CA2244989A1 - Expression of group b neisseria meningitidis outer membrane (mb3) protein from yeast and vaccines - Google Patents

Abstract

The present invention relates, in general, to a method for obtaining the outer membrane protein meningococcal group B porin proteins, in particular MB3, and fusion proteins thereof. In particular, the present invention relates to a method of expressing the outer membrane protein meningococcal group B porin proteins in yeast. The invention also relates to a method of high level expression of the above-mentioned proteins wherein the rate of protein expression is enhanced by substituting a nucleotide sequence for the 5' region of the gene encoding said protein wherein the sequence has been optimized for yeast codon usage. The invention also relates to a vaccine comprising group A
meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP) and group C meningococcal polysaccharide (GCMP) antigens, together with a pharmaceutically acceptable carrier. The invention also relates to a method of inducing an immune response in a mammal, comprising administering the above-mentioned vaccine to a mammal in an amount sufficient to induce an immune response.

Description

CA 02244989 l998-07-3l W O 97/28273 PCTrUS97/01687 Expression of Group B Neisseria meningitidis Outer Membrane (MB3) Protein from Yeast and Vacci~es Background of the Invenfion F-ield of the Invention The present invention is in the field of recombinant genetics, protein expression, and vaccines. The present invention relates to a method of ~X~ SSillg in a recombinant yeast host an outer membrane group B porin protein from Neisseria meningitidis. The invention also relates to a vaccine comprising groupA meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP) and group C meningococcal polysaccharide (GCMP) antigens, together with a ph~rmR~elltically acceptable carrier. The invention also relates to a method of inducing an immune response in a m~mmsll, comprising z~lmini~tering the above-mentioned vaccine to a m~mm~l in an amount sufficient to induce an immune response.

l~ackground Information Meningococcal meningitis remains a worldwide problem, and occurs in both endemic and epidemic forms (Peltola, H., Rev. Infect. Dis. 5:71-91 (1983);
'~ Gotschlich, E.C., "Meningococcal Meningitis," in Bacterial Vaccines, Germanier, E., ed., Academic, New York (1984), pp.237-255). Epidemic disease occurs in W O 97/28273 PCTrUS97/01687 all parts of the world and incidences as high as 500 per 100,000 population havebeen reported. Without antibiotic treatment the mortality is extremely high (85%), and even with antibiotics, it remains at approximately 10%. In addition, patients cured by antibiotic therapy can still suffer serious and permanent S neurologic deficiencies. These facts together with the emergence of sulfadiazine-resistant strains of Neisseria n~eningitidis promoted the rapid development of acommercial vaccine (Peltola, H., Rel~. In~ect. Dis. 5:71-91 (1983)).
Neisseria meningitidis is a gram-negative organism that has been classified serologically into groups A, B, 29e, W135~ X, Y. and Z (Gotschlicll, E.C., "Meningococcal Meningitis~" in Bacteri~JI Vaccines~ Germanier, E., ed.~
Academic, New York (1984), pp.237-255). Additional groups H~ 1, and K were isolated in China (Ding, S.-Q. et al., J. J~ol. Stand. 9:307-31 S (1981)) and group L was isolated in Canada (Ashton, F.E. et al., J. Clin. Microbiol. 17:722-727 (1983)). The grouping system is based on the organisms' capsular polysaccharides. It was established (Lui, T.-Y. et al., J. Biol. Che)?~. 2il6:2849-2858 (1971)) that the group A polysaccharide is a partially O-acetylated (1-6) linked homopolymer of 2-acetamido-2-detoxy-D-mannopyranosyl phospllate~ and that both groups B and C polysaccharides are llomopolymers of sialic acid.
N. meningitidis groups A, B, and C are responsible for approximately 90% of cases of meningococcal meningitis. Success in the prevention of group A and C meningococcal meningitis was achieved using a bivalent polysaccharide vaccine (Gotschlich, E.C. et al., J. Exp. Med. 129:1367-1384 (1969); Artenstein~M.S. et al., N. Engl. J. Med. 282:417-420 (1970)); this vaccine became a commercial product and has been used successfully in the last decade in the prevention and arrest of major meningitis epidemics in man~ parts of the world.
~owever, there has been a need to augment this vaccine because a significant proportion of cases of meningococcal meningitis are due to groups other than A
and C. Group B is of particular epidemiologic importance~ but groups Y and W135 are also significant (Cadoz, M. et cll, Vc~cci)1e 3:340-342 (1985)). Tlle Yinclusion of the group B polysaccharide in the vaccine has been a special problem W O 97128273 PCTnUS97J~fi87 (see below); however, a tetravalent vaccine comprising groups A, C, W135, and Y has proven to be safe and immunogenic in humans (Cadoz, M. et al., Vaccine 3:340-342 (1985)) and is the currently used meningococcal meningitis vaccine (Jennings, H.J., "Capsular Polysaccharides as Vaccine Candidates," in Currenl Topics in Microbiol. and Immunol., Jann, D. and Jann, B., eds, Springer-Verlag, Berlin (1990) Vol 150:97-127).
The outer membranes of Neisseria species much like other Gram negative bacteria are semi-perrneable membranes whicll allow free flow access and escape of small molecular weight substances to and from the periplasmic space of these bacteria but retard molecules of larger size (Heasley, F.A., et al., "Reconstitution and characterization of the N. gon-~rrl70eae outer membrane permeability barrier,"
in Genetics and Immunobiolo~y of Nei.sseria gonorrhoeae, Danielsson and Norrnark, eds., University of Umea, Umea, pp. l 2- 15 (1980); Douglas, J.T., et al., li'EMSMicrobiol. Let~. 12:305-309 ~1981)). One ofthe mechanisms whereby this is accomplished is the inclusion within these membranes of proteins which have been collectively named porins. These proteins are made up of three identical polypeptide chains (Jones, R.B., et ul.~ Infec~. In7mun~ 3f):773-780 (1980);
McDade, Jr. and Johnston, .J. Bacteriol. 1~ 1183-1191 (1980)) and in their native trimer conforrnation, form water filled voltage-dependent channels withinthe outer membrane of the bacteria or other membranes to which they have been introduced (Lynch, E.C., e~ al., Biophys. J. ~1:62 (1983); Lynch, E.C., et al., Biophys. J. ~5:104-107 (1984); Young, J.D.E., et al., Proc. Natl. Acad. ~Sci. USA
80:3831-3835(1983);Mauro,A.,etal.,Proc.Natl.Acad.Sci. ~JSA~5:1071-1075 (1988); Young, J.D., et al., Proc. Nall. Acad. Sci. USA 83:150-154 (1986)).
Because of the relative abundance of these proteins withill the outer membrane, these protein antigens have also been used to subgroup both Neisseria gonorrhoeae and Neisseria meningi/idi.s into several serotypes for epidemiological purposes (Frasch, C.E., e~ al., Rél~. In,fecl. Di.s. 7:504-510 (1985);
~' Knapp, J.S., et al., "Overview of epidemiological and clinical applications of auxotype/serovar classification of Nei.s.seria gonorrhoeae." Tl1e Pa/l70genic W O 97/28273 PCT~US97/01687 Neisseriae, Schoolnil;, G.K., ed., American Society for Microbiology, Washington, pp. 6-12 (1985)). To date, many of these proteins from both gonococci and meningococci have been purified (Heckels7 J.E., .J. Gen.
Microbiol. 99:333-341 (1977);JarnesandHeckels,J. Immu-701. Meth. ~2:223-228 (1981); Judd, R.C.,Anal. Biochem. 173:307-316 (1988); Blake and Gotschlich, Infect. Immun. 36:277-283 (1982); Wetzler, L.M., et al., J. Exp. Mecl. 168:1883-1897 (1988)), and cloned and sequenced (Gotschlich, E.C., et al., Proc. Natl.
Acad. Sci. USA 84:8135-8139 (1987); McGuinness, B., et al., .J. Exp. Me~.
171:1871-1882 (1990); Carbonetti and Sparling, Proc. Natl. Acad. ~Sci. USA
84:9084-9088 (1987); Feavers, I.M., e~ al., Infect. Immun. 60:3620-3629 (1992);
Murakami, K., et al., Infect. /mmun. 57:2318-2323 (1989); Wolff and Stern.
FEMSMicrobiol. Jett. 83:179-186 (1991); Ward, M..l., et al., FEMSMicrobiol.
Lett. 73:283-289(1992)).
The porin proteins were initially co-isolated with lipopolysaccharides (LPS). Consequently, the porin proteins have been terrned "endotoxin-associated proteins" (Bjornsonetal., Infect. lmmuf? 56:1602-1607 (1988)). Studies on the wild type porins have reported that full assembly and oligomerization are not achieved unless LPS from the corresponding bacterial strain is present in the protein environrnent (Holzenburg et al., Biochemi.~f ~y 28:4187-4193 (1989); SenandNikaido,J. Biol. Chem. 266.11295-11300(1991)).
The meningococcal porins have been subdivided into three major classifications which in antedated nomenc}ature were known as Class 1, 2, and 3 (Frasch, C.E., e~ al., Rev. Infect. Dis. 7:504-510 (1985)). Each meningococcusexamined has contained one of the alleles for either a Class 2 porin gene or a Class 3 porin gene but not both (Feavers, I.M., c~t al., Infect. Imm~n. 60:3620-3629 (1992)), Murakami, K., et al., Infect. Immun. 57:2318-2323 (1989)). The presence or absence of the Class 1 gene appears to be optional Likewise, all probed gonococci contain only one porin gene with similarities to either the Class 2 or Class 3 allele (Gotschlich, E.C.. et al., Proc. Natl. Acad. Sci. U~SA 84:8135-8139 (1987); Carbonetti and Sparling~ Pl oc. Natl. Acad. Sci. USA ~:9084-9088 W O 97J28273 PCTnUS97/01687 (1987)). N. gonorrhoeae appear to completely lack the Class I allele. The data from the genes that have been thus far sequenced would suggest that all neisserial porin proteins have at least 70% homology with each other with some variations on a basic theme (Feavers, I.M., et al., Infecl. Imn7ul1. 6V:3620-3629 (1992)). It has been suggested that much of the variation seen between these neisserial porin proteins is due to the immunological pressures brought about by the invasion of these pathogenic org.qni~m~ into their natural host, man. However, very little is known about how the changes in the porin protein sequence effect the functional activity of these proteins.
It has been previously reported that isolated gonococcal porins of the Class 2 allelic type behave electrophysically somewhat differently than isolatedgonococcal porins of the Class 3 type in lipid bilayer studies both in regards to their ion selectivity and voltage-dependence (Lynch. E.C., e~ al., Biophys. .J.
41:62 (1983); Lynch, E.C., ef al., Biophys. J. ~}~:104-107 (1984)). Furthermore,the ability of the different porins to enter these lipid bilayers from intact living bacteria seems to correlate not only with the porin type but also with the neisserial species from which they were donated (Lynch, E.C.. e~ al., Biophys. J.
~5:104-107 (1984)). It would seem that at least some of these functional attributes could be related to different areas within the protein sequence of the porin. One such functional area, previously identifled within all gonococcal Class 2-like proteins, is the site of chymotrypsin cleavage. Upon chymotrypsin digestion, this class of porins lack the ability to respond to a voltage potential and close. Gonococcal Class 3-like porins as well as meningococcal porins lack this se~uence and are thus not subject to chymotrypsin cleavage but nonetheless respond by closing to an applied voltage potential (Greco, F.. "The formation of channels in lipid bilayers by gonococcal major outer membrane protein~" Ihesis~
The Rockefeller University, Ne~A~ York (1981); Greco, ~ a1., F~ >roc.
39:1813 (1980)).
y As the Neisseria porins are among the most abundant proteins present in the outer membrane of these org~ni~m~ and as they do not undergo antigenic W O 97/28273 PCTrUS97/01687 shift during infection (unlike several other major surface antigens), their universal prescnce in both Neisseria meningiti~is and Neisseria gonorrhoea, as well as their exposure at the surface, make them candidates for components of vaccines against these orp~ni~m~. Patients convalescing from meningococcal disease produce anti-porin antibodies, and antibodies elicited by immunization with porin proteins are bactericidal to homologous serotypes. Furthermore, within a particular epidemiologic setting, most strains causing meningococcal disease belong to a limited number of serotypes, notably serotype ~ among strains witl a class 2 protein and serotype 15 among strains with class 3 proteins. Therefore, I0 class 2 and 3 proteins are attractive candidates for vaccines.
The major impediment for such studies has been tlle ability to easily manipu}ate the porin genes by modern molecular techniques and obtain sufficient purified protein to carry out the biophysical characterizations of these alteredporin proteins. It was early recognized that cloned neisseria} porin genes. whenexpressed in Escherichia coli, were lethal to the host E. coli (Carbonetti and Sparling, Proc. Natl. Acad. Sci. USA ~ 9084-9088 (1987); Carbonetti, N.H., et al., Proc. Natl. Acad. Sci. USA 85:6841-6845 (1988); Barlow, A.K., et al., I7?fect. Immu7?. 55:2734-2740 (1987)). Thus, many of these genes were cloned andsequenced as pieces of the whole gene or placed into low copy number plasmids under tight expression control (~arbonetti, N.I-I., et al., Proc Na~l. Acad. ~Sci.
USA 85:6841 -6845 (1988)). Under these conditions, even when the entire porin gene was expressed~ very little protein accumulated that could be further purified and processed for characterization.
Another tack to this problem which has met with a modicum of success has been to clone the porin genes into a low copy, tightly controlled expressionplasmid, introduce modifications to ~he porin gene, and then reintroduce the modified sequence back into Neisseria (Carbonetti. N.H., et al.~ Proc. Natl. Acad.
Sci. USA 85:6841-6845 ~1988)). However, this llas also been fraugl1t with problems due to the elaborate restriction endonuclease system present in i CA 02244989 l998-07-3l W O 97/28273 PCTnUS97)01687 Neisseria, especially gonococci (Davies, J.K., Clin. Microbiol. Rel~. 2:S78-S82 (1 989)).
While a vaccine comprising neisserial porin has long been sought, an effective meningococcal polysaccharide vaccine which would give complete coverage to all serogroup org~ni~m~ and to all humans is also needed. Several serious problems remain in the development of such a broad range polysaccharide vaccine. First, it has been established that although the group A and C
polysaccharides are efficacious in adults and older childrer1, their effectiveness in infants has only been marginal (Goldschneider, I., et al., J. Infect. Dis.
128:769-776 (1973); Gotschlich, E.C., et ~(1., "Tl1e Immune Responses to Bacterial Polysaccharides in Man," In: Anlihodie* in Human Diclgnosis and Therapy, Haber, E. and Krause, R.M., eds.~ Raven, New York (1977), pp. 391-402). Second, the group B meningococcal polysaccharide is only poorly immunogenic in man (Wyle, F.A., et al" J. Infect. Dis. 126:514-521 (1972)). A
third problem is the tendency for multivalent vaccines to be less immuno~enic than each component would be if administered individually (Insel, R.A., "Potential alterations in immunogenicity by combining or simultaneously ~lrnini~tering vaccine components," In: Annals of the New York Academy of Sciences, Yol. 754. Combined Vaccines and SimzlltaneotLs A(lministration:
2~ Current Issues and Perspectives, Williams. J.C., et al.~ eds, New York Academy of Sciences, New York (1993), pp. 35-47; Clemens, J., et al.~ "Interactions between PRP-T vaccine against Haemol7hilus in,fluenzae type b and conventional infant vaccines: lessons for future studies of simultaneous immunization and combined vaccines," In: Annals of t~?e Nel~ York Accrdem,y of Science.s, ,T~ol. 75~.
Com~ined Vaccines and Simultaneot(s A~ministration: Culren~ Issues and Perspecti~es, Williams, J.C., et al.. eds, New York Academy of Sciences, New York (1993), pp. 255-266; Paradiso, P.R., e~ al., Pediatrics 92(6):827-832 (1 993)).
y Presently available vaccines against group A and C N. meningitidis are poorly immunogenic in human infants (age two and under) because, in contrast W O 97/28273 PCT~US97/01687 to the immunity generated by most antigens, a polysaccharide-specific immune response in infants is T-cell-independent. In the absence of T-cell involvement,an immune response is of short duratiom More importantly7 no memory is demonstrable, so no "booster" reactions occur. Furthermore, antibody afrmity S maturation does not occur. These deficiencies are due to the inability ofpolysaccharides to specifically bind to T-cells. Presumably, the structural features required for association with a T-cell receptor do not exist in the majority of polysaccharides. Because of the T-cell independent nature of the immune response, the antibody response to a polysaccharide in infants is limited to antibodies of the IgM isotype; the isotype switching necessary for production ofnon-IgM antibodies requires T-cell involvement. Polysaccharide antigens prescnt less of a problem in more mature humans (over age two), as tlley are able to induce antibodies of the IgG isotype as well as IgM (Yount e~ al., J. Exp. Med.
127:633-646 (1968)).
The group B meningococcal polysaccllaride is even less immunogenic in humans of all ages than other polysaccharides. Two major explanatiolls have been proposed to account for this characteristic (Jennings, H.J., A~ . Car~ohydr.
Chem. Biochem. 41:15~-208 (1983); Lifely, M.R. etal, Vaccine 5~ 26 (1987)).
One is that the group B meningococcal polysaccharide~ an o~-(2~8)-linked sialic acid homopolyrner, is rapidly depolymerized in lluman tissue because of the action of neurarninidase. The other is that the structure is recognized as "self ' by the human immune system and in consequence, the production of antibody speci~lc for this structure is suppressed. The weight of evidence is in favor of the latter explanation because a neuraminidase-sensitive variant of the group C
meningococcal polysaccharide [an o~-(2~9)-linked sialic acid homopolymer] still proved to be highly immunogenic in man (Glode, M.P. e~ al., .J. Infect. Di.s.
139:52-59 (1979)). In addition it was demonstrated tllat con~ugation of the group B polysaccharide to a protein carrier (tetanus toxoid) througll its terminal nonrcducing sialic acid, which stabilizes the polysaccharide to neuraminidase, did not result in any significant enhancement in its immwlogenicity (Jennings~ I I.J.

W 097/28273 PCT~US97/01687 and Lugowski, C., J. Immunol. 127:1011-1018 (1981)~. The above observations are consistent with a theory that the immune mechanism avoids the production of antibody having a specificity for the a-(2~8)-linked sialic acid residues. This theory was further confirrned by the identification of oc-(2~8)-lillked sialic acid residues in the oligosaccharides of human and animal tissue. A novel approach to overcoming the poor immunogenicity of the group B polysaccharide has been to modify it chemically.
The T-cell independent quality of polysaccharide antigens in infant humans can be overcome by conjugating (covalently coupling) the polysaccharide to a protein carrier. The capsular polysaccharides of the bacteria primaril~
responsible for postneonatal meningitis have been conjugated to protein carriers;
these include type b H. influenzae (Schneerson, R. et al., .~. Exp. Med. 152:361-376 (1980); Anderson, P.W., Infect. Immun. 39:233-238 (1983); Marburg, S. et al., J. Am. Chem. Soc. 108:5282-5287 (1986)), group A (Jennings, H.J. and Lugowski, C., J. Immunol. 127:1011-1018 (1981)); Beuvery, E.C. etal., Yaccine 1 :31 -36 (1983)), B (Jennings, H.J. and Lugowski, C., J. Imn2unol. 127: 1011- 1018 (1981)), and C (Jennings, H.J. and Lugowski, C., J. Immun~l. 127:1011-1018 (1981)); Beuvery, E.C. et al., Infecl. /mmwn. 40:39-45 (1983)) N. meningitidis~
and type 6A Strep. pneumoniae (Chu, C. et al., Infec~. In7m2m. ~0:24s-2s6 (1983)). ~or the choice of carrier protein most investigators have used tctanus toxoid or diphtheria toxoid, two proteins currently used as infant vaccines. A
recent innovation on this theme has been the use of a mutant-derived diphtheria toxin (Cl~M ,97) (Anderson, P.W., Infect. Immun. 39:233-238 (1983)) which is nontoxic. The significance of this protein is that because it does not require detoxifying by treatment with forrnaldehyde, all its amino groups remain underivatized, which greatly facilitates the conjugation process.
The use of other potential bacterial proteins as carriers has not been extensively explored. However, a serotype outer member protein of A~
meningitidis has been used as a protein carrier (Marburg, S. et al., J. Am. Chem.
Soc. 108:5282-5287 ~ 1986)).

CA 02244989 l998-07-3l W O 97/28273 PCTrUS97/01687 In light of the foregoing~ it will be clear that there is a significant need fora process by which large quantities of the outer membrane group B porin proteinsof N. meningitidis can be obtained. It will also be clear that a need exists for a polysaccharide vaccine which would give complete coverage to the three major serogroups of N. meningitidis, groups A, B and C, and which would provide immunity against these or~ni~m~ to both infants and more mature humans.

Summ~ry of t/le Invention It is a general object of the invention to provide a method of expressing in yeast the meningococcal group B porin proteins, in particular, the class 3 porin 1 0 protein.
It is a specific object of the invention to provide a method of expressing the outer membrane meningococcal group B porin protein or a fusion protein thereof in yeast, comprising:
(a) cloning into a plasmid having a selectable marker a gene coding for a protein selected from the group consisting of:
(i) a mature porin protein (ii) a fusion protein which is a mature porin protein fused to a yeast secretion signal peptide;
wherein said gene is operably linked to a yeast promoter;
(b) transforming said plasmid cont~ining said gene into a yeast strain;
(c) selecting the transformed yeast by growing said yeast in a culture medium allowing selection of said transformed yeast;
(d) growing the transformed yeast, and (e) inducing expression of said protein to gi~e yeast containing said protein;
wherein the protein so expressed comprises more than about 2% of the total protein expressed in said yeast.

3 P(:~TJUS971D2687 It is another specific object of the invention to provide a method of expressing a mature porin protein or fusion protein thereof, wherein the proteinso expressed comprises about 3-5% of the total protein expressed in yeast.
It is yet another specific object of the invention to provide a method of S expressing a mature porin protein wherein the protein is the Nei.s.seri~
meningitidis outer membrane meningococcal group B porin protein (MB3).
It is another specific object of the invention to provide a method of expressing a mature porin protein or fusion protein thereof, wherein the yeast promoter is the AOX1 promoter.
It is another specific object of the invention to provide a method of expressing the outer membrane meningococcal group B porin protein or a fusion protein thereof in yeast, wherein the yeast secretion signal peptide is selectedfrom the group consisting of the secretion signal of the S. ce~el~i.siae o~-mating factor prepro-peptide and the secretion signal of the ~. pasloris acid phosphatase gene (PHO).
It is yet another specific object of the invention to provide a method of expressing MB3 or a fusion protein thereof in yeast as described above, wherein the plasmid is selected from the group consisting of pHIL-D2~ pHlL-S I, pPIC9 and pPIC9K.
It is a further specific object of the inventioll to provide a method of expressing the above-described meningococcal group B porin protein or fusion protein wherein at least one codon of the 5' region of the gene encoding said protein has been changed so as to be optimized for yeast codon usage.
It is still a further specific object of the invention to provide a method of expressing the above-described meningococcal group B porin protein or fusion protein wherein the 5' region of the gene encoding said protein comprises a nucleotide sequence that incorporates codons optimized for ~. p~l.sl~ri.s codon usage.
J It is another specific object of the invention to provide a metllod as described above wherein the codon changes are selected from the group of CA 02244989 l998-07-3l -12 - ~ ~ ~ ~ a changes c~n~i~ting of: (GTT to GTC at positions 4-6 of the native sequence), (ACC to ACT at positions 7-9 of the native sequence), (CTG to TTG at positions 10-12 of the native sequence), (GGC to GGT at positions 16-18 of the native sequence), (ACC to ACT at positions 19-21 of the native sequence), (ATC to ATT at positions 22-24 of the native sequence), (AAA to AAG at positions 25-27 of the native sequence), (GCC to GCT at positions 28-30 of the native sequence),(GGC to GGT at positions 31-33 of the native sequence), (GTA to GTT at positions 34-36 of the native sequence), (GAA to GAG at positions 37-39 of the native sequence); wherein said positions are numbered from the first nucleotide of the native nucleotide sequence encoding said protein.
It is another specific object of the invention to provide a method as described above wherein the 5' region of the gene includes codons o~ ~i~d for P. pastoris codon usage, and wherein the nucleotide sequence is SEQ ID NO: 11.
It is another specific object of the invention to provide a method of ~ e~ g the above-m~nti- n~(l protein ~L~,re.. l the yeast secretes the protein or fusion protein.
It is another specific object of the invention to provide a method of expressing the above-mentioned protein wherein the vector from which the secreted protein is ci2~l.,ssed is selected from the group con.~ tin~ of pHIL-Sl, pPIC9, and pPIC9K.
It is another specific object of the invention to provide a method of ~ul;ry~, insoluble, intracellular outer membrane mçninpococcal group B porin protein or fusion protein thereofobtained according to the invention co..,p. ;~i..g (a) lysing the yeast described above which has expressed the protein to release said protein as an insoluble membrane bound fraction;
(b) washing the insoluble material obtained in step (a) with buffers to remove cont~min~ting yeast cellular proteins;
(c) suspending and dissolving said insoluble fraction obtained in step (b) in aqueous solution of denaturant, AMEN~ED

WO 97/28273 PCT~US97)01687 (d) diluting the solution obtained in step ~c) with a detergent;
and (e) purifying said protein by gel filtration and ion excllange chromatography.
S It is another specific object of the invention to provide a method of purifying the outer membrane meningococcal group B porin protein or fusion protein thereof obtained according to the invention comprising:
(a) centrifuging the yeast culture described above which has expressed the protein to isolate the protein as soluble secreted material;
(b) removing cont~min~tin~ yeast culture impurities from the soluble secreted material obtained in step (a) by precipitating said impurities with about 20% ethanol, wherein the soluble secreted material remains in the soluble fraction;
(c) precipitating the secreted material from the soluble fraction of step (b) with about 80% ethanol;
(d) washing the precipitated material obtained in step (c) with a buffer to remove cont~min~ting yeast secreted proteins;
(e) suspending and dissolving the precipitated material 2Q obtained in step (d) in an aqueous solution of detergent; and (f) purifying the protein by ion exchange chromatography.
It is a further specific object of the invention to provide a yeast host cell that contains a gene coding for a protein selected from the group consisting of (a) a mature porin protein 2~ (b) a fusion protein which is a mature porin protein fused to a yeast secretion signal peptide;
wherein said gene is operably linked to a yeast promoter.
It is still another specific object of the invention to provide a yeast host J cell as described above which is capable of expressing the ATeis.se~ ?~eningitidi.s mature outer membrane class 3 protein of serogroup B (MB3).

W O 97/28273 PCTrUS97/01687 It is still another specific object of the invention to provide a yeast host cell as described above wherein the yeast promoter is the AOXI promoter.
It is another object of the invention to provide a vaccine comprising group A meningococcal polysaccharide (GAMP), group B meningococcal poly-S saccharide (GBMP), and group C meningococcal polysaccharide (GCMP) antigens, together with a pharmaceutically accept~ble carrier.
It is still another specif~c object of the invention to provide a method of inducing an immune response in a mammal, comprising ~-lmini~tering to a m~mm~l the above-described vaccine in an amount sufficient to induce an immune response in a m~mm~l.
Further ob~ects and advantages of the present invention will be clear from the description that follows.

Brief Descripfion of t/le Drnwin~s Figurc 1: A diagram showing the sequencing strategy of the Po~ B gene.
Thc PCR product described in Example 1 (Materials and Methods section) was ligated into the BamHI-XhoI site of the expression plasmid pFT- I 7b. The initial double stranded primer extension sequencing was accomplished usin~
oligonucleotide sequences directl~ upstream of the Ban7T-II site and just downstream of the ~7?oI site within the pET-17b plasmid. Additional sequence data was obtained by making numerous deletions in the 3 ' end of the gene, usingexonuclease III/mung bean nuclease reactions. After religation and transformation back into ~. coli, several clones were selected on size of insert and subsequently sequenced. This sequencing was always fron1 the 3 ' end of the geneusing an oligonucleotide primer just downstream ofthe Bpul 1021 site.
Figure 2: A gel electrophoresis showing the products of the PCR reaction (electrophoresed in a 1% agarose using TAE buffer).
Figures 3A and 3B. Fig. 3A: SI:)S-PAGE analysis of whole cell Iysates of E. coli hosting the control pET-l 7b plasmid without inserts and an E. coli CA 02244989 1998-07-31 P~T/~S 9 7 / O 1 6 8 7 clone harboring pET-17b plasmid cont~inin~ an insert from the obtained PCR
product described in the m~teri~l~ and methods section. Both cultures were grown to an O.D. of 0.6 at 600 nm, IPTG added, and incubated at 37~C for 2 hrs.
1.5 mls of each of the cultures were removed, centrifuged, and the bact~-ri~l pellet S solubilized in 100 1ll of SDS-PAGE pf~d~ion buffer. Lane A shows the protein profile obtained with 10 ,ul, from the control sample and Lanes B (5 ,ul) and C (10 1ll) demonstrate the protein profile of the E. coli host expressing the PorB protein. Fig. 3B: Western blot analysis of whole cell lysates of E. coli harboring the control pET-l 7b plasmid without insert after 2 hrs induction with0 IPTG, Lane A, 20 1ll and a corresponding E. coli clone cont~inin~ a porB-pET-17b plasmid, Lane B, 5 ,ul; Lane C, 10 111; and Lane D, 20 111. The monoclonal antibody 4D11 was used as the primary antibody and the western blot developed as described. The pre-stained low molecular weight standards from BRL were used in each c~e.
Figure 4: The nucleotide sequence (SEQ ID NO:l) and the tr~n~l~t~d amino acid sequence (SEQ ID NO:2) of the mature PorB gene cloned into the expression plasmid pET-17b. The two nucleotides which differ from the previously published serotype 15 PorB are underlined.
Figure 5: A graph showing the Sephacryl S-300 column elution profile of both the wild type Cl~s 3 protein isolated from the meningococcal strain 8765and the recombinant Cl~s 3 protein produced by BL21(DE3) -I~ompA E. coli strain hosting the r3pET-17b plasmid ~ monitored by absorption at 280nm and SDS-PAGE analysis. The void volume of the column is indicated by the arrow.
Fractions col-t~ the meningococcal porin and recombinant porin ~
determined by SDS-PAGE are noted by the bar.
Figure 6: A graph showing the results of the inhibition ELISA ~says showing the ability of the homologous wild type (wt) PorB to compete for reactive antibodies in six human immune sera. The arithn~letic mean inhibition is shown by the bold line.

CA 02244989 1998-07-31 ~ ~ ~ S 9 7 / O 1 6 8~

-16- ,~

Figure 7: A graph showing the results of the inhibition ELISA assays showing the ability of the purified recombinant PorB protein to compete for reactive antibodies in six human immune sera. The arithmetic mean inhibition is shown by the bold line.
~ S Figure 8: A graph showing a c~mp~neon of these two mean inhibitions obtained with the wt and recombinant PorB protein.
Figure 9A and 9B: The nucleotide sequence (SEQ ID NO:3) and the tr~n.~l~te~1 amino acid sequence (SEQ ID NO:4) of the mature class II porin genecloned into the ~A~ic.,:iion plasmid pET-17b.
Figure lOA and lOB: The nucleotide sequence (SEQ ID NO:5) and the ..el-,1le~1 amino acid sequence (SEQ ID NO:6) of the fusion class II porin gene cloned into the t;~re~;on plasmid pET- 1 7b.
Figure 11 (panels A and B): Panel A depicts the restriction map of the pET-17b plasmid. Panel B depicts the nucleotide sequence (SEQ ID NO:7) between the BglII and ~oI sites of pET-17b. The sequence provided by the plasmid is in normal print while the sequence inserted from the PCR product are identified in bold print. The amino acids (SEQ ID NO:8) which are derived from the plasmid are in normal print while the amino acids (SEQ ID NO:8) from the insert are in bold. The arrows demarcate where the sequence begins to match the sequence in Figure 4 and when it ends.
Figure 12: A graph showing the level of- A~l~~ion of MB3 for clone pnv 322, where the ~A~>l~ion vector used is pE~L D2. The level of MB3 e~lessed is d~: ,t~l as mg of insoluble MB3 per gram of cell pellet per unit time.
Figure 13A: The DNA sequence (SEQ ID NO:9) and tr~n~l~ted amino acid 5~ u~,l~e, (SEQ ID NO:10) of pNV15 (MB3 in pET24a) before codon e~ellce o~ ion.
Figure 13B: The DNA sequence (SEQ ID NO:l 1) and tr~n~l~ted amino acid sequence (SEQ ID NO: 12) of Men.Class3 opt. (MB3 o~linli;~c;d for yeast codon preference).
Figures 14A and 14B: Graphs showing the elution of MB3 from a size exclusion column. MB3 expressed in an intracellular form was purified by a denaturation/renaturation protocol, followed by gel filtration and ion exchange clL,~ tography. The res~lt~nt purified protein exhibited by size exclusion ~ L~ ~r CA 02244989 1998-07-31 ~ ~ / ~
~ ? .IA~a ~

. . .

chromatography an elution profile which resembles the recombinant class 3 protein o~ ;A~fessed in E. coli, and both give the same elution profile as the native wild-type cou,lh l~u l. This in~lic~tes that MB3 refolds and oligomerizes, achieving full native confc-rm~tion. 14(A): the elution profile of MB3; 14(B): the elution profile of class 3 protein expressed and refolded from E. coli inclusionbodies.
Figure 15: A graph showing the size exclusion ch~ ography of purified MB3 on a Superose 12 (Pharmacia) column connected to an HPLC (Hewlett Packard model 1090). Based on the comp~ri~Qn of MB3 witlh the native wild-~ '.0 type co~ , ~ well ~ calibration using molecular weight standards (~le~ign~ted as arrows), the elution profile is indicative of trim~nc assembly.
~olec~ r weight ~ i are: 1 = thyroglobulin (670,000); 2 = g~mm~globulin (158,000); 3 = myoglobin (17,000).
Figures 16A, 16B and 16C: The DNA sequence of clone pnv 322 (SEQ
ID NO:13). This clone h~ the MB3 gene inserted into the EcoRI site of the Invitrogen ~ s~ionvectorpHlL-D2. MB3 is thus inserted directly downstream from the AO~promoter. This construct allows intracellular expression. Vector sequences are shown in upper case letters, while the MB3 sequence is given in lower case letters.
Figures 17A, 17B and 17C: The DNA sequence of clone pnv 318 (SEQ
ID NO: 14). This clone has the MB3 gene inserted into the XhoI-BamHI sites of the Invitrogen c;~lcssion vector pHIL-Sl. MB3 is thus inserted directly do~ll~ from the PHOI leader peptide, in frame with the secretion signal open reading frame for secretion of c:xl~les~ed protein. Vector sequences are shown in upper case letters, while the MB3 sequence is given in lower case letters.
~ Figures 18A, 18B and 18C: The DNA sequence of clone pnv 342 (SEQ
ID NO: 15). This clone has the MB3 gene inserted into the EcoRI-AvrII sites of the Invitrogen ex~ression vector pPIC-9. MB3 is thus inserted directly downstream from the secretion signal of a-factor prepro peptide, for secretion of ~x~,~;ssed protein.

AM~

CA 02244989 1998-07-31 ~ 9 7 / Q 1 6 Y~7 Vector sequences are shown in upper case letters, while the MB3 sequence is given in lower case letters.
Figures l9A, 1 9B and l9C: The DNA sequence of clone pnv 350 (SEQ
. . _ ID NO: 16). This clone has the MB3 gene inserted into the EcoRI-AvrII sites of 5the Invitrogen ~x~iession vector pPIC-9K MB3 is thus inserted directly downstream from the secretion signal of ~x-factor prepro peptide, for secretion of expressed protein. Vector sequences are shown in upper case letters, while the MB3 sequence is given in lower case letters.
Figure 20: A graph showing the absolb~lce spectra (electropherogram) 10of GAMP, TT-monomer, and GAMP-TT conjugate.
Figure 21: A graph showing the absorbance spectra (electropherogram) of GCMP, rr-monomer, and GCMP-IT conjugate.
Figure 22: A graph showing the A-specific IgG ELISA titer elicited by monovalent (A) and trivalent (A/B/C) meningococcal conjugate vaccines in mice.
15Figure 23: A graph showing the B-specific IgG ELISA titer elicited by monovalent (A) and trivalent (AJB/C) meningococcal colljl,gaLe vaccines in mice.Figure 24: A graph showing the C-specific IgG ELISA titer elicited by monovalent (C) and trivalent (A/B/C) meningococcal conjugate vaccines in mice.
Figure 25: A graph showing the A-specific bacteriocidal activity elicited by monovalent (A) and trivalent (A/B/C) meningococcal conjugate vaccines in mice.
Figure 26: A graph showing the B-specific bacteriocidal activity elicited by ~ v~lent (A) and trivalent (A/B/C) meningococcal conjugate vaccines in mice.
25Figure 27: A graph showing the C-specific bacteriocidal activity elicited by monovalent (A) and trivalent (A/B/C) meningococcal conjugate vaccines in mice.
..~

CA 02244989 l998-07-3l W O 97/~8273 P~TrUS97)~16~7 Detailed Descripfion of flle Invention It is possible to overcome some of the difficulties involved in expressing and purifying the outer membrane group I3 porin proteins of N. meningi~idi.s from E. coli. The DNA sequences of the mature porin proteins, e.g. class 2 and class 3 as well as fusions thereof, were amplified USillg the chromosome of the meningococcal bacteria as a template for the PCR reaction. The amplified porin sequences were ligated and cloned into an expression vector containing the T7 promoter. E. coli strain BL2 1 Iysogenic for the DE3 lambda pha~e (Studier and Moffatt, J. Mol. Biol. 189:1 13-130 ( 1986)), modified to eliminate the ompA gene~
was selected as one expression host for the pET- I 7b plasmid containing the porin gene. Upon induction, large amounts of the meningococcal porin proteins accumulated within E. coli without any obvious lethal effects to the host bacterium. The expressed meningococcal porin proteins were extracted and processed through standard procedures and finally purified by molecular sieve chromatography and ion exchange chromatography. As judged by the protein pro~1le from the molecular sieve chromatography, the recombinant meningococcal porins eluted from the column as trimers. To be certain that no PCR artifacts had been introduced into the meningococcal porin ~enes to allow for such high expression, the inserted PorB gene se~uence was determined.
Inhibition ELISA assays were used to give further evidence that the expressed recombinant porin proteins had renatured into their natural antigenic and trimerconformation.
As an alternative to the bacterial E. coli host system. Meningococcal B
Class 3 porin protein (MB3) may be expressed in yeast. A preferred host is the methylotrophic yeast Pichia pastoris. which may be transformed with the Pichia Expression Kit developed by Invitrogen. Yeasts are attractive hosts for the production of heterologous proteins. Unli ke prokaryotic systems~ their eukaryotic subcellular org~ni7~tion enables them to carry O~lt many of the post-translational folding, proc~s.sing and modification events required to produce "authentic" andbioactive proteins. As a eukaryote, Pichia pastoris has many of the advantages of a higher eukaryotic expression system, while being as easy to manipulate as E. coli or Saccharomyces cerevisiae. As a yeast, it shares the advantages of molecular and genetic manipulations with Sacchanomyces, and it has the added advantages of 10- to 100-fold higher heterologous protein expression levels and the protein processing characteristics of higher eukaryotes.
Expression in Pichia also provides advantages compared to expression in other yeast strains because Pichia does not tend to hyperglycosylate proteins asdoes S. cerevisiae. Further, proteins expressed and modified in I'ichia may be more useful therapeutically than those produced by S. cerevi.~iae, as oligosaccharides added by Pichia lack the o~l,3 glycan linkages which are believed to be primarily responsible for the hyper-antigenic nature of proteins produced by S. cerevisiae. Several vaccine antigens have been produced in yeast cells, including hepatitis B surface antigen which is in clinical use (Cregg et al., Bio/~echnology 11 :905-910 (1993)).
Unlike thc porin proteins of E. coli and a few other gram negative bacteria, relatively little is known about how changes in the primary sequence of porins from Neisseria effect their ion selectivity. voltage dependence, and other biophysical funclions. F~ecently, the crystalline structure of two E. coli porins, Omp~ and PhoE, were solved to 2.4~ and 3.0A, respectively (Cowan. S.W., et al., Nature 358:727-733 (1992)). Both of these E. coli porins have becn intensively studied owing to their unusual stability and ease with which molecular genetic manipulations could be accomplished. The data obtained for the genetics of these two porins correlated well with the crystalline structure. Although it has been shown in several studies using monoclonal antibodies to select neisserial porins that the surface topology of Neisse~ ia closely resembles that of these two E. coli porins (van der Ley, P., et al., Infect. In?mun. 5g:2963-2971 (1991)), almost no information is available about how changes in amino acid sequences l.in specific areas of the neisserial porins effect their biophysical characteristics, W ~ 97128273 P~TnU~97101687 as is known about the E. coli porins (Cowan, S.W., et al., Nature 358;727-733 (1992)).
Two of the major prob}ems impeding this research are: (1) the inability to easily manipulate Neisseria genetically by modern molecular techniques and (2) the inability to express sufficient quantities of neisserial porins in E. coli or yeast for further purification to obtain biophysical and biochemical characterization data. In fact, most of the DNA sequence data on gonococcal and meningococcal porins have been obtained by cloning overlapping pieces of the porin gene and then reconstructing the information to reveal the entire gene sequence (Gotschlich, E.C., et al., Proc. Na~ cad. Sci. USA 8~?:8135-8139 (1987); Murakami, K., etal., In,fect, Immun. 57:2318-2323 (1989)). Carbonetti et al, were the ~Irst to clone an entire gonococcal porin gene into E. coli using a tightly controlled pT7-5 expression plasmid. The results of these studies showedthat when the porin gene was induced, very little porin protein accumulated and the expression of this protein was lethal to the ~. coli (Carbonetti and Sparling.
Proc. Natl. ~cad, Sci. US~ 8~:9084-9088 ~1987)). In additional studies, Carbonetti etal, (Proc, Natl, Acad, Sci. USA 8~:6841-6845 (1988)) did showthat alterations in the gonococcal porin gene could be made in this system in E. coliand then reintroduced into gonococci. However, the ease with which one can make these manipulations and obtain enough porin protein for further biochemical and biophysical characterization seems limited.
Feavers et al. have described a method to amplify, by PCR, neisserial porin genes from a wide variety of sources using two synthesized oligonucleotides to common domains at the 5' and 3' ends of the porin genes respectively (Feavers, I.M., e~ al., Infèct. ln?n1un. 6~:3620-3629 (1992)). The oligonucleotides were constructed such that the amplified DNA could be forced cloned into plasmids using the restriction endonucleases B~III and X~701.
Using the Feavers et al. PCR system, the DNA sequence of the mature PorB protein from meningococcal strain 8765 serotype 15 was amplified and ligated into the BamHI-X~7vI site ofthe T7 expression plasmid pET-17b. This W O 97t28273 PCTrUS97/01687 placed the mature PorB protein sequence in frame directly behind the T7 promoter and 20 amino acids of the ~ 10 protein including the leader sequence.
Upon addition of IPTC~ to a culture of E. coli containing this plasmid, large amounts of PorB protein accumulated within the bacteria. A complete explanation for why this construction was non-lethal to the E. coli and expressed large amount of the porin protein~ await further studies. However, one possible hypothesis is that by replacing the neisserial promoter and signal sequence withthat of the T7 and ~10 respectively~ the porin product was directed to the cytoplasm rather than toward the outer membrane. Henning and co-workers have reported that when E. coli OmpA protein and its fragments are expressed~ those products which are found in the cytoplasm are less toxic than those directed toward the periplasmic space (Klose, M., et al., J. Biol. Chem. 263: 13291 -13296 (19~8), Klose, M., et al., J. Biol. Chem. 263:13297-13302 (1988); Freudl, R., et al., J. Mol. Biol. 205:771-775 (1989)). Whatever the explanation, once the PorB protein was expressed, it was easily isolated, puri~led and appeared to reform into trimers much like the native porin. The results of Lhe inhibition ELISA data using human immune sera suggests that the PorB protein obtained in this fashion regains most if not all of the antigenic characteristics of the wild type PorB protein purified from meningococci. This expression system lends itself to the easy manipulation of the neisserial porin gene by modern Illoleculal techniques. In addition, this system allows one to obtain large quantities of pure porin protein for characterization. In addition, the present expression system allows the genes from numerous strains of Neisseria, both gonococci and meningococci, to be examined and characterized in a similar manner.
The Neisseria meningi~idis outer membrane class 3 protein from serogroup B (MB3) was also expressed in the methylotrophic yeast Pichia pastoris by placing the MB3 DNA fragmellt under the control of the strong 1'.
pastoris alcohol oxidase promoter AOXl . Upon induction on methanol, strains of P. pastoris transformed witl1 the recombinant plasmids produced either a native or a fusion MB3 proteim which were reactive Wit]l mouse polyclonal W O g7128273 PCTnUS97101687 antibodies raised against the wild type counterpart. In shaking flask cultures, engineered P. pastoris yielded about 1-3 mg of expressed protein per gram of pelleted wet cells, or 100-600 mg per liter, which corresponded to 10-15% of theyeast cell suspension or about 3-5% of total cellular proteins (Table 4). Full-length I\~B3 DNA was cloned into each of four Pichia Expression Vectors developed by Invitrogen. To obtain the expression of monomeric, full size 34 kDa MB3 protein, the intracellular pHlL-D2 vector was used. A map of the pHII,-D2 vector may be found on p. 19 of the Invitrogen Instruction Manual for the Pichia Expression Kit, Version E, the contents of which is hereby incorporated by reference. This construct provided maximal expression levels (up to 3 mg of MB3 per gram of cells) (Tables 3 and 4 ). The expressed product was not secreted, being mainly (95%) insoluble, and it was tightly associated with cell membranes.
To further increase the possibility for the secretion of expressed MB3, three other vectors with different secretion signals were also used: the vector pHIL-S l, which carries a native Pichia pasforis signal sequence from the acid phosphatase gene, PHOI, and the vectors pPIC 9 and pPIC9K, which carry the secretion signal from the S. cerevisiae a-mating factor prepro-peptide. Maps of the pHIL-S 1 and pPIC9 vectors may be found on pp. 21-22 of the Invitrogen Instruction Manual for the Pichia Expression Ki~, Version E. It was found that the pHIL-Sl/MB3 construct provided the expression of a MB3- PHOl fusion polypeptide with an apparent molecular weight of 36.5 kDa. which was partly processed to generate mature 34 kDa MB3. About 5-10% of expressed MB3 was secreted to the yeast growth medium, and about 40-50% of the 36.5 kDa fusion polypeptide was cleaved (Table 4). Pichicl recombinants transformed by pPIC9/MB3 or pPICgK/MB3 constructs expressed only MB3 fused with ~-factor, yielding a fusion polypeptide of approximately 45 I~Da. There was no evidence of any cleavage or processing of that fusion protein.
Preliminary studies on the isolation and purification of recombinant MB3 (pHIL-D2/MB3 cont~ining transformants) suggest that whell expressed in ~.

W O 97/28273 rCT~US97/01687 pas~oris, MB3 may form trimers under native conditions, and that the native protein is resistant to trypsin digestion. These results are similar to those which have been observed for the wild-type counterpart.
An increase in the yield of expressed MB3 may be obtained by using S strains of richia which contain multiple copies of the MB3 expression cassette.
Strains harboring multiple copies exist naturally within transformed cell populations at <I û% frequency. These strains may be identified either by directly screening large numbers of transformants for levels of MB3 expression via SDS-PAGE or immunoblotting, or indirectly screening by "dot blot" hybridization to select for clones containing multiple copies of the MB3 gene (Cregg et al., Bio/Technology 11:905-910 (1993)~. Alternatively, such multiple integrated clones may be constructed by using a new pAO8 15 vector (Invitrogen), which allows cloning of multiple copies of the gene of interest via repeated cassette insertion steps (Ibid. at p. 907). Scale-up procedures using a fermenter will provide higher yeast cell densities and therefore improve the yields of the expressed proteins by at least 5-10 times. Optimization of protein expression ~i.e., growth media composition, buffering capacit~, casamino acids supplementation, increase of methanol concentration, etc.) may be carried out with routine experimentation.
Anoth~er way to identify Pichia transformants having multiple copies of MB3 takes advantage of the fact that the Pichia expression vector pPlC9K carriesthe kanamycin resistance gene which confers resistance to G418; in other respects, pPIC9I~ corresponds to pPlC9. Spontaneous generation of multiple insertion events can then be identified by the level of resistance to G4 18. ~'ichia transformants are selected on histidine-deficient medium and screened for their level of resistance to G418. An increased level of resistance to G418 indicates multiple copies of the kanamycin resistance gene.
Thus, the present invention relates to a method of expressing an outer membrane meningococcal group B porin protein, in particular, the class 2 and class 3 porin proteins.

W Og~2~273 PCTnUS97101687 In one embodiment, the present invention relates to a method of expressing the outer membrane meningococcal group B porin protein in E. coli comprising:
(a) transforming ~. coli by a vector comprisin~ a selectable marker S and a gene coding for a protein selected from the group consisting of:
~i) a mature porin protein, and (ii) a fusion protein comprising a mature porin protein fused to amino acids I to 20 or 22 of the T7 gene ~10 capsid protein;
wherein said gene is operably linked to the T7 promoter;
(b) growing the transformed E. coli in a culture media containing a selection agent, and (c) inducing e;~pl~S~iOn of said protein;
wherein the protein so produced comprises more than about 2% of the total protein expressed in the E. coli.
In a preferred embodiment, the meningococcal group B porin protein or fusion protein expressed comprises more than about 5% of the total proteins expressed in ~. coli. In another preferred embodiment, the mel1ingococcal group B porin protein or fusion protein expressed comprises more tl1an about 10% of the total proteins expressed in E. coli. In yet another preferred embodiment. the meningococcal group B porin protein or fusion protein expressed comprises more than about 30% of the total proteins expressed in E. coli.
Examples of plasmids which contain the T7 inducible promotor include the expression plasmids pET-I7b, pET-1 la, pET-24a-d(+) and pET-9a, all of which are commercially available from Novagen (565 Science Drive, Madison, WI 53711). These plasmids comprise. in sequence, a T7 promoter, optionally a lac operator, a ribosome binding sile, restriction sites to allow insertion of the structural gene and a T7 terminator sequence. See, the Novagen catalogue, pages 36-43 (1993).

W O 97/28273 PCTrUS97/01687 In a preferred embodiment. E. coli strain BL2 1 (DE3) ~nlpA is employed. The above mentioned plasmids may be transformed into this strain or thc wild-type strain BL21(DE3). E. coli strain BL21 (DE3) ~ompA is preferred as no OmpA protein is produced by this strain which might cont~min~te the purified porin protein and create undesirable immunogenic side effects.
The transformed E. coli are grown in a medium containing a selection agent, e.g. any 13-lactam to which E. coli is sensitive such as ampicillin. The pET
expression vectors provide selectable markers which confer antibiotic resistanceto the transformed organism.
High level expression of meningococcal group B porin protein can be toxic in E. coli. Surprisingly, the present invention allows E. coli to express the protein to a level of at least almost 30% and as high as ~50% of the total cellular proteins.
In another embodiment, the present invention relates to a method of expressing an outer membrane meningococcal group B porin protein in yeast comprislng:
(a) ligating into a plasmid having a selectable marker a gene coding for a protein selected from the group consisting of:
(i) a mature porin protein. and (ii) a fusion protein comprising a mature porin protein fused to a yeast secretion signal pcptide;
wherein said gene is operably }inked to a yeast promoter;
(b) transforming the plasmid containing the gene into a yeast strain;
(c) selecting the transforrned yeast by growing said yeast in a culture medium allowing selection of said transformed yeast;
(d~ growing the transformed yeast. and (e) inducing expression of said protein to give yeast containillg said protein.
Transformation of the yeast host may be accomplished by any one of several teclmiques that are well known by those of ordinary skill in the art. These CA 02i44989 1998-07-31 W O g7128273 PCTnUS97~0~687 techniques include direct or liposome-mediated transformation of yeast cells whose cell wall has been partially or completely destroyed to form spheroplasts,tre~tment of the host with alkali cations and PEG, and freeze-thawing combined with PEG treatment. (.See Weber et al., I\Tonconventional Yeas~s: Their Geneticsand Biotechnological Applications, CRC C it. ~ev. Biotechnol. 7: 281, 317 (1988) and the references cited therein, all of WhiCIl are hereby fully incorporated by reference.) In another preferred embodiment, the mature porin protein or fusion protein expressed comprises more than about 2% of the total protein expressed in the yeast host. In yet another preferred embodiment, the mature porin proteinor fusion protein expressed comprises about 3-5% of the total protein expressed in the yeast host.
In another preferred embodiment, the mature porin protein is tlle Neilsseria meningitidis mature outer membrane class 3 protein from serogroup B.
In another preferred embodiment, the present invention relates to perforrning the above method of expressing the outer membrane meningococcal group B porin protein or fusion protein in yeast, wherein said yeast is selectedfrom the group consisting of: Saccharomyces cerevisiae, Schizosaccharomyces pombe, Saccharomyces uvarum, Saccharomyce.~ carlsber-gen.sis, LSaccharon?yce.s 2~ diastaticu.s, Candidatropicalis, Can~lidamallosa, Candidaparapsilo.si.s, Pichia pastoris, Pichiafarinosa, Pichiapinus, Pichiavanrijii, l'ichiafermentans, Pichiaguilliermondii, Pichia stipitis, Saccharomyces telluris, Candida utilis, Candidaguilliermondii, Han.senula henricii, Hansenula capsulata, ~Iansenula polymorpha, Hansenula saturnus, Lypomyces kononenkoae, Klt~yveron?yces marxianus, Candida lipolyl ica, .Saccaromycopsi.s fihuligera, LSaccharomycodes ludwigii, Saccharomyces kluyveri, Tremella mesenlerica, Zygo.sacGharon?yce,s acidofacien.s, Zygosaccharomyces fermentati, Yarrowia lipolytica, and Zygosaccharomyces soja. Many of these yeast hosts are available from the American Type Culture Collection~ Rockville, Md.

CA 02244989 1998-07-31 P ~ 1~ S 9 7 1 U ~ 6 ~ I

In another ~efe~ d embodiment, the nucleotide sequence of the gene encoding the mature porin protein or fusion protein incorporates codons wich are optimized for yeast codon usage. In yet another plefc.l~d embodiment, the nucleotide sequence of the gene Pn~O(~in~ the mature porin protein which has S been o~ 1 for yeast codon usage is the nucleotide sequence SEQ ID NO: 11.
In another pl~rc.led embodiment, the yeast secretion signal peptide is selecte~l ~om the group concieting of the secretion signal of the S. cerevisiae a-~- mating factor prepro-peptide and the secretion signal of the P. pastoris acid phosph~t~ee gene.
In another pl~l;r~ ,~d Pmho~limPnt the yeast secretes the protein or fusion protein.
In another ~l~r~ d emb~limPnt the yeast promoter to which the gene is operably linked is selçcte~l from a group con.ci.etin~ of the AOXI promoter, the GAPDH promoter, the PHO5 promoter, the glycPr~ldPhyde-3-phosphate dehydrogenase CIDH3) promoter, the ADHI promoter, the MFocl promoter, and the GAL10 promoter. F.~mrles of plasmids which contain the AOXl promoter include the c ~Le~ion pl~.emi-ls p~L-D2, pHIL-S l, pPIC9, and pPIC9K. These pl~emicl.e comprise, in sequence, an AOXl promoter, restriction sites to allow insertion ofthe ~llu ~ l gene, an AOXl tr~nerription t~ ",i~ on fr~gm~o-nt an open reading frame enro-ling HIS4 (hi.etirlino1 dehydrogenase), an ampicillin resiet~nce gene, and a ColE1 origin. In ~ lition, p1~emi~1e pPIC9 and pPIC9K
c~ the cc-factor secretion signal of S. cerevisfae, and plas_id pHIL-Sl comrrieçs the PHOl secretion signal of P. pastorfs. pPIC9K also includes the ka,~yc.n~ e gene, which confere ~ e to G418 ~Pichia The level of G418 rÇciet~n~e in Pfchfa transformants can be used to identify cells which have undergone multiple insertion events. This occurs at a frequency of 1-10%.
~h increased level of ~ ...re to G418 in~lic~tçs the plese.~e of multiple copiesof the ~u~lly~iLl ~.ei~ nce gene and of the gene of interëst. See the Novagene catalogue, Version E, pp. 19-22 (1995).

al~NDED S~

CA 02244989 l998-07-3l W 0 97/28273 P~TnUS97J01687 In another preferred embodiment, yeast host strains having a mutation in a suitable marker gene which causes the strain to have specific nutritional requirements are employed. Expression plasmids carrying a functional copy o~
the mutated gene as well as a copy of the meningococcal group B porin protein or fusion protein are then transformed into the yeast host strain, and transformants are selected on the basis of their ability to grow on medium lacking the required nutrient. Examples of suitable marker genes, followed by their S. cere~isiae notation, include the genes encoding imidazole glycerol phosphate dehydrogenase (HIS3), beta-isopropylmalate dehydrogenase (LEU2), tryptophan synthase (TRP5), ar~ininosuccinate Iyase (ARG~ -(5'-phosphorilosyl) anthranilate isomerase (T~PI), histidinol dehydrogenase (HIS4), orotidine-5-phosphate decarboxylase (URA3), dihydroorotate dehydrogenase (~RAl), galactokinase (GALI), and alpha-aminodipate reductase (LY$2). After transformed yeast host cells are selected on the basis of their ability to grow in medium lacking the appropriate nutrient~ the cells are screened for integration of the meningococcal group B porin protein or fusion protein at the correct loci.
This screening is performed by methods well known to those of ordinary skill in the art, for example, by selecting for transformants which grow slowly on medium which lacks the nutrient used to confirm transformation and includes methanol in order to induce expression of the outer membrane meningococcal group B porin protein or fusion protein from the AC)Xl promoter. These transformants are then grown up in glycerol-containing medium, and expression of the meningococcal group B porin protein or fusion protein is then induced by the addition of methanol.
In a more preferred embodiment, P. past~ri~s host strains GS I l 5 or KM7 1 are employed. These strains have a mutation in the histidhlol dehydrogenase gene (his~) which prevents them from synthesizing histidine. The expression plasmids pHIL-D2, p~lL-S1, pPIC9, and pPlC9K carry the HIS~ gene which complements his4 in the host, allowing selection of transformants on histidine-deficient medium. Af~ter transformed ~. pastoris host cells are selected in W O 97/28273 PCTrUS97/01687 histidine-deficient medium, the cells are screened for inte~ration of the meningococcal group B porin protein or fusion protein at the correct loci by selecting for transfolmants which grow slowly on his-, methanol ~ plates. These transformants, which become mutated at the AOXl locus when the MB3 gene S inserts into the host genome, are only capable of slow growth on methanol, as thcy are metabolizing methanol with the less efficient AOX2 gene product. The transforrnants are then grown up in glycerol-containing medium, and expression of the meningococcal group B porin protein or fusion protein is then induced by the addition of methanol.
In a most preferred embodiment. the present invention relates to perfortning the above method of expressing the outer membrane meningococcal group B porin protein in yeast, wherein said yeast is Pichia pastori*.
In another preferred embodiment, the present invention relates to a vaccine for inducing an immune response in an animal comprising the outer nlembrane meningococcal group B porin protein or fusion protein thercof, produced according to the above-described methods, together with a pharmaceutically acceptable diluent, carrier, or excipient, wherein the vaccine may be ~1mini~tered in an amount effective to elicit an immune response in an animal to Neisseria meningitidi~. In a preferred embodiment, the animal is 2~ selected from the group consisting of humans. cattle, pigs, sheep, and chickens.
In another preferred embodiment, the animal is a h~lman.
In another preferred embodiment, the present invention relates to the above-described vaccine, wherein said outer nlembrane meningococcal group B
porin plotein or fusion protein thereof is conjugated to a meningococcal group Bcapsular polysaccharide (CP). Such capsular polysaccharides may be prepared as described in Ashton, F.E. et al., Micro1t)ial Pathog 6:455-458 (1989);
Jennings, H.J. et al., J. Inlntunol. 13~:2651 (1985); Jennings~ ~.J. et al., J.
Imnlunol. 137:1708-1713 (1986); Jennin~s~ II.J. et al., J. Immunol. 1~2:3585-3591 (1989); Jennings, H.J., "Capsular Polysaccharides as Vaccine C~andidates,"

W O g7128273 PCTnUS97101687 in C~rrent Topics in Microbi-~logy and Inlmunology, 150:105-107 (l990); the contents of each of which are fully incorporated by reference herein.
The invention also relates to a vaccine capable of simultaneously inducing an immune response against any one of several N. meningitidis serogroups. Thus, in another preferred embodiment, the invention relates to a trivalent vaccine comprising the capsular polysaccharides from each of three different serogroups of N. meningitidis. Specifically, the vaccine of the invention comprises group Ameningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP~, and group C meningococcal polysaccllaride (GCMP) antigens, together with a pharmaceutically acceptable carrier.
In a preferred embodiment, group A meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP), and group C
meningococcal polysaccharide (GCMP) antigens are each conjugated to a protein carrier, thus yielding GAMP, GCMP and GBMP polysaccharide antigen conjugates.
Of course, it will be understood by those of ordinary skill that a number of carrier proteins will be suitable to be used in the polysaccharide-protein conjugates included in the vaccine of the invention. A suitable carrier protein will be one which is safe for administratiol1 to m:~mm~ls, and which is immunologically effective as a carrier. Safety includes absence of primary toxicity and minim~l risk of allergic complications.
In general, any heterologous protein could serve as a carrier antigen. The protein may be, for example, native toxin or detoxified toxin (also termed toxoid).
In addition, genetically altered proteins which are antigenically similar to toxins and yet non-toxic may be produced by mutational techniques well-known to those of skill in the art. Such an altered toxin is termed a "cross reacting material," or CRM. CRM~97 is noteworthy, because it differs from native diphtheria toxin at only one amino acid residue, and is immunologically indistinguishable from the native toxin (Anderson, P.W., Infect. Imm~/n. 39:233-238 (1983)).

W O 97128273 PCTrUS97/01687 It will be understood by those of skill in the art that the polysaccharide-protein carrier conjugates of the vaccine may be produced by several different methods. The types of covalent bonds which couple a polysaccharide to a protein carrier, and the means of producing them, arc well known to those of skill in the art. Details concerning the chemical means by which the two moieties can be linkcd may be found in U.S. Patent No. 5,371,197, and 4,902,506, the contents of which are herein incorporated by refercnce in their entirety. One such methodis the reductive amination process described in Schwartz and Gray (Arch.
Biochim. Biop~?ys. 1~1:542-549 (1977)). This process involves reacting the reducing capsular polysaccharide fragment and bacterial toxhl or toxoid in the presence of cyanoborohydride ions, or another reducing agent. Such a process will not adverscly af~ect the toxin or toxoid or the capsular polysaccharide (U.S.
Patent No. 4,902,506). Such a conjugation process is also described in Examples 12-14, below.
While tetanus and diphtheria toxins are the prime candidates for carrier proteins, owing to their history of safety, thele may be overwhelming reasons, well known to those of ordinary skill in the arL to use another protein. For example, another protein may be more effective as a carrier, or production economics may be significant. Other candidates include toxins or toxoids of pseudomonas, staphylococcus, streptococcus, pertussis and entertoxigenic bacteria, including Escherichia coli. A preferred carrier protein to which the group B meningococcal polysaccharide may be conjugated is the class 3 porin protein (~orB) of group B N. ~neningitidis. A preferred protein carrier protein to which GAMP antigen and GCMP antigen may be conjugated is tetanus toxoid.
It is known in the art that the immunogenicity of GBMP is limited in humans, and especially in infant humans, and that direct covalent couplings of the group B polysaccharide to tetanus toxoid yielded a conjugate which failed to induce a significant polysaccharide-specific response in either rabbits (Jennings, H.J. and Lugowski, C., J. Imnzunol. 127:1011-1018 (1981)) or mice (Jennings, CA 02244989 l998-07-3l WO 97/23273 P~TnU~97J~1687 H.J. et al, J. Immunol. 137:1708-1713 (1986)). This failure prompted interest inthe direct chemical modification of the group B polysaccharide. This was done with the idea of creating synthetic epitopes capable of modulating tl1e immune response in such a way as to produce enhanced levels of cross-reactive B
polysaccharide-specific antibodies (J~nning~, ~.J. et al., J. Intmunol. 137:1708-1713 (1986)).
It will be understood by those of ordinary skill in the art that in selecting possible chemical modifications of the group B polysaccharide (Jennings, H.J. etal., J. Immunol. 137:1708-1713 (1986)), two factors should be considered. First,the chemical modification should be able to be accomplished with racility and with the minimum of degradation of the polysaccharide. Second, in order to produce cross-reactive B polysaccharide-specific antibodies, the antigenicity ofthe modified polysaccharide to B polysaccharide-specific antibodies should be preserved. It will be understood by those of skill in the art that the ideal chemical modification of group B polysaccharide will retain both the carboxylate and the N-carbonyl groups (Jennings, H.J. et al., J. In7munol 137:1708-1713 (1986)).
The most preferred modification which satisfies the above criteria is a modification wherein the N-acetyl groups of tl~e sialic acid residues of the B
polysaccharide are removed by strong base and replaced by N-propionyl groups 2(~ (see Examples ~ and 14).
In a more preferred embodiment, tl e N-propionylated GBMP is subsequently conjugated to a carrier protein. While any carrier protein which enhances the immunogenicity of N-propionylated GBMP may be used, a preferred protein carrier is the class 3 outer membrane protein of group B N.
meningitidis (MB3, or PorB~.
Thus, in still another preferred embodiment, GBMP antigen is conjugated to PorB after having been N-propionylated.
Preferably, the capsular polysaccharide (CP), which may be group A, B
or C meningococcal polysaccharide~ is isolated according to ~rasch, C.E., "Production and Control of ~leissericJ meningiticlis Vaccines" in Baclerial W O 97128273 PCT~US97/01687 Vaccines, Alan R. Liss, Inc., pages 123-145 (1990), the contents of which are fully incorporated by reference herein, as follows:
Grow org~ni~ms in modifled Franz medium 10 to 20 hrs Heat kill, 55 ~C, 10 min Remove inactivated cells by centrifugation Add Cetavlon to 0.1%
Precipitate CP from culture broth Add calcium chloride to 1 M
Dissolve CP then centrifuge to remove cellular debris 1 Add ethyl alcohol to 25%
Remove precipitated nucleic acids by centrifugation Add ethyl alcohol to 80%
Precipitate crude CP and remove alcohol The crude CP is then further purified by gel filtration chromatography after partial depolymerization with dilute acid, e.g. acetic acid, formic acid, and trifluoroacetic acid (0.01-0.5 N), to give a mixture of polysaccharides having an average molecular weight of 10,000-20,000. Where the CP is GBMP, purified GBMP is then N-deacetylated with NaOH in the presence of sodium borohydr;de and N-propionylated to afford N-Pr GBMP. Thus, the CP that may be employed in the conjugate vaccines of the present invention may be CP fragments, N-deacylated CP and fragments thereof, as well as N-Pr CP and fragments thereof, so long as they induce active immunity when employed as part of a CP-porin protein conjugate (see Examples 6 and 14).
In a further preferred embodiment, the present invention relates to a method of pl~paling a polysaccharide conjugate comprising: obtaining the above-described outer membrane meningococcal group B porin protein or fusion protein thereof; obtaining a CP from a Neisseria meningifidis organism, and conjugating the protein to the CP.

WC~ g7/28273 PCT~US97/~s687 The conjugates of the invention may be formed by reacting the reducing end groups of the CP to primary amino groups of the porin by reductive s~.min~tion. The reducing groups may be formed by selective hydrolysis or specific oxidative cleavage, or a combination of both. Preferably, the CP is S conjugated to the porin protein by the method of Jennings el al., U.S. Patent No.

4,356, l 70, the contents of which are fully incorporated by reference herein, which involves controlled oxidation of the CP with periodate followed by reductive amination with the porin protein.
The vaccine of the present invention comprises the meningococcal group B porin protein, fusion protein or conjugate vaccine, or the trivalent GAMP.
GBMP and GCMP vaccine, in an amount effective depending on the route of ~lmini.stration. Although subcutaneous or intramuscular routes of ~(lministration are preferred, the meningococcal group B porin protein, fusion protein or vaccine of the present invention can also be administered by an intraperitoneal or intravenous route. One slcilled in the art will appreciate that tlle amounts to be iq~mini~tered for any particular treatment protocol can be readily determined without undue experimentation. Suitable amounts might be expected to fall within the range of 2 micrograms of the protein per kg body weight to l00 micrograms per kg body weight.
Thus, in a preferred embodimenL the vaccine comprises about 2 ~lg of the GAMP, GCMP and GBMP polysaccharide antigen conjugates.
In another preferred embodiment, the vaccine comprises about S ~Lg of the GAMP, GCMP and GBMP polysaccharide antigen conjugates.
In yet another referred embod;ment? the vaccine comprises about 2 llg of the GAMP and GCMP polysaccharide antigen conjugates, and about S llg of the GBMP polysaccharide antigen conjugate.
The vaccine of the present invention may be employed in such forms as capsules, liquid solutions, suspensions or elixirs for oral ~ listration, or sterile liquid forms such as solutions or suspensions. Any inert carrier is preferably used, such as saline, phosphate-buffered saline~ or any such carrier in which the meningococcal group B porin protein, fusion protein or con~ugate vaccine have suitable solubility properties. The vaccines may be in the form of single dose preparations or in multi-dose flasks which can be used for mass vaccination programs. Reference is made to Remington's Pharmaceutical Scie7?ces, Mack S Publishing Co., ~aston, PA, Osol (ed.) ( 1980); and Ne~ Trends ar~d De-~elopme~?ts in Vaccines, Voller et al. (eds.), University Park Press, Baltimore, MD (1978), for methods of preparing and using vaccines.
The vaccines of the present invention may further comprise adjuvants which enhance production of porin-specific antibodies. Such adjuvants include, I0 but are not limited to, various oil formulations such as Freund's complete adjuvant (CFA), stearyl tyrosine (ST, see U.S. Patent No. 4,258,029), the dipeptide known as MDP, saponin, aluminum hydroxide, and Iymphatic cytokine.
Freund's adjuvant is an emulsion of mineral oil and water which is mixed with the immunogenic substance. Although ~reund's adjuvant is powerful, it is usually not sl~?mini~tered to humans. Tn~te~(l, the adjuvant alum (aluminum hydroxide) or ST may be used for zlf~mini.~tration to a human. The meningococcalgroup B porin protein or a conjugate vaccine thereof may be absorbed onto the aluminum hydroxide from which it is slowly released after injectioll. The meningococcal group B porin protein or group A, B and C meningococcal polysaccharide conjugate vaccine may also be encapsulated withill liposomes according to Fullerton, U.S. Patent No. 4,235,877.
In another preferred embodiment~ the present invention relates to a method of inducing an immune response in an animal comprising ~lmini.~tering to the animal the vaccine of the invention, produced according to methods described, in an amount effective to induce an immune response.
In a further embodiment, the invention relates to a method of purifying the above-described outer membrane meningococcal group B porin protein or fusion protein comprising: Iysing the transformed E. coli to release the meningococcal group B porin protein or fusion protein as part of insoluble f 30 inclusion bodies; washing the inclusion bodies with a buffer to remove WO g7/28273 PCTJUS97J01687 cont~min~fing E. coli cellular proteins; resuspending and dissolving the inclusion bodies in an aqueous solution of a denaturant; diluting the resultant solution in a detergent; and purifying the solubili~ed meningococcal group B porin protein by gel filtration.
The Iysing step may be carried out according to any method known to those of ordinary skill in the art, e.g. by sonication, enzyme digestion, osmotic shock, or by passing through a mull press.
The inclusion bodies may be washed with any buffer which is capable of solubilizing the ~. coli cellular proteins without solubilizing the inclusion bodies comprising the meningococcal group B porin protein. Such buffers include but are not limited to TEN buffer (50 mM Tris HCI, l mM EDTA, l O0 mM NaCI, pl I
8.0), Tricine, Bicine and HEPES.
Denaturants which may be used in the practice of the invention include 2 to 8 M urea or about 2 to 6 M guanidine HCI, more preferably, 4 to 8 M urea or about 4 to 6 M guanidine HCI~ and most preferably, about 8 M urea or about 6 M guanidine HCI.
Examples of detergents which can be used to dilute the solubilized meningococcal group B porin protein include, but are not limited to, ionic deter~ents such as SDS and cetavlon ~Calbiochem); non-ionic detergents such as Tween, Triton X, Brij 35 and octyl glucoside; and zwitterionic delergents such as 3,1 4-Zwittergent, empigen BB and Champs.
Finally, the solubilized outer membrane meningococcal group B porin protein may be purified by gel filtration to separate the high and low molecularweight materials. Types of filtration gels include but are not limited to Sephacryl-300, Sepharose CL-6B, and Bio-Gel A-l.Sm. The column is eluted with the buffer used to dilute the solubilized protein. The fractions containing the porin or fusion thereof may then be identified by gel electrophoresis, the fractions pooled, dialyzed, and concentrated.

WO 97/28273 PCT~US97/01687 Finally, substantially pure (>95%) porin protcin and fusion protein may be obtained by passing the concentrated fractions through a Q sepharose high performance column.
In another embodiment, the present invention relates to expression of the meningococcal group B porin protein gene which is part of a vector which comprises the T7 promoter, wllich is inducible. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent.
The T7 promoter is inducible by the addition of isopropyl ,i3-D-thiogalactopyranoside (IPTG) to the culture medium. Alternatively, the Tac promotor or heat shock promotor may be employed. Preferably, the meningococcal group B porin protein gene is expressed from the pET-17 expression vector or the pET- I ~ a expression vector, both of which contain the T7 promoter.
The cloning of the meningococcal group B porin protein gene or fusion gene into an expression vector may be carried out in accordance with conventional techniques, including blunt-ended or stagger-ellded termini for Iigation, restriction enzyme digestion to provide appropriate termini~ filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Reference is made to Sambrook et al., Molecular Cloning. A Laboratofy Mc~nuai, 2nd ed., Cold Spring Harbor, New Yorl;, Cold Spring Harbor Laboratory Press ( 1989), for gelleral methods of cloning.
The meningococcal group B porin protein and fusion protein expressed according to the present invention must be properly refolded in order to achievea structure which is immunologically characteristic of Ihe native protein. In yet another embodiment~ the present invention relates to a method of refolding the above-described outer membrane protein and fusion protein comprising: Iysing the transformed cells to release the meningococcal group B porin protein or fusion protein as part of insoluble inclusion bodies; washing the inclusion bodies with a buffer to remove contaminating cellular proteins: resuspendillg and W ~ g7/28273 PCTnUS97101687 dissolving the inclusion bodies in an aqueous solution of a denaturant; dilutingthe resultant solution in a detergent; and purifying the solubilized meningococcal group 33 porin protein or fusion protein by gel filtration to give tlle refoldedprotein in the eluant. Surprisingly, it has been discovered that the folded trimeric S menin~ococcal group B class 2 and class 3 porin proteins and fusion proteins are obtained directly in the eluant from the gel filtration column.
In another preferred embodiment, the present invention relates to a substantially pure refolded outer membrane meningococcal group B porin protein and fusion protein produced according to the above-described methods. A
substantially pure protein is a protein that is generally lacking in other cellular Neisseria meningitidis components as evidenced by, for example, electrophoresis.Such substantially pure proteins have a purity of >95%, as measured by densitometry on an electrophoretic gel after staining with Coomassie blue or silver stains.
The ~ollowing examples are illustrative, but not limiting, of the method and compositions of the present invention. Other suitable modifications and adaptations of the variety of conditions and parameters normally encountered in this art which are obvious to those skilled in the art are within the spirit and scope of the present invention.

Examples Example 1. Cloning of the Class 3 Porin Protein from Croup K
Neisseria meningitidis Materials and Metlro~ls Organisnrs: The Group B Neisseria nleningitidis strain 8765 (B: l S :P 1,3) was obtained from Dr. Wendell Zollinger (Walter Reed Army Institute for Research) and grown on agar media previously described (S~anson, J.L., Infect.

WO 97/28273 PCT~US97/01687 Imm~ . 21:292-302 (1978)) in a candle extinction jar in an incubator m:~int~inedat 30~C. Escherichic( coli strains DME558 (from the collection of S. Benson;
Silhavy, T.J. et al., "Experiments with Gene Fusions~" Cold Spring ~arbor Laboratory, Cold Spring ~Iarbor, N.Y.,1984). BRE51 (Bremer, E. el c~l., FEMS
Microbiol. Lett. 33:173-178 ~1986)) and BL21(DE3) were grown on LB agar plates at 37~C.
Pl Tr~nsduc~ion: A Pl),jr Iysate of ~. coli strain DME558 was used to transduce a tetracycline resistance marker to strain BRE51 (Bremer~ E., et al., FEMS Microbiol. Lett. 33: 173-178 (1986)) in which the entire ompA gene had been deleted (Silhavy, T.J., et al., ~xperin?ent.s with Gene Fzlsions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984)). Strain DME558, cont~ining the tetracycline resistance marker in close proximity of the on?pA
gene, was grown in LB medium until it reached a density of approximately 0.6 OD at 600 nm. One tenth of a milliliter of 0.5 M CaCl~ was added to the 10 ml culture and 0.1 ml of a solution contz~ining I X 109 PFU of P1 ~/r The culture was incubated for 3 hours at 37~C. After this time, the bacterial cell density was visibly reduced. 0.5 ml of chloroform was added and the phage culture stored at 4~C. Becausc typically 1-2% ofthe E. coli chromosome can be packaged in each phage, the number of phage generated covers the entire bacterial host 21) chromosome, including the tetracycline resistance marker close to the ompA
gene.
Next, strain BRE51, which lacks the ompA gene, was grown in LB
medium overnight at 37~C. The overnight culture was diluted 1 :50 into fresh LB
and grown for 2 hr. The cells were removed ~y centrifugation and resuspended in MC salts. 0.1 ml of the bacterial cells were mixed with 0.05 of the phage lysate described above and incubated for 20 min. at room tempera~ure.
Thereafter, an equal volume of I M sodium citrate was added and the bacterial cells were plated out onto LB plates containing 12.5 ~g/ml of tetracycline. The plates were incubated overnight at 37~C. Tetracycline resistant (12 ,ug/ml) tran.~dllc.t~nts were screened for lack of OmpA protein expression by SDS-PAGE

CA 02244989 1998-07-31 p ~ ~ S 9 7 / O 1 6 8 i U~JS --U~ ~F

and Western Blot analysis, as described below. The bacteria resistant to the antibiotic have the tetracycline resiet~n~e gene illLe~led into the chromosome very near where the ompA gene had been deleted from this strain. One particular strainwas desi n~ted BRE-TR.
A second round of phage production was then carried out with the strain BRE-TR, using the same method as described above. Re~rf s.o.~ es of this phage population contain both the tetracycline rçsiet~nce gene and the OmpA
deletion. These phage were then collected and stored. These phage were then used to infect E. coli BL21(DE3). Af'cer infection, the bacteria contain the tetracycline resi~t~nce marker. In addition, there is a high probability that the OmpA deletion was selected on the LB plates CO~ g t~tld~ycline.
Colonies of bacteria which grew on the plates were grown up separately in LB medium and tested for the presence of the OmpA protein. Of those colonies selected for eX~ tion~ all lacked the OmpA protein as judged by antibody reactivity on SDS-PAGE w~ l blots.
SDS-PAGE and Western Blof: The SDS-PAGE was a variation of Laemmli's method (T.~mmli, U.K., Nature 227:680-685 (1970)) as described previously (Blake and Gotschlich, J. ~p. Me~ 159:452-462 (1984)).
Electrophoretic transfer to Immobilon P (Millipore Corp. Bedford, MA) was ') performed according to the methods of Towbin et al. (Towbin, H., et al., Proc.
Natl. Aca~ Sci. USA 76:4350-4354 (1979)) with the exception that the paper was first wetted in methanol. The Western blots were probed with phosphatase c~njugut~ d reagents (Blake, M.S., et al., Analyt. Biochem. 136: 175-179 (1984)).
Pol~ ,~e Chain Rf~ on: The method described by Feavers et al.
(Feavers, I.M., et al., Infect. Immun. 60:3620-3629 (1992)) was used to amplify the gene encoding the PorB. The primers selected were primers 33(GGG GTA
GAT CTG CAG GTT ACC TTG TAC GGT ACA ATT AAA GCA GGC GT) (SEQ ID NO- 17) and 34 (GGG GGG GTG ACC CTC GAG TTA GAA l-rT
GTG ACG CAG ACC AAC) (SEQ ID NO: 18) as previously described (Feavers, I.M., et al., Infect. Immun. 60:3620-3629 (1992)). Briefly, the reaction components were as follows:

AMENDED

W O 97/28273 PCT~US97/01687 Meningococcal strain 8765 chromosomal DNA (lOO ng/~ ; 5' and 3' primers (I IlM) 2 ~LI each; dNTP (IO mM stocks), 4 !11 each; 10 X PCR reaction buffer (lOO mM Tris HCI, 500 mM KCl, p~ 8.3), 10 ~1; 25 mM MgCl~, 6 ~
double distilled H20, 62 111; and Taq polymerase (Cetus Corp.~ S u/~l), 1 ,ul. The reaction was carried out in a GTC-2 Genetic Thermocycler (Precision Inst. Inc, Chicago, IL) connected to a Lauda 4/K metllanol/watel cooling system (Brinkrnan Instruments, Inc., Westbury, NY) set at 0~C. The thermocycler was programmed to cycle 30 times through: 94"C, 2 min.; 40~C, 2 min.; and 72~C, 3 min. At the end of these 30 cycles~ the reaction was extended at 72 ~C for 3 min IO and finally held at 4~C until readied for analysis on a 1% agarose gel in TAE
buffer as described by Maniatis (Maniatis, T., el al., A~olecula7 Cl07?i7?g, A
Laborato~y Manual, Cold Spring Harbor Laboratory. Cold Spring Harbor, NY
(I 982)).
Subcloni~zg of flle PCR prodllct: The pET-17b plasmid (Novagen, Inc.) I5 was used for subcloning and was prepared by double digesting the plasmid with the restriction endonucleases BamHI and XhoI (New England Biolabs, Inc., Beverly, MA). The digested ends were then dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN). The digested plasmid was then analyzed on a 1% agarose gel~ the cut plasmid removed, and purified using the GeneClean kit (BiolOl~ La Jolla, CA). The PCR product was prepared by extraction with phenol-chloroform, chloroform~ and finally pur;fied using the GeneClean Kit (BiolO1). The PCR product was digested with restriction endonucleases BglII and Xhol (New England Biolabs, Inc.). The DNA was then extracted with phenol-chloroform, precipitated by adding 0.1 volumes of 3 M sodium acetate, S lul glycogen (20 !lg/lll), and 2.5 volumes of ethanol. After washing the DNA with 70% ethanol (vol/vol)~ it was redissolved in TE buf~er. The digested PCR product was ligated to the double digested pET-17b plasmid described above using the standard T4 ligase procedure at 16~C
overnight (Curr~nt Protocols in Molecular Biology, John Wiley & Sons, New York (1993)). The ligationproduct was then transÇormed into the BL21 (DE3)-CA 02244989 1998-07-31 PCT~S ~ 7 ~ 0 1 6 8 7 3iÇi~ s~

. . .

I~ompA described above which were made competent by the method of Chung et aL (Chung, C.T., et al., Proc. Natl. Aca~ Sci. U~A 86:2172-2175 (1989)). The tran~rolill~ll~ were selected on LB plates co..l~ il.g 50 llg/ml carbenicillin and 1211g/ml tetracycline. Several transformants were selected, cultured in LB both ~5 contzlining carbenicillin and tetracycline for 6 hours at 30~C, and plasmid gene expression inducted by the addition of IPTG. The temperature was raised to 37~C and the cultures continued for an additional 2 hrs. The cells of each culture were collected by centrifugation, whole cell lysates prepared, and analyzed by SDS-PAGE and Western Blot using a monoclonal antibody (4D11) which reacts ' 0 with all neisserial porins.
Nucleotide Sequence Analysis: The nucleotide sequences of the cloned Cl~s 3 porin gene DNA were detelmined by the dideoxy method using denatured double-stranded plasmid DNA as the template as described (Current Protocols in Molecular Biology, John Wiley & Sons, New York (1993~. Sequenase II kits (United States Biochemical Corp., Cleveland, OH) were used in accordance with the mzlnnfzl-~tllrer's instructions. The three synthesized oligonucleotide primers (Operon Technologies, Inc., Alameda, CA) were used for these reactions. One for the 5 ' end, which consisted of 5 'TCAAGCTTGGTACCGAGCTC (SEQ ID
NO:19) and two for the 3' end, 5'l-l-lGTTAGCAGCCGGATCTG (SEQ ID
') NO:20) and 5' CTCAAGACCCGTTTAGAGGCC (SEQ ID NO:21).
Overlapping, nested deletions were made by lit-ez~ .g the plasmid DNA by restricti~n endomlclezl~e Bpu11021 and the ends blunted by the addition of Thio-dNTP and Klenow polymerase (Current Protocols in Molecular Biolo~, John Wiley & Sons, New York (1993)). The linl?ztri7f~(1 plasmid was then cleaved withrestriction entlomlclease~oI and the exoII/Mung bean nuclease deletion kit used to make 3 ' deletions of the plasmid (Stratagene, Inc., La Jolla, CA) as instructed by the supplier. A map of this strategy is shown in Figure 1.
Expression and purff cation of the Porl~ gene product: Using a sterile micropipette tip, a single colony of the BL2 1 (DE3)-~ompA contzlinin~ the PorB-pET-17b plasmid was selected and inoculated into 10 ml of LB broth contZIining W O 97/28273 PCT~US97101687 50 ~g/ml carbenicillin. The culture was incubated overnight at 30~C while .sh~king The 10 ml overnight culture was then sterilely added to I liter of LB
broth with the same concentration of carbenicillin, and the culture continued ina shaking incubator at 37~C until the OD60(, reached 0.6-1Ø Three mls of a stocl;
solution of IPTG (100 mM) was added to the culture and the culture incubated foran additional 30 min. Rif~~npicin was then added (5.88 ml of a stock solution;
34 mg/ml in methanol) and the culture continued for an additional 2 hrs. The cells were harvested by centrifugation at 10,000 rpm in a GS3 rotor for 10 min and weighed. The cells were thoroughly resuspended h- 3 ml of TEN buffer (50 mM Tris HCI, I mM Tris ~CI, 1 mM E~TA~ 100 mM NaCl, pl 1 8.0~ per gram wet weight of cells. To this was added 8 111 of PMSF stock solution (50 mM in anhydrous ethanol) and 80 ~11 of a Iysozyme stock solution ( 10 mg/ml in water) per gram wet weight of cells. This mixture was stirred at room temperature for 20 min. While stirring, 4 mg per gram wet weight of cells o~ deoxycllolate was added. The mixture was placed in a 37~C water bath and stirred with a glass rod.When thc mixture became viscous, 20 ~LI of DNase 1 stock solution ( I mg/ml) was added per gram weight wet cells. The mixture was thell removed i;om the water bath and left at room temperature until the solution was no longer viscous.
The mixture was then centrifuged at 15,000 rpm in a SS-34 rotor for 20 min at 4~C. The pellet was retained and thoroughly washed twice witll TEN buffer.
The pellet was then resuspended in freshly prepared Tl~N buf'l~r containing 0.1 mM PMSF and 8 M urea and sonicated in a bath sonicator (Heat Systems, Inc., Plain viev~. N~). The protein concentration was delermilled ushl~, a BCA kit (Pierce, ~ockville, IL) and the protein concentration adjusted to less thall 10 mg/ml using the TEN-urea buffer. The sample was then diluted 1:1 witll 10%
(weight/vol) Zwittergent 3,14 (Calbiochem, La Jolla, CA), sonicated, alld loadedonto a Sephacryl S-300 molecular sieve column. The Sephacryl S-300 column (2.5CIIIX 200 cm) had previously equiliblated with 100 mM Tris HCI, 200 mM
NaCI, 10 mM EDTA, 0.05% Zwitter~ent 3~14, and 0.02% azide, pl~ 8Ø The column flow rate was adjusted to 8 mlthr and 1() ml fiactions were collected. The OD280 of each fraction was measured and SDS-PAGE analysis performed on protein containing fractions.
In~ibifion ELISA Assnys: Microtiter plates (Nunc-Immuno Plate IIF, Nunc, Inc., Naperville, IL) were sensitized by adding 0.1 ml per well of porB (2!lg/ml) purified from the wild type strain 8765, in 0.1 M carbonate buffer, pH 9.6 with 0.02% azide. The plates were incubated overnight at room temperature.
The plates were washed five times witll 0.9% NaCI, 0.05% Brij 35, 10 mM
sodium acetate pH 7.0, 0 02% azide. Human immune sera raised against the Type 15 Class 3 PorB protein was obtained from Dr. Phillip O. Livingston, Memorial-Sloan Kettering Cancer Center, New York, N.Y. The human immune sera was diluted in PBS with 0.5~/O Brij 35 and added to the plate and incubatedfor 2 hr at room temperature. The plates were again washed as before and the secondary antibody, alkaline phosphatase conjugated goat anti-human IL~G ~Tago Inc., Burlingame, CA), was diluted in PBS-Brij~ added to the plates and incubated for 1 hr at room temperature. The plates were washed as before and p-nitrophenyl phosphate (Sigma Phosphatase Substrate 104) (I mg/ml) in 0.1 diethanolamine, 1 mM MgCI~, 0.1 mM ZnCI~, 0.02% azide, pH 9.8, was added.
The plates were incubated at 37~C for I h and the absorbance at ~05 nm determined using an Elida-5 microtiter plate reader (Physica~ New York, NY).
Control wells lacked either the primary and/or secondary an~ibody. l~his was done to obtain a titer for each human serum which would ~ive a half-maximal reading in the ELISA assay. This titer for each human serum would be used in the inhibition ELISA. The E~ISA microtiter plate would be sensitized with purified wild type PorB protein and washed as before. In a separate V-96 polypropylene microtiter plate (Nunc, Inc.), varying amounts of eitller purifiedwild type PorB protein or the purified recombinant PorB protein were added in a total volume of 75 1ll. The human sera were diluted in PBS-Brij solution to twice their half maximal titer and 75 ~11 added to each of the wells containing the PorB or recombinant PorB proteins. This plate was incubated for 2 hr at room temperature and centrifuged in a ~orvall RT6000 refrigerated centrifuge, W O 97/28273 PCTrUS97/01687 equipped with microtiter plate carriers (Wilmington~ DE) at 3000 rpm for 10 min.Avoiding the V-bottom, 100 Ill from each well was removed and transferred to the sensitized and washed ELI~A microtiter plate. The ELISA plates are incubated for an additional 2 hr, washed, and the conjugated second antibody added as before. The plate is then processed and read as described. The percentage of inhibition is then processed and read as described. The percentageof inhibition is calculated as follows:
I - (ELISA valu~ with either PorB o~ rPorB protein addec~) lOQ
(ELISA value without the porB added) Resul~s Polymerase Cllain Reaction alld Sll~Clol~ g: A method to easily clone, genetically manipulate, and eventually obtain enough pure porin protein from anynumber of different neisserial porin genes for further antigenic and biophysicalcharacterization has been developed. The first step toward this goal was cloningthe porin gene from a Neisseria. Using a technique originally described by Feavers, et al. (Feavers, I.M., el ~1., Inf~ct. In7mun. 60:3620-3629 (1~92O, tl1e DNA sequence of the mature porin protein from a class 3, serotype 15 porin was amplifled using the chromosome of meningococcal strain 8765 as a template for the PCR reaction. Appropriate endonuclease restriction sites had been synthesized onto the ends of the oligonucleotide primers, such that when cleaved, the amplified mature porin sequence could be directly ligated and cloned into the chosen expression plasmid. After 30 cycles, the PCR products shown in Figure 2 were obtained. The major product migrated between 900bp and l OOObp which was in accord with the previous study (~eavers, I.M., c~ l., Infcct. Immun.
60:3620-3629 (1992)). However, a higher molecular weight product was not CA 02244989 1998-07-31 PCT~S 9 7 / O 1 b 8 2 JAI~

seen, even though the PCR was conflucte-l under low ~nnç~ling stringencies (40~C, 50 mM KCl).
To be able to produce large amounts of the cloned porin protein, the tightly controlled ~_A~ression system of Studier, et al. (Studier and Moffatt, J.
Mol. Biol. 189:113-130 (1986~ was employed, which is comrnercially available through Novagen Inc. The amplified PCR prQduct was cloned into the BamH~-X~oI site of plasmid pET-17b. This strategy places the DNA sequence for the mature porin protein in frame directly behind the T7 promoter, the DNA sequence encoding for the 9 amino acid leader sequence and 11 amino acids of the mature '.0 ~10 protein. The Studier E. coli strain BL21 lysogenic for the DE3 lambda d~iv~livG (Studier and Moffatt, J. Mol. Biol. 189:113-130 (1986)) was selected as the ~A~icssion host for the pET-17b plasmid cont~ining the porin gene. But b~c~use it was thought that the OmpA protein, origin~ting from the E. coli GA~ ession host, might tend to co-purify with the GA~re3sed meningococcal porin protein, a modification of this strain was made by P1 transduction which el;,-,i"~ i the ompA gene from this strain. Thus, after restriction endonucleasedigestion of both the PCR product and the pET-17b vector and ligation, the product was Ll~u~fu~ ed into BL21 (DE3)-~ompA and llcu~r ,l-nd.ll~ selected for ampicillin and tGL,cuiycline rpeiet~n~e The restriction map of pET-17b is shown in Figure 1 lA, while the nucleotide sequence between the BglII and~oI sites of pET-17b is shown in Figure 1 lB (SEQ ID NO:7). Of the numerous colonies observed on the sPlechnn plate, 10 were picked for further ch~ teri7~hon. All ten ~ ~cs~ed large amounts of a protein, which migrated at the al)~loxilllate molecular weight of the PorB protein, when grown to log phase and in~ ce-1 with IPTG. The whole cell lysate of one such culture is shown in Figure 3a. The WG~t~ l blot analysis with the 4Dl l monoclonal antibody further suggested that theprotein being Gx~lcssed was the PorB protein (Figure 3b). As opposed to other studies, when neisserial porins have been cloned and Gx~lcssed in E. coli,the host bacterial cells showed no signs of any toxic or lethal effects even after the addition of the IPTG.

W O 97/28273 PCTrUS97/01687 The E. coli cells appeared viable and could be recultured at any time throughoutthe expression phase.
Nucleotide sequerlce a~talysis: The amount of PorB expressed in these experiments was significantly greater than that previously observed and there appeared to be no adverse effects of this expression on the host E. coli. To be certain that no PCR artifacts had been introduced into the meningococcal porin gene to allow for such high expression~ the clltire ~10 porin fusion was sequenced by double stranded primer extension from the plasmid. The results are shown in Figure 4. The nucleotide sequence was identical witll another meningococcal serotype 15 PorB gene sequence previously reported by Heckels, et al. (Ward, M.J., et al., ~EMSMicrobiol. Lett. 73:283-289 (1992)) with two exceptions which are shown. These two nucleotide differences each occur in the third position of the codon and would not alter the amino acid sequence of the expressed protein. Thus, from the nucleotide sequence, there did not appear to be any PCR artifact or mutation which might account for the high protein expression and laclc of toxicity within the ~ coli. Furthermore, this data wouldsuggest that a true PorB protein was being produced.
Purification of tlle expresse-~ porB gene pro~luct: The PorB protein expressed in the E. coli was insoluble in TEN buffer which suggested that when expres~ed, the PorB protein formed into inclusion bodies. However, washing of the insoluble PorB protein with TEN buffer removed most of the contamin~ting E. coli proteins. The PorB protein could then be solubilized in freshly prepared8M urea and diluted into the Zwittergent 3,14 detergent. The final purification was accomplished, using a Sephacryl S-300 molecular sieve column which not only removed the urea but also the remaining cont~min~ g proteins. The majority of the PorB protein eluted from the column having the apparent molecular weight of trimers much like the wild type PorB. The comparative elution patterns of both the wild type and the PorB expressed in the E. coli areshown in Figure 5. It is important to note that when the PorB protein concentration in the 8 M urea was in excess of 10 mg/ml prior to dilution into the W O 97/28273 PCTnUSg7101687 Zwittergent detergent, the relative amounts of PorB protein found as trimers decreased and appeared as aggregates eluting at the void volume. However, at protein concentrations below 10 mg/ml in the urea buffer, the majority of the Por~3 eluted in the exact same fraction as did the wild type PorB. It was also determined using a T7-Tag monoclonal antibody and western blot analysis that the 1 1 amino acids of the mature T7 capsid protein were retained as the amino terminus. The total yield of the meningococcal porin protein from one }iter of E. coli was approximately 50 mg.
Inllibitio~2 ELISA Assays. In order to determine if the purified trimeric recombinant PorB had a similar antigenic conformation as compared to the PorB
produced in the wild type meningococcal strain 8765, the sera from six patients which had been vaccinated with the wild type meningococcal Type l 5 PorB
protein were used in inhibition EBISA assays. In the inhibition assay, antibodies reactive to the native PorB were competitively inhibited with various amounts ofeither the purified recombinant PorB or tl~e homologous purified wild type PorB.The results of the inhibition with the homologous purified PorB of each of the six human sera and the mean inhibition of these sera are shown in Figure 6. The corresponding inhibition of these sera with the purified recombinallt PorB is seen in Figure 6B. A comparison of the mean inhibition fiom Figure 6 and 7 are plotted in ~igure 8. These data would suggest that the antibodies contained in the sera of these six patients found similar epitopes on botll the homologous purified wild type PorB and the purified recombinant PorB. This gave further evidence that the recombinant PorB had regained most if not all of the native conformation found in the wild type PorB.

-. CA 02244989 1998-07-31 ~ ~ 4 7 ~ Q;

U'EAJU~ U2JAN9 Example ~ Cloning of the Class 2 Porin from Group B N'eisseria Meningi~idis s~rain BNCVM986 .
Genomic DNA was isolated from approximately O.5g of Group B
l~eisseria meningitidis strain BNCV M986 (serotype 2a) using previously S described methods (Sambrook et aL, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press (1989)). This DNA then served as the template for two class 2 porin specific oligonucleotides in a standard PCR reaction. These oligonucleotides were designed to be complementary to the 5' and 3 ' fl~nkin~ regions of the class 2 0 porin and to contain EcoR~ restriction sites to f~-~ilit~te the cloning of the fr~nent The sequences of the oligonucleotides were as follows:

5' AGC GGC TTG GAA TTC CCG GCT GGC TTA AAT TTC 3' (SEQ ID
NO:22) and -- 5' CAAACGAATGAA ITCAAATAAAAAAGCCTG3' (SEQIDNO:23).
The polymerase chain reaction was then utilized to obtain the class 2 porin. Thereaction conditions were as follows: BNCV M986 genomic DNA 200ng, the two oligonucleotide primers described above at 1 IlM of each, 200 ,uM of each dNTP, PCR reaction buffer (10 mM Tris HCl, 50 mM KCl, pH 8.3), 1.5 mM MgC12, and 2.5 units of Taq polyrn~r~e, made up to 100 ~11 with distilled H2O. This reaction nli~ was then subjected to 25 cycles of 95~C for 1 min, 50~C for 2 min and 72~C for 1.5 min. At the end of the cycling period, the reaction mixture was loaded on a 1% agarose gel and the material was electrophoresed for 2h af~er which the band at 1.3 kb was removed and the DNA recovered using the Gene Clean kit (Bio 101). This DNA was then digested with EcoRI, repurified and ligated to EcoRI digested pUCl9 using T4 DNA ligase. The ligation lllixlule was used to transform colll~ lt E. coli DHSoc. Recombinant plasmids were selected and sequenced. The insert was found to have a DNA sequence consistent with that of a class 2 porin. See, Murakami, K. et al., Infect. Immun. 57:2318-2323 (1989).

AAltENDED S~T

CA 02244989 1998-07-31 ~ClIU~ ~ ~ / U 1 ~ ~ ~

The plasmid pET-17b (Novagen) was used to express the class 2 porin.
As descnbed below, two p1~emi<ls were constructed that yielded two different proteins~ One plasmid was d~ei,~n~l to produce a mature class 2 porin while the other was designed to yield a class 2 porin fused to 20 amino acids from the T7 '5 gene ~10 capsid protein.
~~ ., Conslruction of t~ e mature class 2 porin The mature class 2 porin was constructed by amplifying the pUC19-class 2 porin Gonstruct using the oligonucleotides: 5'-CCT GTT GCA GCA CATATG
- GAC GTT ACC TTG TAC GGT ACA ATT AAA GC-3' (SEQ ID NO:24) and 5 '-CGA CAG GCT TTT TCT CGA GAC CAA TCT TTT CAG -3' (SEQ ID
NO:25). This ~ ,y allowed the cloning of the amplified class 2 porin into the Ndel and ~ol sites of the plasmid pET-17b thus producing a mature class 2 porin. Standard PCRwas conl1n-t~1 using the pUCl9-class 2 as the template and the two oligonucleotides described above. This PCR reaction yielded a l.lkb product when analyzed on a 1.0% agarose gel. The DNA obtained from the PCR
reaction was gel purified and digested with the restriction enzymes Ndel and ~ol. The l.lkb DNA produced was again gel purified and ligated to Ndel and Xhol digested pET-17b using T4 DNA ligase. This ligation mixture was then used to transform competent E. coli DH5a. Colonies that contained the l.lkb insert were chosen for further analysis. The DNA from the DH50c clones was an~ly~ed by restriction lllal~pillg and the cloning junctions of the chosen plasmids were seqn~n~e~l After this analysis, the DNA obtained from the DH50~ clones was used to transform E. coli BL21(DE3)-~ompA. The transformants were selectedtoLB-agarCO~ 100~lg/mlofcarbenicillin. Severalll~ro~
were screened for their ability to make the class 2 porin protein. This was donebygrowingtheclonesinLBliquidmediumco-.l~;..;..~ 100~ig/mlofcarbenicillin and 0.4% glucose at 30~C to OD600 = 0.6 then inducing the cultures with IPTG
(0.4 mM). The cells were then disrupted and the cell extract was analyzed by SDS-PAGE. The nucleotide sequence (SEQ ID NO:3) and A~N~

CA 02244989 1998-07-31 P ~ ~ ~ 97 !~
~~ 2 ~N
- s2 -h~n~l~teA a nino acid sequence (SEQ ID NO:4) of the mature class II porin gene cloned into pET-17b are shown in Figures 9A and 9B.

Cons*uction of t*e fusion cLass 2 porin The fusion class 2 porin was constructed by amplifying the pUC 1 9-class 2 porin construct using the oligonucleotides: 5 '-CCT GTT GCA GCG GAT CCA
GAC GTT ACC TTG TAC GGT ACA ATT AAA GC- 3' (SEQ ID NO:26) and 5'-CGA CAG GCT TTT TCT CGA GAC CAA TCT TTT CAG -3' (SEQ ID
NO:27~; This strategy allowed the cloning of the amplified class 2 porin into the BamHI and X~oI sites of the plasmid pET-l 7b thus producing a fusion class 2 porin co~ g an additional 22 amino acids at the N-te. ., .i. ."c derived from the T7 ~10 capsid protein contained in the plasmid. Standard PCR was con-lucted using the pUC 1 9-class 2 as the template and the two oligonucleotides describedabove. The PCR reaction yielded a l.lkb product when analyzed on a 1.0%
agarose gel. The DNA obtained from the PCR reaction was gel purif}ed and digested with the reaction en~ymes BamHI and ~71oI. The l.lkb product produced was again gel purified and ligated to BamHI and ~oI digested pET- 1 7b using T4 DNA ligase. This ligation mixture was then used to transform competent E. coli DH5a. Colonies that contained the 1 .lkb insert were chosen for further analysis. The DNA from the DH5a clones was analyzed by restriction el~y.. c mapping and the cloning junctions of the chosen plasmids were se~lu~ced. The nuclçotide sequence (SEQ ID NO:5) and tr~nel~ted amino acid sequence (SEQ ID NO:6) of the fusion class II porin gene cloned into the ~x~lcssion plasmid pET-17b are shown in Figures 10A and 10B. After this analysis, the DNA obtained from the DH5a clones was used to transform E. coli BL21(DE3)-~ompA. The transformants were selected on LB-agar co.. ~i.. ;.. g 100 ,ug/ml of carbenicillin. Several transformants were screened for their ability to make the class 2 porin protein. This was done by growing the clones in LB liquidmedium co- ~~;.i .-i. .g 100 llg/ml of carbenicillin and 0.4% glucose at 30~C to OD600 Ah~NI~ S~~T

CA 02244989 1998-07-31 P~T/US 9 7 ~1 6 8 - 'i'PE~i:JS ~

= 0.6 then inducing the cultures with IPTG (0.4 mM). The cells were then disrupted and the cell extract was analyzed by SDS-PAGE.
.
Exnmple 3. Cloning and Éxpression of the Mature class 3 porin - from Group B Neisseria meningitidis strain 8765 in S-~ E. coli Genomic DNA was isolated from approximately 0.5 g of Group B
Neisseria meningitidis strain 8765 using the method described above (Sambrook et al., Molecular Cloning A Laboratory Manual, 2nd ed., Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press (1989)). This DNA then served as the template for two class 3 porin specific oligonucleotides in a standard PCR
reaction.
The mature class 3 porin was constructed by amplifying the genomic DNA from 8765 using the oligonucleotides: 5'-GTT GCA GCA. CATATG GAC
GTT ACC CTG TAC GGC ACC-3' (SEQ ID NO:28) and 5'-GGG GGG ATG
GAT CCA GAT TAG AAT TTG TGG CGC AGA CCG ACA CC-3' (SEQ ID
NO:29). This strategy allowed the cloning of the amplified class 3 porin into the NdeI and BamHI sites of the plasmid pET-24a+ (Figures 13A and 13B), thus producing a mature class 3 porin. Standard PCR was conducted using the genomic DNA isolated from 8765 as the template and the two oligonucleotides described above.
The reaction conditions were as follows: 8765 genomic DNA 200 ng, the two oligonucleotide primers described above at 1 IlM of each, 200 ~lM of each dNTP, PCR reaction buffer (10 mM Tris HCI, 50 mM KCl, pH 8.3~, 1.5 mM
MgCl2, and 2.5 units of Taq polymerase, and made up to 100 ~11 with distilled water This reaction mixbure was then subjected to 25 cycles of 95~C for 1 min, 50~C for 2 min and 72~C for 1.5 min.
This PCR reaction yielded about 930 bp of product, as analyzed on a 1%
agarose gel. The DNA obtained from the PCR reaction was gel purified and digested with the restriction enzymes NdeI and BamHI. The 930 bp product was Ahll~NDE~

W O 97/28273 PCTrUS97/01687 .

again gel purified and ligated to NdeI and BamHl digested pET-24a(+) using T4 ligase. This ligation mixture was then used to transforrn competent E. coli DT-I5~.
Colonies that contained the 930 bp insert were chosen for further analysis. The DNA from the E. coli DIISa clones was analyzed by restriction enzyme mapping and cloning iunctions of the chosen plasmids were sequenced. After this analysis, the DN~ obtained from the E. coli DH50~ clones was used to transform E. coli BL21(DE3)-Aomp~. The transformants were selected on LB-agar containing 50 !lg/ml of kanamycin. Several transformants were screened for their ability to make the class 3 porin protein. This was done by growing the clones in LB liquidmedium cont~inin~ 50 ,ug/ml of kanamycin and 0.4% of glucose at 30~C to OD60() = 0.6 then inducing thc cultures with IPTG (I mM). The cells were then disrupted and the cell extract was analyzed by SDS-PAGE.

Ex~lmple 4. Purif c~tion and refolding of recof7lbinanf cl~l:ss 2 porin E coli strain BL2 1 (DE3)~ompA [pNV-5] is grown to mid-log phase (OD
= 0.6 at 600 nrn) in Luria broth at 30~C. IPTG is then added (0.4 mM final) and the cells grown an additional two hours at 37DC. Tl~e cells were then harvested and washed with several volumes of TEN buffer (50 n1M Tris-HCl, 0.2 M NaCI, 10 mM EDTA, pH = 8.0) and the cell paste stored frozen at -75~C.
For purification preweighed cells are thawed and suspended in TEN
buffer at a 1:15 ratio (g/v3. The suspension is passed through a Stansted cell disrupter (Stansted fluid power Ltd.) twice at 8~000 psi. The resultant solutionis then centrifuged at 13,000 rpm for 20 min and the supernatant discarded. The pellet is then twice suspended in TEN buffer containing 0.5% deoxycholate and the supernatants discarded. The pellet is then suspended in TEN buffer containing 8 M deionized urea (electrophoresis grade) and 0.1 mM PMSF (3 g/10ml). The suspension is sonicated for 10 min or until an even suspension is achieved. 10 ml of a 10% aqueous solution of 3,1 4-zwittergen (Calbiochem) is W O 97/28273 PCTnUS97101687 added and the solution thoroughly mixed. The solution is again sonicated for 10 min. Any residual insoluble material is removed by centrifugation. The protein concentration is determined and the protein concentration adjusted to 2 mg/ml with 8 M urea-10% zwittergen buffer (I :1 ratio).
This mixture is then applied to a 2.6 x 100 cm column of Sephacryl S-300 equilibrated in 100 mM Tris-HCI, l M NaCI, 10 mM EDTA, 20 n1M CaCI~, 0.05% 3,14-zwittergen, 0.0:2% sodium azide, pH = 8Ø The flow rate is m~int~ined at 1 ml/min. Fractions of 10 ml are collected. The porin refolds intotrimer during the gel filtration. The OD = 280 mn of each fraction is measured I0 and those fractions containing protein are subjected to SDS gel electrophoresis assay for porin. Those fractions containin~ porin are pooled. The pooled fractions are either dialyzed or diluted 1:10 in 50 mM Tris HCI pH = 8.0, 0.05%
3,14-zwittergen, 5 mM EDTA, 0.1 M NaCI. The resulting solution is then applied to a 2.6 x 10 cm Q sepharose high performance colurnn (Pharmacia) equilibrated in the sarne buffer. The porin is eluted with a linear gradient of 0.1 to I M NaCl.

Example 5. Pur f c~ltion f~nd refold~ng of r ecombi~l~mt cl~lss 3 por~t E coli strain BL2 1 (DE3) ~ompA containing the porB-p~T- I 7b plasmid is grown to mid-lo~ phase (OD = 0.6 at 600 nm) in Luria broth al 30~C. IPTG
is then added (0.4 mM final) and the cells grown an additional two hours at 31~C.
The cells were then harvested and washed with several volumes of TEN buffer (50 mM Tris-HCI, 0.2 M NaCl, 10 mM EDTA, pH = 8.0) and lhe cell paste stored frozen at -75~C.
For purification about 3 grams of cells are thawed and suspended in 9 ml of TEN buffer. Lysozyme is added (Sigma, 0.25 mg/ml) deoxycholate (Sigma, 1.3 mg/ml) plus PMSF (Sigma, llg/ml) and the mixture gently shaken for one hour at room temperature. During this t;me~ the cells Iyse and the released DNA

W O 97128273 PCTrUS97/01687 causes the solution to become very viscous. DNase is then added (Sigma, 2 ~g/ml) and the solution again mi,Yed for one hour at room temperature. The mixture is then centrifuged at 15K rpm in a S-600 rotor for 30 minutes and the supernatant discarded. The pellet is then twice suspended in 10 ml of TEN bufferS and the supern~tzlnt~ discarded. The pellet is then suspended in 10 ml of 8 M urea (Pierce) in TEN buffer. The mixture is gently stirred to break up any clumps.
The suspension is sonicated for 20 minutes or until an even suspension is achieved. 10 ml of a 10% aqueous solution of 3,1 4-zwittergen (Calbiochem~ is added and the solution thoroughly mixed. The solution is again sonicated for 10 minutes. Any residual insoluble material is removed by centrifugation. The protein concentration is determined and the protein concentratioll adjusted to '~
mg/ml with 8 M urea-10% zwittergen buffer (I :1 ratio).
This mixture is then applied to a 180 x 2.5 cm column of Sephacryl S-300 (Pharmacia) equilibrated in 100 mM Tris-HCI, I M NaCl~ 10 mM EDTA, 20 mM
CaC12, 0.05% 3,14-zwittergen, pl~ = 8Ø The flow rate is maintained at I
ml/min. Fractions of 10 ml are collected. The porin refolds into trimcr during the gel filtration. The OD280 mn of each fraction is measured and those fiactions containing protein are subjected to SDS gel electroplloresis assay for porin.
Those fractions containing porin are pooled.
The pooled fractions are dialyzed and concentrated 4-6 fold usin~ Amicon concentrator with a PM 10 membrane against bui'i'el contahling 100 mM Tris-3~CI, 0.1 M NaCI, 10 mM EDTA~ 0.05% 3,1 ~-zwittergen, pH - 8Ø
Alternatively~ the pooled fractions are precipitated with 80% ethanol and resuspended with the above-menlioned buffer. Si,Y to 10 mg of the material is then applied to a monoQ 10/10 column (Pharmacia) equilibrated in the same buffer. The pOIill iS eluted from a shallow 0.1 to 0.6 M NaCI gradient with a 1.~% increase per min over a 50 min period. The Flow rate is I ml/min. The pcak cont~ in~ porill is collected and dialyzed against TEN buffer and 0.05%
3,14-zwittergen. The porin ma~ be purified further by another S-300 chrornatography.

CA 02244989 l998-07-3l W 097128273 PCTnUS97J01687 Ex~mple 6. Purif~cafion ~md chemical moclification of t~2e polysncch~lrides J

The capsular polysaccharide from both group B Nei.s.~eria meningitidi.s and E;. coli Kl consists of c~(2-8) polysialic acid (commonly referred to as S GBMP or K1 polysaccharide). High molecular weight polysaccharide isolated from growth medium by precipitation (,~.ee, Frasch, C.E., "Production and Control of Neisseria meningitidis Vaccines" in Bactericll ~accines, Alan R. Liss, Inc., pages 123-145 (1990)) was purified and chemically modified before being coupled to the porin protein. The high molecular weight polysaccharide was partially depolymerized with 0.1 M acetic acid (7 mg polysaccharide/ml), pH =

6.0 to 6.5 (70~C, 3 hrs) to provide polysaccharide having an average molecular weight of 12,000-16,000. After purification by gel filtration column chromatography (Superdex 200 prep grade, Pharmacia), the polysaccharide was N-deacetylated in the presence of NaBH4 and then N-propionylated as described by Jennings et al. (J. Immunol. 137:1808 (1986)) to afford N-Pr GBMP (see Example 14). Treatment with NalO4 followed by gel ~lltration column purification gave the oxidized N-Pr GBMP having an average molecular weight of 12,000 daltons.

Example 7. Coupling of oxidized N-Pr GBMP to tl~e gr~up B
meningococcal cl~lss 3 porin protein (PPJ

The o7~idized N-Pr GBMP (9.5 mg) was added to purified class 3 porin protein (3.4 mg) dissolved in 0.21 ml of 0.2 M phosphate buffer pH 7.5 which also contained 10% octyl glucoside. After the polysaccharide was dissolved~
sodium cyanoborohydride (7 mg) was added and the reaction solution was incubated at 37~C for 4 days. The reaction mixture was diluted witl1 0.15 M
sodium chloride solution containing û.01% thimerosal and separated by gel filtration column chromatography using Superde~; 200 PG. The conjugate (N-Pr W O 97t28273 PCTrUS97/01687 GBMP-PP) was obtained as single peak eluting near the void volume. Analysis of the conjugate solution for sialic acid and protein showed that the conjugate consists of 43% polysaccharide by weight. The porin protein was recovered in the conjugate in 44% yield and the polysaccharide in 12% yield. The protein recoveries in different experiments generally occur in the 50-80% rangc and those of the polysaccharide in the 9-13% range (see also Example 14).

Example8. Immunogenicitys~udies The immunogenicities of the N-Pr GBMP-PP conjugàte and those of the N-Pr GBMP-Tetanus toxoid (N-Pr GBMP-TT) conjugate which was prepared by a similar coupling procedure were assayed in 4-6 week old outbread Swiss Webster CFW female mice. The polysaccharide ~2 llg)-conjugate was a~lmini~tered on days 1, 14 and 28, and the sera collected on day 38. The conjugates were a~mini.~tered as saline solutions, adsorbed on aluminum hydroxide, or admixed with stearyl tyrosine. The sera El,ISA titers against the po}ysaccharide antigen and bactericidal titers against N. meningifidi* group B are summarized in Table 1.

Example 9. Expression of group B Neisseria meningi~;dis Ol~fer Membrane ~MB3) Using Yenst Picll ia pastoris Expression Sysfem Maferials (md Metllods Strains and Plasmids Pichia pastoris GS 115 (provided by Invitrogen) has a defect in the histidinol dehydrogenase gene (his4~ which prevents it from synthesizing histidine. All expression plasmids carry the HIS4 gene which complements his4 W O ~7~2~273 P~TnU~971~87 in the host, so transformants are selected for tlleir ability to grow on histidine-deficient medium. Until transformed, GS l 15 will not grow on minimal medium alone.

Expression vectors Four different expression vectors were used that include the strong, highly-inducible AOX1 promoter for expression of foreign protein (Pichia Expression Kit, Invitrogen). One vector, pHIL-D2, is used for intracellular expression, while the other three (pHlL-S l, pPlC9, and pPIC9K) are used for secreted expression. Maps of the pHlL-D2, pH~L-S l ~ and pPlC9 vectors may be found on pp. 19-22 of the Invitrogen Instruction Manual for the Pichia Expression Kit, Version E, the contents of which is hereby incorporated by reference. Secretion requires the presence of a signal sequence on the expressedprotein to target it to the secretory pathway. To improve the cllances for success~
two different kinds of vectors are included in the kit. The vector pHTL-S l carries a native Pichi~ pastoris signal from the acid phosphatase gene, PHOl. The vectors, pPIC9 and pPIC9K (with corrected HIS4 region), both carry the secretionsignal from the S. cere~isiae oL-mating factor pre-pro peptide. The advantage ofexpressing secreted proteins is tha~ P. pa~tori.s secretes very low levels of native proteins. Thus, the secreted heterologous protein comprises the vast majority ofthe total protein in the media and serves as the first step in purification of the protein (Barr et al., Pharm. Eng. 12(2).-48-51 (1992)).

Cloniz~g of tlze mez2ingococcal B clnss 3 profei~t gene (MB3) The genomic DNA of Group B Neisseria meningilidis (strain 8765) served as the template for the amplification of class 3 porin (MB3) in a standard PCR. The amplified ~NA fragment (930 b.p. Iong) of the mature porin protein was.ligated in Nde I - BamH I cloning sites of the pET-24a cloninglexpression W 097/28273 PCTrUS97/01687 -6~-vector,originallyconstructedbyStudieretal., J. Mol. Biol. 189:113-130(1986), Meth. Enzymol. 185:60-89(1990); J. Mol. Biol. 219:37-44 (1991), and manufactured by Novagen. The pET vectors were developed for cloning and for expressing target DNA fragments under the strong T7 transcription and translation signals. Expression from the T7 promoter is induced by providing thehost cell with a source of T7 RNA polymerase. Newer, more convenient vectors utilizing the T7 expression system are now available from Novagen (Madison, WI 53711). The T7 expression system was successfully used for the expression of MB3 in E. coli (see Example 3).

0 Tl~e opti nization of tJte franslntio~ elong~ltion rntefor tlte e~cpressed MB3 gene Codon usage is known to affect the translational elongation rate, and therefore it has been considered an important factor in affecting product yields(Romanos et al., Yeast 8:423-488(1992)). There is evidence that codon usage may affect both yield and quality of the expressed protein. A number of highly expressed genes show a strong bias toward a subset of codons (Bennetzen et al., J. Biol. Chem. 257:3026-3031(1982). This "major codon bias," which can vary greatly between orf~P~ni.~m~,is thought to be a growth optimization strategy. This mechanism allows an organism to be capable of ef~lcient translation of highly expressed genes during rapid growth, as only a subset of tRNAs and aminoacyl-tRNA synthetases need to be present in high concentrations. Kurland et ~11., TIBS
12:126-128 (1987). Tn cases where mRNA contains rare codons, aminoacyl-tRNAs may become limited, increasing the probability of amino acid misincorporations, and possibly causing ribosomes to drop off. Indeed, a high misincorporation frequency has recently been observed in a foreign protein produced in E. coli (Scorer et al., Nucleic Acids ~es. 19:3511-3516 (1991)).
Moreover, proteins containing amino acid misincorporations are difficult to purify and may have both impaired activity and antigenicity. ~he presence of several rare codons has been shown to limit the production of tetanus tOXill CA 02244989 1998-07-31 ~T~S 97/01687 pE~U5 O Zi-JAN~

fragment C in E. coli (Makoffet al., Nucleic Acids Res. 17:10191-10201 (1989)).
In yeast, Hoekema et al. (Mol. Cell Biol. 7: 2914-2924 (1987)) showed that substitution of a large proportion of plc;r~led codons for rare codons in the 5 ' portion of the PGK (phosphoglycerate kinase) gene caused a decrease in ~ ression levels. Recently, the e~ s~ion of an immlmoglobulin kappa chain in yeast has been shown to be increased 50-fold when a synthetic codon-optimi7~1 gene is used, although the level of kappa chain mRNA remains the c, same.
Signific~nt di~ences between codon usage profiles of Pichia and MB3 O were found (Table 5). In order to c~Limi;Ge the tr~n~l~tion efficiency, particularly at the beginning of tr~ncl~tion elongation, codons optimal for Pic*ia were introduced into the 5' region of the MB3 gene. When constructing the linker used to clone MB3 into pHIL-Sl, the oligomers were synthesi7~d so that they cont~in~-l sequence optimized for Pichia e~ ssion. A 51 nucleotide long oligomer (51-mer) was syntht?si7~cl for this purpose. The sequence of the oligomer (SEQ ID NO:30) is:
5'-TCGAGACGTCACTTTGTACGGTACTATTAAGGCTGGTGTTGAGA
CTTCCCG-3' A 47 nucleotide oligomer complement~ry to the 5 l-mer was also synthrsi7ed ~0 The sequence of this oligomer (SEQ ID NO:3 1) is:
5'-CGGGAAGTCTCAACACCAGCCTTAATAGTACCGTACAAAGTGAC

These two oligomers, which contain~oIand BsrI restriction sites, were ~nnr~led to serve as a conl,e~;Lor, and then ligated to vector pHIL-S 1, which had been lin~ri7Pfl withXhoI digestion. The ligated fi~gment was then digested with BamHI, gel purified, and ligated with an MB3 fi~gment obtained from cutting the pNV15 vector with both BsrI and BamHI enzymes. The fragment was then cloned into the Pichia pHIL-S l t;~ ssion vector. The new DNA sequence of the 5' region of MB3 was verified by DNA seq~lenrin~ of pHIL-Sl/MB3 isolated from Pichia.

AM~DEI~

CA 02244989 1998-07-31 ~ ~ 9 7 / 0:1 6 8 7 ~ ~ e~ JA~

The sequence ofthe original 5' end ofthe gene for mature MB3 (from NT
l)is(SEQIDNOs:32 and 33):

gac gtt acc ctg tac ggc acc att aaa gcc ggc gta gaa act tcc cgc tct gta m cac cag aac ggc D V T L Y G T I K A G V E T S R S V F H Q N G

caa gtt act gaa gtt aca Q V T E V T

The codon-optimized sequence of the same fi~grn~nt (replaced nucleotides showed as capital letters), along with its corresponding amino acid sequence (SEQIDNO:34)is:

gac gtC acT Ttg tac ggT acT att aaG gcT ggT gtT gaG act tcc cgc tct gtam cac cag aac D V T L Y G T I K A G V E T S R S V F H Q N

ggc caa gtt act gaa gtt aca G Q V T E V T

Vector pHIL-Sl/MB3, C~ the codon-optimized MB3 DNA, :~ served as the template for the amplification of MB3 in a standard PCR.
Oligomers were syntllç~ d to serve as PCR ~ s. The PCR fragments of MB3 were inserted into Pichia ~ es~ion vectors either directly or by using the Original TA Cloning Kit (Invitrogen); details are given below.
For the cloning of MB3 into the EcoRI site of pHlL-D2:
Forward primer (39 nt, having an .ongin~red EcoRI site ~nd a sequence (5'ATG) encoding an initi~tion methionine):
5'-CGAGAATTCATGGACGTCAC~ lGTACGGTACTATTAAG-3'(SEQ
NO:35) Reverse primer (45 nt, having an engineered EcoRI site and stop codon):
5'-GCTGAATTCTTAGAATTTGTGGCGCAGACCGACACCGCCGGCAGT-3' (SEQ ID NO:36) AMENDEDSff~

-CA 02244989 1998-07-31 ~NS 9 7 ~ O 1 i8t - ~ ~ a2J~

For the cloning of MB3 into the EcoRI-AvrII sites of pPIC9 and pPIC9:
Forward primer (39 nucleotides (nt), having an engineered EcoRI site; no sequence encoding an initiation methionine was necessary because the leader peptide had an initiation methionine):
5'-AGCGAATTCGACGTCACTTTGTACGGTACTATTAAGGCT-3' (SEQ ID
NO:37) Reverse primer (36 nt, having an .?n~in~ered AvrII site and stop codon):
5'-CACCCTAGGTTAGAATTTGTGACGCAGACCGACACC-3' (SEQ ID
NO:38) For PCR ~mplifil~tion of the complete MB3 gene, Vent~ DNA
polymerase (NEB) was used. The fidelity ofthis polymerase is 5-15-fold higher than tbat observed for Taq DNA polymerase. To generate an t;x~le~sion c~sette plasmid, PCR fr~gment~ of MB3 (full length and tnln- ated fr~ment~) were inserted in Pichia t;~lession vectors either directly or using the Original TA
Cloning~ Kit (Invitrogen), which includes a pCRTMII vector for subcloning of PCR fr~nent~. Direct cloning of DNA amplified by either Vent~ DNA
polyrnerase or P,ti~ DNA polymerase into the vector pCR~MII is difficult, as thecloning efficiency is often very low. This is due to the 3' to 5' exonuclease proofreading activity of Vent~ and Ppu, which removes the 3' A overhangs that ~0 are nPc~C.~ for TA cloning, leaving blunt ends. The Original TA Cloning~ Kit allows these blunt-ended fr~gment.~ to be cloned. Use of this method ~limin~tes any c~,~lic modifications of the PCR product, and does not require the use of PCR l..;,.~c~s co~ ;..i.,g restriction sites. To increase the cloning efficiencyfurther, the Invitrogen protocol was modified as follows. Following amplification with Vent~ or PJ~ (see manual for The Original TA Cloning~ Kit, protocol for theaddition of 3'A-overhangs post amplification, p. 19), rather than placing the vial on ice, as recommended in the kit, the mineral oil in the PCR ~ e was immediately removed using ParafilmTM. This was accomplished by pouring the PCR ll~lul~ onto the P~r~film, and 7ig7~gin~ the drop down the surface of the Parafilm with a gentle rocking motion until all of the oil had adhered to the Parafilm surface. The reaction mixture, now free of oil, was then collected intoa ~esh tube. The Invitrogen protocol was then resumed with the AM~NDE~ .~H~ET

CA 02244989 1998-07-31 ~ ~ S 9 ~ / O 1 6 8 i addition of Taq polymerase. This method allowed the difficult cloning of PCR
fragmçnt~ into large cxprcs~ion vectors.
The cx~lci~ion c~sette of the inte~ting vector anvitrogen) contains the methanol-indllce~l AOXl promoter and its tçrmin~tor, flanked by stretches of S nucleotides up- and dowI~healll from the AOXl gene. The P. pastoris His4 gene served as an auxotrophic marker. These vectors do not contain a yeast ori, henceHis+ colonies must col.~,,~nd to intcgldLion ofthe ~ A~l~s~ion e~ccett~ All PCR
fr~mentc of MB3 were inserted in frame with a Pichia Kozak consensus sequence (CAAAAAACAA) (SEQ ID NO:39) (Cavenor et al. NucleicAcids Res.
19:3185-3192 (1991); Kozak Nucleic ~cids Res. 15:8125-8148 (1987); Kozak Proc. Natl. Acad. Sci. USA 87:8301-8305 (1990)) to provide the best tr~n~l~tion initiation of the MB3 gene. All insertc were placed under the control of the AOXl promoter to drive c~,c~ion ofthe gene of interest. After the ~ ti~n of the MB3 fi~m~nt in a~ a~ iate ~;A~lc~ion vector, ch~mic~lly con~clcllL
E. coli cells were transformed (TOP lOF') (F'{proAB, laqIq, lacZl~M15, TnlO
(TetR)} mcrA, /~(mrr-hsdPMS-mcrBC), dp80 lacZ~M15, /~lac~74, deoR, recAl, araD 139, ~ (ara-leu)7697, galU, galK, rpsL(St~), endA l, nupGA ) . Other strains which may be suitable are DH5a F', JM109, or any other strain that carries a selectable F' episome and is recA deficient (endA is preferable) (Pichia 'O Expression Kit Instruction Manual, Invitrogen). Colonies with an MB3 insert were used for the p~ dlion of CsCl purified maxi-prep of a plasmid DNA for Pichia ~a~r~,l.llation (Sambrook, J. er al., Eds., Molecular Cloning: A
Labora:toryManual. 2nd. Ed., Cold Spring Harbor Press (1989), pp. 1.42-1.43).
Restriction analysis and DNA sequencing (DNA Seqll~ncin~ Kit, Version 2 (USB)) confirmed that these constructs were correct.
Modification of the starting MB3 sequence was especially useful for intracellular c A~ sion ofthe porin gene (pHIL-D2/MB3 construct). Because the other constructs (pHIL-Sl/MB3 and pPIC9/MB3) used for MB3 secretion contained codons optimal for Pichia in the leader peptide sequence ~lleam of the MB3 insert, ~e initiation of tr~n~l~tion was not rate-limiting In contrast, the ~M~ ~

CA 02244989 l998-07-3l W O 97J28273 PCTnUS97J0168 pHIB-D2 vector does not include any leader sequence and the initiation of translation must be started from the rare codons of the MB3 insert. The optimization of this sequence is believed to be responsible for the fact that pHIL-D2/MB3 constructs gave the highest level of MB3 expression of any of the clones tested (Tables 3, 4).

Transformation of yeast ce/ls a~td DNA nnnlysis of integrmlts Plasmid DNA was linearized witll single or double (for higher integration efficiencies) digestion, and ~. pas~oris strain GS 1 l S (his4-) was transformed to the His~ phenotype by the spheroplast method using Zymolyase followed by adsorption of transforming DNA and penetration of this DNA through the spheroplast pores into the Pichia cells in the presence of PEG and Ca~ ~ (PichiaExpression Kit m~nll~l, Invitrogen. pp.33-38). By replica plating or patching onMinimal Dextrose (MD: 1.34% yeast nitrogen base (YNB - Difco), 4x10-5%
biotin, 2% dextrose) versus Minimal Methanol (MM: 1.34% YNE3, ~x10-5%
biotin, 0.5% methanol), it was possible to determine which His~ transformants also exhibited disruption of the ,4OXI gene. Transformed spheroplasts were seeded on agarose-conl~ining plates USillg selective growth medium withoul histidine (MD). At the end of 4-G days~ white separated colonies of yeast transformants had appeared. These colonies were picked up and were seeded on selective methanol-contzlinin~; medium (MM) for screening of AOXl -disrupted (Muts or Mut--) transforrnants (Pichia Expression Kit manual, Invitrogen, p. 60).

Growtll of tlteyeast and metllanol inductiolt Because recombination events can occur in many different ways which affect the level of protein expression (clonal variation)~ at least 16 verified recombinant clones were screened to determine the level of MB3 expression.
These colonies were grown in 5 ml of glycerol-containing Buffered Glycerol-W 097/28273 PCTrUS97/01687 complex Medium (BMGY: 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4x 10-5% biotin, 1.0% glycerol) (~ichia Expression Kit m~nll~l, Invitrogen, p. 61) at 30~C in 50 ml 2098 Bluemax tubes (Falcon) in an Innova incubator shaker (New Brunswick Sci.) ("pilot"
expression). After 1-2 days when cultures had reached an OD600 = 5-10, the cells were harvested by centrifugation (4000 rpm for 10 minutes at room telllp~.dLure) and were resuspended in methanol-containing Buffered Methanol-complex Medium (BMMY: 1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0, 1.34% YNB, 4x10-5% biotin, 0.5% methanol) (Pichia I0 Expression Kit manual, Invitrogen, p. 61) for the induction of the AOXI
promoter. To replenish exh~sted methanol, 0.5% of fresh methanol was added each day to induced cells. Aliquots of the cells were collected every day for 6 days by centrifugation, and stored (pellets and supernatants separately) at -70~C
before e~ rnining The most promising clones were examined for the optimi7:~tion of protein expression and to scale-up the expression protocol to produce more protein.

Lysis o~P. I astoris cells, nnalysis by SDS-PAGE al~d Wester~t blot annlysis Cells were broken by a~itation in breaking buffer ~50 mM sodium phosphate, pH 7.4; 1 mM PMSF(phenylmethylsulfonyl fluoride), I mM EDTA
and 5% glycerol). Equal volumes of acid-washed glass beads (0.5 mm in diameter) were added. The mixture was vortexed for a total of 4 min, 30 sec mixing each, followed by 30 sec on ice. The soluble fraction was recovered by centrifugation for 10 min at 14000 rpm at 4~C. Supernatant (or cell Iysate, or fraction of "soluble" proteins) was removed and stored at -70~C, and the residual cell pellet was extracted by vortexing with SDS sample buffer (1% SDS, 5%
beta-mercaptoethanol, 10% glycerol, 10 mM EDTA, 0.025% bromophenol blue) followed by boiling for 10 min. Lysates were centrifuged again and the aqueous layer was examined as fraction of "insoluble" or membrane associated proteins.

WC~ 97~28273 PCT~US97~0~687 NOVEX pre-cast 8-16% gradient gels were used for separation of proteins according to the procedure of Laemmli (Nature 227:680-685 (1970)). Proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were stained with Coomassie Brilliant Blue R250, or were transferred to polyvinylidene difluoride (PVDF) membrane using a Transblott apparatus (BioRad Laboratories) according to the company specification.
The Western blot procedure was carried out without detergents, using only blocking procedures, as described by Sheng and Schuster (Bio Technique 13:704-708 (1992)) with some modii~lcations. This method provides high specificity and sensitivity with a low background. For the transfer, both Western transfer membrane and the SDS-PAGE separating ~;el were equilibrated with transfer buffer (24mM Tris-HCI/192 mM glycine/ 20% methanol) for 20 minutes prior to electrotransfer. The transfer was perforlned at 90V and 4~C for 3-4 hours. Transfer of proteins to PVDF membranes was monitored by the transfer of prestained molecular weight markers (BRL).
Immunostaining of proteins was carricd o~lt as follows. The trallsfel membrane was rinsed with TBS (lOmM Tris-HCI/.09% NaCI, pH 7.2). The membrane was then incubated in 1% non fat dried milk PBS solution (M-PBS) with .02% sodium azide at 37~C for 3 hours (or al 4~C overni~llt). The membrane was then washed 3 times with TBS/0.5C/o BSA ~BSA/TBS) and once with TBS. The membrane was then incubated with the primaly mouse anti-MB3 antibody (mouse polyclonal antisera against purii;ed OMP class 3) diluted to about 1:4000 in PBS/1%BSA (BSAJPBS), and the membralle was again washed 3 times with TBS/0.5% BSA (BSA/TBS) and once with TBS. The membrane was then incubated in 1% M-PBS at room temperature ~or 30 minutes with gelltle .sll~kin~. The membrane was washed 3 times with TBS/0.5% BSA (BSA/TBS) and once with TBS. The membrane was then incubated in the secondary allialine phosphatase-conjugated anti-mouse antibody (Kirl~egaald & Perry Laboratory (KPL), Gaithersburg, MD) diluted 1:4000 in l % 13SAJPBS. The membrane was then washed 2 times witll 0.5% BSA/TBS and 3 tillles with .25% Twecn 20 in W O 97/28273 PCTrUS97/01687 PBS. These washing steps differed from those recommended by Sheng and Schuster; the improved protocol provided less background than did the wash steps of the reference, which utilized 6 washes in 0.5% BSA/PE~S. The membrane was then incubated in alkaline phosphatase buffer (0.05% M Tris-l ICI, S pll 9.5; l0 mM MgCl~), followed by incubation in BCIP/NBT substrate solution (KPL). The development was stopped by washing the membrane in PBS/50 mM
EDTA. The limit of detection was about 2-5 ng of native MB3 protein.

Results nnd discussion The strategy used to insert the cDNA encoding the mature MB3 into expression vectors and the steps using this construct for the transformation of P.
pastoris are outlined below. First, the MB3 gene is cloned into one of the 4 Pichia expression vectors. In the next step, the resulting construct is linearized by digestion with NotI or BglII, and his4 Pichia spheroplasts are transformed with the linearized construct. In the following step, a recombination event occurs in vivo between the 5 and 3'AOX1 sequences in the vector and in the genome, resulting in replacement of the AOXI gene with the MB3 gene. Next, the Pichia transformants are selected on histidine-deficient medium, on which only cells that have undergone gene replacement can grow. Tlle one-step f~ene replacement method described for 5. ce~ isiae (Rothstein. M~tl7. E~7~ ?ol.
101:202-211 (1983)) was successfully used by Cregg ~t ul. (Biolo~icul Re.sca~ch on Industrial Yeast Vol. Il Stewart e1 ul. ed.s. CRC Press, Boca Ratonl pp. I - I 8 (1987)) for the replacement of the ~. pustori.s AOXl structural gene.
Transformation of GS I 15 with l0 ,L~g of linearized expression vectors (pHlL-D'', plIIL-S1, pPlC9, and pPIC9K) with MB3 insert gave more than 100 colonies in each experiment. Thusl the procedure yielded >107 His' colonics per,ug DNA.
which is comparable to that reportcd for the best results of 1'. pu.stori.s transformations. These transformallts have the ability to ~row Oll histidilIe- ~
deficient medium (MD-minimz~l dextrose)~ and so are His . About 1 0-4û% Or these recombinants were "methanol slow" (Mut~ -- "methanol utilization slow"), i.e., demonstrated impaired growth on media such as MM (minimal methanol)~
which contains methanol as the sole carbon and energy source. These His+/Mut~
transformants are a result of the replacement of the AO~l structural gene with the MB3 expression cassette containing the Hist gene via a double crossover event. Recombination events may also occur as integration or insertion (single crossover events) of the expression cassette into the 5' or 3' AOX l region, which leaves the AOX1 gene intact. Among the His+/Muts clones, 25-35% were positive, MB3-expressing transformants (Table 2). Tl1e reason that tlle AC)Xl-deleted transformants grow at all on methanol mediuln is due to low-level expression of alcohol oxidase activity by the AOX~ ~ene product. Analysis of DNA isolated from these "positive" recombinants using PCR with 5' AOXI, 3' ~OXI, 5' MB3, 3' MB3 and other specific primers, indicated that theAOXI
structural gene was indeed replaced by the fragment containing tlle MB3 and HIS~ genes. Analysis of the DNA isolated from HisT/Mut transformants indicated that the AOXI structural gene was intact and that the entire vector cont:~inin~; His4 DNA had integrated elsewhere. Among 39 AOXl-disrupted transformants that expressed MB3, no His+/Mut~ transformants were found, indicating preference for tlle ~OXl replacement mode of integration.
The results of immunoblot analysis of 84 Pic~zia transformants indicated that one may express thc MB3 protein using all of the construcled recombinant plasmids, pHIL-D2/MB3, pHlL-Sl/MB3, pPlC9/MB3 and pl'lC9K/MB3 (Table 3). Thirty-nine clones were isolated that expressed the MB3 protein. Antigcnic specificity of expressed MB3 protein was examined and was confirmed by Westem blot analysis usin~ monoclonal and polyclonal antibodies raised a~ainst wild type N. m~ningi~i~lis OMP class 3. These results led to tlle conclusion tllat all of the expression vectors were correctly constructed, and that thc transformations of Pichi~ spheroplasts were properly performed.
The amount o~expressed MB3 was detemlined by densitometric scamlin~
of the Coomassie brilliant blue stained protein bands fractionated by SDS-PAGE

W O 97/28273 PCTrUS97/01687 using a Model GDS-7500 scanning densitometer (UVP Life Sci.) or Model IS-1000 densitometer (Alpha Innotech Corp.). Purified OMP class 3 extracted wild type of N. ~7~eningitidis was used as a standard. Based on the results (summarized in Table 3), the level of protein expression was estimated to be S moderate to high.
The optimization of the translation elongation rate for the expression of the MB3 gene (see Materials and Methods, above) was very useful. The modification of the starting MB3 sequence was especially effective for intracellular expression of the porin gene (pHlL-D2/MB3 construct). Because other constructs (pHIL-S1/MB3 and pPIC9/M133, both used for MB3 secretion) contained codons optimal for Pichi~J in the leader peptide sequence upstream of the MB3 insert, the initiation of translation of these cassettes was not rate-limiting. In contrast, the pHIL-D2/MB3 construct did not include a leader sequence, and so without codon optimization, translation would have had to have been initiated at rare codons of the MB3 insert. The codon-optimized p~IL-D2/MB3 construct, when transformed into Pichi~J chromosomal DNA, provided the highest level of MB3 expression of all the other mentioned MB3 expression constructs (Tables 3 and 4). Thus, this modification of the translation start sequence of MB3 appears to be responsible for the high yield of expressed protein in pl IIL-D2/MB3 constructs.
The level oi MB3 expression by the best clones (l'ic~ia transformed with the prIIL-D2/MB3 construct) was in the range of 0.1-0.6 g per lL of cell suspension, or 1-3 mg per g of cell pellel; (Table 3, Fig. 12). Such efficiency of expression in yeast has been reported i~or many of the following manufactured 2~ proteins: hepatitis B surface antigen (0.3 g/L), superoxide dismutase (0.75 g/L), bovine and human Iysozyme (0.3 and 0.7 g/L, respectively)~ human and mouse epidermal growth factors (0.5 and 0.45 g/L respectivel~). human insulin-like growth factor (0.5 g/L), human interleukin-2 ( 1.0 g/L), aprotinin analog (0.8 g/L).
Kunitz protease inhibitor (1.0 g/L)~ etc. (Cregg e~ crl., Bio~echnolo~ 903-906, Table 1 (1993)).

CA 02244989 l998-07-3l W O 97J28273 PCTnUS97JO1687 It should be emphasized that all of the previously listed levels of expression for manufactured proteins are the result of production of these proteins during fermentation in high cell density fermentors. MB3 was expressed lltili7.in~
only sha3ce flask cultures which, as a rule, provide much lower expression levels than does fermentation. Recently reported observations lead one to expect a much higher yield (a 5-10 fold or greater increase) of MB3 in a fermenter (Cregget al., 1993). P. pas~oris adapts well to being scaled up from shake flask to lligh density fermentor cultures. In addition, where AOX-deleted ~ichia strains are used for fermentation, production of foreign proteins can be optimized by first causing rapid growth, and then adding methanol to induce protein production while minimizing additional cell ~rowth. The long amount of time needed to produce proteins when Pichia is growing on methanol can be reduced by applying one of several mixed-feed fermentation strategies (Siegel et al., Biotechnol. Bioeng 34:403-404 (1989); Brierley et al., Int. Patent Application No. WO 90/03431 (1989); Brierly et al., Biochen~. Eng 589:350-362 (1990);
Siegel et al., Int. Patent Application No. WO 90/10697 (1990)).
Another promising aspect of the expression levels of MB3 protein in Pichia is that the results were similar for all examined clones. As otller investigators have found that in shake flask induction the level of expression is proportional to the number of copies of inserted gene of irlterest (Clare et al., 1991), it can be deduced that all of the MB3 clones tested were single-copy chromosomal integrants, and thus that no Pichia recombinants with multiple integrated copies of the MB3 fragment were isolated.
An important factor in obtaining high levels of expression using P. pastoris is the ability to obtain recombinants with multicopy transplacement or integration (Romanos et al., Vaccine 9:901-906 (1991); Clare et al., Bio/Technology 9:455-460 (1991); Clare et al., Gene 105:205-121 (1991)). .
Multicopy transformants have been found to be surprisingly stable over multiple generations during growth and induction in higll cell density fermentations.
Since this multiple gene insertion event occurs at a low t'requency during CA 02244989 1998-07-31 ~ .tllC! C~-7 r '~ 1 ' Q
r ~

spheroplast transformation, a special dot blot screening of a number of recombinants is used (Scorrer et al., Bio/Technology 12:181-184 (1993)). An alternative to screening for spontaneous multiple insertion events is to insert multiple copies of the gene(s) of interest into Pichia expression vector pAO815,which h~ recently been constructed by Invitrogen for this purpose.
Before ~llcn~liilg to express MB3, the protein w~ evaluated to ~lct~ormine if any ofthe factors believed to reduce e~lt;s~ion levels were present. One ofthe factors which can reduce ~pecte~l high-level accumulation of a protein is proteolytic stability. It is now known that highly expressed proteins are devoidof good PEST sequences. PEST sequences contain proline (P), gll~t~mic acid (E), . serine (S) and threonine (1~, and are found in all rapidly degraded eukaryotic oteills of known sequence; such pr~teills have been irnplicated as favored substrates for calcium-activated proteases (Rogers et al., Science 234:364-369 (1986)). Proteins that are t;x~ressed at high levels in yeast do not contain a so-called "good" PEST sequence (having a score ~5 as calculated by the algo~
developed by Rogers et aL (1986)), which leads to susceptibility to proteolysis,nor do they contain the pentapeptide sequences XFXRQ (SEQ ID NO:41) or QR~FX (SEQ ID NO:42) (X=any amino acid), which are selective for degradation of cytopl~mic proteins by the lysosomal p~l~lw~y (Dice, J.F., Fed.
'O Am.Soc. Exp. Biol. (FASEB) ~ 1:349-357 (1987)). Proteins that are c~ ,s~d at high levels in yeast do not contain these pt;ll~l,e~.lide sequences. Computer analysis of the MB3 sequence i(1enti~ed a "poor" but not "good" PEST region (13-32aa) having the sequence C~RSVFHQNGQV:I~V:~:AT) (SEQ ID
NO:40). According Rogers et aL (1986) such a poor PEST sequence weakly influences the proteolytic stability of eukaryotic proteins. Thus, one of the factors which leads to proteolysis is not present in MB3.
MB3 also does not contain the highly conserved ~lll~cl~Lide sequences mentioned above. The sequence E~QSEI (SEQ ID NO:43) (75-79aa) is present in MB3; this sequence displays some homology to the degradation pentapeptide QRXFX (SEQ ID NO:42), but is not believed to greatly destabilize MB3.

AM~N~ ~

W O 97/28273 PCTJUS97)D1687 The nature of tlle NH2-terminal amino acid residue can also be an important factor in the susceptibility of a protein to degradation. Varshavsky el al. have demonstrated that the presence of certain amino acids at tlle NH,-terminus provide a stabilizing effect against rapid degradation by ubiquitin-mediated pathways (the N-end rule pathway) (Varshavsky et al. Yeasl Genetic Engineering, Butterworths, pp. 109-143 ( 1989)). Most proteins that are expressed at high levels in yeast have a stabili~ing amino-terminus amino acid residue (A, C, G, M, S, T or V). Examples oi' such proteins include human superoxide dismutase, human tumor necrosis factor, phosphoglycerate kinase from S. cerevisiae, invertase from S. cerevisiae, alcohol oxidase from P. pastoris~
and extracellular alkaline protease from Y. li~701ylica (Sreekrishna et al., Biochemistry 28:4l l 7-4125 (1989)). Althougll MB3 is expressed well in yeast, the NH~-terminal aspartic acid (D) of MB3 does not provide a stabilizin~ ei'fectagainst rapid degradation by ubiquitin-mediated pathways.
It is possible that the NH,-terminal aspartic acid of MB3 will play a role in the level of MB3 produced from Pi~hia in large scale production. Replacing the first amino acid of MB3 with one of the amino acids known to stabilize the NH~-terminus of proteins, mentioned above, could improve the level of MB3 production.
It was decided to proceed with experimellts attempting to express ME~3 in yeast, as most of the factors known to reduce expression levels were not present in MB3.
The best expression o~ MB3 was provided by richi~l clones trans1'ormed with the pHIL-D2/MB3 expression cassette (Tables 3 and 4). This p~IIL-D2 vector generated intracellular expression of complete, monomeric, non-fusion, non-secreted MB3 with an expected MW of about 34 kDa. These clones provided tlle highest level of expression oi' MB3~ up to 600 mg/L or 3 mg per g of wet cell pellet (Table 4). About 90-95% of this product was insoluble, membrane-associated material, i. e., material which sediments upon centri-3() fugation for 5 min at lO,OOOg. and that can be extracted b~ treatment with SDS-W 097/28273 PCTrUS97/01687 cont~inin~ buffer (PAGE sample buffer) followed by boiling. The protein can then be renatured to a conformation that can be easily recognized by an anti-meningococcal OMP class 3 antibody.
Induction of p~IIL-D2/MB3 constructed clones with methanol resulted in the rapid expression and fast accumulation of intracellular MB3. After 24 hours of a methanol induction, the ievel of expressed MB3 was estimated at not less than 80% of maximal, which was reached after 5-6 days.
The pHIL-D2/MB3-cont~inin~ Pichicl recombinant is the most promising for commercial production. This clone provides relatively high levels of expression which could be significantly improved by using multiple-copy recombinants, and by producing the protein in a fermentor. The fact that MB3 is rapidly produced also provides an advantage for large scale manufacture.
MB3 expressed in an intracellular form was purified by a denaturation/renaturation protocol, followed by gel filtration and ion exchange chromatography. The resultant purified protein exhibits an elution profile on size exclusion chromatography that resembles the recombinant class 3 protein overexpressed in E. coli. MB3 expressed by either ~: coli or 1'. /~asloris co-elutes with the native wild-type counterpart~ indicating that MB3 expressed by either E. coli or P. pastoris refolds and oli~omerizes~ achievin~ full native conforn1ation (Figs. 1 4A and 1 4B).
Both the native (Pichia) secretion signal (PI101) and the alpha-i'actor signal sequence from S. cere-~isiae were tested f~r tar~etin~ expressed porin tothe secretar~ pathway. Unexpectedly~ the shorter PHOI leader was more efl'ective for causing MB3 secretion. The pHIL-SI I~ichia transfer vector includes a sequence encoding tlle '~ .5 kDa PHO 1 leader peptide~ a secretion siL~nal peptide of P. pasto~i~. In tl1e pHIL-SI/MB3 constrLlct, the sequence encodin~
MB3 was inserted downstream of the PI-IOI leader sequence. 40-50% of the 36.5 kDa expressed fusion protein PHOI/MB3 produced by pHIL-Sl/MB3 cloncs was properly cleaved to ~enerate a 34 kDa MB3 mononler (Tables ~ and 3), and 5-10% of expressed soluble porin was secreted. The pPlC9 and pPlC9K

WO g7/2827~ PCT~US97JD1687 Pichia transfer vectors include a sequence encoding the 10 kDa alpha-factor leader derived from S. cerevisiae. Pichia clones transformed by pPIC9/MB3 or pPIC9K/MB3 did not secrete porin. These recombinants expressed a 44 kDa alpha-factor prepro/MB3 fusion protein well, but no evidence of correct cleavage and processing was observed. Improved secretion of expressed MB3 was not obtained by using its 3' truncated fragment fused witl1 either PHOI
leader or alpha-factor leader peptides.

Example 10. Isolation, purif cation nnd characterizntion of MB3 profein expressed as a secretory profein 1~) Yeast cells cultures harboring Ihe expression vector containing the gene for MB3 (pHIL-Sl-pNV318) were configured to isolate the protein as soluble secreted material). The supernatant was clarified by precipitation witl1 20%
ethanol (v/v) to remove cont~min~tin~ yeast cultule impurities. The supernatant was then precipitated with 80% ethanol (v/v). The resulting pellet was washed with TEN buffer (Tris HCI, pH 8.0, 100 mM NaCl and 1 mM EDTA), in order to remove other hydrosoluble contaminating secreted proteins. The pellet containing MB3 was dissolved in an aqueous solution of detergent (solubilizing buffer), comprised of TEN buffer with 5% Z 3-14. The solution was applied to a Hi-Trap Q ~epharose ion exchange column (I ml) (Pharmacia) equilibrated in 50 mM Tris, 0.2 M NaCl and 1.0 mM EDTA (pH 8.0). A gradient of 0.2-1.0 M
NaCI was applied. and MB3 protein eluted as a single peak.

Example 11. Isolation, purif cation nnd ckaracterization of MB3 protein expressed as an insoluble-membrane bound protein Yeast cells cultures harboring the expression vector cont~ining the gene for MB3 (pHILD-2--pNV322) (see Table 3) were resuspended in breaking buffer W O 97/28273 PCTrUS97/01687 (i.e., 50 mM sodium phosphate buffer, pH 7.4, 1 mM EDTA, and 5% glycerol), to a concentration equivalent to 50-100 ODs. The suspension was added to the same volume of acid treated glass beads. The suspension was Iysed using a Minibead-Beater (Biospec Products, Bartlesville, OK), in 8 consecutive cycles of 1 min each, followed by 1 min on ice, between each cycle. As an alternative procedure, the Iysis process was facilitated by the addition of Zymolase to the breaking buffer. The suspension was transferred to a glass sintered filter to separate the glass beads, and the cell suspension was collected in the filtrate. The beads were further washed and tl e filtrates combined. The suspension was then centrifugcd at 12,000 rpm for 15 min at 4~C. A series of consecutive washing steps was applied to the resultant pellet~ consisting of the following: (a) TEN
(Tris HCl, pH 8.0, 100 mM NaCI, and 1 mM EDTA) containing 0.5%
deoxycholate; (b) TEN containing 0.1% SDS and 1% Nonidet, after which the suspension was rotated for 30 min at 25~C; (c) washing with TEN buffer; and (d) washing with TEN buffer containing 5% Z 3-14. under rotation overnight at 4~C. Each washing step was followed by centrifugation at 12,00Q rpm for 10 min at 4~C to collect the pellet for the following step. As an alternative method ofwashing the pellet, tlle suspension was passed through an 18 ~auge needle in lieu of rotation in steps (b) and (d). Finally, the MB3 was extracted Witl1 8M urea~ or 6M guanadinium HCI, and the extract was sohicated for 10 mill, using a water bath sonicator. The extract was clarified by centrifugation (17~000 rpm, for 10 min at 4~C), ~he same volume of a 10% aqueous solution of 3,14-zwittergen (Calbiochem) was added and the solution thoroughly mixed. The solution was again sonicated for 10 min. Any residual material was removed by ccntrifugation. This mix~ure was then applied to a Sephacryl S-300 (5x100 cm) column (Pharmacia~ equilibrated in a buffer comprised of 0.1 M Tris-~ ICl, 0.2 MNaCI, 10 mM EDTA, 20 mM CaCI~ and 0.05% Z 3-14 (pll 8.0). Fractions cont~inin~ class 2 protein were identified by SDS-PAGE, pooled, and applied to a Hi-Trap Q Sepharose ion exchange column ( 1 ml) (Pharmacia) equilibrated in 50-mM Tris, 0.2 M NaCl and 1.0 mM EDTA (pH 8.0). A gradient of 0.2-1.0 M

W O 97128273 PCT~USg71~1C~7 NaCI was applied and MB3 protein eluted as a single peak. Figures 1 4A, I 4B
and 15 depict the elution profile of purified MB3 in a Sepharose 12 (Pharmacia) connected to an HPLC (Hewlett Packard, model 1090). Based on the comparison with the native wild-type class 3 protein, as well as calibration using molecular weight standards, the elution profile is indicative of trimeric assembly.

Ex~lmple 12. Preparation of ~AMP-TT Conjllgate 12.1 Prepnratio~ of NMA polysaccll~lri~le for conjllgatioll. ~
meningitidis group A (NMA) strain 604 A was grown in modified Franz medium (Franz, I. D., J. Bacf. 73:757-761 (1942). Precipitation of the polysaccharide as ~V a cationic detergent complex followed by fractional precipitation with ethanol provided the high molecular NMA capsular polysaccharide. The high molecular weigllt polysaccharide was further purified by ultra filtration. Partial hydrolysis ofthe polysaccharide with 100 mM sodium acetate buffer pH 5.0 at 70~C yielded a low molecular weight polysaccharide in the range of 10~000-20,000 daltons.
The free reducing terminal residue of the polysaccharide was reduced with NaBH4 in the cold to preserve O-acetyl substituents and then oxidized with sodium periodate to generate terminal aldehyde groups. The oxidized polysaccharide was the purified and fractionated by size exclusion chromatography to provide activated group A meningococcal polysaccharide (GAMP) of average molecular weight about 13,000 daltons.
12.2 Preparafion of GAMP-TT co~ljugafe. Tetanus toxoid (Serum Statens Institute, Denmark) was first purified to its monomeric form (mw 150,000) by size exclusion chromatography using a Superdex G-200 column ~Pharmacia). Freeze-dried tetanus toxoid monomer (1 part by weight) and oxidized GAMP (2.5 part by weight) were dissolved in 0.2 M phosphate buffer pH 7.5. ~ecrystallized NaBH3CN (1 part) was added and the reaction mixture incubated at 37~C for 4 days. The conjugate was purified from the free components by size exclusion chromatography using a Superdex G-200 column W O 97/28Z73 PCT~US97/01687 (Pharmacia), and PBS containing 0.01% thimerosal as an eluent. Purified GAMP-tetanus toxoid conjugate was stored at 4~C in this buffer. The polysaccharide content of the conjugate based on phosphorus analysis (Chen assay) was about 18-20% by weight.

Example 13. Prep(lration of GCMP-TT Conjl~gate 13.1 PrepQrntion of NMC polysnccllari~le for conjugntion. The capsular polysaccharide was isolated from the growth medium of Neisseria meningitidis group C ~NMC3 strain C 11. This strain was grown in modified Franz medium. The NMC polysaccharide (group C meningococcal polysaccharide (GCMP)) was isolated from the culture medium by cetavlon precipitation as described for the GAMP. Native GCMP was O-deacetylated with.
base and depolymerized by oxidative cleavage with NaIO4 to an average molecular weight of 10,000-20,000. The cleaved polysaccharide was sized and purified by gel filtration chromatography to provide a hi~hly purified product of average molecular weight about 12,000 daltons and having aldehyde groups at both termini.
13.2 Preparntion of CCMP-TTcl7njl gote. Tetanus toxoid monomer (1 part) and solid oxidized GCMP ~1 part) were dissolved in 0.2 M phosphate buffer pH 7.5 and incubated at 37~C with 1 part of recrystallized NaBT T3CN for 4 days. The conjugate was purified from its free components by gel filtration chromatography on Superdex G-200 using PBS containing 0.01% thimerosal as eluent. The purified conjugate was stored at 4~C prior to being formulated for animal studies. The content of the polysaccharide in the conjugate was 33%
based on its sialic acid content as measured by the Svennerholm resorcinol assay(siochi~2. Biophys. Acta 244:604-~1 1 (1957).

CA 02244989 l998-07-3l W O 97l28273 P~TnUS97J~1687 Example 14. Prepnration of N-Propionyl Group B Meningococcal Polysnccll nride-rPorB Conjugnf e 14.1 Preparation of Neisseria rPorB. Expression of class 3 N.
meningitidis porin protein (PorB) in E. coli and purification of porin gene products is described supra. The recombinant rPorB protein was purified by using a sephacryl S-300 molecular sieve column equilibrated with 100 mM Tris-HCI, 200 nM NaCI, 10 mM EDTA, 0.05% Zwittergen 3, 14 (Calbiochem. La Jolla, CA), 0.02% sodium azide pH 8Ø The protein fractions as measured by their OD280 eluting with an apparent molecular weight of trimers were pooled anddiafiltered against 0.25 M HEPES,0.25 M NaCI, 0.05% Zwittergen 3,14 pH 8.5 to a concentration of 10-12 mg/ml.
14.2 Preparation of N-propiorl~lnte~l Croup B Meningococcal Polysaccllaride (GBMP). The N-propionylated GBMP and its oxidized form were prepared as described in U.S. Patent No. 4,727,136 and l~PO 0504202, both of which are fully incorporated by reference herein.
14.3 Preparation of N-Pr-GBMP-rPorB c~l~jugnte. To 10 mg Or oxidized N-Pr-GBMP of avcrage molecular weigllt 12.000 was added 33 ,ul of a 12 mg/ml of rPorB protein in 0.25 M HEPES, 0.''~% M NaCI~ 0.05% Zwittergen 3, 14, pH 8.5. The solution was mixed until all solid dissolved and 6.~ ng oi recrystallized NaBH3CN was added. The solution was incubated at 37~C for 4 days and the conjugate was purified from the mixture by USillg a Supeldex G-200 column (Pharmacia) equilibra~ed with PBS -0.0% thimerosal. Protein iiactions were combined and stored at 4~C. The conjugates were ana}yzed f'or theil sialic acid content by the resorcinol assay and for proteill with the Pierce Coomassie Plus assay. The resulling conjugate had a polysaccharide content of about 20-~5% and is devoid of any pyrogens as measured by the LAL and rabbit pyrogenicity tests.

W O 97/~8273 rCT~US97/01687 - ~0 -Example 15. Ann/ysis of Conjllgates by C~rpill ry Electroplloresis 15.1 System and metltod Analysis was performed by Capillary Zone Electrophoresis on a Beckman 2000 Series CE system (Beckman Instruments Inc., Fullerton, CA) using an untreated fused silica capillary of dimensions 47 cm S total length (40 cm effective length) by 50 llm i.d. (375 llm o.d.) and 0.4N borate buf'fer, pl:I 10.2 as electrolyte (Hewlett Packard, Palo Alto, CA). System control and data acquisition was performed using Beckman Gold system software. The voltage was set at 25 KV and the detector was set to 200 nm detection wavelength. The capillary temperature was set to 20~C. The capillary was conditioned between runs with a high pressure rinse for 2.0 minutes witl1 O. l Msodium hydroxide followed by 2.0 minutes with deionized water. All samples were pressure injected. All buffer and sample media were filtered through an appropriate 0.2 ~m membrane filter and degassed pr;or to use.
15.2 Analysis of Conjllgates. After purification the conjugates were concentrated by ultrafiltration througl1 an Amicol1 Centricon-3 concentrator (Amicon, Inc., Beverly, MA). Meningococcal polysaccharide and tetanus toxoid monomer calibration samples were prepared in deionized water at a concentration of 0.25 mg/ml and 0.28 mg/n1l, respectively. The method was determincd to be selective for the glycoprotein and conjugate components with adjacent components being completely separated (Rs> l .5), as demonstrated in the electropherograms of the polysaccharides ancl protein spiked glycoprotein conjugates ~Fig. 20 and Fig. 21). Fi~,. 0 sl1ows tlle GAMP-TT conjugate spiked with GAMP and TT-monomer conjugate components~ while Fig. 71 shows the GCMP-TT conjugate spiked with GCMP and TT-mollomer conjugate 2~ components. The lower limit of detection (LLD3 for the free form polysaccharide and protein components for the method was determined to be in the subnanogram level. A lower limit of quantitation (LLQ) of applo~ 1ately 0.6 n~ was obtained for the frec form of each component. A linear response was obtail1ed f'or tl1e selected total mass of each component. A lil1ear response was obtailled for thc CA 02244989 l998-07-3l W O 9712~73 P~TnUS97101687 -selected total mass range of 0.6-~.6 ng and 0.6-2.4 ng for the polysaccharide and protein, respectively, with a coefficient of determination of 0.99 for both curves.
Using this CZE based assay, analysis of a meningococcal polysaccharide-tetanus toxoid conjugate indicated a free polysaccharide content of less than about 5%
and a free protein content of less than about 2%.

Example 16. ImmunizQtion and Imn~unonssnys 16.1 Trivalent conjugate vaccil~e fornzulafio~l. Each individual conjugate component (A, B, C) was absorbed onto Aluminum hydroxide (Al(OH)3) Alhydrogel (Superfos, Denmark) at a final Al concentration of I0 1 mg/ml of the trivalent vaccine. Three vaccines were formulated in which the doses of each conjugated polysaccharide varied. Formulations had either about 2 ~g of each A, B, and C conjugated polysaccharide; or about 2 ,ug A conjugated polysaccharide, about 5 ,ug B conjugated polysaccharide and about 211g C
conjugated polysaccharide; or about S llg of each A, B, and C conjugated polysaccharide per dose of 0.2 ml of PBS, 0.01% thimerosal.
16.2 Immul11zntiolt~ Female Balb/c mice (Charles River Laboratories) 4-6 weeL~s old, were injected i.p. at days 0, 28. and 4'7. Bleeds were performedat days 0, 14, 28, and 4~. and mice were finally exsanguinated at day 5~. Sera were stored at -70~C prior to serological analysis.
16.3 ll~tntunonssays:
ELISAs: Antibody titers to each A, N-propionylated B and C polysaccharides were (let~rrnined by ELISA using the corresponding HSA conjugates as coating antigen (Figs. 22, 23, and 24). Antibody titer was defined as the x-axis intercept of the linear regression curve of absorbance vs. absorbance x dilution fac~or.
~. 25 Bactericidal Assays: Bactericidal assays were peri'ormed using baby rabbit serum as a source of complement and N. meningi~ i.s strains H 44/76 (Serotype 15), Cl I and Al respectively used as group B meningococcal, group C
meningococcal, and group A meningococcal or~anisms in this assay (Figs. ~5, W O 97/28273 PCTrUS97/01687 26, and 27). Bactericidal titer was defined as the serum dilution producing 50%
reduction in viable counts.
Having now fully described this invention, it will be understood by those of ordinary skill in the art that the invention can be practiced within a wide and equivalent range of conditions, ~ormulations and other parameters without affecting the scope of the invention or any embodiment thereof. All patents and publications cited herein are fully incorporated by reference herein in their entirety.

W 0 97/28273 PCTnUS97101687 Table 1. ELISA and Bactericidal Titers of Group B Meningococcal Conjugate Vaccines (N-Pr GBMP-Protein) ELISA E~actericida Vaccine AdjuvantTiterI Titer Saline 5,400 0 N-Pr GBMP- Al(OH)313,000 0 TT STl 17,000 0 CFA2 40,000 800 Saline20,000 500 Saline22,000 150 Saline39~000 960 Al(0~)393,000 200 N-Pr GBMP-PP Al(OH)3166,000>3,200 Al(OH)3130,0001~200 ST 53P00 1~000 ST 29,000 1,700 ST 72,000 1.500 Saline > 100 0 N-Pr GBMP Al(OEI)3>100 0 ST > 100 0 Saline > 100 0 PP Al(OH)'~100 0 'ST = Stearyl tyrosine.
2CFA = Complete Freund's Adjuvant W O 97/28273 PCTrUS97/01687 -g4-Table 2. Efficacy of a transformation of yeast ~P;chia) cells ConstructNumber of analyzed MB~ ex~ressed transforn~ants transformants Number of positive '~, from total pHIL-D2 / MB3 3'' 9 28 pHIL-Sl /MB3 23 8 35 pPIC9 / MB3 16 4 '75 pPlC9K/ MB3 16 5 31 w og7n8273 PCTnUS971~1687 Table 3. l~xpression of MB3 rlorin pr~tein with recombinant Pic/lia pasforis .
Code Clone Vector Level of expression Secretion AMVAX mg / g m~ / L
pnv 311 Sl/MB3/3/spHlL-SI ND20 - 30 0 pnv312 Sl/MB3/5/spHlL-Sl ND30-40 0 pnv313 Sl/MB3/7/spHlL-SI ND30-40 0 pnv314 Sl/MB3/12/spHlL-SI ND20-30 5- 10 pnv 315 Sl/MB3/15/spHlL-SI ND20 - 30 0 pnv316 Sl/MB3tl8/spHlL-SI ND80- 100 5- 10 pnv317 Sl/MB3/22/spHlL-SI ND50-60 5- 10 pnv318 Sl/MB3/23/spHlL-SI ND300-400 5- 10 pnv 321 D2/MB3/1-7/spHlL-D~ 2.4480 0 pnv 322 D2/MB3/2-1/spHlL-D2 3.0600 0 pnv 323 D2/MB3/2-6/spHlL-D2 1.7340 0 pnv 324 D2/MB3/2-8/spHlL-D2 1.6320 0 pnv 325 D2/MB3/4-1/spHlL-D2 1.7340 0 pnv 326 D2/MB3/4-3/spHlL-D2 2.4480 0 pnv 327 D2/MB3/4-4/spHlL-D2 2.4480 0 pnv 328 D2/MB3/4-5/spHlL-D2 2.4480 0 pnv 329 D2/MB3/4-26/spHlL-D2 2.44~50 () pnv 341 P9/MB3/1-46/spPlC-9 ND10 - 20 0 pnv 342 P9/MB3/1-261/s pPlC-9ND 80 - 100 0 pnv 343 P9/MB3/1-263/s pPlC-9ND 20 - 30 0 pnv 344 P9/MB3/1-268/s pPlC-9ND 20 - 30 0 pl1V 345 9K/MB3/T113-4/s pPlC-91C ND 151) - 200 5 pnv346 9K/MB3/Tr/3-5/s pPlC-9K ND 100- 150 0 pllV 347 9K/MB3/Tr/3-6/s pPlC-91i ND 100 - 150 0 pnv 348 9K/MB3/Tr/3-8/s pPlC-9K ND 80 - 100 0 pnv349 91C/MB3/Tr/3-9/s pPlC-9K ND 80- 100 0 WO 97/28273 ~CT/US97/01687 Code Clone Vector Level of expression Secretion AMVAX mg/g mg/L
pnv 350 9K/MB3/6-1/s pPlC-9K ND 150 - 200 0 pnv 351 9K/MB3/6-2/s pPlC-9K ND 100 - 150 0 pnv 352 9K/MB3/6-3/s pPlC-9K ND 100 - 150 0 pnv 353 9K/MB3/6-5/s pPlC-9K ND 80 - 100 0 pnv 354 9K/MB3/6-9/s pPlC-9K ND 80 - 100 0 pnv 355 9K/MB3/8-22/s pPlC-9K ND 150 - 200 0 pnv 356 9K/MB3/9-5/s pPlC-9K ND 80 - 100 0 pnv 357 9K/MB3/10-20/s pPlC-9K ND 80 - 100 0 pnv 358 9K/MB3/10-33/s pPlC-9K ND 80 - 100 0 pnv 359 9K/MB3/Tr/l l- pPlC-9K ND 150 - 200 0 pnv 360 9K/MB3/Tr/l l- pPlC-9K ND 150 - 200 0 pnv361 9K/MB3/Tr/ll- pPlC-9K ND 80- 100 0 pnv 362 9K/MB3/Tr/l l- pPlC-9K ND 80 - 100 0 W O 97~2827~ PCTnUS97~01687 Table 4. The expression of MB3 by recombinant clones with different expression cassettes. The main characteristic of the best clones.
.

pnv318 pnv322 pnv345 pnv350 CODE: sl/MB3/ D1/MB3/2- 9K/MB3/Tr/3- 9K/MB3/6-23ls 1/s 41s I/s CHARACTERISTIC:
Expression vector pHIL-SI pHlL-D2 pPlC 9K pPlC 9K
Fused leader PHOI NO a-factor(lOkDa) a-I)eptide (2.5kDa) factor( 1 OKDa) Promoter for AOX1 AOX1 AOX1 AOXl Size of expr. 34.0; 34 OkDa 43kDa 44kDa protein(s) 37.5kDa Cleavage Cleavage NO NO NO
(Processing) (40-50%) Secretion <WleOaO/o~ NO NO NO
MB3 degradation <10% <10% <10% <10%
Express 2.0 3.0 2.0 1.5 level(mg/g) l~xpression Level300 0 600.0 150.0 150.0 Cytosol 60-70% 5- 1 0% 50~/0 50%
locali-~ation Mcmbrane 30-40% 90 95% 50% 50%
association Solubility Partly InsolublePartly solub3ePartly soluble W O 97/28273 PCT~US97/01687 Table 5. Codon Usage for Picltin pastoris and MB3 Pichia pastoris codon usage TTT phe F I I TCT ser S ] 3 TAT tyr Y 6 TGT cys C
TTC phe F 5 TCC ser S 9 TAC tyr Y 8 TGC cys C
TTA leu L 3 TCA ser S ~ TAA OCH Z - TGA OPA Z
TTG leu L 26 TCG ser S 3 TAG AMB Z - TGG trp W 3 CCT leu L 4 CCT pro P 6 CAT his H - CTG arg R 4 CTC leu L I CCC pro P S CAC his H 3 CGC arg R
CTA leu L 4 CCA pro P 4 CAA glrl Q 1~ CGA arg R
CTG leu 1, 8 CCG pro P I CAG gln Q I CGG arg R
ATT ile 1 8 ACT thr T 17 AAT asn N 9 AGT ser S 6 ATC ile 1 7 ACC thr T S AAC asn N ~ AGC ser S
ATA ile 1 3 ACA thr T S AAA Iys i~ 15 AGA arg R 6 ATG ile M 4 ACG thr T 1 AAG Iys ~ 14 AGG arg R 6 GTT val V 15 GCT ala A 17 GAT asp D I S GGT gl!~ G 13 GTC val V 6 GCC ala A 6 GAC asp D I ~ GGC gl~ G S
GTA val V ~ GCA ala A 9 GAA glu E ~3 GGA gly G 6 GTG val V 1 0 GCG ala A I GAG glu E 11 GGG glv G

Outer membrane group B porin protein class 3 (MB3) codon usa~;e TTT phe F ~ TCT ser S g TAT tyr Y ~ TGT c~s C
TTC phc F I I TCC ser S 7 TAC tyr Y I I TGC c~s C
TTA leu L I TCA ser S - TAA OC}-I Z I TGA OPA Z
TTG leu 1, 1 I TCG ser S ~ TAG AMB Z - TGG trp W
CCT leu L ? CCT pro P ~ CAT his H ~ CTG arg R
CTC leu L 3 CCC pro P 3 CAC his H 7 CGC arg R 8 CTA leu L - CCA pro P - CAA ghl Q 10 CGA arg R
CTG leu L 7 CCG pro P - CAG glll Q ~ CGG arl R
ATT ilc I S ACT thr T S AAT asn N 6 AGT ser S
ATC iic 1 7 ACC thr T 7 AAC asn N I AGC ser S 9 ATA ile I - ACA thr T - AAA Iys ~ ~1 AGA arg R
ATG met M ~ ACG thr T I AAG Iys ~ ~ AGG arg R
GTT val V I O GCT ala A ~ GAT asp D 9 GGT gl~ G l-iGTC val V S GCC ala A 7 GAC asp D I ~ GGC ~Iy Ci ~3 GTA val V 9 GCA ala A 9 GAA glu E I I GGA gl~ G
GTG v~l V 7 GCG ala A ~ GAG glu E ~ GGG ~ G

g 97~687 -88.1- ;' SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: NORTH AMERICAN VACCINE, INC.

BELTSVILLE, MD 20705 UNITED STATES OF AMERICA
APPLICANT/INVENTORS: TAI, JOSEPH Y.
DONETS, MIKHAIL
WANG, MING-DER
LIANG, SHU-MEI
POLVINO-BODNAR, MARYELLEN
MINETTI, CONCIECAO A.S.A ' MICHON, FRANCIS
(ii) TITLE OF INVENTION: EXPRESSION OF GROUP B NEISSERIA
MENINGIDITIS OUTER MEMBRANE (MB3) PROTEIN FROM YEAST AND
VACCINES
(iii) NUMBER OF SEQUENCES: 43 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
~B) STREET: 1100 NEW YORK AVENUE, SUITE 600 - (C) CITY: WASHINGTON
.~. ~. (D) STATE: DC
(E) COUNTRY: US
- (F) ZIP: 20005-3939 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/US97/01687 (B) FILING DATE: 31-JAN-1997 (C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/010,972 (B) FILING DATE: 01-FEB-1996 (vii) PRIOR APPLICATION DATA:
(A~ APPLICATION NUMBER: US 60/020,440 (B) FILING DATE: 13-JUN-1996 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: ESMOND, ROBERT W.
(B) REGISTRATION NUMBER: 32,893 (C) REFERENCE/DOCKET NUMBER: 1438.009PC02 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 371-2600 (B) TELEFAX: (202) 371-2540 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:

AME~O~D SHE~T -P~T~JS 97J~1~87 - ~PEA~S 02~0'19 -88.2-(A) LENGTH: 930 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..927 txi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser Arg Ser Val Phe Hi~ Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala Thr Gly Ile Val GAT TTG GGT TCG A~A ATC GGC TTC A~A GGC CAA GAA GAC CTC GGT AAC 144 Asp Leu Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Leu Lys Ala Ile Trp Gln Val Glu Gln Lys Ala Ser Ile Ala Gly Thr Asp Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile Gly Leu Lys Gly Gly Phe Gly Lys Leu Arg Val Gly Arg Leu Asn Ser Val Leu Lys Asp Thr Gly Asp Ile Asn Pro Trp Asp Ser Lys Ser Asp Tyr Leu Gly Val Asn Lys Ile Ala Glu Pro Glu Ala Arg Leu Ile Ser Val Arg Tyr Asp Ser Pro Glu Phe Ala Gly Leu Ser Gly Ser Val Gln Tyr Ala Leu Asn Asp Asn Ala Gly Arg His Asn Ser Glu Ser Tyr His Ala Gly Phe Asn Tyr Lys Asn Gly Gly Phe Phe Val Gln Tyr Gly Gly Ala Tyr Lys Arg His His Gln Val Gln Glu Gly Leu Asn Ile Glu Lys Tyr Gln Ile His AMENDED SHEET

CA 02244989 l998-07-3l PCT~S 97/~i687 A/US O ~
-88.3-Arg Leu Val Ser Gly Tyr Asp Asn Asp Ala Leu Tyr Ala Ser Val Ala Val Gln Gln Gln Asp Ala Lys Leu Thr Asp Ala Ser Asn Ser His Asn Ser Gln Thr Glu Val Ala Ala Thr Leu Ala Tyr Arg Phe Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Gly Leu Val Asp Asp Ala Asp Ile Gly Asn Glu Tyr Asp Gln Val Val Val Gly Ala Glu Tyr f Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu Gln Glu Gly Lys Gly Glu Asn Lys Phe Val Ala Thr Ala Gly Gly Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 309 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser Arg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala Thr Gly Ile Val Asp Leu Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Leu Lys Ala Ile Trp Gln Val Glu Gln Lys Ala Ser Ile Ala Gly Thr Asp Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile Gly Leu Lys Gly Gly Phe Gly Lys Leu Arg Val Gly Arg Leu Asn Ser Val Leu Lys Asp Thr Gly Asp Ile Asn Pro Trp Asp Ser Lys Ser Asp Tyr Leu Gly Val AMENDED SHEET

CA 02244989 l998-07-3l o~rf -88.4_ ~ ~ ~ S 0 ~ 9 Asn Lys Ile Ala Glu Pro Glu Ala Arg Leu Ile Ser Val Arg Tyr Asp Ser Pro Glu Phe Ala Gly Leu Ser Gly Ser Val Gln Tyr Ala Leu Asn Asp Asn Ala Gly Arg His Asn Ser Glu Ser Tyr His Ala Gly Phe Asn ~yr Lys Asn Gly Gly Phe Phe Val Gln Tyr Gly Gly Ala Tyr Lys Arg ~is His Gln Val Gln Glu Gly Leu Asn Ile Glu Lys Tyr Gln Ile His Arg Leu Val Ser Gly Tyr Asp Asn Asp Ala Leu Tyr Ala Ser Val Ala Val Gln Gln Gln Asp Ala Lys Leu Thr Asp Ala Ser A~n Ser Hi~ A~n Ser Gln Thr Glu Val Ala Ala Thr Leu Ala Tyr Arg Phe Gly Asn Val ~hr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Gly Leu Val Asp Asp ~la Asp Ile Gly Asn Glu Tyr Asp Gln Val Val Val Gly Ala Glu Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu Gln Glu Gly Lys Gly Glu Asn Lys Phe Val Ala Thr Ala Gly Gly Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A' LENGTH: 1029 base pairs (B TYPE: nucleic acid (C STRANDEDNESS: double (Dl TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1026 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Met Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Val Ser AMI~ ED Sl-IEET

CA 02244989 l998-07-3l ~ è.J~ ~7~6~7 -88.5_ 1 ~ S 0 Arg Val Lys Asp Ala Gly Thr Tyr Lys Ala Gln Gly Gly Lys Ser Lys Thr Ala Thr Gln Ile Ala Asp Phe Gly Ser Lys Ile Gly Phe Lys Gly 345 350 ~ 355 Gln Glu Asp Leu Gly Asn Gly Met Lys Ala Ile Trp Gln Leu Glu Gln Lys Ala Ser Ile Ala Gly Thr Asn Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile Gly Leu Lys Gly Gly Phe Gly Thr Val Arg Ala Gly Asn Leu Asn Thr Val Leu Lys Asp Ser Gly Asp Asn Val Asn Ala Trp Glu Ser Gly Ser Asn Thr Glu Asp Val Leu Gly Leu Gly Thr Ile Gly Arg Val Glu Ser Arg Glu Ile Ser Val Arg Tyr Asp Ser Pro Val Phe Ala Gly Phe Ser Gly Ser Val Gln Tyr Val Pro Arg Asp Asn Ala Asn Asp Val Asp Lys Tyr Lys His Thr Lys Ser Ser Arg Glu Ser Tyr His Ala Gly Leu Lys Tyr Glu Asn Ala Gly Phe Phe Gly Gln Tyr Ala Gly Ser Phe Ala Lys Tyr Ala Asp Leu Asn Thr Asp Ala Glu Arg Val Ala Val Asn Thr Ala Asn Ala His Pro Val Lys Asp Tyr Gln Val His Arg Val Val Ala Gly Tyr Asp Ala Asn Asp Leu Tyr Val Ser Val Ala Gly Gln Tyr Glu Ala Ala Lys Asn Asn Glu Val Gly Ser Thr Lys Gly Lys Lys His Glu Gln Thr Gln Val Ala Ala Thr Ala Ala Tyr Arg Phe Gly Asn Val A~1ENDED SHEET

:~T~ 9 7 ~ û 1 6 8 7 -88.6_ ~ d~US o ~ 9~
ACG CCT CGC GTT TCT TAC GCC CAC GGC TTC AAA GCT A~A GTG AAT GGC 864 Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Ala Lys Val Asn Gly Val Lys Asp Ala Asn Tyr Gln Tyr Asp Gln Val Ile Val Gly Ala Asp Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu AAA CAA GGT A~A GGC GCG GGA AAA GTC GAA CAA ACT GCC AGC ATG GTT 1008 Lys Gln Gly Lys Gly Ala Gly Lys Val Glu Gln Thr Ala Ser Met Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCB CHARACTERISTICS:
(A) LENGTH: 342 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
~et Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Val Ser ~rg Val Lys Asp Ala Gly Thr Tyr Lys Ala Gln Gly Gly Lys Ser Lys Thr Ala Thr Gln Ile Ala Asp Phe Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Met Lys Ala Ile Trp Gln Leu Glu Gln Lys Ala Ser I1Q Ala Gly Thr Asn Ser Gly Trp Gly Asn Arg Gln Ser ~he Ile Gly Leu Lys Gly Gly Phe Gly Thr Val Arg Ala Gly Asn Leu ~sn Thr Val Leu Lys Asp Ser Gly Asp Asn Val Asn Ala Trp Glu Ser Gly Ser Asn Thr Glu Asp Val Leu Gly Leu Gly Thr Ile Gly Arg Val Glu Ser Arg Glu Ile Ser Val Arg Tyr Asp Ser Pro Val Phe Ala Gly Phe Ser Gly Ser Val Gln Tyr Val Pro Arg Asp Asn Ala Asn Asp Val Asp Lys Tyr Lys His Thr Lys Ser Ser Arg Glu Ser Tyr His Ala Gly AME~NDED Sl ILt I

CA 02244989 l998-07-3l PCT~US 9 7 ~ O ~ ~ 8 7 -88.7_ ' ~ ~ S 0 ~eu Lys Tyr Glu Asn Ala Gly Phe Phe Gly Gln Tyr Ala Gly Ser Phe Ala Lys Tyr Ala Asp Leu Asn Thr Asp Ala Glu Arg Val Ala Val Asn Thr Ala Asn Ala His Pro Val Lys Asp Tyr Gln Val His Arg Val Val Ala Gly Tyr Asp Ala Asn Asp Leu Tyr Val Ser Val Ala Gly Gln Tyr 225 230 . 235 240 ~lu Ala Ala Lys Asn Asn Glu Val Gly Ser Thr Lys Gly Lys Lys His ~lu Gln Thr Gln Val Ala Ala Thr Ala Ala Tyr Arg Phe Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Ala Ly~ Val A~n Gly Val Lys Asp Ala Asn Tyr Gln Tyr Asp Gln Val Ile Val Gly Ala Asp Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu Lys Gln Gly Lys Gly Ala Gly Lys Val Glu Gln Thr Ala Ser Met Val ~ly Leu Arg His Lys Phe ~2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1092 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
' (B) LOCATION: 1..1089 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Ser Ser Leu Val Pro Ser Ser Asp Pro Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala GGC GTA GAA GTT TCT CGC GTA AAA GAT GCT GGT ACA TAT A~A GCT CAA 144 Gly Val Glu Val Ser Arg Val Lys Asp Ala Gly Thr Tyr Lys Ala Gln AMENDED SHE~T

CA 02244989 l998-07-3l PCT~US 9 7 J ~ 1 ~ 87 ~ws 02~
-88.8-Gly Gly Ly~ Ser Lys Thr Ala Thr Gln Ile Ala Asp Phe Gly Ser Lys ATC GGT TTC AAA GGT $AA GAA GAC CTC GGC AAC GGC ATG AAA GCC ATT 240 Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Met Lys Ala Ile Trp Gln Leu Glu Gln Lys Ala Ser Ile Ala Gly Thr Asn Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile Gly Leu Lys Gly Gly Phe Gly Thr Val Arg Ala Gly Asn Leu Asn Thr Val Leu Lys Asp Ser Gly Asp Asn Val Asn Ala Trp Glu Ser Gly Ser Asn Thr Glu Asp Val Leu Gly Leu Gly Thr Ile Gly Arg Val Glu Ser Arg Glu Ile Ser Val Arg Tyr Asp Ser Pro Val Phe Ala Gly Phe Ser Gly Ser Val Gln Tyr Val Pro Arg Asp Asn Ala Asn Asp Val Asp Lys Tyr Lys His Thr Lys Ser Ser Arg Glu Ser Tyr His Ala Gly Leu Lys Tyr Glu Asn Ala Gly Phe Phe Gly Gln Tyr Ala Gly Ser Phe Ala Lys Tyr Ala Asp Leu Asn Thr Asp Ala Glu Arg Val Ala Val Asn Thr Ala Asn Ala His Pro Val Lys Asp Tyr Gln Val His Arg Val Val Ala Gly Tyr Asp Ala Asn Asp Leu Tyr Val Ser Val Ala Gly Gln Tyr Glu Ala Ala Lys Asn Asn Glu Val Gly Ser Thr Lys Gly Lys Lys His Glu Gln Thr Gln Val Ala Ala Thr Ala Ala Tyr AMENDED SHE~T ,f CA 02244989 l998-07-3l 9 7~1 687 ~PEAJUS ~1 2~g~
-88.9-Arg Phe Gly A~n Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Ala Lys Val Asn Gly Val Lys Asp Ala Asn Tyr Gln Tyr Asp Gln Val 650 ~55 660 ATC GTT GGT GCC GAC TAC GAC TTC TCC AAA CGC ACT TCC GCT CTG GTT i008 Ile Val Gly Ala Asp Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu Lys Gln Gly Lys Gly Ala Gly Lys Val Glu Gln Thr Ala Ser Met Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 363 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Ser Ser Leu Val Pro Ser Ser Asp Pro Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Val Ser Arg Val Lys Asp Ala Gly Thr Tyr Lys Ala Gln Gly Gly Lys Ser Lys Thr Ala Thr Gln Ile Ala Asp Phe Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Met Lys Ala Ile Trp Gln Leu Glu Gln Lys Ala Ser Ile Ala Gly Thr Asn Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile Gly Leu Lys Gly Gly Phe Gly Thr Val Arg Ala Gly Asn Leu Asn Thr Val Leu Lys Asp Ser Gly Asp Asn Val Asn Ala Trp Glu Ser Gly Ser Asn Thr Glu Asp Val Leu Gly Leu Gly Thr Ile Gly Arg Val Glu Ser Arg Glu Ile Ser Val Arg Tyr Asp Ser Pro Val Phe Ala Gly Phe Ser Gly Ser Val Gln Tyr Val Pro Arg Asp AMENDED SHEET

CA 02244989 l998-07-3l PCT/US 9 7 ~ 8 7 -88.10- ~ iPEAAJS 0 2~9 ~sn Ala Asn Asp Val Asp Lys Tyr Lys His Thr Lys Ser Ser Arg Glu Ser Tyr His Ala Gly Leu Lys Tyr Glu Asn Ala Gly Phe Phe Gly Gln Tyr Ala Gly Ser Phe Ala Lys Tyr Ala Asp Leu Asn Thr Asp Ala Glu Arg Val Ala Val Asn Thr Ala Asn Ala His Pro Val Lys Asp Tyr Gln ~al His Arg Val Val Ala Gly Tyr Asp Ala Asn Asp Leu Tyr Val Ser ~al Ala Gly Gln Tyr Glu Ala Ala Lys Asn Asn Glu Val Gly Ser Thr Lys Gly Lys Lys His Glu Gln Thr Gln Val Ala Ala Thr Ala Ala Tyr Arg Phe Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Ala Lys Val Asn Gly Val Lys Asp Ala Asn Tyr Gln Tyr Asp Gln Val ~le Val Gly Ala Asp Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val ~er Ala Gly Trp Leu Lys Gln Gly Lys Gly Ala Gly Lys Val Glu Gln Thr Ala Ser Met Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 241 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 101..208 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

TAGA~ATAAT TTTGTTTAAC TTAAAGAAGG AGATATACAT ATG GCT AGC ATG ACT 115 Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Ser Ser Leu Val Pro Ser Ser Asp AMENDED SHEET

PC'rllVS 97~0188 -88.11- ~P ~ ~ g 0 2~g8 Leu Gln Val Thr Leu Tyr Gly Thr Val Gly Leu Arg His Lys Phe TAACTCGAGC AGATCCGGCT GCTAACAAAG CCC 24l (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Ser Ser Leu l 5 l0 15 Val Pro Ser Ser Asp Leu Gln Val Thr Leu Tyr Gly Thr Val Gly Leu Arg Hi~ Lys Phe ~2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 942 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: l..939 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Met Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser Arg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala ACC GGC ATC GTT GAT TTG GGT TCG AAA ATC GGC TTC AAA GGC CAA GAA l44 Thr Gly Ile Val Asp Leu Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu GAC CTC GGT AAC GGC CTG AAA GCC ATT TGG CAG GTT GAG CAA AAA GCA l92 Asp Leu Gly Asn Gly Leu Lys Ala Ile Trp Gln Val Glu Gln Lys Ala 85 90 95 l00 Ser Ile Ala Gly Thr Asp Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile AMENDEI:) SHEEr , CA 02244989 l998-07-3l - f ~ 2~l~9 -88.12-Gly Leu Lys Gly Gly Phe Gly Lys Leu Arg Val Gly Arg Leu Asn Ser Val Leu Lys Asp Thr Gly Asp Ile Asn Pro Trp Asp Ser Lys Ser Asp Tyr Leu Gly Val Asn Lys Ile Ala Glu Pro Glu Ala Arg Leu Ile Ser Val Arg Tyr Asp Ser Pro Glu Phe Ala Gly Leu Ser Gly Ser Val Gln Tyr Ala Leu Asn Asp Asn Ala Gly Arg His Asn Ser Glu Ser Tyr His Ala Gly Phe Asn Tyr Lys Asn Gly Gly Phe Phe Val Gln Tyr Gly Gly Ala Tyr Lys Arg His His Gln Val Gln Glu Gly Leu Asn Ile Glu Lys Tyr Gln Ile His Arg Leu Val Ser Gly Tyr Asp Asn Asp Ala Leu Tyr Ala Ser Val Ala Val Gln Gln Gln Asp Ala Lys Leu Thr Asp Ala Ser Asn Ser His Asn Ser Gln Thr Glu Val Ala Ala Thr Leu Ala Tyr Arg Phe Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Gly Leu Val Asp A~p Ala Asp Ile Gly Asn Glu Tyr Asp Gln Val Val Val Gly Ala Glu Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu Gln Glu Gly Lys Gly Glu Asn Lys Phe Val Ala Thr Ala Gly Gly Val Gly Leu Arg His Lys Phe AM~N~ED SHEET

CA 02244989 l998-07-3l 9 7 ~ 0 ~ 68 Eh~S G ~9 -88.13-(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 313 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Met Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser ~rg Ser Val Phe Hi~ Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala Thr Gly Ile Val Asp Leu Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Leu Lys Ala Ile Trp Gln Val Glu Gln Lys Ala Ser Ile Ala Gly Thr Asp Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile ~ly Leu Lys Gly Gly Phe Gly Lys Leu Arg Val Gly Arg Leu Asn Ser ~al Leu Lys Asp Thr Gly Asp Ile Asn Pro Trp Asp Ser Lys Ser Asp Tyr Leu Gly Val Asn Lys Ile Ala Glu Pro Glu Ala Arg Leu Ile Ser Val Arg Tyr Asp Ser Pro Glu Phe Ala Gly Leu Ser Gly Ser Val Gln Tyr Ala Leu Asn Asp Asn Ala Gly Arg His Asn Ser Glu Ser Tyr His ~la Gly Phe Asn Tyr Lys Asn Gly Gly Phe Phe Val Gln Tyr Gly Gly ~la Tyr Lys Arg His His Gln Val Gln Glu Gly Leu Asn Ile Glu Lys Tyr Gln Ile His Arg Leu Val Ser Gly Tyr Asp Asn Asp Ala Leu Tyr Ala Ser Val Ala Val Gln Gln Gln Asp Ala Lys Leu Thr Asp Ala Ser Asn Ser His Asn Ser Gln Thr Glu Val Ala Ala Thr Leu Ala Tyr Arg ~he Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Gly ~eu Val Asp Asp Ala Asp Ile Gly Asn Glu Tyr Asp Gln Val Val Val ~ly Ala Glu Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala AMENDED SHEET

CA 02244989 l998-07-3l PCT/VS 9 7 ~ O 1 ~ 8 7 O2~
-88. 14-Gly Trp Leu Gln Glu Gly Lys Gly Glu Asn Lys Phe Val Ala Thr Ala Gly Gly Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 942 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..939 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:

Met Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser Arg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala Thr Gly Ile Val Asp Leu Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu Asp Leu Gly Asn Gly Leu Ly~ Ala Ile Trp Gln Val Glu Gln Lys Ala Ser Ile Ala Gly Thr Asp Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile Gly Leu Ly~ Gly Gly Phe Gly Lys Leu Arg Val Gly Arg Leu Asn Ser Val Leu Lys Asp Thr Gly Asp Ile Asn Pro Trp Asp Ser Lys Ser Asp Tyr Leu Gly Val Asn Lys Ile Ala Glu Pro Glu Ala Arg Leu Ile Ser Val Arg Tyr Asp Ser Pro Glu Phe Ala Gly Leu Ser Gly Ser Val Gln AMEN~ED Sl-IE~T

CA 02244989 l998-07-3l PCTl~JS 9 7 ~ O ~- 6 87 -88.15- ~ ~PEA/~JS 02~98 Tyr Ala Leu A~n Asp Asn Ala Gly Arg His Asn Ser Glu Ser Tyr His Ala Gly Phe Asn Tyr Lys Asn Gly Gly Phe Phe Val Gln Tyr Gly Gly Ala Tyr Lys Arg His His Gln Val Gln Glu Gly Leu Asn Ile Glu Lys g90 495 500 505 Tyr Gln Ile His Arg Leu Val Ser Gly Tyr Asp Asn Asp Ala Leu Tyr Ala Ser Val Ala Val Gln Gln Gln Asp Ala Lys Leu Thr A~p Ala Ser Asn Ser Hi~ Asn Ser Gln Thr Glu Val Ala Ala Thr Leu Ala Tyr Arg Phe Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Gly Leu Val Asp Asp Ala Asp Ile Gly Asn Glu Tyr Asp Gln Val Val Val Gly Ala Glu Tyr Asp Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala Gly Trp Leu Gln Glu Gly Lys Gly Glu Asn Lys Phe Val Ala Thr Ala Gly Gly Val Gly Leu Arg His Ly.~ Phe (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 313 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Met Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser ~rg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala Thr Gly Ile Val Asp Leu Gly Ser Lys Ile Gly Phe Lys Gly Gln Glu AMENDED SHEET

CA 02244989 l998-07-3l PC-/US 97~'a~687 PEA/US 023ri~98 -88.16-Asp Leu Gly Asn Gly Leu Lys Ala Ile Trp Gln Val Glu Gln Lys Ala Ser Ile Ala Gly Thr Asp Ser Gly Trp Gly Asn Arg Gln Ser Phe Ile ~ly Leu Lys Gly Gly Phe Gly Lys Leu Arg Val Gly Arg Leu Asn Ser ~al Leu Lys Asp Thr Gly Asp Ile Asn Pro Trp Asp Ser Lys Ser Asp Tyr Leu Gly Val Asn Lys Ile Ala Glu Pro Glu Ala Arg Leu Ile Ser Val Arg Tyr A~p Ser Pro Glu Phe Ala Gly Leu Ser Gly Ser Val Gln Tyr Ala Leu Asn Asp Asn Ala Gly Arg His Asn Ser Glu Ser Tyr His Ala Gly Phe Asn Tyr Lys Asn Gly Gly Phe Phe Val Gln Tyr Gly Gly 165 . 170 175 ~la Tyr Lys Arg His His Gln Val Gln Glu Gly Leu Asn Ile Glu Lys Tyr Gln Ile His Arg Leu Val Ser Gly Tyr Asp Asn Asp Ala Leu Tyr Ala Ser Val Ala Val Gln Gln Gln Asp Ala Lys Leu Thr Asp Ala Ser Asn Ser His Asn Ser Gln Thr Glu Val Ala Ala Thr Leu Ala Tyr Arg Phe Gly Asn Val Thr Pro Arg Val Ser Tyr Ala His Gly Phe Lys Gly ~eu Val Asp Asp Ala Asp Ile Gly Asn Glu Tyr Asp Gln Val Val Val Gly Ala Glu Tyr A~p Phe Ser Lys Arg Thr Ser Ala Leu Val Ser Ala . 275 280 285 Gly Trp Leu Gln Glu Gly Lys Gly Glu Asn Lys Phe Val Ala Thr Ala Gly Gly Val Gly Leu Arg His Lys Phe (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9156 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

AMENDED SHEET

CA 02244989 l998-07-3l PC-US 97~01687 -?~JV~ 02;r~9~
-88.17-tXi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

GACTGATGCT TCCAATTCGC ACA'ACTCTCA AACCGAAGTT GCCGCTACCT TGGCATACCG 1680 AMENDED SHEET

CA 02244989 l998-07-3l PC~VS 9 7 ~ 8 7 - ~PEA~s 02~AIJg~
-88.18-GAGGATGTCA GAATGCCATT TGCCTGAGAG ATGCAGGCTT CATTTTTGAT A~llllllAT 2040 TTGTAACCTA TATAGTATAG GAllllllll GTCATTTTGT TTCTTCTCGT ACGAGCTTGC 2100 TCGAGTTTGA T~lllllCTT GGTATTTCCC ACTCCTCTTC AGAGTACAGA AGATTAAGTG 2220 AMENDED SHEET

PCTJllS 97~1687 ,, ;-IPEWS o~rs~
-88.19-CCGGAATAGA ~lllllGGAC GAGTACACCA GGCCCAACGA GTAATTAGAA GAGTCAGCCA 4560 TGACAGGGAA ~lllllGACA TCTTCAGAAA GTTCGTATTC AGTAGTCAAT TGCCGAGCAT 4680 CAGAAAAAGC ATA~ACAGTT CTACTACCGC CATTAGTGAA ACTTTTCAAA TCGCCCAGTG 4800 AMENDED SHEET

CA 02244989 l998-07-3l PC~7 ~ ~898 -88.20-CAGAAATGTC CTTCTTGGAG ACAGTAAATG AAGTCCCACC AATAAAGA~A TCCTTGTTAT 5760 CAGGAACAAA ~ll~llGTTT CGAACTTTTT CGGTGCCTTG AACTATAAAA TGTAGAGTGG 5820 TTATTCCCTT TTTTGCGGCA TTTTGCCTTC CT~ll'lilGC TCACCCAGAA ACGCTGGTGA 6720 AMENDED SHFE~

CA 02244989 l998-07-3l PCT~VS s7/a~s.7 ~ ~P~ 02~9 -88.21-AACAAGAGTC CACTATTAAA GAACGTGGAC TCCAACGTCA AAGGGcGAAA AACCGTCTAT 7740 CAGGGCGATG GCCCACTACG TGAACCATCA CCCTAATCAA ~~ GGG GTCGAGGTGC 7800 CAGGGCGCGT AAAAGGATCT AGGTGAAGAT C~lllllGAT AATCTCATGA CCAAAATCCC 8040 TTGAGATCCT llllllCTGC GCGTAATCTG CTGCTTGCAA ACAAAAAAAC CACCGCTACC 8160 (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9191 ba~e pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

AMEN~ED SHEET

CA 02244989 l998-07-3l PCT/US 9 7 / ~ ~ 6 ~i~
- - - tPEAJ~J~; 02~A~
-88.22-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

GTCCATTCTC ACACATAAGT GCCA~ACGCA ACAGGAGGGG ATACACTAGC AGCAGACCGT 120 GTGTGGGGTC A~ATAGTTTC ATGTTCCCAA ATGGCCCAAA ACTGACAGTT TA~ACGCTGT 420 GAAATGCTAA CGGCCAGTTG GTCAAAAAGA AACTTCCA~A AGTCGCCATA CCGTTTGTCT 540 TATATA~ACA GAAGGAAGCT GCCCTGTCTT A~ACCTTTTT TTTTATCATC ATTATTAGCT 840 CCTTGGA~AT TATTTTAGCT TTGGCTACTT TGCAATCTGT CTTCGCTCGA GACGTCACTT 1020 ATCCTTGGGA TAGCAAAAGC GACTATTTGG GTGTA~ACAA AATTGCCGAA CCCGAGGCAC 1380 ACA~AAACGG TGGCTTCTTC GTGCAATATG GCGGTGCCTA TA~AAGACAT CATCAAGTGC 1560 AMENDED SHEET

CA 02244989 l998-07-3l PCTJUS 9 7 J ~1 68 ~p~4US 0~9 -88.23-TGGTTTCTGC CGGTTGGTTG CAAGAAGGCA AAGGCGAAAA CA~ATTCGTA GCGACTGCCG 1920 AGTATAGGAT llllllLGTC ATTTTGTTTC TTCTCGTACG AGCTTGCTCC TGATCAGCCT 2160 TGCAAGCTTA TCGATAAGCT TTAATGCGGT AGTTTATCAC AGTTA~ATTG CTAACGCAGT 2340 CAGGCACCGT GTATGAAATC TAACAATGCG CTCATCGTCA TCCTCGGCAC CGTCACCCTG 2~00 CAAGTGTTCA GGAGCGTACT GATTGGACAT TTCCA~AGCC TGCTCGTAGG TTGCAACCGA 3060 AMENDED St IEET

CA 02244989 l998-07-3l PCT/I~S 97~ 87 ~PEAJIJ~ 02~
-88.24-~M~NDED SHEET

CA 02244989 l998-07-3l PCT~ 97~0~687 IP~us O2~
-88 .25-CTTGTTTCGA A~lllllCGG TGCCTTGAAC TATAAAATGT AGAGTGGATA TGTCGGGTAG 5880 AATCAAAGTT GTTTGTCTAC TATTGATCCA AGCCAGTGCG GTCTTGA~AC TGACAATAGT 6060 CCGCGTTGCT GGC~lllllC CATAGGCTCC GCCCCCCTGA CGAGCATCAC AAAAATCGAC 6840 GCTCAAGTCA GAGGTGGCGA AACCCGACAG GACTATA~AG ATACCAGGCG TTTCCCCCTG 6900 AMENDED St~EET

CA 02244989 l998-07-3l PCT/I~S 97~ 87 - , IPEA US O ~
-88.26-CTTGCCAGCG CCCTAGCGCC CGCTCCTTTC G~lll~llCC CTTCCTTTCT CGCCACGTTC 7620 AATAAGGGCG ACACGGAAAT GTTGAATACT CATACTCTTC ~lllllCAAT ATTATTGAAG 8880 (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 8974 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear AMENDE~:) SHEET

PCTJUS 97~;687 , ~US 02~'g~o -88.27-(ii) MOLECULE TYPE: cDNA

txi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

ATATAAACAG AAGGAAGCTG CCCTGTCTTA AAC~llllll TTTATCATCA TTATTAGCTT 840 GAAGGGGATT TCGATGTTGC l~llllGCCA TTTTCCAACA GCACAAATAA CGGGTTATTG 1140 AM~NDED SHEEl-CA 02244989 l998-07-3l PCT/US 9~/~16~7 ~P~$ O 2~i~
-88.28-GGTGCGGAAT ACGACTTCTC CA~ACGCACT TCTGCCTTGG TTTCTGCCGG TTGGTTGCAA 2100 AMEN~ED S~EET

CA 02244989 l998-07-3l p ~ U S 9 7 ~ ~ ~ 6 8 iPE~lS ~ 2~ 9 -88.29-TGACGACGAG ATTGGTAGAC TCCAGTTTGT GTCCTTATAG CCTCCGGAAT AGA~lllllG 4800 CCATCGGGGC GGTCAGTAGT CAAAGACGCC AACAAAATTT CACTGACAGG GAA~lllllG 4920 AMENDED SH~T

9 7 ~ 0 ~ ~ 8 7 - ~PEAIUS 02~
-88.30-AATAATCTTG ACGAGCCAAG GCGATAAATA CCCAAATCTA AAA~l~llll AAAACGTTAA 6420 TAAAAAGGCC GCGTTGCTGG C~lllllCCA TAGGCTCCGC CCCCCTGACG AGCATCACAA 7080 AMENDED S~EET

CA 02244989 l998-07-3l PCTIIJS 97/û1687 -88.3 1-ACAAACCACC GCTGGTAGCG GTG~ TGTTTGCAAG CAGCAGATTA CGCGCAGAAA 7620 A~ACTCACGT TAAGGGATTT TGGTCATGAG ATTATCAAAA AGGATCTTCA CCTAGATCCT 7740 GACACGGAAA TGTTGAATAC TCATACTCTT C~lllllCAA TATTATTGAA GCATTTATCA 8700 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10215 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

AMENI}ED SHEET

CA 02244989 l998-07-3l PCF~3S7 02~s~

-88.32-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
AGATCTAACA TCCAAAGACG AAAGGTTGAA TGA~ACCTTT TTGCCATCCG ACATCCACAG 60 TTGAAATGCT AACGGCCAGT TGGTCAAAAA GAAACTTCCA AAAGTCGCCA TACCGTTTGT 5q0 ATATAAACAG AAGGAAGCTG CCCTGTCTTA AAC~llllll TTTATCATCA TTATTAGCTT 840 CGTTTGAACA GCGTCCTGAA AGACACCGGC GACATCAATC CTTGGGATAG CA~AAGCGAC 1560 AMENDED SHEET

CA 02244989 l998-07-3l PCT~JS 97J~1 b87 0 2~
-88.33-GTACAGCAAC AAGACGCGAA ACTGACTGAT GCTTCCAATT CGCACAACTC TCA~ACCGAA 1920 AMENDED SHEET

~A 02244989 1998-07-31 P ~ ~ S , 7 ~ O 1 ~i ~ 7 i~EA/lJ~ U2~9~
-88.34-ATGACTTCTG GGGTAAGGGT ACCATCCTTC TTAGGTGGAG ATGCAA~AAC AATTTCTTTG 3780 TTGGATTCTT CTTTAGGTTG TTCCTTGGTG TATCCTGGCT TGGCATCTCC lllC~llCTA 4320 TTGGATTTAG CTTCTGCAAG TTCATCAGCT TCCTCCCTAA TTTTAGCGTT CAACA~AACT 4500 TGACGACGAG ATTGGTAGAC TCCAGTTTGT GTCCTTATAG CCTCCGGAAT AGA~lllllG 4800 CCATCGGGGC GGTCAGTAGT CAAAGACGCC AACAAAATTT CACTGACAGG GAA~lllllG 4920 AA~1ENc)ED SHEET

CA 02244989 l998-07-3l p ~ ~ S 9 7 / a 1 6 8 ~

2 ~ '98 -88.35-~ llCGGT GCCTTGAACT ATAAAATGTA GAGTGGATAT GTCGGGTAGG AATGGAGCGG 7380 AMENC~ED SHEFr CA 02244989 l998-07-3l PCTIIIS 97/~1687 -88.36-TTGAGGTCAT CTTTGTATGA ATA~ATCTAG TCTTTGATCT AAATAATCTT GACGAGCCAA 7620 TGTATTAAAC CCCA~ATCAG CTCGTAGTCT GATCCTCATC AACTTGAGGG GCACTATCTT 7740 GTGCACCATA TGCGGTGTGA AATACCGCAC AGATGCGTAA GGAGA~AATA CCGCATCAGG 8100 GC~llll LCC ATAGGCTCCG CCCCCCTGAC GAGCATCACA AAAATCGACG CTCAAGTCAG 8340 GGTGGTTTTT ~l~l.lGCAA GCAGCAGATT ACGCGCAGAA AAAAAGGATC TCAAGAAGAT 8880 AMEI~IDED SHEET

CA 02244989 l998-07-3l P~T/IJS 9 7 / O 1 6 8 7 - ~ oeE~ a~ ~
-88.37-CTCATACTCT TC~lllllCA ATATTATTGA AGCATTTATC AGGGTTATTG TCTCATGAGC 9960 (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs tB) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

AMENDED SHEEr CA 02244989 l998-07-3l p ~ ~ S 9 7 / 01 o ~

-88.38-(A) LENGTH: 20 base pairs IB) TYPE: nucleic acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

AMENDED SHEET

CA 02244989 1998-07-31 PCT~S 9 7 / a 1 68 7 ~ IP-~JS ~2 -88.39-AGCGGCTTGG AATTCCCGGC TGGCTTA~AT TTC 33 (2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
CCTGTTGCAG Q CATATGGA CGTTACCTTG TACGGTACAA TTA~AGC 47 (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 97 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

AMEN~ED SHEET

CA 02244989 l998-07-3l PClIUS 97J~1687 - ; ' IP~ O~J~
-88.40-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
CCTGTTGCAG CGGATCCAGA CGTTACCTTG TACGGTACAA TTA~AGC 47 (2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A'l LENGTH: 44 base pairs (B TYPE: nucleic acid (C STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

(2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single AMENDED SHEET

CA 02244989 l998-07-3l PGTJUS 9 7 J ~1 687 *EA~ 9 -88.41-(D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

(2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:

(2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 87 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..87 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser Arg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein AMENDED SHEET

CA 02244989 l998-07-3l PCT~ 9 7 / O 1 b 8 ~

-88.42-(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Asp Val Thr Leu Tyr Gly Thr Ile Lys Ala Gly Val Glu Thr Ser Arg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 87 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

(2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:

(2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

(2) INFORMATION FOR SEQ ID NO:37:

AMENI:~ED S~E~T

PCT/US 9 7 / ~ 7 ~, ~US 92~N
-88.43-(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:

(2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:

(2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:

(2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 amino acids ( B ) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:

AMENDEt:) SHEE r CA 02244989 l998-07-3l P~T~US 97/~lb8~
O 2~9a -88.44-Glu Thr Ser Arg Ser Val Phe His Gln Asn Gly Gln Val Thr Glu Val Thr Thr Ala Thr (2) INFORMATION FOR SEQ ID NO:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear MOLECULE TYPE: peptide ~xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Xaa Phe Xaa Arg Gln (2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Gln Arg Xaa Phe Xaa (2) INFORMATION FOR SEQ ID NO:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: not relevant (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:
Arg Gln Ser Phe Ile AMENDED SHEEl'

Claims (33)

What Is Claimed Is:

1. A method for the high level expression of the outer membrane meningococcal group B porin protein or a fusion protein thereof in yeast, comprising:
(a) ligating into a plasmid having a selectable marker a gene coding for a protein selected from the group consisting of:
(i) a mature porin protein (ii) a fusion protein which is a mature porin protein fused to a yeast secretion signal peptide;
wherein said gene is operably linked to a yeast promoter;
(b) transforming said plasmid containing said gene into a yeast strain;
(c) selecting the transformed yeast by growing said yeast in a culture medium allowing selection of said transformed yeast;
(d) growing the transformed yeast, and (e) inducing expression of said protein to give yeast containing said protein;
wherein the protein so expressed comprises more than about 2% of the total protein expressed in said yeast.

2. The method according to claim 1, wherein the protein so expressed comprises about 3-5% of the total protein expressed in said yeast.

3. The method according to claim 1, wherein said mature porin protein is the Neisseria meningitidis mature outer membrane class 3 protein fromserogroup B.

4. The method according to claim 1, wherein said yeast promoter is the AOX1 promoter.

5. The method according to claim 1, wherein said yeast secretion signal peptide is selected from the group consisting of the secretion signal of the S. cerevisiae .alpha.-mating factor prepro-peptide and the secretion signal of the P.
pastoris acid phosphatase gene.

6. The method according to claim 1, wherein said plasmid is selected from the group consisting of pHIL-D2, pHIL-S1, pPIC9 and pPIC9K.

7. The method according to claim 1, wherein said gene comprises a nucleotide sequence that incorporates codons optimized for yeast codon usage.

8. The method according to claim 7, wherein said codons optimized for yeast codon usage are in the 5' region of said gene.

9. The method according to claim 8, wherein said 5' region of said gene is the nucleotide sequence:

5'-gac gtC acT Ttg tac ggT acT att aaG gcT ggT gtT gaG act tcc cgc tct gta ttt cac cag aac ggc caa gtt act gaa gtt aca-3' (SEQ ID NO:34).

10. The method according to claim 8, wherein said yeast is P.
pastoris.

11. The method of claim 1 wherein said yeast secretes said protein or fusion protein into a growth medium.

12. The method of claim 11 wherein said plasmid is selected from the group consisting of pHIL-S1, pPIC9, and pPIC9K.

13. A method of purifying the outer membrane meningococcal group B porin protein or fusion protein thereof obtained according to the method of claim 1 comprising (a) lysing said yeast obtained in step (d) to release said protein or fusion protein as an insoluble membrane bound fraction;
(b) washing said insoluble membrane bound fraction obtained in step (a) with a buffer to remove contaminating yeast cellular proteins;
(c) suspending and dissolving said insoluble membrane bound fraction obtained in step (b) in an aqueous solution of a denaturant;
(d) diluting the solution obtained in step (c) with a detergent;
and (e) purifying said protein or fusion protein by gel filtration and ion exchange chromatography.

14. A method of purifying the outer membrane meningococcal group B porin protein or fusion protein thereof obtained according to the method of claim 11 comprising:
(a) centrifuging said yeast culture which has expressed the protein to isolate the protein as soluble secreted material;
(b) removing contaminating yeast culture impurities from the soluble secreted material obtained in step (a) by precipitating said impurities with about 20% ethanol, wherein the soluble secreted material remains in the soluble fraction;

(c) precipitating the secreted material from the soluble fraction of step (b) with about 80% ethanol;
(d) washing the precipitated material obtained in step (c) with a buffer to remove contaminating yeast secreted proteins;
(e) suspending and dissolving the precipitated material obtained in step (d) in an aqueous solution of detergent, and (f) purifying the protein by ion exchange chromatography.

15. A yeast host cell that contains a gene coding for a protein selected from the group consisting of:
(a) a mature porin protein (b) a fusion protein which is a mature porin protein fused to a yeast secretion signal peptide.

16. The yeast host cell of claim 15, wherein said yeast contains more than one copy of said gene.

17. The yeast host cell of claim 15 wherein said mature porin protein is the Neisseria meningitidis mature outer membrane class 3 protein from serogroup B.

18. The yeast host cell of claim 17 wherein said plasmid is selected from the group consisting of pHIL-D2, pHIL-S1, pPIC9, pPIC9K and pAO815.

19. The yeast host cell of claim 15, wherein said yeast is P. pastoris.

20. The yeast host cell of claim 15, wherein the 5' region of the gene encoding said protein is encoded by the nucleotide sequence:

5'-gac gtC acT Ttg tac ggT acT att aaG gcT ggT gtT gaG act tcc cgc tct gta ttt cac cag aac ggc caa gtt act gaa gtt aca-3' (SEQ ID NO:34).

21. A nucleotide sequence coding for an outer membrane meningococcal group B porin protein, wherein at least one codon has been changed to optimize yeast codon usage.

22. The nucleotide sequence of claim 21, wherein said porin protein is the mature outer membrane class 3 protein from serogroup B, and said codon changes are selected from the group of changes consisting of: (GTT to GTC at positions 4-6 of the native sequence), (ACC to ACT at positions 7-9 of the native sequence), (CTG to TTG at positions 10-12 of the native sequence), (GGC to GGT at positions 16-18 of the native sequence), (ACC to ACT at positions 19-21 of the native sequence), (ATC to ATT at positions 22-24 of the native sequence),(AAA to AAG at positions 25-27 of the native sequence), (GCC to GCT at positions 28-30 of the native sequence), (GGC to GGT at positions 31-33 of the native sequence), (GTA to GTT at positions 34-36 of the native sequence), (GAA
to GAG at positions 37-39 of the native sequence);
wherein said positions are numbered from the first nucleotide of the native nucleotide sequence encoding said protein.

23. A vaccine comprising group A meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP), and group C
meningococcal polysaccharide (GCMP) antigens, together with a pharmaceutically acceptable carrier.

24. The vaccine of claim 23, wherein said group A meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP), and group C meningococcal polysaccharide (GCMP) antigens are each conjugated to a protein carrier.

25. The vaccine of claim 24, wherein said protein carrier to which said GBMP antigen is conjugated is class 3 N. meningitidis porin protein (PorB).

26. The vaccine of claim 24, wherein said protein carrier to which said GAMP antigen and said GCMP antigen are conjugated is tetanus toxoid.

27. The vaccine of claim 25, wherein said GBMP antigen is N-propionylated prior to being conjugated to PorB.

28. The vaccine of claim 24 wherein said vaccine comprises about 2 µg of the GAMP, GCMP and GBMP polysaccharide antigen conjugates.

29. The vaccine of claim 24, wherein said vaccine comprises about 5 µg of the GAMP, GCMP and GBMP polysaccharide antigen conjugates.

30. The vaccine of claim 24, wherein said vaccine comprises about 2 µg ofthe GAMP and GCMP polysaccharide antigen conjugates, and about 5 µgof the GBMP polysaccharide antigen conjugate.

31. A method of inducing an immune response in a mammal, comprising administering a vaccine comprising group A meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP), and group C meningococcal polysaccharide (GCMP) antigens. together with a pharmaceutically acceptable carrier. in an amount sufficient to induce an immuneresponse in a mammal.

32. The method of claim 31, wherein said group A meningococcal polysaccharide (GAMP), group B meningococcal polysaccharide (GBMP), and group C meningococcal polysaccharide (GCMP) antigens are each conjugated to a protein carrier.

33. The method of claim 31, wherein said mammal is a human.