: 105-107 (1990). Of "Capsular Polysaccharides as Vaccine Candidates" And the contents of these documents are fully incorporated herein by reference. Quoted in   The present invention also relates to any of several Neisseria meningitidis serogroups. It also relates to vaccines that can simultaneously elicit an immune response. Therefore, other preferred In a preferred embodiment, the present invention provides three different sera of Neisseria meningitidis. A trivalent vaccine comprising capsular polysaccharide from each of the groups. Above all, books The vaccine of the invention comprises a group A meningococcus, together with a pharmacologically acceptable carrier. A polysaccharide (GAMP) antigen, a meningococcal polysaccharide (GBMP) antigen of group B; Contains loop C meningococcal polysaccharide (GCMP) antigen.   In a preferred embodiment, a group A meningococcal polysaccharide (GAMP) antigen, a glue Group B meningococcal polysaccharide (GBMP) antigen and Group C meningococcal polysaccharide (GC MP) antigens are bound to protein carriers, respectively, to form GAMP, GCMP and GMP. Generate a BMP polysaccharide antigen conjugate.   Of course, those skilled in the art will recognize that many carrier proteins are included in the vaccines of the present invention. Understand that it would be suitable for use in polysaccharide-protein conjugates Will be done. Suitable carrier proteins are safe for administration to mammals. Would be immunologically effective as a carrier. Safety lacks major toxicity and And minimal risk of allergic complications.   Generally, any heterologous protein can be used as the carrier antigen. Such protein The quality is, for example, a natural or detoxified toxin (also called toxoid) May be. In addition, genetically modified antigens that are the same as toxins but are non-toxic The altered protein can be produced by mutagenesis methods well known to those skilled in the art. You. Such modified toxins are also called "cross-reactants" or CRMs. CRM₁₉₇ Is worth noting. This is because it is a natural diphtheria toxin and only one amino acid. The only difference is the amino acid residue, which is immunologically indistinguishable from the natural toxin (Anderson, P.W.), Infect. Immun. 39: 233-238 (19 83)).   The polysaccharide-protein carrier conjugate of a vaccine can be prepared in several different ways It will be understood by those skilled in the art that they can be manufactured. Binding polysaccharide to protein carrier The type of covalent bond to be effected, and the means for forming the bond, are well known to those skilled in the art. ing. Details of the chemical means by which two residues can be combined are described in US Pat. No. 5,371,19. 7 and 4,902,506 (the contents of which are incorporated herein by reference in their entirety. Quoted). One such method is Schwartz. ) And Gray (Rech. Bioch). im. Biophys. 181: 542-549 (1977)). This method uses reducing pods Membrane polysaccharide fragments can be combined with bacterial toxins or toxoids and cyanoborohydride ions or other And reacting in the presence of a reducing agent. Such methods include toxins or ibis Would not adversely affect the Soid or capsular polysaccharide (US Pat. No. 4,902,50) No. 6). Such a bonding process is also described in Examples 12-14 below. .   Tetanus and diphtheria toxins have been identified as carrier proteins due to their safety history. A major candidate but well known to those skilled in the art for using other proteins. There are overwhelming reasons. For example, other proteins are more effective as carriers Or the cost of manufacturing is also important. Other candidates include Pseudomonas (pseu domonas), staphylococcus, streptococcus (str) eptococcus), pertussis and toxinogenic bacteria (including Escherichia coli) Toxoids or toxoids. Group B Meningococcal polysaccharide binding Preferred carrier proteins are those of class B Neisseria meningitidis 3 Porin protein (PorB). GAMP antigen and GCMP antigen A preferred carrier protein for binding is tetanus toxoid.   Limited immunogenicity of GBMP in humans, especially human infants Direct covalent attachment of Group B polysaccharides to tetanus toxoids was achieved using rabbit (Genin) Gus and Lugowski, J. Immunol. 127: 1011-1018 (1981). ) Or mouse (Jennings et al., J. Immunol. 137: 1708-1713 (1) 986)) can cause a significant polysaccharide-specific response. It is known in the art to produce unconjugated conjugates. this The failure prompted interest in direct chemical modification of the Group B polysaccharide. This means that Immunoreactivity in a manner that allows for high levels of production of differentially reactive B polysaccharide-specific antibodies The idea was to form a synthetic epitope that could regulate Ngus et al., J. Immunol. 137: 1708-1713 (1986)).   Possible chemical modification of group B polysaccharides (Jennings et al., J. Immunol. 137: 1 708-1713 (1986)). It will be understood by those skilled in the art that First, chemical modification is easy and It must be able to do so with minimal degradation of the polysaccharide. Second, cross anti Reacting the modified polysaccharide with the B-polysaccharide-specific antibody to produce a responsive B-polysaccharide-specific antibody. Antigenicity must be preserved. Ideal chemical modification of group B polysaccharide Would carry both a carboxylic acid group and an N-carbonyl group. It will be understood by those skilled in the art (Jennings et al., J. Immunol. 137: 1708- 1713 (1986)). The most preferred modification that satisfies the above criteria is the polysaccharide B The N-acetyl group of the amic acid residue was removed with a strong base and replaced with an N-propionyl group. (See Examples 6 and 14).   In a more preferred embodiment, N-propionylated GBMP is subsequently added to the carrier tan Bind to protein. Any increase in the immunogenicity of N-propionylated GBMP Carrier proteins can also be used, but preferred protein carriers are B Neisseria meningitidis class 3 outer membrane protein (MB3 or Po rB).   Therefore, in yet another preferred embodiment, N-propionylation followed by G BMP antigen is bound to PorB.   Preferably, the capsular polysaccharide (CP) is Bacterial V from Flash (Frasch, C.E.). accines, Alan R. Liss, Inc., 123-145 (1990). ・ Production and Control of Neissitis seria meningitidis Vaccines ", the contents of which are fully incorporated herein by reference. And is isolated as follows:   Grow organisms for 10-20 hours in denatured Franz medium                   ↓ Kill by heating at 55 ℃ for 10 minutes   Remove inactivated cells by centrifugation                   ↓ Add cetabilon to 0.1%   Precipitate CP from medium broth                   ↓ Add calcium chloride to 1M   Lyse CP, then centrifuge to remove cell debris                   ↓ Add ethyl alcohol up to 25%   Remove precipitated nucleic acids by centrifugation                   ↓ Add ethyl alcohol up to 80%   Precipitate the crude CP and remove the alcohol.   The crude CP is then diluted with dilute acids such as acetic acid, formic acid, and trifluoroacetic acid. (0.01 to 0.5N) and then subjected to gel filtration chromatography. Further purification to obtain a mixture of polysaccharides having an average molecular weight of 10,000 to 20,000 You. If CP is GBMP, then refine GBMP with sodium borohydride. N-deacetylation with NaOH and N-propionylation in the presence of Obtain r GBMP. Therefore, it can be used in the conjugate vaccine of the invention. Can be used as part of a CP-porin protein conjugate. In this case, CP fragments, N-deacylated CP and And fragments thereof, and N-Pr CP and fragments thereof (Example 6 and And 14).   In a further preferred embodiment, the present invention relates to the above-mentioned outer meningococcal group B Protein or its fusion protein from Neisseria meningitidis A polysaccharide conjugate comprising obtaining a CP and then binding the protein to the CP The present invention relates to a method for manufacturing a gate.   The conjugates of the present invention allow the reductive end group of the CP to be oxidized by reductive amination. And by reacting it with the primary amino group of phosphorus. reduction Sex groups are formed by selective hydrolysis or specific oxidative cleavage, or both Can be done. The binding of CP to the porin protein was determined by Jennings et al. U.S. Patent No. 4,356,170, the contents of which are fully incorporated herein by reference. The method is preferably performed by the method described in (1). This method uses CP Controlled oxidation with citrate followed by reductive amination of the porin protein Including.   The vaccine of the present invention comprises a meningococcal group B porin protein, a fusion protein Quality or conjugate vaccine, or trivalent GAMP, GBMP and GCM The P vaccine is included in an effective amount depending on the route of administration. Subcutaneous or intramuscular administration Is preferred, a meningococcal group B porin protein of the present invention, a fusion protein The quality or vaccine can also be administered by the intraperitoneal or intravenous route. Business Can be administered to a particular treatment protocol without undue experimentation. We will appreciate that the amount can be easily determined. The appropriate amount is per kg of body weight Expected to be in the range of 2 μg of the protein to 100 μg per kg of body weight Will be.   Therefore, in a preferred embodiment, the vaccine of the invention comprises about 2 μg of GAMP , GCMP and GBMP polysaccharide antigen conjugates.   In another preferred embodiment, the vaccine of the invention comprises about 5 μg of GAMP, GC Includes MP and GBMP polysaccharide antigen conjugates.   In yet another preferred embodiment, the vaccine of the invention comprises about 2 μg of GAMP And GCMP polysaccharide antigen conjugate, and about 5 μg of GBMP polysaccharide antigen conjugate. Including conjugates.   The vaccine of the present invention may be used as a capsule, solution, suspending agent, or air capsule for oral administration. Lyxil or sterile liquid form such as liquid or suspending agent Can be used. Any inert carrier such as saline or phosphate buffered saline And meningococcal group B porin protein, fusion protein Any carrier for which the protein or conjugate vaccine has the appropriate dissolution properties It is preferably used. Vaccines may be in single dose form or in large doses A vial (multi-dose) flask that can be used for the program it can. For preparation and use of the vaccine, see Remington's Pharmamaceu. tical Sciences, Mac Publishing, Easton, Pennsylvania, Oso (Osol) (1980); and New Trends and Developments in Vaccines , Voller et al. (Eds.), University Park Press, Baltimore And Maryland (1978).   The vaccine of the present invention provides an adjuvant that promotes the production of a porin-specific antibody. It may further include. One such adjuvant is Freund's complete adjuvant. Adjuvant (CFA), stearyl tyrosine (ST, US Pat. No. 4,258,02) No. 9), dipeptide known as MDP, saponin, aluminum hydroxide And various oily preparations such as lymphocyte cytokines. It is not limited.   Freund's adjuvant mixes mineral oil and water emulsions with immunogenic substances Things. Freund's adjuvant is powerful but usually administered to humans do not do. Instead, use the adjuvant alum (aluminum hydroxide) or ST Used for human administration. Meningococcal group B porin protein or its The conjugate vaccine is adsorbed on aluminum hydroxide, from which Tsu It is released. A meningococcal group B porin protein or group A, B and C meningococcal polysaccharide conjugate vaccines are also available from Fullerto. n) encapsulation in liposomes according to US Pat. No. 4,235,877. Wear.   In another preferred embodiment, the present invention relates to the invention Administration of the vaccine to animals in an amount sufficient to elicit an immune response A method of eliciting an immune response in an animal.   In another embodiment, the present invention provides a method for lysing transformed E. coli and B-porin protein or fusion protein as part of an insoluble inclusion body Release and wash the inclusion bodies with buffer to remove contaminating E. coli cellular proteins. And the inclusion bodies are resuspended and dissolved in an aqueous solution of denaturant, and the resulting solution is Meningococcal group B porin protein diluted in active agent and then solubilized Is purified by gel filtration, wherein the outer meningococcal group B The present invention relates to a method for purifying a phosphoprotein or a fusion protein.   The lysis step can be performed by any method known to those skilled in the art, Sonication, enzymatic digestion, osmotic shock, or mull press Can be performed.   Washing of inclusion bodies is performed by leaching inclusion bodies containing meningococcal group B porin protein. Buffer that can solubilize E. coli cellular proteins without Any can be used. As such a buffer, TEN buffer (50 mM Tris HCl, 1 mM EDTA, 100 mM NaCl, pH 8.0) , Bicine and HEPES, but are not limited thereto.   Modifiers that can be used in the practice of the present invention include 2-8M urea or about 2-6M urea. Guanidine HCl, more preferably 4-8 M urea or about 4-6 M guar. Nidin HCl, and most preferably about 8 M urea or about 6 M guanidine H Cl.   Used to dilute solubilized meningococcal group B porin protein Examples of surfactants that can be used include SDS and cetablon (Calbiochem). Ionic surfactants (Calbiochem); Tween, Triton X, yellowtail Non-ionic surfactants such as di-35 and octyl glucoside; Zwittergent, empigen BB and shampoos (Champs) and other zwitterionic surfactants. is not.   Finally, gel filtration of the solubilized outer meningococcal group B porin protein was performed. To separate high and low molecular weight substances. Filtration gel Thailand Sephacryl-300, Sepharose CL-6B, and Bio- Gel (Bio-Gel) A-1.5m, but is not limited thereto. There is no. The column is eluted using the buffer used to dilute the solubilized proteins . Then, the fraction containing porin or its fusion protein was subjected to gel electrophoresis. Identified by motion, fractions are pooled, dialyzed and concentrated.   Finally, the concentrated fraction is passed through a Q Sepharose high speed column. Obtaining substantially pure (> 95%) porin and fusion proteins Can be.   In another aspect, the invention provides a vector comprising a T7 promoter that is inducible. The expression of a meningococcal group B porin protein gene which is part of Step If the promoter is inducible, the rate of transcription increases in response to the inducing agent. T 7 promoter is isopropyl β-D-thiogalactopyranoside (IPT It can be triggered by adding G). Instead, the Tac promoter Or a heat shock promoter. Meningococcal group B The expression of the phosphoprotein gene was determined using a pET-17 expression vector or pET-1. It is preferred to carry out from a 1a expression vector (both vectors containing the T7 promoter). New   Meningococcal group B porin protein gene or fusion protein gene Cloning into expression vectors can be blunt-ended or used for ligation. Adhesive ends, generation of appropriate ends by restriction enzyme digestion, appropriate filling of sticky ends Alkaline phosphatase treatment to avoid unwanted binding, and It can be carried out according to a conventional method including ligation using the appropriate ligase. Black For general methods of cleaning, see Molecular Brook et al., Sambrook et al. Roning: A Laboratory Manual (Molecular Cloning: A Laborator) y Manual), 2nd edition, Cold Spring Harbor, New York, Colds See Pulling Harbor Laboratory Press (1989).   Meningococcal group B porin protein and fusion expressed according to the invention Proteins are suitable for achieving structures that exhibit the immunological properties of native proteins. Need to be regenerated. In yet another aspect, the invention relates to a transformed cell To dissolve the meningococcal group B porin protein or fusion protein. Large intestine that is released as part of a soluble inclusion body, and the inclusion body is washed with a buffer and contaminated. The bacterial cellular proteins are removed and the inclusion bodies are resuspended and dissolved in an aqueous denaturant solution. And dilute the resulting solution in detergent, then solubilized meningococcal glue. Purify and elute purified B-porin protein or fusion protein by gel filtration The outer membrane protein and the fusion, wherein a regenerated protein is obtained in a liquid. The present invention relates to a method for regenerating a protein. Surprisingly, folded trimer meningitis Bacterial group B class 2 and class 3 porin proteins and fusion proteins Was obtained directly in the eluate from the gel filtration column.   In another preferred embodiment, the present invention relates to a method for producing substantially the same comprising: Pure regenerated outer meningococcal group B porin protein and fusion protein Quality. Substantially pure protein is recognized, for example, by electrophoresis. Generally free of other cellular components of Neisseria meningitidis It is a protein. Such a substantially pure protein is coomassie blue stained > 9, as determined by densitometry on the electrophoresis gel after color or silver staining It has a purity of 5%.   The following examples, which illustrate the methods and compositions of the present invention, Is not limited. A variety of commonly recognized in the art that would be obvious to one skilled in the art. Other suitable modifications and adaptations of the conditions and parameters are within the scope of the invention.                                  ExampleEmbodiment 1 FIG. Group B Class 3 Paulintan from Neisseria meningitidis Cloning of protein Materials and methods Creature: Group B Neisseria meningitidis strain 8765 (B15: P1,3 Dr. Wendell Zollinger (Walter Reed) ・ Walter Reed Army Institut te for Research)) and candles in an incubator kept at 30 ° C. In quenching jars, the agar medium previously described (Swanson, J.L.), Infe ct. Immunol. 21: 292-302 (1978)). E. coli strain DM E558 (from the collection of S. Benson; Silhavy , T.J.) et al., “Experiments with Gene Fusions”, co. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1984), BRE51 (Bremer, E.) et al., FEMS Microb. iol. Lett. 33: 173-178 (1986)) and BL21 (DE3) Grow on LB agar plates at 7 ° C.   P1 transduction: P1 of E. coli strain DME558_virUsing the lysis solution, all ompA remains The gene has been deleted (Silhevy et al., Experiments using gene fusion, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1984 )) Strain BRE51 (Bremer et al., FEMS Microbiol. Lett. 33: 173-17). 8 (1986)) was transduced with a tetracycline resistance marker. ompA remains Strain DME558 containing a tetracycline resistance marker in close proximity to the gene Was grown on LB medium to a density at which the absorbance at 600 nm was about 0.6. Was. 1/10 of 0.5 MCaCl_TwoWith 10 ml medium and 1 × 10⁹P FU P1_virWas added to 0.1 ml of a solution containing This culture is incubated at 37 ° C for 3 hours. Incubated. After this time, the bacterial cell density has decreased appreciably . 0.5 ml of chloroform was added and the phage culture was stored at 4 ° C. General 1 to 2% of E. coli chromosome can be packaged in each phage Therefore, the number of phage produced was determined to be tetracycline resistant close to the ompA gene. Covers the entire chromosome of the bacterial host, including the sex marker.   Next, strain BRE51 lacking the ompA gene was placed in LB medium at 37 ° C. And grown overnight. This overnight culture was diluted 1:50 in fresh LB and left for 2 hours. Propagated. The cells were removed by centrifugation and resuspended in MC salts. 0.1ml Was mixed with the above phage lysis solution 0.05 and incubated at room temperature for 20 minutes. I was vate. Thereafter, an equal volume of 1 M sodium citrate was added to the bacterial cells for 12 Placed on LB plates containing 0.5 μg / ml tetracycline. play The plates were incubated overnight at 37 ° C. Tetracycline resistance (12 μg / m l) Transductants were subjected to SDS-PAGE and Western blot as described below. Screened for loss of OmpA protein expression by lot analysis. This Bacteria resistant to other antibiotics are very close to the site where the ompA gene was deleted Then, a tetracycline resistance gene is integrated into the chromosome. One specific Share BRE-T^RIt was called.   Then, using the same method as above, the strain BRE-T was used.^RSecond phage production Was done. Typical of this phage population are the tetracycline resistance gene and Omp It has both A deletions. These phages were then recovered and stored. Then Escherichia coli BL21 (DE3) was infected using these phages. After infection, The bacterium contains a tetracycline resistance marker. In addition, it contains tetracycline There is a high probability that OmpA deletion will be selected on LB plates.   Bacterial colonies grown on the plate were separately grown in LB medium and Tested for the presence of pA protein. Of the selected colonies examined, SDS- As determined by antibody activity on PAGE western blots, all O The mpA protein was deleted.   SDS-PAGE and Western blot: SDS-PAGE was previously described As listed (Blake and Gotschlich ), J. Exp. Med. 159: 452-462 (1984)), the Laemmli method (Laemmli (La emmli, U.K.), Nature 227: 680-685 (1970)) It is. Immobilon P (Millipore, Bedford, Mass.) Electrophoresis transfer to Scots), except that paper was first moistened in methanol Acad. Sci. USA 76: 435 (Towbin, H.). 0-4354 (1979)). Western blot to phosphata Probe binding reagent (Break et al., Analyt. Biochem. 136: 175-175). 179 (1984)).   Replication chain reaction: Method described by Fever's et al. (Fever's et al., In fect.Immun.60: 3620-3629 (1992)) and PorB The amplified gene was amplified. The primers selected were as previously described (Fevers et al., Infect. Immunon. 60: 3620-3629 (1992)) , Primer 33 Met. Briefly, the reaction components were as follows: meningococcal strain 87 65 chromosomal DNA (100 ng / μl), 1 μl; 5 ′ and 3 ′ primers (1 μM) 2 μl each; dNTP (10 mM stock), 4 μl each; 10 × PCR reaction Buffer (100 mM Tris HCl, 500 mM KCl, pH 8.3), 10 μl 25 mM MgCl_Two, 6 μl; double distilled H_TwoO, 62 μl; and Taq poly Merase (Cetus Corporation, 5 units / μl), 1 μl. The reaction is 0 Lauda 4 / K methanol / water cooling system (Blink Brinkman Instruments, Inc., Westbury, NY GTC-2 Genetic Thermocycler (Geneti) c Thermocycler) (Precision Instruments (Precision Inst. Irlc., Chicago) and Illinois). Thermocycler, 94 ° C, 2 minutes; 4 Programmed to cycle 30 times at 0 ° C, 2 minutes; and 72 ° C, 3 minutes Was. At the end of these 30 cycles, the reaction was continued for 3 minutes at 72 ° C. So as noted (mania Chis et al., Molecular Cloning, A Laboratory Manual, Call De Spring Harbor Laboratory, Cold Spring Harbor, New York (1982) ready for analysis on a 1% agarose gel in TAE buffer. Finally, the temperature was kept at 4 ° C. until the end.   Subcloning of PCR products: Plasmid pET-17b (Novagen) Used for subcloning, the restriction endonucleases BamHI and XhoI ( New England Biolabs, Inc., Beverly , Mass.) By double digestion of the plasmid. One The digested ends were digested with bovine intestinal alkaline phosphatase (Boehringer Manha Im, Indianapolis, Indianapolis). Incidentally The digested plasmid was analyzed on a 1% agarose gel, and the Remove and remove Gene Clean kit (Bio101, La Jolla, Cali) (Fornia). Preparation of the PCR product is performed using phenol-chlorophore. Extraction with chloroform and chloroform, and finally Gene Clean Kit (Bio101) The purification was carried out using Restriction endonuclease Bgl to PCR product Digested with II and XhoI (New England Biolabs). Incidentally The DNA was extracted with phenol-chloroform and 0.1 volume of 3M sodium acetate was extracted. 5 μl glycogen (20 μg / μl) and 2.5 volumes of ethanol And precipitated. This DNA was washed with 70% ethanol (vol / vol). Later, it was redissolved in TE buffer. The digested PCR product was subjected to the standard T4 ligase method ( Current Protocol in Molecular Biology) John Wiley & Sons, New York (1993)) at 16 ° C. overnight with the double digested pET-17. b ligated to plasmid. The ligation product is then transferred to Shang et al. (Chung, C.T., et al., Proc. Natl. Acad. Sci. USA 86: 217). BL21 (DE3) made competent according to 2-2175 (1989)) Transformed into -ΔompA. Transformants were selected using 50 μg / ml Carbeni. Performed on LB plates containing sylin and 12 μg / ml tetracycline Was. Several transformants were selected and carbenicillin and tetra After culturing at 30 ° C. for 6 hours in LB broth containing both cyclins, IPTG Was added to induce plasmid gene expression. Raise the temperature to 37 ° C and continue the culture. For two hours. Collect cells from each culture by centrifugation to prepare a whole cell lysate To react with SDS-PAGE and all Neisseria Porins Analyzed by Western blot using null antibody (4D11).   Nucleotide sequence analysis: DNA of cloned class 3 porin gene DNA Determination of the nucleotide sequence was performed as described (Current Protocol in Molecular Biolog y, John Wiley & Sons, New York (1993)), denatured double-stranded plastic It was performed by the dideoxy method using the plasmid DNA as a template. Sequenase ( Sequenase II Kit (United States Biochemical (United Stat) es Biochemical Corp.), Cleveland, Ohio) according to manufacturer's instructions I used it. Three synthetic oligonucleotide primers (Operon Technolo These (Operon Technologies, Inc., Alameda, CA) Used for reaction. One is for the 5 'end and 5' TCAAGCTTGGGTAC Consists of CGAGCTC, two for the 3 'end and 5' TTTGTTAG CAGCCGGATCTG and 5'CTCAAGACCCGTTTAGAGGG CC. The plasmid DNA was digested with the restriction endonuclease Bpu11021. Create overlapping nested deletions by linearizing with thio-dNTP and And Klenow polymerase were added to blunt the ends (Current Prot ocol in Molecular Biology, John Wiley & Sons, New York (19 93)). The linearized plasmid was then digested with the restriction endonuclease XhoI. Cleavage to create a 3 'deletion of the plasmid as taught by the supplier. ExoII / Phoenix nuclease deletion kit was used (Stratagene, La Jora, California). A map of this strategy is shown in FIG.   Expression and purification of PorB gene product: Using the tip of a sterile micropipette, BL21 (DE3) -ΔompA containing the PorB-pET-17b plasmid A single colony was selected and 10 ml containing 50 μg / ml carbenicillin was selected. Inoculated into LB broth. Incubate the culture at 30 ° C overnight with shaking. I did it. Then, 10 ml of the overnight culture contains the same concentration of carbenicillin. Add sterile to 1 liter of LB broth and add OD₆₀₀Until it reaches 0.6-1.0 Culture was continued at 37 ° C. in a shaking incubator. IP A stock solution (3 ml) of TG (100 mM) was added and the culture was allowed to stand for another 30 minutes. Incubated. Then add rifampicin (5.88 ml of stock) Solution; 34 mg / ml in methanol) and the culture was continued for another 2 hours. GS3B The cells are centrifuged at 10,000 rpm for 10 minutes in a It was collected and weighed. These cells were washed with 3 ml of TEN buffer per 1 g of wet weight of the cells. Implant (50 mM Tris HCl, 1 mM Tris HCl, 1 mM EDTA, 100 mM Resuspended well in mM NaCl, pH 8.0. Add 1g wet weight of the cells 8 μl of PMSF stock solution (50 mM in absolute ethanol) and 80 μl μl of lysozyme stock solution (10 mg / ml in water) was added. This mixture Was stirred at room temperature for 20 minutes. While stirring, 4 mg / g of wet weight Deoxycholate was added. This mixture is placed in a 37 ° C. water bath and Stirred. When the mixture becomes viscous, 20 μl of DNA / g of wet cell weight Aase I stock solution (1 mg / ml) was added. Then remove this mixture from the water bath Removed and left at room temperature until the solution was no longer viscous. Then this mixture Is centrifuged at 15,000 rpm for 20 minutes at 4 ° C. in an SS-34 rotor. To The pellet was secured and thoroughly washed twice with TEN buffer. By the way, Of the freshly prepared TE containing 0.1 mM PMSF and 8 M urea Resuspend in N buffer and add bath sonicator (Heat Systems (Heat Systems)  Systems, Inc.), Plainview, NY). B Protein using CA kit (Pierce, Rockville, IL) The concentration was measured, and the protein concentration was adjusted to 10 mg / ml using TEN-urea buffer. Fully adjusted. Then, the sample was treated with 10% (w / v) Zwittergent 3,14 ( (Calbiochem, La Jolla, CA) diluted 1: 1 and sonicated And loaded onto a Sephacryl S-300 molecular sieve column. Sephacryl S-3 The 00 column (2.5 cm × 200 cm) is a 100 mM Tris HCl, 20 0 mM NaCl, 10 mM EDTA, 0.05% Zwittergent 3,14, And previously equilibrated with 0.02% azide, pH 8.0. Column flow rate Adjusted to 8 ml / hour and collected 10 ml fractions. OD of each fraction₂₈₀ Was measured, and SDS-PAGE analysis was performed on the protein-containing fraction. Was.   Inhibition ELISA assay: 0.1 ml / well of wild type strain 8765 PorB (2 μg / ml) (0.1 M carbonate buffer containing 0.02% azide) Solution, in pH 9.6) to obtain microtiter plates (Nunc- Nunc-Immuno Plate, Inc., Naperville, Illinois Sensitized. Plates were incubated overnight at room temperature. Plate 0.9 % NaCl, 0.05% Bridge 35, 10 mM sodium acetate pH 7.0, 0.0 Washed 5 times with 2% azide. Produced for type 15 class 3 PorB protein Live Immune Serum was transferred to Phillip O. Livingstone ngston) Dr. Memorial Sloan Kettering Cancer Center ( Memorial-Sloan Kettering Cancer Center), New York, NY ). This human immune serum was placed in PBS containing 0.5% Bridge 35. Diluted, added to plate, and incubated at room temperature for 2 hours. Plate above After washing again in the same manner as described above, secondary antibody, alkaline phosphatase-conjugated goat anti-human gG (Tago Inc., Burlingame, CA) with PBS-B. Diluted in lysate, added to plate and incubated for 1 hour at room temperature. play And washed with 0.1 diethanolamine, 1 mM MgCl_Two, 0.1 mM ZnCl_TwoP-Nitrophenylphos in 0.02% azide, pH 9.8 Phosphate (Sigma phosphatase substrate 104) (1 mg / ml) was added. Step The rate was incubated at 37 ° C. for 1 hour, and Elida-5 microliters were added. Interplate Reader (Physica, New York, New York) (State) was used to measure the absorbance at 405 nm. Control wells contain primary antibody and And / or deleted any of the secondary antibodies. This is because the ELISA Obtain a titer for each human serum that gives half the maximum reading in Say Went for. This titer against each human serum is used in the suppression ELISA . ELISA microtiter plate with purified wild-type PorB protein Sensitized and washed as above. Another V-96 polypropylene micro tie Various amounts of purified wild-type PorB protein in Alternatively, any of the purified recombinant PorB proteins was added in a total volume of 75 μl . Human serum was diluted in PBS-Bridge solution to twice its half-maximal titer, 5 μl of each well containing PorB protein or recombinant PorB protein Elle added. Incubate the plate at room temperature for 2 hours, Sorvall RT6000 refrigerated centrifuge tube with tar plate carrier ( 10 at 3000 rpm in Wilmington, Delaware Centrifuged for minutes. To avoid V-bottom, from each well Take 100 μl and transfer to a sensitized and washed ELISA microtiter plate. did. Incubate the ELISA plate for an additional 2 hours, wash and bind secondary Antibodies were added as described above. The plate is then processed as described, I read. The% inhibition was then processed and read as described. % Suppression Calculate as follows:                                   result   Replication chain reaction and subcloning: Easy cloning and genetic manipulation Any number of differences, ultimately for further antigenicity and biophysical characterization Pure Porin Protein from Neisseria Porin Gene Method developed. The first step for this purpose is to use the porin gene from Neisseria Was to be cloned. Techniques first described by Fever's et al. Using the technique (Fevers et al., Infect. Immun. 60: 3620-3629 (1992). )), DNA sequence of mature porin protein from class 3, serotype 15 porin The sequence was amplified using the chromosome of N. meningitidis strain 8765 as a template for the PCR reaction. Was. Appropriate endonuclease restriction site at the end of the oligonucleotide primer When the site is synthesized and cleaved, the amplified mature porin sequence And ligated directly into the clone. After 30 cycles The PCR product shown in FIG. 2 was obtained. The main products are 900bp and 1000bp Which was consistent with previous findings (Feverz et al., In fect. Immun. 60: 3620-3629 (1992)). However, PCR Performed at low annealing stringency (40 ° C .; 50 mM KCl) No high molecular weight products were found.   In order to produce large amounts of the cloned porin protein, Studier et al. A tightly regulated expression system (Studier and Moffat, J. Mol. Biol. 18). 9: 113-130 (1986)), which is commercially available from Novagen. Is what it is. The amplified PCR product was isolated from the plasmid pET-17b using Ba It was cloned into the mHI-XhoI site. This strategy allows mature pollinators The DNA sequence of the protein consists of a T7 promoter, a 9 amino acid leader sequence and Immediately after the DNA sequence encoding 11 amino acids of the mature φ10 protein, Placed in the frame. Generation of pET-17b Plasmid Containing Porin Gene As a current host, Studier's Escherichia coli strain B, which is lysogenic for DE3 lambda L21 (Studier and Moffat, J. Mol. Biol. 189: 113-130. (1986)). However, OmpA derived from an E. coli expression host Protein may be purified along with expressed meningococcal porin protein Because of this, this strain was modified by P1 transduction and The mpA gene was removed. Therefore, the PCR product and the pET-17b vector After restriction endonuclease digestion and ligation of both 21 (DE3) -ΔompA and transformants were transformed with ampicillin and Selected for tetracycline resistance. FIG. 11A shows the restriction map of pET-17b. And the nucleotide sequence between the BglII and XhoI sites of pET-17b. The columns are shown in FIG. 11B. Of the large number of colonies observed on the selection plate, 10 Selected for further characterization. All 10 of these are in the log phase When grown in IPTG and induced by IPTG, almost the molecular weight of PorB protein Expressed large amounts of migrating proteins. One whole cell lysate of such culture As shown in FIG. For Western blot analysis using 4D11 monoclonal antibody Further suggest that the expressed protein is a PorB protein (FIG. 3b). In contrast to other studies, Neisseria porin was cloned into E. coli. When the host bacterial cells were engineered and expressed, the host bacterial cells They showed no signs of toxicity or lethal effects. E. coli cells should be viable Apparently, it was possible to re-culture at any time throughout the expression phase.   Nucleotide sequence analysis: The amount of PorB expressed in these experiments has been Significantly greater than that observed in E. coli and is harmful to expression on this host E. coli Did not appear to have any effect. In order to enable such high expression, PCR artificial To ensure that the product was not introduced into the meningococcal porin gene, The entire φ10 porin fusion was sequenced by double-stranded primer extension from the lathmid. Was. FIG. 4 shows the results. The nucleotide sequence is provided by Heckels et al. Thus, another previously reported meningococcal serotype 15PorB gene sequence (Ward (Ward, M.J.) et al., FEMS Microbiol. Lett. 73: 283-289 (1992). )) But with two exceptions as shown. These two nucleochi The difference occurs at the third position of the codon, and the amino acid sequence of the expressed protein Will not change. Therefore, from the nucleotide sequence, No PCR artifacts or mutations appear to explain the lack of protein expression and toxicity Was. In addition, this data suggests that true PorB protein was produced Would be.   Purification of expressed porB gene product: PorB tamper expressed in E. coli The protein is insoluble in TEN buffer, indicating that PorB protein is expressed. Was suggested to be formed in the inclusion bodies. However, insoluble P E. coli tamper contaminated by washing the orB protein with TEN buffer Most of the material was removed. Then, PorB protein was newly prepared 8 Solubilized in M urea and diluted in Zwittergent 3,14 surfactant. Most Final purification was carried out using a Sephacryl S-300 molecular sieve column, which The remaining contaminating proteins as well as the element were removed. Po eluted from the column Most of the rB protein is an apparent trimer molecule just like wild-type PorB Had the amount. Comparison of wild-type PorB and PorB expressed in E. coli The elution pattern is shown in FIG. 8 before dilution in Zwittergent surfactant If the concentration of PorB protein in M urea exceeds 10 mg / ml, The relative amount of PorB protein found in the body is reduced and dissolved in the void volume. It is important to note that they appear as emerging aggregates. However, If the protein concentration in the urea buffer is less than 10 mg / ml, the PorB Most eluted in exactly the same fraction as the wild-type PorB eluted . Also, using T7-Tag monoclonal antibody and Western blot analysis That 11 amino acids of the mature T7 capsid protein are retained as amino termini. It was also decided. Total yield of meningococcal porin protein from 1 liter of E. coli The amount was about 50 mg.   Inhibition ELISA assay: Purified trimer recombinant PorB is wild-type meningitis Similar antigenic conformation as compared to PorB produced by strain 8765 To determine whether or not they have a wild-type meningococcal type 15 PorB tamper. Serum from six patients vaccinated with the protein was used in the suppression ELISA assay. Suppression In the assay, antibodies reactive with native PorB can be produced in varying amounts of purified recombinant P was competitively suppressed by either orB or homologous purified wild-type PorB . The results of suppression of each of these six human sera by homologous purified PorB and The mean inhibition of these sera is shown in FIG. Purification of these sera by recombinant PorB The correspondence suppression is shown in FIG. 6B. A comparison of the average suppression from FIGS. 6 and 7 is shown in FIG. It is plotted. These data show that the antibodies contained in the sera of these six patients In both homologous purified wild type PorB and purified recombinant PorB Suggests that you are aware of the tope. From this, recombinant PorB is Not all, but not all, of the natural conformations found in gender PorB Further evidence was obtained that most of them were retained.Embodiment 2. FIG. Group B, a strain from Neisseria meningitidis strain BNCVM986 Cloning of Ras 2 Porin   Using methods previously described (Sunbrook et al., Molecular Cloning). : A Laboratory Manual, 2nd edition, Cold Spring Harbor, New York -York, Cold Spring Harbor Laboratory Press (1989)), approx. 0.5 g of group B Neisseria meningitidis strain BNCV M986 (serotype Genomic DNA was isolated from 2a). This DNA is then used in a standard PCR reaction. As a template for two class 2 porin-specific oligonucleotides Was. These oligonucleotides are class 2 porin 5 ′ and 3 ′ Franks. EcoRI restriction to complement the cloning region and to facilitate cloning of the fragment. It was designed to have an order. The sequences of these oligonucleotides are as follows: Was: and Subsequently, class 2 porin was obtained using the replication chain reaction. Reaction conditions are as follows 200 ng of BNCV M986 genomic DNA, the two oligonucleotides 1 μM each of the reotide primers and 200 μM each dNTP, Buffer (10 mM Tris HCl, 50 mM KCl, pH 8.3), 1.5 mM Mg Cl_Two, And 2.5 units of Taq polymerase, distilled over H_2OTo 100 μl Adjustment. The reaction mixture was then allowed to stand at 95 ° C. for 1 minute, 50 ° C. for 2 minutes and 72 minutes. Subjected to 25 cycles of 1.5 minutes at 150C. At the end of this cycle period, the reaction mixture The product was loaded on a 1% agarose gel, electrophoresed for 2 hours, and then treated with a 1.3 kb band. The DNA was removed, and the DNA was recovered using a GeneClean kit (Bio101). . The DNA was then digested with EcoRI, repurified,_FourDNA ligase And ligated to EcoRI digested pUC19. This ligation mixture Was used to transform competent Escherichia coli DH5α. Select recombinant plasmid And sequenced. The inserted sequence is a DNA sequence consistent with that of class 2 porin. Was found to have columns. Murakami et al., Infect. Immun. 57: 2318- 2323 (1989).   Expression of class 2 porin using plasmid pET-17b (Novagen) I let you. As described below, two plasmids were constructed and two different And produced a solid. One plasmid was designed to produce mature class 2 porin. The other plasmid contained 20 amino acids from the T7 gene φ10 capsid protein. It was designed to produce a class 2 porin fused to nonoic acid.Construction of mature class 2 porin   Oligonucleotides: and Amplify the pUC19-class 2 porin construct using Sporin was constructed. This strategy allows the Nde of plasmid pET-17b to be The amplified class 2 porin can be cloned into the I and XhoI sites. Thus, mature class 2 porin could be produced. PU as a template Standard PCR was performed using C19-Class 2 and the two oligonucleotides described above. Was. This PCR reaction resulted in 1.1 when analyzed on a 1.0% agarose gel. kb product was obtained. The DNA obtained by this PCR reaction was gel-purified and restricted. It was digested with the enzymes NdeI and XhoI. The generated 1.1 kb DNA was re- Purified, T_FourPDE digested with Ndel and Xhol using DNA ligase Ligated to -17b. The ligation mixture is then used to compile Tent E. coli DH5α was transformed. Colonies containing the 1.1 kb insert Selected for further analysis. Restriction mapping of DNA from DH5α clone The sequence of the cloning junction of the selected plasmid was determined. After this analysis, the DNA obtained from the DH5α clone was used to transform E. coli BL21 (D E3) -ΔompA was transformed. Contains 100 μg / ml carbenicillin You Transformants were selected on LB-agar. Produces class 2 porin protein Some of the transformants were screened for their ability. This means that L-containing 100 μg / ml carbenicillin and 0.4% glucose OD at 30 ° C in liquid B medium₆₀₀= 0.6, then IPTG (0.6. 4 mM). Next, the cells were crushed and the cells were extracted. The output was analyzed by SDS-PAGE. Cloned in pET-17b FIG. 9 shows the nucleotide sequence and translated amino acid sequence of the mature class II porin gene. A and FIG. 9B.Construction of fusion class 2 porin   Oligonucleotides: and Amplification of the pUC19-class 2 porin construct using Sporin was constructed. This strategy allows the Bam of plasmid pET-17b to be used. Amplification class 2 porin can be cloned into the HI and XhoI sites. From the T7φ10 capsid protein contained in the plasmid It is possible to produce a fusion class 2 porin further containing 22 amino acids at the N-terminus. Came. PUC19-Class 2 as template and the two oligonucleotides described above Was used to perform standard PCR. By this PCR reaction, 1.0% agarose gel was used. A 1.1 kb product was obtained when analyzed above. Obtained in this PCR reaction The DNA was gel purified and digested with the reaction enzymes BamHI and XhoI. Generated The 1.1 kb product was gel purified again and_FourBamHI and DNA ligase And XhoI digested pET-17b. Then this lighe The competent E. coli DH5α was transformed using the mixture. 1.1k Colonies containing the b insert were selected for further analysis. DH5α clone DNA from the plasmid was analyzed by restriction mapping and cloned from the selected plasmid. The sequence of the ning joint was determined. Clonin in the expression plasmid pET-17b And translated amino acid sequences of the fused fusion class II porin gene Are shown in FIGS. 10A and 10B. After this analysis, it was obtained from the DH5α clone. Escherichia coli BL21 (DE3) -ΔompA was transformed with the DNA. 100 Transformants were selected on LB-agar containing μg / ml carbenicillin. Some transformants were screened for their ability to produce class 2 porin proteins. Cleaned. This means that clones were treated with 100 μg / ml carbenicillin. And OD at 30 ° C. in LB liquid medium containing 0.4% glucose.₆₀₀= 0. 6 and then inducing the culture with IPTG (0.4 mM) went. Subsequently, the cells were disrupted, and the cell extracts were analyzed by SDS-PAGE. .Embodiment 3 FIG. Mature class from Group B Neisseria meningitidis strain 8765 Cloning and expression of 3-pollin in E. coli   Using the method described above (Sunbrook et al., Molecular Cloning: Alabora) Tree Manual, 2nd Edition, Cold Spring Harbor, New York, United States Old Spring Harbor Laboratory Press (1989)) Genomic DNA was isolated from Loop B Neisseria meningitidis strain 8765. This DNA was then used in two standard 3 PCR reactions in a standard PCR reaction. Used as template for oligonucleotides.   Oligonucleotides: and Amplify genomic DNA from 8765 using Phosphorus was built. This strategy allows the NdeI of plasmid pET-24a (+) to be And the amplified class 3 porin can be cloned into the BamHI site. (FIGS. 13A and 13B), thus producing mature class 3 porin Was completed. Genomic DNA isolated from 8765 as a template and the two Standard PCR was performed using rigonucleotides.   The reaction conditions were as follows: 200 ng of 8765 genomic DNA, 2 above 1 μM of each oligonucleotide primer and 200 μM of each dNTP A PCR reaction buffer (10 mM Tris HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl_Two, And 2.5 units of Taq polymerase, above with distilled water Adjust to 100 μl. The reaction mixture is then allowed to stand at 95 ° C for 1 minute and at 50 ° C for 2 minutes. And 25 cycles of 1.5 minutes at 72 ° C.   This PCR reaction resulted in approximately 930 bp when analyzed on a 1% agarose gel. The product of was obtained. The DNA obtained by this PCR reaction is gel-purified and Digested with NdeI and BamHI. This 930 bp product was gel purified again. PET-24a (+) digested with NdeI and BamHI using T4 ligase ). The ligation mixture is then used to competently E. coli DH5α was transformed. Additional colonies containing the 930 bp insert Selected for analysis. The DNA from the E. coli DH5α clone was Analysis by ping to determine the sequence of the cloning junction of the selected plasmid. Was. After this analysis, the DNA obtained from the E. coli DH5α clone was L21 (DE3) -ΔompA was transformed. 50 μg / ml kanamycin The transformants were selected on LB-agar containing. Some transformants were It was screened for its ability to produce sporalin protein. this thing Contains 50 μg / ml kanamycin and 0.4% glucose OD at 30 ° C in LB liquid medium₆₀₀= 0.6, then IPTG (1 mM) by inducing the culture. Then, crush the cells, Extracts were analyzed by SDS-PAGE.Embodiment 4. FIG. Purification and regeneration of recombinant class 2 porin   E. coli BL21 (DE3) ΔompA [pNV-5] was added to Luria broth for 30 minutes. Grow to mid-log (OD at 600 nm = 0.6) at 0 ° C. Then IPTG (final 0.4 mM) is added and the cells are grown for an additional 2 hours at 37 ° C. . The cells were then collected and several volumes of TEN buffer (50 mM Tris-HC l, 0.2 M NaCl, 10 mM EDTA, pH = 8.0) Was stored frozen at -75 ° C.   For purification, the previously weighed cells are thawed and 1:15 in TEN buffer. At a ratio (g / v). Transfer this suspension to a Stansted cell Disruptor (Stansted fluid pow) er Ltd.)) twice at 8,000 psi. Then, the resulting solution was Centrifuge at 000 rpm for 20 minutes and discard the supernatant. Then, Pele The cells were suspended twice in TEN buffer containing 0.5% deoxycholate and Discard the supernatant. The pellet was then washed with 8M deionized urea (electrophoretic gray). In TEN buffer containing 0.1 mM PMSF (3 g / 10 ml) Suspend. The suspension is sonicated for 10 minutes or until a homogeneous suspension is obtained. Manage. 3,14-Twittergen (Calbiochem) 10% aqueous solution (10 ml) and mix the solution thoroughly. The solution is sonicated again for 10 minutes. . Remove any remaining insoluble material by centrifugation. Measure protein concentration And protein concentration with 8M urea-10% Zwittergen buffer (1: 1 ratio) Is adjusted to 2 mg / ml.   The mixture was then diluted with 100 mM Tris-HCl, 1 M NaCl, 10 m M EDTA, 20 mM CaCl_Two0.05% 3,14-zwittergen; Sephacryl S-300 equilibrated in 02% sodium azide, pH = 8.0 2.6 × 100 cm column. The flow rate is maintained at 1 ml / min. 10m Collect 1 fractions. Porin regenerates into trimers during gel filtration. O of each fraction Measure D = 280 nm and filter the protein containing fractions for SDS for porin Subject to gel electrophoresis assay. Pool the fractions containing porin. Swimming pool Dialyzed fractions or 50 mM Tris HCl pH = 8.0, 0.05% 1:10 in 3,14-zwittergen, 5 mM EDTA, 0.1 M NaCl Dilute to. The resulting solution was then equilibrated in the same buffer to 2.6 × 10 c m Applies to Q Sepharose high speed columns (Pharmacia). Porin is 0.1 ~ Elute with a linear gradient of 1M NaCl.Embodiment 5 FIG. Purification and regeneration of recombinant class 3 porin   E. coli strain BL21 (DE3) containing porB-pET-17b plasmid ΔompA in luria broth at 30 ° C. until mid-log (O at 600 nm) D = 0.6) Proliferate. Then, IPTG was added (final 0.4 mM), and the cells were cultured for 3 hours. Grow for an additional 2 hours at 7 ° C. Next, the cells were collected and several volumes of TE N buffer (50 mM Tris-HCl, 0.2 M NaCl, 10 mM EDTA, (pH 8.0) and the cell paste was stored frozen at -75 ° C.   For purification, about 3 g of cells are thawed and suspended in 9 ml of TEN buffer. Lysozyme (Sigma, 0.25 mg / ml) was added, and deoxycholate (Sigma) was added. 1.3 mg / ml) and PMSF (Sigma, μg / ml) Gently shake at room temperature for 1 hour. During this time the cells were lysed and released The DNA makes the solution very viscous. Then, DNase was added (Sigma, 2 μg / ml) and mix the solution again for 1 hour at room temperature. Then, the mixture was subjected to S-6. Centrifuge for 30 minutes at 15K rpm in a 00 rotor and discard the supernatant You. The pellet was then suspended twice in 10 ml of TEN buffer, and the supernatant was discarded. Abandon The pellet was then washed with 8M urea (piercing) in TEN buffer (10 ml). Suspend in. The mixture is gently stirred to break up any lumps. This suspension Sonicate for 20 minutes or until a homogeneous suspension is obtained. 3,14-tu A 10% aqueous solution (10 ml) of Bittergen (Calbiochem) was added and the solution was added. Mix well. The solution is sonicated again for 10 minutes. Insoluble matter remaining All quality is removed by centrifugation. The protein concentration was measured and 8M urea-10 Adjust protein concentration to 2 mg / ml with 1% Zwittergen buffer (1: 1 ratio) I do.   The mixture was then diluted with 100 mM Tris-HCl, 1 M NaCl, 10 m M EDTA, 20 mM CaCl_Two, 0.05% 3,14-zwittergen, p 180 × of Sephacryl S-300 (Pharmacia) equilibrated in H = 8.0 Applies to 2.5 cm columns. The flow rate is maintained at 1 ml / min. 10 ml fraction to recover. Porin regenerates into trimers during gel filtration. OD of each fraction₂₈₀nm The fractions containing the protein were analyzed by SDS gel electrophoresis for porin. Serve for essays. Pool the fractions containing porin.   The pooled fractions were collected at 100 mM concentration using an Amicon concentrator with a PM10 membrane. Squirrel-HCl, 0.1 M NaCl, 10 mM EDTA, 0.05% 3,14-tu Dialyze against buffer containing Bittergen, pH 8.0 and concentrate 4-6 fold I do. Alternatively, pooled fractions are precipitated with 80% ethanol and Resuspend with. Next, Mono Q1 was prepared by equilibrating 6 to 10 mg of the substance with the same buffer. Applies to 0/10 column (Pharmacia). Do not increase 1.2% per minute Porin from a shallow 0.1-0.6M NaCl gradient for 50 minutes To elute. The flow rate is 1 ml / min. The peak containing porin is collected and T Dialyze against EN buffer and 0.05% 3,14-zwittergen. Poe Phosphorus may be further purified by other S-300 chromatography.Embodiment 6 FIG. Purification and chemical modification of polysaccharide   The capsular polysaccharides of both Group B Neisseria meningitidis and E. coli K1 are , Α (2 → 8) polysialic acid (generally called GBMP or K1 polysaccharide) Is). High molecular weight polysaccharides isolated from the growth medium by precipitation (Flash et al., Ba cterial Vaccines, Alan R. Liss, Inc., 123-14 5 (1990), "Manufacture and regulation of Neisseria meningitidis vaccine. (Production and Control of Neisseria meningitidis Vaccines) "), It was purified and chemically modified before binding to the porin protein. This high molecular weight Partially deweight polysaccharide with 0.1 M acetic acid (7 mg polysaccharide / ml; pH = 6.0-6.5) In total (70 ° C., 3 hours), a polysaccharide having an average molecular weight of 12,000 to 16,000 was obtained. . Gel filtration column chromatography (Superdex 200-tone) NaBH_FourPolysaccharide in the presence of N Deacetylation followed by the description of Jennings et al. (J. Immunol. 137: 1808) (1986) to give N-Pr GBMP. See Example 14). NaIO_FourAfter purification with gel filtration column, average molecular weight An oxidized N-Pr GBMP of 12,000 daltons was obtained.Embodiment 7 FIG. Group B meningococcal class 3 porin tamper of oxidized N-PrGBMP Binding to carbon (PP)   Oxidized N-Pr GBMP (9.5 mg) was added to 0.21 ml of 0.2 M phosphate buffer. (PH 7.5) (purified class dissolved in 10% octyl glucoside) Added to 3 Paulin protein (3.4 mg). After the polysaccharide is dissolved, Sodium noboronate (7 mg) was added, and the reaction solution was incubated at 37 ° C for 4 days. I did it. The reaction mixture was diluted with 0.15M sodium chloride containing 0.01% thimerosal. Gel filtration column using Superdex 200PG diluted with thorium solution Separated by chromatography. Conjugate (N-PrGBMP-PP) Was obtained as a single peak eluting near the void volume. This conjugate When the solution was analyzed for sialic acid and protein, the conjugate was It was shown to consist of 43% by weight of polysaccharide. Porin protein is the conjugation The polysaccharide was recovered in a yield of 44% and the polysaccharide was recovered in a yield of 12%. For various experiments In general, protein recovery is obtained in the range of 50-80%, and polysaccharide recovery is It was obtained in the range of 9-13% (see also Example 14).Embodiment 8 FIG. Immunogenicity studies   Immunogenicity of the N-Pr GBMP-PP conjugate, and similar binding N-Pr GBMP-tetanus toxoid prepared by the procedure (N-Pr GBMP -TT) The immunogenicity of the conjugate was determined using 4-6 week old outbred Swiss websters. -Assayed in CFW female mice. Polysaccharide (2 μg) -conjugate on day 1 Dose was administered on days 14 and 28, and serum was collected on day 38. Conjugation Can be administered as a saline solution, adsorbed on aluminum hydroxide, or This was performed by mixing with riltyrosine. Serum ELISA titers and polysaccharide antigen titers Table 1 summarizes the bactericidal titers against Iseria meningitidis group B.Embodiment 9 FIG. Group B Neisseria meni using yeast Pichia pastoris expression system Expression of outer membrane of Ngitidis (MB3) Materials and methods Strains and plasmids   Pichia pastoris GS115 (provided by Invitrogen) is histidine Synthesizes histidine due to a defect in the hydrogenase gene (his4) Can not do. All expression plasmids carry the HIS4 gene and To complement his4, transformants were grown on histidine-deficient media due to their ability to grow. Selected. Until transformed, GS115 does not grow in minimal medium alone There will be.Expression vector   Includes strong, highly inducible AOX1 promoter for expression of foreign proteins Four different expression vectors were used (Pichia expression kit, Invitrogen). One vector, pHIL-D2, was used for cell expression and the other three (pHI L-S1, pPIC9, and pPIC9K) are used for secretory expression. pH A map of IL-D2, pHIL-S1, and pPIC9 is available from Pichia Expression Kit, Version E, Invitrogen Instruction Manual, pages 19-22 (The contents of which are incorporated herein by reference). For secretion, For targeting the expressed protein to the secretory pathway on the expressed protein It is necessary that the signal sequence be present. To increase the likelihood of success, 2 Two different types of vectors are included in the kit. The vector pHIL-S1 is Natural Pichia pastoris signal from acid phosphatase gene PHO1 Have. Vectors pPIC9 and pPIC9K (with corrected HIS4 region Are derived from the Saccharomyces cerevisiae α-mating factor prepropeptide. Secretion signal. The advantage of expressing secreted proteins is Pichia past Squirrels secrete natural proteins at very low levels. therefore The secreted heterologous protein makes up the majority of the total protein in the culture medium, This is the first step in quality purification (Barr et al., Pharm. Eng. 12 (2): 48). -51 (1992)).Cloning of N. meningitidis B class 3 protein gene (MB3)   The genomic DNA of Group B Neisseria meningitidis (strain 8765) was Used as template for amplification of class 3 porin (MB3) in semi-PCR. Mature The amplified DNA fragment of the porin protein (930 bp in length) was And expression vectors (first constructed by Studio et al. (J. Mol. Biol. .189: 113-130 (1986): Meth.Enzymol. 185: 60-89 (1 990); J. Mol. Biol. 219: 37-44 (1991)), according to Novagen. (Produced by Escherichia coli) at the NdeI-BamHI cloning site. p ET vectors are used for cloning of target DNA fragments and for strong T7 transcription and translation. Developed for expression under translational signals. Expression from the T7 promoter is Triggered by providing a source of 7 RNA polymerase to the host cell. T7 expression Newer and more convenient vectors using the system are now Novagen (Madison, Wis.) Available from Consin 53711). T7 expression system expresses MB3 in E. coli (See Example 3).Optimization of translation elongation rate of expressed MB3 gene   Codon usage is known to affect translation elongation rate and therefore It is believed to be an important factor affecting product yield (Romanos (Ro manos) et al., Yeast 8: 423-488 (1992)). Codon usage appears There is evidence that this affects both the yield and the quality of the protein produced. many Highly expressed genes show a strong bias for some codons (Bennetze n) et al., J. Biol. Chem. 257: 3026-3031 (1982)). This "primary The “major codon bias” (which can vary widely from organism to organism) increases This seems to be a breeding optimization strategy. This mechanism involves a small fraction of tRNA and amino acids. Since only acyl tRNA synthetase needs to be present at a high concentration, organisms It allows efficient translation of highly expressed genes during rapid growth. Curran Kurland et al., TIBS 12: 126-128 (1987). mRNA is rare Amino coacyl tRNA is limited when it contains various codons, The probability increases, and possibly the ribosome can come off. In fact, recently High frequency of mistransfer has been observed in foreign proteins produced in E. coli ( Scorer et al., Nucleic Acids Res. 19: 3511-516 (199). 1)). In addition, proteins containing amino acid mistransfers should be purified. Can be difficult, and both activity and immunogenicity may be compromised. Some Presence of rare codons in Escherichia coli limits production of tetanus toxin fragment C in E. coli (Makoff et al., Nucleic Acids Res. 17: 10191-102). 01 (1989)). In yeast, Hoekema et al. (Mol. Cell. Biol. 7: 2914-2924 (1987)), PGK (phosphoglycerate kinase) A) a large proportion of preferred codons in the 5 'portion of the gene It has been shown that substitution results in a decrease in expression levels. Recently, synthetic codons When the optimized gene is used, the kappa-chain mRNA levels may be the same. However, it was shown that the expression of the immunoglobulin kappa chain in yeast was 50 times higher. .   There was a significant difference in codon usage between Pichia and MB3 (Table 5). Bird The optimal codons for Pichia to optimize translation efficiency at the start of translation elongation Was introduced into the 5 ′ region of the MB3 gene. Cloning MB3 into pHIL-S1 When constructing a linker to be used for Oligomers were synthesized as described above. Oligomers 51 nucleotides long (51-me r) was synthesized for this purpose. The sequence of this oligomer is as follows: A 47 nucleotide oligomer complementary to the 51-mer was also synthesized. This ori The sequence of Gomer is as follows:   These two oligomers (containing XhoI and BsrI restriction sites) To act as a connector and then linearized by XhoI digestion Ligated to pHIL-S1. The ligated fragment was then digested with BamHI. Digest, gel purify and then transfer the pNV15 vector to Bsrl and BamHI. It was ligated with the MB3 fragment obtained by digestion with both enzymes. This fragment is then It was cloned into the Chia pHIL-S1 expression vector. New in 5 'area of MB3 DNA sequence of pHIL-S1 / MB3 isolated from Pichia Confirmed by constant.   The native 5 'end sequence (from NTI) of the mature MB3 gene is as follows: RU: The following shows the codon-optimized sequence of the same fragment together with the corresponding amino acid sequence. (The substituted nucleotides are shown in capital letters):   Vector pHIL-S1 / MB3 (including codon-optimized MB3 DNA) Used as template for amplification of MB3 in semi-PCR. Synthesize oligomers Used as PCR primers. The PCR fragment of MB3 can be directly or Original TA Cloning Kit (Invitrogen ) Was inserted into a Pichia expression vector. Details are as follows. : For cloning MB3 into the EcoRI site of pHIL-D2: Forward primer (39 nucleotides, created EcoRI site and (With the sequence encoding the starting methionine (5'ATG)): Reverse primer (45 nucleotides, created EcoRI site and stop primer) Don): Cloning of MB3 into pPIC9 and EcoRI-AvrII site of pPIC9 For ling: Forward primer (39 nucleotides, with EcoRI site created) Coding the starting methionine because the leader peptide had the starting methionine. No sequence was required): Reverse primer (36 nucleotides, created AvrII site and stop code) With)   For PCR amplification of the complete MB3 gene, vent (Vent^R) DNA polymerase Ze (NEB) was used. The fidelity of this polymerase is Taq D 5 to 15 times higher than that observed with NA polymerase. Expression cassette plastic To generate the sumid, the PCR fragment of MB3 (full length fragment and cleaved fragment) Direct or original TA cloning kit (P Torogen) (pCR for subcloning of PCR fragments)^TMII vector Mu). Vent DNA polymerase or Pfu DNA poly Vector pCR of DNA amplified by any of merases^TMDirect black into II Cloning is difficult because the cloning efficiency is often very low. this is, Vent and P to remove the 3'A overhang required for TA cloning to leave blunt ends This is for fu 3 ′ → 5 ′ exonuclease proofreading activity. Original TA black Cloning kit makes it possible to clone these blunt-ended fragments. I do. This method eliminates the need for enzymatic modification of the PCR product and eliminates restriction sites. There is no need to use PCR primers. Further increase cloning efficiency Therefore, the in vitro Gen protocol was modified as follows. Vent or P After amplification with fu (manual of original TA cloning kit, Protocol for the Addition of 3'A Overhangs, page 19), recommended in the kit Paraffin mineral oil in the PCR mixture instead of placing the vial on ice as in Film (Parafilm^TM) And immediately removed. This means that the PCR mixture is Pour into the plastic film and gently shake until all the oil droplets The oil droplets zigzag down on the parafilm surface I went. The reaction mixture, now free of oil, was then collected in a new tube. Then, the Invitrogen protocol was restarted by adding Taq polymerase. Was. This method involves the difficult cloning of PCR fragments into large expression vectors. Made it possible.   The expression cassette of the integration vector (Invitrogen) is Methanol-induced, flanked by upstream and downstream nucleotide sequences Includes AOX1 promoter and its terminator. Of Pichia Pastoris The His4 gene functioned as an auxotrophy marker. These vectors are yeast His does not include the origin⁺Colonies respond to integration of expression cassette Must. All the PCR fragments of MB3 were ligated with the Pichia Kozak consensus sequence (CAAA). AAACAA) (Cavenor et al., Nucleic Acids Res. 19: 3185). ３１3192 (1991); Kozak, Nucleic Acids Res. 15:81. 25-8148 (1987); Kozak, Proc. Natl. Acad. Sci. USA 87: 8. 301-8305 (1990)) and the best of the MB3 gene Translation started. All insertions were placed under the control of the AOX promoter. The desired gene was expressed. The MB3 fragment is ligated into an appropriate expression vector. After that, chemically competent Escherichia coli cells were transformed (TOPIOF ') ( F '{proAB, laqI_q, LacZΔM15, Tn (Tet^R)} McrA, Δ (mrr-hsdRMS-mcrBC), φ80lacZΔM15, Δlac X74, deoR, recA1, araD139, Δ (ara-leu) 769 7, galU, galK, rpsL (Str^R), EndA1, nupGλ^-). Other suitable strains include DH5αF ', JM109, or a selectable F' episome. Other strains that have recA deletion (endA is preferred) (Pichia Expression Kit) Instruction Manual, Invitrogen). Has MB3 insertion CsCl purification of plasmid DNA for Pichia transformation using Xypreps (Molecular Cloning: A, edited by Sunbrook et al.) ・ Laboratory Manual, 2nd edition, Cold Spring Harbor Press (1 989), 1.42 to 1.43). Restriction analysis and DNA sequencing (DNA sequencing) Quenching kit, version 2 (USB)) confirms that these constructs are correct It was confirmed.   Modification of the starting material MB3 sequence can be achieved by intracellular expression of the porin gene (pHIL -D2 / MB3 construct). Other constructs used for MB3 secretion ( pHIL-S1 / MB3 and pPIC9 / MB3) are upstream of the MB3 insert. Since the leader peptide sequence contained an optimal codon for Pichia, translation was started. Did not limit the speed. In contrast, the pHIL-D2 vector is Does not contain a base sequence, and the start of translation does not start at the rare codon of the MB3 insert. I have to. Optimization of this sequence has been tested by the pHIL-D2 / MB3 construct. Due to the fact that it gave the highest level of MB3 expression among all clones There seems to be (Tables 3 and 4).Transformation of yeast cells and DNA analysis of integrants   Digest plasmid DNA alone or double (for higher integration efficiency) Linearize, use zymolyase, then adsorb transforming DNA and PEG And Ca⁺²The DNA into the Pichia cells through the spheroplast pores in the presence of Infiltration spheroplast method (Pichia Expression Kit Manual, Invitro Rogen, pp. 33-38) Pichia pectris strain GS115 (his4^-) Shaped Transform His⁺Phenotype. Minimum dextrose (MD: 1.34% yeast nitrogen) Base (YNB-Gifco), 4 × 10^-Five% Biotin, 2% dextrose) Minimum methanol (MM: 1.34% YNB) 4 × 10^-Five% Biotin, 0.5% meta Nord) replica plating and patching to determine which His⁺ It was possible to determine if the transformants also showed disruption of the AOX1 gene . The transformed spheroplasts were added to histidine-free selective growth medium (MD). Used to inoculate on agarose-containing plates. At the end of 4-6 days, yeast form quality A white isolated colony of the transformant appeared. Pick up these colonies and crush AOX1 (Mut^sOr Mut^-) Selectable methanol for screening transformants (Pichia Expression Kit Manual, Invitrogen Hen, p. 60).Yeast growth and methanol induction   Recombination events occur in many different ways that affect protein expression levels At least 16 confirmed recombinant clones Lean to determine MB3 expression levels. These colonies are 50ml in incubator shaker (New Brunswick Science) In a 2098 Blue Max tube (Falcon), 5 ml of glyce Buffered Glycerol-complex Medium (B MGY: 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6. 0, 1.34% YNB, 4 × 10^-Five% Biotin, 1.0% glycerin) (from Pichia) Propagated in the current kit manual, Invitrogen, p. G) expression). When the culture reaches OD600 = 5-10 after 1-2 days, AO The cells were centrifuged (4000 rpm, 10 minutes, for induction of the X1 promoter). At room temperature) and buffered methanol-containing medium containing methanol (Buffered Metha nol-complex Medium) (BMMY: 1% yeast extract, 2% peptone, 100m M potassium phosphate, pH 6.0, 1.34% YNB) 4 × 10^-Five% Biotin, 0.1% 5% methanol) (Pichia Expression Kit Manual, Invitrogen, p. 61) Resuspended in. To replenish depleted methanol, 0.5% of new Tanol was added to the induced cells daily. Aliquots of cells were centrifuged for 6 days. Collected daily and stored at −70 ° C. before examination (pellet and supernatant separately ). Optimize protein expression and scale up expression protocols Of the most promising clones to produce more protein .Lysis of Pichia pectris, analysis by SDS-PAGE and Western blot Analysis   Cell disruption buffer (50 mM sodium phosphate, pH 7.4; 1 mM PMSF (Phenylmethylsulfonyl fluoride), 1 mM EDTA and 5% (Serine) by stirring. Equivalent volume of acid-washed glass beads (diameter 0.5 mm). Mix the mixture for a total of 4 minutes (30 seconds each, then 30 seconds each ice Above), and stirred. Centrifuge the soluble fraction at 14000 rpm for 10 minutes at 4 ° C. Collected by running. The supernatant (or cell lysate, or “soluble” Protein fraction), store at −70 ° C., and remove residual cell pellet from SDS sample buffer. Buffer (1% SDS, 5% beta-mercaptoethanol, 10% glycerin, 1 (0 mM EDTA, 0.025% bromophenol blue). Extracted by boiling for minutes. The lysate is centrifuged again and the aqueous layer is It was examined as "insoluble" or as a fraction of membrane bound protein. Remuri et al.'S method (Nature  227: 680-685 (1970)). Proteins were separated using a Recast 8-16% gradient gel. Dodecyl sulfate Separation by sodium-polyacrylamide gel electrophoresis (SDS-PAGE) Stained protein with Coomassie Brilliant Blue R250, or Install a trans-blot device (Bio-Rad Laboratories) according to the company's instructions. And transferred to polyvinylidene difluoride (PVDF).   Method described by Sheng and Schuster (BioTechnique 13: 704-708 (1992)) Western blotting using only blocking method without surfactant Was done. This method gives high specificity and sensitivity with low background. For migration, Western migration membrane and SDS-PAGE prior to electrical migration Both separation gels were transferred to a transfer buffer (24 mM Tris-HCl / 192 mM glycine / (20% methanol) for 20 minutes. Migration is 90V, 4 ° C for 3-4 hours went. Transfer of the protein to the PVDF membrane was determined by a previously stained molecular weight marker ( (BRL).   Immunostaining of the protein was performed as follows. TBS migration film (10 mM Tris-HCl / 0.09% NaCl, pH 7.2). Incidentally , 1% skim milk in PBS containing 0.02% sodium azide in PBS (M-PBS) Incubated at 37 ° C for 3 hours (or 4 ° C overnight). Then, the membrane is Washed three times with BS / 0.5% BSA (BSA / TBS) and once with TBS . The membrane was then diluted about 1: 4000 in PBS / 1% BSA (BSA / PBS). Diluted primary mouse anti-MB3 antibody (mouse polyclonal antibody against purified OMP class 3) Incubated with null antiserum), and the membrane was again reconstituted with TBS / 0.5% BSA (B (SA / TBS) and 3 times with TBS. Then, the membrane was 1% MP Incubate for 30 minutes at room temperature with gentle shaking in BS. TBS membrane Washed three times with /0.5% BSA (BSA / TBS) and once with TBS. One Next, the membrane was washed with a secondary alkaline phosphine diluted 1: 4000 in 1% BSA / PBS. Vatase-conjugated anti-mouse antibody (Kirke Girl & Perry Laboratory (KPL), Gaithersburg, MD). Then, put the membrane on 0. Wash twice with 5% BSA / TBS and three times with 0.25% Tween 20 in PBS Was. These cleaning steps differ from those recommended by Sheng and Shaster. I was The improved protocol consists of 6 washes in 0.5% BSA / PBS. Provided a lower background than the literature wash step utilizing the Then the membrane With alkaline phosphatase buffer (0.05% M Tris-HCl, pH 9.5, 1 0 mM MgCl_Two), Followed by BCIP / NBT substrate solution ( KPL). Wash membrane in PBS / 50 mM EDTA This stopped color development. The detection limit is about 2-5 ng of native MB3 protein. Met.                              Results and discussion   Strategy used to insert cDNA encoding mature MB3 into an expression vector And steps for using the constructs for transformation of Pichia pastoris are outlined below. . First, the MB3 gene is cloned into one of the four Pichia expression vectors. In the next step, the resulting construct is digested with NotI or BglII. And transform his4 Pichia spheroplasts with the linear construct. You. In the next step, the recombination event takes place in vivo at 5 'in the vector and genome. And And 3 'AOX1 sequence, resulting in the replacement of the AOX1 gene with the MB3 gene. Results. Then, a histidine deficiency that allows only the cells with the gene replacement to grow Select Pichia transformants on the medium. Notes on Saccharomyces cerevisiae 1-step gene replacement method (Rothstein, Meth. Enzymol. 1) 01: 202-211 (1983)), the AOX1 structural remains of Pichia pastoris For gene replacement, Clegg et al. (Biological Research on Industrial Yeast, V ol. II, edited by Stewart et al., CRC Press, Boca Lei Thong, 1-18 P. (1987)). 10μ with MB3 insertion sequence g of linear expression vectors (pHIL-D2, pHIL-S1, pPIC9, and And pPIC9K) transformed GS115 in each experiment. Colonies were given. Therefore, this procedure allows for> 10 μg / μg DNA^Twoof His⁺A colony is obtained, which is the best result of Pichia pastoris transformation. Comparable to what was reported about. These transformants were used in a histidine-deficient medium (M D-minimum dextrose) and therefore His^-It is. About 10 to 40% of these recombinants are "methanolslow" (Mu t^s-“Methanol utilization slow”) That is, MM containing methanol as the sole carbon and energy source (minimum Growth on a medium such as methanol) was impaired. These His⁺/ Mut^s Transformants were transformed with AOX1 structural gene and His by double crossover phenomenon.⁺Contains genes It is a result of substitution with the MB3 expression cassette. The recombination event is also 5 ′ or 3 ′ A By integration or insertion of the expression cassette into the OX1 region (single crossover event) Also occur, leaving the AOX1 gene intact. His⁺/ Mut^sOut of the clone 25-35% were positive MB3-expressing transformants (Table 2). AOX1 deletion form The reason why it grows on the transgenic methanol medium is that AOX2 gene product Due to the low level expression of alcohol oxidase activity. 5'AOX With 1,3′AOX1,5′MB3,3′MB3 and other specific primers Analysis of DNA isolated from these “positive” recombinants using PCR was performed using AOX1 Structural gene is confirmed by the fragment containing MB3 gene and HIS4 gene Has been substituted. His⁺/ Mut⁺DN isolated from transformant Analysis of A revealed that the AOX1 structural gene was complete and that His4 DNA was included. This indicates that the entire vector was integrated at any site. Depart MB3 Among the 39 AOX1 disrupted transformants that appeared, His⁺/ Mut⁺Transformants found No, indicating that the built-in AOX1 replacement mode was preferred.   The results of the immunoblot analysis of 84 Pichia transformants were Sumid, pHIL-D2 / MB3, pHIL-S1 / MB3, pPIC9 / MB 3 and pPIC9K / MB3 to express the MB3 protein. (Table 3). 39 clones expressing the MB3 protein were Isolated. The antigen specificity of the expressed MB3 protein was determined using wild-type Neisseria. ・ Monoclonal antibodies and antibodies against Meningitidis OMP class 3 This was checked and confirmed by Western blot analysis using a clonal antibody. this The results show that all expression vectors were constructed correctly and that This led to the conclusion that the strike was properly transformed.   The amount of expressed MB3 was measured using a model GDS-7500 scanning densitometer. (Scanning densitometer) (UVP / Life Science) or Model IS Using SDS-PAGE with a -1000 densitometer (Alpha Innotek) Densit scan of the Coomassie Brilliant Blue monostained protein band metric scanning). Extracted from wild-type Neisseria meningitidis The resulting purified OMP class 3 was used as a standard. The results obtained (summarized in Table 3) Based), the protein expression level was rated as moderate to high Was.   Optimization of translation elongation rate for MB3 gene expression (see above materials and methods) See) was very helpful. Modification of the starting MB3 sequence is based on the porin gene cell It was particularly useful for endogenous expression (pHIL-D2 / MB3 construct). Other construction Products (pHIL-S1 / MB3 and pPIC9 / MB3, both of which secrete MB3) Used for Pichia in the leader peptide sequence upstream of the MB3 insertion sequence. The initiation of translation of these cassettes was rate-limiting because they contained codons. There was no. In contrast, the pHIL-D2 / MB3 construct contains a leader sequence. Without, therefore, without codon optimization, translation would be a rare codon in the MB3 insert. I had to start with. PHIL-D2 / MB3 construct with codon optimization Shows all other MB3 expression when transformed into Pichia chromosomal DNA. It gave the highest level of MB3 expression of the constructs (Tables 3 and 4). therefore, This modification of the translation initiation sequence of MB3 is expressed in the pHIL-D2 / MB3 construct. It appears to be responsible for the high yield of protein.   By the best clone (Pichia transformed with the pHIL-D2 / MB3 construct) MB3 expression levels range from 0.1 to 0.6 g / L cell suspension, or Was 1-3 mg / g cell pellet (Table 3, FIG. 12). In yeast Such expression efficiencies have been reported for many manufactured proteins, including: Are: hepatitis B surface antigen (0.3 g / L), superoxide dismutase ( 0.75 g / L), bovine and human lysozyme (0.3 g / L and 0.7 g / L), human and mouse epidermal growth factor (0.5 g / L and .45 g / L), human insulin-like growth factor (0.5 g / L), human interlo Ikin-2 (1.0 g / L), aprotinin analog (0.8 g / L), Kunitz Protease inhibitors (1.0 g / L) and the like (Cleg et al., Biotechnology, 11: 903-906, Table 1 (1993)).   The expression levels of the production proteins listed above are based on the It must be emphasized that the result is produced when fermented in a fermenter . Although MB3 was only expressed using shake flask culture, this was in principle And result in much lower levels of expression than fermentation. Recently reported Observations indicate that the much higher yield of MB3 (Creg et al., 1993) (5 -10-fold or more increase). Pikia Pastori Is used to scale up from shake flask culture to high density fermentor culture. Adapt to the minute. Furthermore, when a Pichia strain lacking AOX is used for fermentation, Cause rapid growth and then add methanol to maximize cell growth. Induction of foreign protein by inducing protein production while keeping it to a minimum Raw Can be optimized. Proteins when growing Pichia on methanol The long period of time required to produce quality can be determined by several mixed diet fermentation strategies (mixe This can be reduced by applying one of the d-feed fermentation strategies). (Siegel et al., Biotechnol. Bioeng. 34: 304-404). (1989); Brierley et al., International Patent Application WO 90/03431. (1989); Briarley et al., Bichem. Eng. 589: 350-362 (1990). Siegel et al., International Patent Application WO 90/10697 (1990)).   Other promising aspects of MB3 protein expression levels in Pichia are A similar result was obtained for all the clones. Other researchers shake Expression level is directly proportional to copy number of desired inserted gene in shake flask induction (Creg et al., 1991), all MBs tested That the three clones are single copy chromosomal integrants and therefore of the MB3 fragment It was derived that Pichia recombinants with multiple integrated copies were not isolated. You.   An important factor in obtaining high expression levels using Pichia pastoris is multi-core. Ability to obtain recombinants with transplacement or integration (Romanos et al., Vaccine 9: 901-906 (1991); Claire ( Clare et al., Bio / Technology 9: 455-460 (1991); Clare et al., Gene. 105: 205-121 (1991)). Multi-copy transformants have high cell density It is surprisingly stable over multiple generations during growth and induction in yeast. won. This multigene insertion phenomenon occurs only infrequently in spheroplast transformation. Because it does not occur, a special dot blot screen (Scholler et al., Bio / Technology 12: 181-184 (1993). )). An alternative to screening for the natural multiple insertion phenomenon is the Pichia expression vector p. The desired in AO815 (developed by Invitrogen for this purpose) Inserting multiple copies of a gene.   Before attempting to express MB3, there are factors that appear to reduce expression levels The protein was evaluated to determine if The expected of the protein One factor that can reduce high levels of accumulation is proteolytic stability. Highly expressed proteins are now known to lack good PEST sequences . The PEST sequence contains proline (P), glutamic acid (E), serine (S) and A rapidly degraded eukaryotic protein of known sequence that contains leonin (T) All are found. Such proteins are good for calcium-activating proteases. It appears to be a good substrate (Rogers et al., Science 234: 3). 64-369 (1986)). Proteins expressed at high levels in yeast A so-called "complete" PEST sequence (developed by Rogers et al. (1986) With a score of> 5, calculated by a modified algorithm) (Protein hydrolysis Lysosomal pathways), and does not contain cytoplasmic proteins by the lysosomal pathway. The solution is selective (Dice, J.F., Fed. Am. Soc. Exp. Biol. (FASEB) J. 1: 349-357 (1987)) Pentapeptide sequence XFXRQ or Q It also does not contain RXFX (X is any amino acid). High level expression in yeast The resulting protein does not contain these pentapeptide sequences. MB3 sequence compilation Computer analysis, the sequence:ETSRSVFHQNGQVTEVTTWith AT "Poor" but not "complete" PEST sequence (13-32 amino acids ) Was identified. According to Rogers et al. (1986), such inadequate PEST distribution Sequence has only a weak effect on proteolytic stability of eukaryotic proteins Absent. Therefore, one of the factors leading to proteolysis is not present in MB3.   MB3 also does not contain the highly conserved pentapeptide sequence. Array :RQSFI (75-79 amino acids) is present in MB3. This array is Shows some homology to the non-human peptide QRXFX, but does not significantly show MB3. Not expected to stabilize.   NH_TwoThe nature of the terminal amino acid residues also plays an important role in the susceptibility of proteins to degradation. Can be a factor. Varshavsky et al., NH_TwoSome kind of terminal The presence of amino acids can be quickly determined by the ubiquitin-mediated pathway (N-terminal rule pathway). Have shown a stabilizing effect on the solution (Bershawski et al., Yeas t Genetic Engineering, Butterworth, pp. 109-143 (1989)). yeast Most proteins expressed at high levels in No acid residues (A, C, G, M, S, T or V). Such proteins Examples of human superoxide dismutase, human tumor necrosis factor, sugar A phosphoglycerate kinase from Saccharomyces cerevisiae Invertase from Levisier, alcohol dehydro from Pichia pastoris Genases and extracellular proteins from Y. lipolytica Potassium protease (Sreekrishna et al., Biochem istry 28: 4117-4125 (1989)). MB3 is well expressed in yeast The MB3 NH_TwoTerminal aspartic acid (D) is via the ubiquitin-mediated pathway Has no stabilizing effect on rapid degradation.   MB3 NH_TwoTerminal aspartic acid is produced from Pichia in large-scale production. It is likely that it will play a role in the MB3 levels that are generated. MB The first amino acid of the 3_TwoKnown to stabilize the ends Substitution at one of the above amino acids may improve MB3 production levels Absent.   Most of the factors known to reduce expression levels are present in MB3 As a result, it was decided to start an experiment trying to express MB3 in yeast.   The best expression of MB3 was transformed with the pHIL-D2 / MB3 expression cassette Pichia clones (Tables 3 and 4). This pHIL-D2 vector Is a complete, monomeric, non-fusible, non-secretor with an expected molecular weight of approximately 34 kDa Resulted in intracellular expression of MB3. These clones are 600 mg / L or Resulted in the highest levels of MB3 expression up to 3 mg / g wet cell pellet (Table 4) ). Approximately 90-95% of this product is insoluble, membrane bound material, ie, 10,000 A substance that sediments out by centrifugation at 0 g for 5 minutes, which is a buffer containing SDS (PA (GE sample buffer), followed by boiling. The protein is then readily recognized by the anti-meningococcal OMP class 3 antibody. sell Can be played in a conformation.   Methanol induction of pHIL-D2 / MB3-constructed clones rapidly induced intracellular MB3. This resulted in rapid onset and rapid accumulation. 24 hours after methanol induction MB3 expression level estimated to be over 80% of maximal expression (achieved after 5-6 days) Was done.   Pichia recombinants containing pHIL-D2 / MB3 are most promising for commercial production Is what is done. This clone produces a relatively high level of expression, By using multicopy recombinants and by allowing the protein to be produced in fermenters Should be able to improve significantly. If MB3 is produced quickly That fact also offers advantages for large-scale manufacturing.   MB3 expressed in intracellular form was purified by denaturing / reproducing protocol followed by gel Purified by filtration and ion exchange chromatography. The resulting purified tamper The protein is an eluted protein similar to the recombinant class 3 protein overexpressed in E. coli. The feel is shown in size exclusion chromatography. E. coli or Pichia MB3 expressed by any of the Pastoris is not a natural wild type counterpart. Eluted together and expressed by either E. coli or Pichia pastoris MB3 regenerates and oligomerizes to achieve a complete natural conformation (FIGS. 14A and 14B).   Natural (Pichia) secretion signal (PHO1) and Saccharomyces cerevisiae Both α-factor signal sequences derived from d. Was tested. Unexpectedly, shorter PHO1 leaders It was even more effective in causing MB3 secretion. pHIL-S1 Pichia transfer vector Is a 2.5 kDa PH which is a Pichia pastoris secretory signal peptide. Contains the sequence encoding the O1 leader peptide. pHIL-S1 / MB3 construct The sequence encoding MB3 is inserted downstream of the PHO1 leader sequence Was. Expression of 36.5 kDa produced by pHIL-S1 / MB3 clone 40-50% of the fusion protein PHO1 / MB3 is properly cleaved to 34 kDa Of MB3 monomers (Tables 2 and 3) and 5-1 of the expressed soluble porin 0 % Were secreted. pPIC9 and the pPIC9K Pichia transfer vector are A sequence encoding a 10 kDa α-factor leader from R. cerevisiae. Including. Pipes transformed with pPIC9 / MB3 or pPIC9K / MB3 Chia clones did not secrete porin. These recombinants had a 44 kDa α- The factor prepro / MB3 fusion protein was well expressed, but with correct cleavage and No evidence of sexing was observed. The improved secretion of the expressed MB3 is Fused to either the HOI leader peptide or the α-factor leader peptide Was not obtained by using the 3 'truncated fragment.Embodiment 10 FIG. Isolation, purification and purification of MB3 protein expressed as secreted protein And characterization   Has an expression vector (pHIL-S1-pNV318) containing the MB3 gene A yeast cell culture solution was prepared, and the protein was isolated as a soluble secretory substance. 2 The supernatant is clarified by precipitation with 0% ethanol (v / v) and mixed. Yeast culture impurities were removed. Then, the supernatant is washed with 80% ethanol (v / v). Settled. The resulting pellet is used to remove other water-soluble contaminating secreted proteins. With TEN buffer (Tris HCl, pH 8.0, 100 mM NaCl and 1 m M EDTA). The pellet containing MB3 is mixed with an aqueous solution of a surfactant. (Consisting of TEN buffer containing 5% Z3-14). This solution is In 0 mM Tris, 0.2 M NaCl and 1.0 mM EDTA (pH 8.0) Equilibrated High Trap Q Sepharose ion exchange column (1 ml) Macia). A 0.2-1.0 M gradient of NaCl was applied and the MB3 protein was applied. The quality eluted as a single peak.Embodiment 11 FIG. MB3 protein expressed as an insoluble membrane-bound protein Isolation, purification and characterization   An expression vector (pHILD2-pNV322) containing the MB3 gene (Table 3 Of the yeast cell culture medium having the above-mentioned concentration to a concentration equivalent to 50 to 1000 D. Solution (ie, 50 mM sodium phosphate buffer, pH 7.4, 1 mM EDTA , And 5% glycerin). Transfer this suspension to an equal volume of acid-treated glass. Bi Added to This suspension is added to a Minibead-Beater (bath). Each cycle using Iospec Products, Bartlesville, Oklahoma) Eight consecutive 1 minute cycles on ice for 1 minute between each cycle Dissolved. Alternatively, lysis can be achieved by adding zymolase to the disruption buffer. Made it easier. Transfer this suspension to a glass sintering filter to separate the glass beads. After release, the cell suspension was recovered in the filtrate. The beads were further washed and combined with the filtrate . The suspension was then centrifuged at 12,000 rpm at 4 ° C. for 15 minutes. The obtained pellets were subjected to a continuous washing step consisting of: (a) 0.5% de TEN containing oxycholate (Tris HCl, pH 8.0, 100 mM NaC 1 and 1 mM EDTA); (b) containing 0.1% SDS and 1% nonidate TEN, then the suspension was spun at 25 ° C. for 30 minutes; (c) TEN buffer Washing with a liquid, and then (d) T containing 5% Z3-14 while rotating at 4 ° C. overnight. Wash with EN buffer. After each washing step, 12,000 rpm, 4 ° C for 10 minutes The pellet was collected by centrifugation for the next step. As an alternative to pellet cleaning The suspension was passed through an 18 gauge needle instead of the rotation of steps (b) and (d) . Finally, MB3 is extracted with 8M urea or 6M guanidine HCl and the extract is extracted with water. Sonicate for 10 minutes using a bath sonicator. The extract was centrifuged (12.0 00 rpm, 10 minutes, 4 ° C.) and the same volume of 3,14-zwitter A 10% aqueous solution of Jen (Calbiochem) was added and the solution was mixed well. this The solution was sonicated again for 10 minutes. Residual material was removed by centrifugation. About The mixture was then combined with 0.1 M Tris-HCl, 0.2 M NaCl, 10 mM ED. TA, 20 mM CaCl_TwoAnd a buffer consisting of 0.05% Z3-14 (pH 8.0) Sephacryl S-300 (5 × 100 cm) column (Fal Macia) loaded. The fraction containing the class 2 protein was analyzed by SDS-PAGE. Identified, pooled, then 50 mM Tris, 0.2 M NaCl and 1.0 MED. High Trap Q Sepharose ion-exchanger equilibrated in TA (pH 8.0) The ram (1 ml) (Pharmacia) was loaded. 0.2-1.0 M gradient NaCl Was applied to elute the MB3 protein as a single peak. 14A and 14 B and 1 5 is a SEFF coupled to an HPLC (Hewlett-Packard, model 1090) Figure 3 shows the elution profile of purified MB3 on Agarose 12 (Pharmacia). Natural Based on comparison with wild-type class 3 protein and calibration using molecular weight standards, The elution profile shows trimer assembly.Embodiment 12 FIG. Preparation of GAMP-TT conjugate 12.1 Preparation of NMA polysaccharide for conjugation   Modified Franz Neisseria meningitidis group A (NMA) strain 604A Medium (Franz, ID) et al., J. Bact. 73: 757-761 (1942). ). The polysaccharide is precipitated as a cationic surfactant complex and then Fractional precipitation with ethanol yielded a high molecular weight NM-A capsular polysaccharide. This high molecular weight The sugar was further purified by ultrafiltration. This polysaccharide is buffered with 100 mM sodium acetate. Solution (pH 5.0) at 70 ° C to partially hydrolyze Low molecular weight polysaccharides in the Luton range were obtained. Bring the free reducing terminal residue of this polysaccharide to a cool place NaBH_FourTo preserve the O-acetyl substituent and then add sodium periodate Oxidation with chromium produced terminal aldehyde groups. Size exclusion chroma Purified and fractionated by chromatography to have an average molecular weight of about 13,000 daltons Activated Group A meningococcal polysaccharide (GAMP) was obtained.12.2 Preparation of GAMP-TT conjugate   Tetanus toxoid (Sealam State Institute, Denmark) ) Is first sized using a Superdex G-200 column (Pharmacia). Purified to its monomeric form (molecular weight 150,000) by exclusion chromatography did. Lyophilized tetanus toxoid monomer (1 part by weight) and oxidized GAMP ( (2.5 parts by weight) was dissolved in a 0.2 M phosphate buffer (pH 7.5). Recrystallized NaB H_ThreeCN (1 part) was added and the reaction mixture was incubated at 37 ° C. for 4 days. S -Perdex G-200 column (Pharmacia) and 0.01% thimeroser Exclusion chromatography using PBS containing eluent as eluent The conjugate was purified from the free components. Purified GAMP-tetanus toxoi The conjugate was stored in the buffer at 4 ° C. Phosphorus analysis (Chen assay) Based on The resulting conjugate had a polysaccharide content of about 18-20% by weight.Embodiment 13 FIG. Preparation of GCMP-TT conjugate 13.1 Preparation of NMC polysaccharide for conjugation   Growth of Capsular Polysaccharide of Neisseria meningitidis Group C (NMC) Strain C11 Isolated from medium. This strain was grown on a modified Franz medium. NMC polysaccharide (G Loop C meningococcal polysaccharide (GCMP)), cetavlone described for GAMP Isolated from the medium by precipitation. O-deacetylation of natural GCMP with a base, N aIO_FourOxidative cleavage at 10,000 to 20,000 average molecular weight Depolymerized. Size of the cleaved polysaccharide by gel filtration chromatography Purified with an average molecular weight of about 12,000 daltons and aldehyde groups at both ends A highly purified product was obtained.13.2 Preparation of GCMP-TT conjugate   0.2% tetanus toxoid monomer (1 part) and solid oxidized GCMP (1 part) M phosphate buffer (pH 7.5) and recrystallized NaBH_ThreeWith CN (1 copy) Incubated at 37 ° C. for 4 days. PBS containing 0.01% thimerosal Size exclusion chromatograph on Superdex G-200 using eluent as eluent The conjugate was purified from the free components by fee. Purified conjugate Gates were stored at 4 ° C. before being prepared for animal testing. Polysaccharide in conjugate Svennerholm resorcinol assay (Biochim. Biophys. Acta 244: 604-611 (1957)). About 33% based on the sialic acid content.Embodiment 14 FIG. N-propionylated group B meningococcal polysaccharide-rPorB conjugate Preparation of gate 14.1 Preparation of Neisseria rPorB   Large intestine of class 3 Neisseria meningitidisporin protein (PorB) Expression in bacteria and purification of the porin gene product are described above. Recombination Purification of PorB protein was performed using 100 mM Tris-HCl, 200 nM NaC. 1, 10 mM EDTA, 0.05% Zwittergen 3,14 (Calbiochem , La Jolla, California), equilibrated with 0.02% sodium azide (pH 8.0) Sephacryl S-300 molecular sieve column was used. OD_{28 0} The protein fraction eluted at the apparent molecular weight of the trimer as determined by Pool, 0.25M HEPES, 0.25M NaCl, 0.05% Zwitter Genfil 3,14, pH 8.5 to 10-12 mg / ml Torration.14.2 Preparation of N-propionylated Group B meningococcal polysaccharide (GBMP)   The preparation of N-propionylated GBMP and its oxidized form is described in US Pat. 27,136 and EPO 0504202 (both are incorporated by reference in their entirety. In the present specification).14.3 Preparation of N-Pr-GBMP-rPorB conjugate   0.25 M was added to oxidized N-Pr-GBMP (10 mg) having an average molecular weight of 12,000. HEPES) 0.25% M NaCl, 0.05% Zwittergen 3,14, pH Added to 12 mg / ml rPorB protein (33 μl) in 8.5. this The solution is mixed until all solid components are dissolved and recrystallized NaBH_ThreeAdded CN . This solution was incubated at 37 ° C. for 4 days, and PBS-0.01% thimeroser was used. Using a Superdex G-200 column (Pharmacia) equilibrated with The conjugate was purified from the mixture. Combined protein fractions and stored at 4 ° C . The conjugate was assayed for its sialic acid content by resorcinol assay. The proteins were analyzed by the Squamacy Plus assay. Conjugation obtained Has a polysaccharide content of about 20-25% and is tested by LAL and rabbit pyrogenicity tests. Does not contain any heat sources as measured.Embodiment 15 FIG. Conjugate analysis by capillary electrophoresis. 15.1 System and method   Dimensions are 47cm full length (40cm effective length) and 50pm inner diameter (375μm outer diameter) Untreated fused silica capillary and 0.4N borate buffer as electrolyte solution ( pH 10.2) (Hewlett-Packard, Palo Alto, CA) Using Beckman 2000 Series CE System (Beckman Instrument N Capillary zone electrophoresis (Capillar) y Zone Electrophoresis). System control and data acquisition Was performed using Beckman Gold system software. Voltage to 25KV The detector was set to a detection wavelength of 200 nm. Capillary temperature 20 Set to ° C. Conditions during each capillary experiment were adjusted to 0.1 M sodium hydroxide. High pressure rinse for 2.0 minutes with water and then with deionized water for 2.0 minutes. All trials The material was pressure injected. All buffers and sample media should be stored at approximately 2.0 pm membrane Filtered through a filter and degassed before use.15.2 Conjugate analysis   After purification, the conjugate was converted to an Amin concentrator-3 concentrator (A (Micon, Beverly, Mass.). Meninges Calibration samples of bacterium polysaccharide and tetanus toxoid monomer were prepared in deionized water, respectively. Prepared at concentrations of 0.25 mg / ml and 0.28 mg / ml. This method is Electrophoresis of sugar and protein spiked glycoprotein conjugates As shown in the pherograms (FIGS. 20 and 21), the glycoprotein and And conjugate components, adjacent components are completely separated (R s> 1.5). FIG. 20 shows the addition of GAMP and TT-monomer conjugate components GAMP-TT conjugates are shown, while FIG. 21 shows GCMP and TT -Shows a GCMP-TT conjugate with a monomer conjugate component added. The lower limit of detection of free form polysaccharide and protein components (LLD ) Was determined to be at the sub-nanogram level. About each component in free form A lower limit of quantitation (LLQ) of 0.5 ng was obtained. To the total selected mass of each component A linear response was obtained. 0.2 for each of polysaccharide and protein. Linear for selected total mass in the range of 6-2.6 ng and 0.6-2.4 ng Response was obtained, and the measured coefficient of both curves was 0.99. This CZE-based Using the assay, analysis of the meningococcal polysaccharide-tetanus toxoid conjugate is approximately It showed a free polysaccharide content of less than 5% and a free protein content of less than about 2%.Embodiment 16 FIG. Immunological and immunoassays 16.1 Trivalent conjugate vaccine formulation   Each individual conjugate component (A, B, C) was added at 1 / ml of trivalent vaccine. mg of aluminum hydroxide (Al (OH)_Three) Alhydrogel (Superfoss, Denmark). Dosage of each conjugate polysaccharide Three different vaccines were prepared. The formulation contains 0.2 ml of PBS. 01% chime About 2 μg of each A) B) and C conjugated polysaccharide per dose of Rossal Or about 2 μg of the A-conjugated polysaccharide, about 5 μg of the B-conjugated polysaccharide, And about 2 μg of the C-conjugated polysaccharide; or about 5 μg of each A, B, and It contained any of the C-conjugated polysaccharides.16.2 Immunity   4-6 week old female Balb / c mice (Charles River Laboratories) Was injected intraperitoneally on days 0, 28 and 42. Day 0, Day 14, 2 Blood was collected on days 8 and 42, and mice were finally bled on day 52. Serum was stored at -70 <0> C prior to serological analysis.16.3 Immunoassay ELISA :   Antibody titers against each of A polysaccharide, N-propionylated B polysaccharide and C polysaccharide By ELISA using the corresponding HSA conjugate as the coating antigen (FIGS. 22, 23 and 24). The antibody titer was calculated as absorbance vs. absorbance x diluted The x-axis intercept of the linear regression curve of the multiplication factor was defined.Bactericidal assay :   Baby rabbit serum and Group B meningococci as complement sources in this assay , Group C meningococci, and Group C meningococci organisms Using A. meningitidis strain H44 / 76 (serotype 15), C11 and A1 A bactericidal assay was performed (FIGS. 25, 26, and 27). The bactericidal titer is 5 survivors It was defined as the serum dilution factor that reduced by 0%.                                   Table 1           Group B meningococcal conjugate vaccine (N-Pr GBMP-           (Protein) ELISA and bactericidal titers ¹ST = Stearyl tyrosine^Two CFA = Freund's Complete Adjuvant                 Table 2. Efficacy of transformation of yeast (Pichia) cells    Table 3. Expression of MB3 porin protein by recombinant Pichia pastorisTable 3 (continued)    Table 4. Expression of MB3 by recombinant clones with different expression cassettes.          Key features of the best clones          Table 5. Codon usage of Pichia pastoris and MB3

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 19/00 C07K 19/00 C12N 1/15 C12N 1/15 15/09 ZNA C12P 21/02 C C12P 21 / 02 C12N 15/00 ZNAA (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE, SN, TD, TG), AP (KE, LS, MW, SD, SZ, UG), EA (AM , AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, C , CU, CZ, DE, DK, EE, ES, FI, GB, GE, HU, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, TJ, TM, TR, TT, UA, UG, UG , VN (72) Donets, Mikhail United States 20878 N. Potomac, Maryland, Owens Glen Terrace 15514 (72) Inventor One, Mindah United States 92129 San Diego, California Spalen Avenue 13248 (72) Inventor Lian, Shumei United States 20817 River Road 6627 (72) Bethesda, Maryland Inventor Porbino-Bodner, Mary Ellen United States of America Rolling Dale Road, Naples, Maryland 21401, No. 621 (72) Inventor Minetti, Consequence, A.S.A. USA 20906 Silver Spring, Maryland, Isbel Street 3904, No. 72 (72) Inventor , Francis United States 20723 Country Meadows Lane No. 9735 in Laurel, Maryland

Claims (1)

[Claims] 1. (A) in a plasmid having a selectable marker, (i) a mature porin protein, (ii) a fusion protein that is a mature porin protein fused to a yeast secretory signal peptide, and a gene encoding a protein selected from the group consisting of: Ligating, wherein said gene is operably linked to a yeast promoter, (b) transforming said plasmid containing said gene into a yeast strain, and (c) allowing selection of transformed yeast. (D) growing the transformed yeast, and then (e) inducing expression of the protein to obtain a yeast containing the protein. Wherein the protein thus expressed accounts for about 2% or more of the total protein expressed in the yeast, How the expression in yeast of Neisseria meningitidis group B porin protein or fusion protein thereof. 2. 2. The method of claim 1, wherein the protein thus expressed comprises about 3-5% of the total protein expressed in the yeast. 3. The method of claim 1, wherein the mature porin protein is Neisseria meningitidis mature outer membrane class 3 protein from serogroup B. 4. 2. The method according to claim 1, wherein said yeast promoter is an AOX1 promoter. 5. The method according to claim 1, wherein the yeast secretory signal peptide is selected from the group consisting of a secretory signal of a Saccharomyces cerevisiae α-mating factor prepropeptide and a secretory signal of an acid phosphatase gene of Pichia pastoris. 6. 2. The method according to claim 1, wherein said plasmid is selected from the group consisting of pHIL-D2, pHIL-S1, pPIC9 and pPIC9K. 7. The method of claim 1, wherein the gene comprises a nucleotide sequence employing codons that optimize codon usage in yeast. 8. 8. The method of claim 7, wherein said codon that optimizes yeast codon usage is in the 5 'region of said gene. 9. The 5 ′ region of the gene has a nucleotide sequence: The method of claim 8, wherein 10. 9. The method according to claim 8, wherein said yeast is Pichia pastoris. 11. 2. The method of claim 1, wherein said yeast secretes said protein or fusion protein into a growth medium. 12. The method according to claim 11, wherein the plasmid is selected from the group consisting of pHIL-S1, pPIC9 and pPIC9K. 13. A method for purifying outer membrane meningococcus group B porin protein or a fusion protein thereof obtained according to the method according to claim 1, wherein (a) dissolving the yeast obtained in step (d) and dissolving the protein. Or releasing the fusion protein as an insoluble membrane-bound fraction; (b) washing the insoluble membrane-bound fraction obtained in step (a) with a buffer to remove contaminating yeast cell proteins; (c) (D) suspending and dissolving the insoluble membrane-bound fraction obtained in step (b) in an aqueous solution of a denaturant, (d) diluting the solution obtained in step (c) with a surfactant, and then (e). A) a method comprising purifying the protein or fusion protein by gel filtration chromatography and ion exchange chromatography; 14． 12. A method for purifying outer membrane meningococcus group B porin protein or a fusion protein thereof obtained according to the method of claim 11, comprising: (a) centrifuging the yeast culture in which the protein has been expressed; Is isolated as a soluble secretory substance. (B) From the soluble secretory substance obtained in step (a), contaminating yeast culture impurities are removed by precipitating with about 20% ethanol. (C) precipitating the secreted substance from the soluble fraction of step (b) with about 80% ethanol, and (d) removing the precipitated substance obtained in step (c). Washing with a buffer to remove contaminating yeast secreted proteins; (e) suspending and dissolving the precipitated substance obtained in step (d) in an aqueous solution of a surfactant; A How wherein the purified by-exchange chromatography 15. (B) a yeast host cell containing a gene encoding a protein selected from the group consisting of a fusion protein, which is a mature porin protein fused to a yeast secretory signal peptide; 16. 16. The yeast host cell according to claim 15, wherein said yeast comprises more than one copy of said gene. 17． 16. The yeast host cell of claim 15, wherein the mature porin protein is a Neisseria meningitidis mature outer membrane class 3 protein from serotype B. 18. 18. The yeast host cell according to claim 17, wherein said plasmid is selected from the group consisting of pHIL-D2, pHIL-S1, pPIC9, pPIC9K and pAO815. 19. The yeast host cell according to claim 15, wherein the yeast is Pichia pastoris. 20. The 5 'region of the gene encoding the protein has a nucleotide sequence: 16. The yeast host cell of claim 15, which is encoded by: 21. Nucleotide sequence encoding outer meningococcal group B porin protein, wherein at least one codon has been altered to optimize yeast codon usage. 22. The porin protein is a mature outer membrane class 3 protein from serotype B and the codon change is (GTT → GTC at positions 4-6 of the native sequence), (ACC → ACT at positions 7-9 of the native sequence) , (CTG → TTG at positions 10-12 of the native sequence), (GGC → GGT at positions 16-18 of the native sequence), (ACC → ACT at positions 19-21 of the native sequence), (position 22 of the native sequence -24 at ATC → ATT), (AAA → AAG at positions 25-27 of the native sequence), (GCC → GCT at positions 28-30 of the native sequence), (GGC → GGT at positions 31-33 of the native sequence), A group of changes consisting of (GTA → GTT at positions 34-36 of the native sequence), (GAA → GAG at positions 37-39 of the native sequence) It has been chosen al, where said position is counted from the first nucleotide of the native nucleotide sequence encoding the protein, the nucleotide sequence of claim 21. 23. A vaccine comprising a Group A meningococcal polysaccharide (GAMP) antigen, a Group B meningococcal polysaccharide (GBMP) antigen, and a Group C meningococcal polysaccharide (GCMP) antigen together with a pharmaceutically acceptable carrier. 24. 24. The group A meningococcal polysaccharide (GAMP) antigen, the group B meningococcal polysaccharide (GBMP) antigen, and the group C meningococcal polysaccharide (GCMP) antigen are each bound to a protein carrier. The vaccine according to claim 1. 25. The vaccine according to claim 24, wherein the protein carrier to which the GBMP antigen is bound is Class 3 Neisseria meningitidisporin protein (PorB). 26. The vaccine according to claim 24, wherein the protein carrier to which the GAMP antigen and the GCMP antigen are bound is tetanus toxoid. 27. 26. The vaccine of claim 25, wherein the GBMP antigen is N-propionylated before binding to PorB. 28. 25. The vaccine of claim 24, wherein the vaccine comprises about 2 [mu] g of the GAMP polysaccharide antigen conjugate, the GCMP polysaccharide antigen conjugate, and the GBMP polysaccharide antigen conjugate. 29. 25. The vaccine of claim 24, wherein the vaccine comprises about 5 [mu] g of the GAMP polysaccharide antigen conjugate, the GCMP polysaccharide antigen conjugate, and the GBMP polysaccharide antigen conjugate. 30. 25. The vaccine of claim 24, wherein the vaccine comprises about 2 μg of the GAMP polysaccharide antigen conjugate and the G CMP polysaccharide antigen conjugate, and about 5 μg of the GBMP polysaccharide antigen conjugate. 31. Vaccine comprising a Group A meningococcal polysaccharide (GAMP) antigen, a Group B meningococcal polysaccharide (GBMP) antigen, and a Group C meningococcal polysaccharide (GCMP) antigen together with a pharmacologically acceptable carrier. A method of eliciting an immune response in a mammal, comprising administering to the mammal an amount sufficient to elicit an immune response in the animal. 32. 32. The group A meningococcal polysaccharide (GAMP) antigen, group B meningococcal polysaccharide (GBMP) antigen, and group C meningococcal polysaccharide (GCMP) antigen are each conjugated to a protein carrier. The method described in. 33. 32. The method of claim 31, wherein said mammal is a human.