FR3097127A1 - Method of using a Let-7b inhibitor in cosmetics and / or nutraceuticals - Google Patents

Abstract

The present invention relates to a method of using a Let-7b inhibitor in cosmetics and / or nutraceuticals, and in particular to the cosmetic or nutraceutical use of an aqueous extract of the seed of a rhamnoid hippophae exhibiting a inhibitory capacity of Let-7b to inhibit the expression of Let-7b in the skin and / or mucous membranes to maintain or improve their biomechanical properties, in particular their firmness, elasticity and / or density.

Description

Method for using a Let-7b inhibitor in cosmetics and/or nutraceuticals

The present invention relates to a method for using a potential inhibitor of the micro RNA hsa-Let-7b-5p (hereinafter Let-7b) in the cosmetic and/or nutraceutical fields.

The present invention also relates to the use of a new cosmetic and/or nutraceutical ingredient as well as a composition comprising it for inhibiting the expression of Let-7b, in particular in healthy skin and/or healthy mucous membranes, and/or to maintain and/or improve the biomechanical properties of healthy skin and/or healthy mucous membranes.

The structure and properties of the skin change under the effect of complex biological, physical and biomechanical processes, leading to a loss of elasticity, firmness and density of the dermis. This results in slackening and unsightly sagging of the skin of the body, especially that of the face.

From a structural point of view, alterations in the biomechanical properties of the skin are generally due to changes in the organization of the extracellular matrix of the dermis. They include in particular dysregulations in the synthesis of glycosaminoglycans (or GAGs), in particular chondroitin sulphates, involved in the structural functions and physiological regulation in the skin. These changes also include alterations in the polymerization and cross-linking of collagen and elastin fibers. In this case, these fiber networks lose their biomechanical properties, the skin loses its support function and sags.

These phenomena are caused by intrinsic factors on the one hand, in particular genetic, as well as by extrinsic factors on the other hand, such as ultraviolet rays and/or smoking and/or pollution. The latter can in particular lead to epigenetic modifications, including regulation by microRNAs.

Endogenous microRNAs (or miRNAs) are a family of small non-coding RNAs, typically 20-24 nucleotides in length, that negatively regulate gene expression at the post-transcriptional level. They bind base to base the 3'-UTR regions of their target mRNAs, leading to their degradation and consequently the reduction or inhibition of the translation of the corresponding proteins in the cell. In the 2000s, the first studies demonstrated that these molecules played a role as biological regulators and were involved in numerous living processes. The understanding of epigenetic regulations and the discovery of mRNAs targeted by miRNAs has since become a major challenge, particularly in the therapeutic and cosmetic fields.

Prediction by sequence alignment assisted by computational algorithms is one of the methods used for this purpose. However, experimental results suggest that even perfect alignment is not absolute proof of the in vivo interaction of miRNA and its target. Indeed, the expression of miRNAs and mRNAs being cell specific, prediction by sequence alignment suffers from the fact that it does not take into account the co-expression, or not, of the two entities in the cell.

The Applicant has discovered that Let-7b epigenetically negatively regulates the synthesis of five proteins in fibroblasts: fibrillin 1 (FBN1), xylosyl transferase 1 (XYLT1), the TGF beta 2 receptor (TGFBR2), integrin beta 3 (ITGB3) and chondroitin sulfate synthase 3 (CHSY3). (See example 2)

The CHSY3 and XYLT1 proteins are responsible for the synthesis of chondroitin sulfates such as decorin and biglycan necessary for the assembly of glycosaminoglycan (GAG) chains, themselves involved in the organization of collagen fibers and elastic fibers at the within the extracellular matrix.

TGFBR2 is one of two receptors in the TGF-beta signaling pathway. It participates in the regulation of wound healing and tissue repair. In addition, the non-expression of TGFBR2 slows down the phenomenon of scar contraction and delays the reorganization of dermal collagen within the extracellular matrix.

FNB1 is a major component of myofibrils that serve as a framework within the extracellular matrix for the deposition of tropoelastin during the synthesis of elastic fibers.

ITGB3 participates in the integrin complex and is involved in cell-matrix interactions through its binding with fibrilin 1, influencing extracellular matrix deposition and the 3D structure of the dermis.

The Applicant has therefore discovered that the increase in Let-7b, in addition to negatively regulating the synthesis of collagen in the dermis, plays a major role in the loss of organization of the extracellular matrix of the dermis, in particular the organization of collagen fibers, elastic fibers and GAGs. This miRNA is thus responsible for the reduction in firmness, elasticity and density of healthy skin and/or healthy mucous membranes.

The Applicant has been able to observe, as explained in application EP2721408, that the molecules of the extracellular matrix (ECM) are synthesized in native form in the cells in contact with the ECM. From the intracellular compartment, they are excreted outside the cells. After maturation phenomena, they are organized and arranged in a network that forms the MEC. They are then in their functional form. Certain cosmetic active ingredients make it possible to globally stimulate the collagen synthesis of the ECM without however visualizing any improvement in the functionality of the collagen, i.e. no increase in the content of collagen in the ECM nor to increase the content of organized collagen fibers. The Applicant has also observed that certain ingredients improve the functionality of collagen, that is to say the quality of the organization of the collagen fibers in the MEC and/or the quantity of collagen fibers organized in the MEC without however measuring d increased procollagen synthesis. A significant synthesis of ECM molecules by cultured cells measured in the intracellular and/or extracellular medium therefore does not necessarily result in a greater quantity of functional molecules.

The invention therefore also relates to the cosmetic and/or nutraceutical use of a Let-7b inhibitor to improve the functionality of molecules of the extracellular matrix. Thus, it aims at the use of a Let-7b inhibitor for maintaining and/or improving the quality of the organization of the extracellular matrix, and/or for maintaining and/or improving the quantity of molecules of the extracellular matrix organized , in particular collagen fibers and/or elastic fibers and/or for maintaining and/or increasing the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

Consequently, the cosmetic and/or nutraceutical use of an inhibitor of the expression of Let-7b makes it possible to maintain and/or improve the biomechanical properties of healthy skin and/or healthy mucous membranes, preferentially the firmness and /or the elasticity and/or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis.

This new cosmetic target being identified, it is therefore necessary to determine a new means of testing possible inhibitors.

Indeed, as detailed above, miRNAs such as Let-7b have cell-specific expression. The Applicant has therefore developed a method for using a potential Let-7b inhibitor making it possible to take into consideration the specific cell expression of miRNAs and mRNAs.

Thanks to the latter, the applicant discovered that the aqueous extract of the seed of Hippophae rhamnoïde L. (hereinafter abbreviated Hippophae rhamnoïde ) is an inhibitor of the expression of Let-7b which is particularly interesting for its use in cosmetics and/or or in nutraceuticals for maintaining and/or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular maintaining and/or increasing the firmness and/or the elasticity and/or the density of healthy skin and/or healthy mucous membranes, in particular healthy dermis, and/or to maintain and/or improve the quality of the organization of the extracellular matrix and/or to maintain and/or increase the quantity of molecules of the organized extracellular matrix, in particular fibers of collagen and/or elastic fibers and/or for maintaining and/or increasing the synthesis of glycosaminoglycans, in particular of chondroitin sulphates.

Hippophae rhamnoïde , also known as sea buckthorn, is a species of woody plant found in Europe and Asia, especially in China, belonging to the Eleagnacea family.

The use of sea buckthorn berry has been known in traditional Tibetan medicine for over a thousand years, and the plant is widely used in traditional Chinese medicine, particularly to treat cardiovascular diseases. The Greeks also used the fruit of Hippophae rhamnoïde for its analgesic properties, to treat stomach pains and scurvy.

Seed oil is very widely used, particularly in cosmetics as an anti-aging agent, but also as a dietary supplement or in dermatology for the healing of burns, due to its richness in polyunsaturated fatty acids.

The manufacture of Hippophae rhamnoïde seed oil generates a residue consisting of the aqueous fraction of the seed. This last fraction is usually eliminated and constitutes a consequent loss of material. Particularly unexpectedly, the Applicant has discovered that this aqueous fraction of the plant, hitherto little studied, carries numerous activities which are the subject of this patent.

Patents FR2840809, JP4933768 and JP4495925 disclose the use of the hydrophilic fraction of the fruit of Hippophae rhamnoïde as an anti-aging agent. However, none of his patents disclose the use of an aqueous extract of the seed of Hippophae rhamnoïde.

Patent application EP2282750 describes the use of the residue from the supercritical CO ₂ extraction of Hippophae rhamnoïde berries then extracted by aqueous extraction to maintain healthy skin, reduce skin aging, to maintain and improve elasticity. of the skin, or as an active ingredient to promote skin regeneration and wound healing. However, this application does not disclose the cosmetic use of an aqueous extract of the seed of Hippophae rhamnoïde

Patent KR101276141 discloses a method for extracting seeds of Hippophae rhamnoïde allowing the elimination of oily compounds comprising the use of C ₁ -C ₄ alcohol as extraction solvent and vacuum filtration using diatomite. The extract obtained has antioxidant and antibacterial properties and can in particular be used as an active ingredient in a composition for preventing the aging of the skin. However, this patent does not disclose the cosmetic use of an aqueous extract of Hippophae rhamnoïde seed for inhibiting the expression of Let-7b in order to maintain and/or improve the biomechanical properties of the skin.

Thus, to the Applicant's knowledge, none of the prior arts discloses the cosmetic and/or nutraceutical use of an aqueous extract of Hippophae rhamnoïde seed to maintain and/or improve the biomechanical properties of the skin, in particular to maintain and /or increase the firmness and/or the elasticity and/or the density of the skin, in particular of the healthy dermis and/or to maintain and/or improve the quality of the organization of the extracellular matrix and/or to maintain and /or increase the quantity of molecules of the organized extracellular matrix, in particular collagen fibers and/or elastic fibers and/or to maintain and/or increase the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

A first aspect of the invention is to provide a method of using Let-7b inhibitors.

A second aspect of the present invention is also to provide a new cosmetic and/or nutraceutical active ingredient capable of inhibiting the expression of Let-7b, in particular in the skin.

Such an ingredient has the advantage of maintaining and/or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular the firmness and/or elasticity and/or the density of healthy skin and/or mucous membranes healthy, in particular healthy dermis and/or to maintain and/or improve the quality of the organization of the extracellular matrix and/or to maintain and/or improve the quantity of molecules of the extracellular matrix organized, in particular collagen fibers and/or elastic fibers and/or for maintaining and/or increasing the synthesis of glycosaminoglycans, in particular of chondroitin sulphates.

Another aspect of the present invention is also to use a non-recovered fraction of Hippophae rhamnoïde , in particular in the manufacture of cosmetic compositions.

The advantage of this new cosmetic active ingredient is to be topically acceptable for the skin, in particular the scalp, and/or the mucous membranes, non-toxic, easily available, which can be easily manufactured and packaged on an industrial scale.

A first subject of the present invention is a method for using a Let-7b inhibitor in cosmetics and/or nutraceuticals, comprising the following steps:

a) Bringing the target cells into contact with a potential Let-7b inhibitor,

b) Quantification of Let-7b expression,

c) Selection of the potential Let-7b inhibitor if Let-7b expression is decreased,

d) Use of the potential Let-7b inhibitor selected as an active ingredient in cosmetics and/or nutraceuticals.

Within the meaning of the present invention, the term "potential inhibitor" means any extract of plant, animal and/or prokaryotic biological material as well as any molecule or mixture of molecules resulting from chemical synthesis and their mixtures. Preferably, the potential inhibitor is an extract of plant biological material.

This extract and/or this synthetic molecule is selected as a “Let-7b inhibitor” when the quantity of Let-7b measured by RT-qPCR after bringing the potential inhibitor into contact is lower than the quantity measured in the absence of bringing the potential inhibitor into contact, under identical or comparable temperature, contact time and operating conditions. Preferably, this is an inhibition of at least 10% in the presence of the potential inhibitor of Let-7b, more preferably of at least 30% relative to the quantity of Let-7b measured in the absence of the potential inhibitor according to the invention.

By Let-7b is meant hsa-Let-7b-5p. Its sequence of this microRNA is described from SEQ ID NO: 1.

Step a) corresponds to bringing into contact, that is to say adding the potential inhibitor to the target cell and/or to the culture medium of said target cell. Preferably, the target cells are fibroblasts, preferably human, preferably healthy.

Within the meaning of the present invention, the term "target cell" means all the cells in which the target proteins and/or their corresponding mRNAs and Let-7b are co-expressed.

Within the meaning of the present invention, the term “target proteins and/or the corresponding mRNAs” means all the proteins and/or the mRNAs coding for these proteins, the expression of which is regulated by Let-7b. Preferably, the proteins to be regulated and/or their corresponding mRNAs are fibrillin 1 (FBN1) and/or xylosyl transferase 1 (XYLT1) and/or the TGF beta 2 receptor (TGFBR2) and/or integrin beta 3 (ITGB3 ) and/or chondroitin sulfate synthase 3 (CHSY3), preferentially xylosyl transferase 1 (XYLT1) and/or integrin beta 3 (ITGB3) and/or chondroitin sulfate synthase 3 (CHSY3), still preferentially xylosyl transferase 1 (XYLT1) and/or chondroitin sulfate synthase 3 (CHSY3).

Unless otherwise indicated, “healthy” cells and in particular “healthy” fibroblasts are understood to mean cells and in particular fibroblasts not exhibiting any pathology.

The target cells are preferably fibroblasts.

The target cells are cultured beforehand according to conventional culture methods known to those skilled in the art. Preferably, the target cells are cultured in DMEM® medium (Dubecco's Modified Eagle Medium® - Life Technologie®).

According to an advantageous mode of the process according to the invention, the potential inhibitor is present at a concentration ranging from 1×10 ^-4 % to 10% (w/v), preferentially from 0.001% to 0.1% (w/v), more preferably from 0.003% to 0.02% (w/v) by weight of Let-7b inhibitor relative to the volume of the culture medium. Advantageously, the tested concentrations of potential inhibitor are from 0.003% to 0.02% (w/v) by weight of the Let-7b inhibitor relative to the total volume of the culture medium.

Preferably, the contacting is carried out for a period ranging from 12 hours to 72 hours. Advantageously, it is about 48 hours.

Advantageously, the bringing into contact is carried out at a temperature ranging from 20° C. to 45° C., preferably at ambient temperature, preferably at about 37° C.

By way of example, and in a non-limiting way, the cells can be cultured according to the protocol detailed in example 3.1.

Step b), called quantification step, is a step for measuring the expression of Let-7b. It can be performed by any known molecular biology measurement method. The quantification step is a direct quantification by measuring the quantity of Let-7b and/or an indirect quantification by measuring the quantity of proteins regulated by Let-7b and/or their corresponding mRNAs.

This may involve direct quantification by measuring the quantity of Let-7b, in particular by measuring on RNA chips and/or by measuring the chain reaction by polymerase by reverse transcription in real time (RT-qPCR or real time RT-PCR).

It can also involve indirect quantification by measuring the quantity of the target proteins and/or the corresponding mRNAs. The amount of corresponding proteins and/or mRNAs is inversely correlated to the level of Let-7b expression. The quantification of the target mRNAs can be made by measurement on RNA chips and/or by measurement of polymerase chain reaction by reverse transcription in real time (RT-qPCR or real time RT-PCR). Quantification of target proteins can be done by Western Blot.

Preferably, the quantification of the expression of Let-7b is carried out by direct quantification by RT-qPCR.

Advantageously and without limitation, step b) can be carried out according to the protocol described in example 3.2.

Step c), called selection, comprises comparing the results of step b) with one or more positive controls for the inhibition of Let-7b and/or with one or more negative controls for the inhibition of Let-7b and/or between several potentially active substances with each other and/or with respect to the absence of any added substance in the culture medium and/or in the cell. Preferably, the comparison is carried out with respect to the quantity measured in the absence of any substance added to the culture medium and/or to the cell.

Advantageously, the Applicant considers, within the framework of the invention, that the selection of the potentially active molecules during the screening can be carried out for inhibitions of the synthesis of Let-7b qualified as strong. Within the meaning of the present invention, the term “strong inhibition” means any inhibition greater than or equal to 30% of the reference activity. This reference activity is measured without the target cell having been brought into contact with the potentially active substance, under identical or comparable temperature, contact time and operating conditions.

In a preferred mode of the method of use according to the invention, the Let-7b inhibitor is an aqueous extract of Hippophae rhamnoïde seed.

Step d) corresponds to the use of the selected Let-7b inhibitor, as an active principle in cosmetics and/or in nutraceuticals.

The invention also relates to a method for using a Let-7b inhibitor in cosmetics and/or in nutraceuticals as described, in which the Let-7b inhibitor is used to maintain and/or improve the properties biomechanics of healthy skin and/or healthy mucous membranes, in particular for maintaining and/or improving the firmness and/or the elasticity and/or the density of healthy skin and/or healthy mucous membranes, in particular healthy dermis.

The invention also relates to a method of using a Let-7b inhibitor in cosmetics and/or nutraceuticals as described, in which the Let-7b inhibitor is used to maintain and/or improve the firmness and/or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis.

The invention also relates to a method for using a Let-7b inhibitor in cosmetics and/or nutraceuticals as described, in which the Let-7b inhibitor is used to maintain and/or improve the quality the organization of the extracellular matrix and/or to maintain and/or improve the quantity of molecules of the extracellular matrix organized, in particular collagen fibers and/or elastic fibers and/or to maintain and/or increase the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

A subject of the present invention is also the cosmetic and/or nutraceutical use of an aqueous extract of Hippophae rhamnoides seed for inhibiting the expression of Let-7b in healthy skin and/or healthy mucous membranes and/or for maintaining and/or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular the firmness and/or the elasticity and/or the density of healthy skin and/or healthy mucous membranes, in particular of healthy dermis.

The present invention also relates to a cosmetic care process comprising the application, preferably topically, of an aqueous extract of Hippophae rhamnoïde seed and/or of a cosmetic composition comprising it, to healthy skin. , in particular healthy scalp, and/or healthy mucous membranes, for inhibiting the expression of Let-7b in healthy skin and/or healthy mucous membranes or for maintaining or improving the biomechanical properties of healthy skin and/or mucous membranes healthy, in particular for maintaining or improving the firmness, the elasticity and/or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis. The application can be carried out on all or a healthy part of the body and/or the face and/or the scalp, preferably the legs, the thighs, the arms, the stomach, the décolleté, the neck, the armpits, all or part of the face, preferably at the level of the cheeks and/or the angular zone of the face.

In particular, the cosmetic and/or nutraceutical use or the method are implemented to maintain or improve the quality of the organization of the extracellular matrix, to maintain or improve the quantity of molecules of the extracellular matrix organized, in particular fibers of collagen and/or elastic fibres, and/or for maintaining or increasing the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

The extract according to the invention is a seed extract. Within the meaning of the present invention, the seed corresponds to the berry (or fruit) of Hippophae rhamnoïde stripped of the fleshy part, otherwise called pericarp.

The extract can be obtained by aqueous extraction methods from plants known in the field, for example by maceration of at least part of the seed, preferably ranging from 1% to 90% (w/w) by weight , preferably ranging from 1% to 50% (w / w) by weight, more preferably ranging from 5% to 20% (w / w) by weight, relative to the total weight of the seed part and the solvent, in the water or a solvent mixture such as water/alcohol, water/glycol or water/polyol. For example, the extract may be obtained by extraction in a water/ethanol mixture, in particular in a respective proportion of 70/30 by volume. Preferably, the extract is obtained by aqueous extraction with water as sole solvent.

Within the meaning of the present invention, the term “aqueous extraction” means any extraction carried out with an aqueous solution comprising at least 60% (w/w) by weight, advantageously at least 70% (w/w) by weight, in particular at least 80% (w/w) by weight, more particularly at least 90% (w/w) by weight, in particular at least 95% (w/w) by weight, of water relative to the total weight of the aqueous solution. According to a preferred mode, the aqueous extraction of the seed of Hippophae rhamnoïde is carried out with water as sole solvent.

According to an advantageous mode, the extract can therefore be obtained by aqueous extraction carried out with an amount ranging from 1% to 50% (w/w) by weight of Hippophae rhamnoïde seed relative to the total weight of Hippophae seed rhamnoids and solvent, preferably with water as sole solvent.

The extract can be obtained by aqueous extraction carried out at a temperature ranging from 4°C to 95°C, preferably from 20°C to 95°C, more preferably from 50 to 95°C, preferably from 70°C to 90 °C. In a particular embodiment, the extraction is carried out at about 80°C.

The extraction can be carried out during a period of 1 hour to 24 hours, preferentially from 1 hour to 12 hours, more preferentially from 1 hour to 6 hours. Advantageously, the extraction is carried out over a period of 2 to 3 hours.

Preferably, the extract is prepared according to the protocol described in example 1a).

An additional step of adding maltodextrin can be performed. Advantageously an amount of at least 20% (w/w) by weight relative to the total weight of the extract and the maltodextrin, preferably of at least 50% (w/w), even more preferably of at least 70 % (w/w) by weight of maltodextrin, is then added to the extract. The extract can then be concentrated by evaporation of the solvent and/or dried by lyophilization and/or by atomization.

In a preferred embodiment of the invention, the extract is dried by spraying after adding maltodextrin to the solution.

In a preferred mode of the invention, the seed of Hippophae rhamnoïde is extracted beforehand by supercritical extraction with carbon dioxide.

According to this embodiment, the aqueous extract of Hippophae rhamnoïde seed is obtained by aqueous extraction of the co-product of supercritical carbon dioxide extraction of Hippophae rhamnoïde seed.

Supercritical extraction with carbon dioxide is a technique known to those skilled in the art which makes it possible to isolate the oily fraction of the compound to be extracted in order to use it for various applications. The residue of this extraction is called “co-product” within the meaning of the present invention and contains all the compounds not extracted by said technique. It is therefore the delipidated fraction of the seed of Hippophae rhamnoïde.

Within the meaning of the presentation, the aqueous extract of Hippophae rhamnoïde seed contains only trace lipid compounds. Preferably, the extract comprises a concentration ranging from 1x10 ^-6 % to 1% (w/w) of lipid compounds relative to the total weight of the extract, more preferably between 0.01% and 1% (w/w) , advantageously the extract contains between 0.1 and 1% (w/w) of lipid compounds relative to the total weight of the extract.

This extraction technique makes it possible to obtain a co-product free of residual solvent that can be more easily isolated and integrated into a cosmetic and/or nutraceutical composition.

It can be carried out in the presence or not of co-solvent, advantageously it is carried out without co-solvent. It can be carried out at a pressure ranging from 50 to 80 bar and at a temperature ranging from 25 to 70°C, preferably it is carried out at around 60 bar and around 30°C. The duration of the supercritical extraction can range from 30 to 120 minutes, preferably from 60 to 100 minutes.

The coproduct is then extracted by an aqueous extraction as described above.

Preferably, the extract is prepared according to the protocol described in example 1b).

Another aspect of the invention relates to the use of a Let-7b inhibitor for maintaining or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular firmness, elasticity and/or density of healthy skin and/or healthy mucous membranes, in particular healthy dermis.

Furthermore, the invention also relates to a cosmetic care process comprising the application, preferably topically, of a Let-7b inhibitor and/or of a cosmetic composition comprising it, to healthy skin. , in particular healthy scalp, and/or healthy mucous membranes, to maintain or improve the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular the firmness, elasticity and/or density of healthy skin and/or or healthy mucous membranes, especially healthy dermis. The application can be carried out on all or a healthy part of the body and/or the face and/or the scalp, preferably the legs, the thighs, the arms, the stomach, the décolleté, the neck, the armpits, all or part of the face, preferably at the level of the cheeks and/or the angular zone of the face.

Preferably, the method and the use are implemented to maintain or improve the quality of the organization of the extracellular matrix, to maintain or increase the quantity of molecules of the extracellular matrix organized, in particular collagen fibers and/or elastic fibres, and/or to maintain or increase the synthesis of glycosaminoglycans, in particular of chondroitin sulphates.

In a particular embodiment, the Let-7b inhibitor is selected by the method according to the present invention, as described above. A number of Let-7b inhibitors are available to those skilled in the art. Mention may be made, for example, of an oligonucleotide complementary to the sequence of Let-7b such as that of sequence SEQ ID NO: 2.

The present invention relates to a cosmetic composition comprising a Let-7b inhibitor and at least one cosmetically acceptable excipient.

Within the meaning of the present invention, the term “cosmetic use and/or cosmetic composition” means a non-pharmaceutical use and/or composition, that is to say which does not require therapeutic treatment, that is to say say intended for any area of healthy skin, in particular the healthy scalp, and/or healthy mucous membrane.

Within the meaning of the present invention, the term “nutraceutical use and/or nutraceutical composition” means a use and/or a composition for non-pharmaceutical oral administration, that is to say which does not require therapeutic treatment.

The term “healthy skin” and/or “healthy mucous membrane” and/or “healthy scalp” is understood to mean an area of skin and/or mucous membrane and/or scalp to which the extract according to the so-called invention is applied. "non-pathological" by a dermatologist, that is to say not showing any infection, scar, disease, or sores or wounds and/or other dermatoses.

The term “mucosa” is understood to mean the ocular mucosa, the vaginal mucosa, the urogenital mucosa, the anal mucosa, the nasal mucosa and/or the buccal, labial and/or gingival mucosa, preferentially, the ocular and/or buccal mucosa .

Within the meaning of the present invention, the term “inhibit the expression of Let-7b” is understood to mean reducing the quantity of Let-7b, in particular in the healthy skin and/or the healthy mucous membranes, preferentially at the level of the healthy dermis. Preferably, this is an inhibition of at least 10% in the presence of the aqueous extract of Hippophae rhamnoïde seed, more preferably still of at least 30% relative to the quantity of Let-7b measured in l absence of the extract according to the invention.

According to a particular mode of the invention, it is the use of the aqueous extract of Hippophae rhamnoïde seed according to the invention to inhibit the expression of Let-7b in the healthy dermis and/or the laminae healthy basal areas, in particular of the healthy dermo-epidermal junction, preferentially in the healthy dermis.

According to a preferred mode of the invention, it is the use of the aqueous extract of Hippophae rhamnoïde seed according to the invention to inhibit the expression of Let-7b at the level in healthy fibroblasts.

The quantity of Let-7b can be measured by any known method of molecular biology of quantification. This may involve the direct quantification of the amount of Let-7b miRNA, in particular by measurement on RNA chips and/or by measurement of polymerase chain reaction by reverse transcription in real time (RT-qPCR or real time RT -PCR). Preferably, the amount of Let-7b is measured by RT-qPCR according to standard methods known to those skilled in the art. Again preferably, it is measured according to Example 3.2.

Within the meaning of the present invention, the term "biomechanical property of healthy skin and/or healthy mucous membranes" means the firmness and/or the elasticity and/or the density and/or the resistance to compression and/or the resistance to stretching and/or flexibility and/or extensibility and/or the ability to resist deformation of healthy skin and/or healthy mucous membranes, in particular healthy dermis. Preferably, it is the firmness and/or the elasticity and/or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis.

The biomechanical properties of healthy skin and/or healthy mucous membranes can be studied by measurement techniques known to those skilled in the art, in particular by traction, torsion, suction, indentation, levatometry, ballistometry, by high-resolution ultrasound scanner or elastography, preferably by indentation, by high-resolution ultrasound scanner. Advantageously, the biomechanical properties of healthy skin and/or healthy mucous membranes are studied according to the protocol described in Example 5.

For the purposes of the present invention, the term “maintaining the biomechanical properties of healthy skin and/or healthy mucous membranes” means preventing a reduction in the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular the firmness and/or the elasticity and/or density of healthy skin and/or healthy mucous membranes, in particular of healthy dermis, relative to the biomechanical properties of healthy skin and/or healthy mucous membranes measured in the absence of the extract according to invention.

Within the meaning of the present invention, the term “improving the biomechanical properties of healthy skin and/or healthy mucous membranes” means an increase in the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular firmness and/or elasticity and/or density of healthy skin and/or healthy mucous membranes, in particular healthy dermis, preferably by at least 10% in the presence of the Let-7b inhibitor or of the aqueous extract of the seed of Hippophae rhamnoides relative to the biomechanical properties of healthy skin and/or healthy mucous membranes measured in the absence of the Let-7b inhibitor or of the extract according to the invention.

According to a particular embodiment, the subject of the invention is the cosmetic and/or nutraceutical use of a Let-7b inhibitor or of an aqueous extract of Hippophae rhamnoïde seed according to the invention for maintaining and/or increase the firmness and/or the density of the healthy skin and/or the healthy mucous membranes, in particular the healthy dermis.

In particular, maintaining and/or improving the biomechanical properties of healthy skin makes it possible to limit and/or reduce the slackening of healthy facial skin, in particular in the cheeks and/or the angular area of the face ( commonly called rounded face or V face).

Another object of the present invention relates to the cosmetic and/or nutraceutical use of a Let-7b inhibitor or of an aqueous extract of Hippophae rhamnoïde seed according to the invention for maintaining and/or improving the quality of the organization of the extracellular matrix, in particular collagen fibers and/or elastic fibers.

Within the meaning of the present invention, the term "quality of the organization of the extracellular matrix" means the level of functional organization of the molecules which constitute the extracellular matrix. As explained in the introduction to the application, the FBN1 and/or XYLT1 and/or TGFBR2 and/or ITGB3 and/or CHSY3 proteins are involved in the deposition and/or organization of the extracellular matrix and are negatively regulated by the Let-7b. The inhibition of Let-7b leads to a decrease in the inhibition of these proteins and makes it possible to maintain and/or improve the quality of the organization of the extracellular matrix.

Within the meaning of the present invention, the term “maintaining the quality of the organization of the extracellular matrix” means preventing a reduction in the organization of the cellular matrix, in particular by limiting the negative regulation of the proteins FBN1 and/or XYLT1 and/ or TGFBR2 and/or ITGB3 and/or CHSY3 with respect to the organization of the extracellular matrix visualized in the absence of an inhibitor of Let-7b or of the extract according to the invention.

Within the meaning of the present invention, the term “improving the quality of the organization of the extracellular matrix” means an improvement in the organization of the extracellular matrix, in particular by limiting the negative regulation of the proteins FBN1 and/or XYLT1 and/or TGFBR2 and/or ITGB3 and/or CHSY3 relative to the organization of the extracellular matrix visualized in the absence of an inhibitor of Let-7b or of the extract according to the invention.

The visualization of the functional organization of the extracellular matrix can be carried out by immunohistochemical techniques or according to the method as described in patent EP2721408 of the applicant.

Another object of the present invention relates to the cosmetic and/or nutraceutical use of a Let-7b inhibitor or of an aqueous extract of Hippophae rhamnoïde seed according to the invention for maintaining and/or increasing the quantity of molecules organized extracellular matrix, in particular collagen fibers and/or elastic fibers.

Within the meaning of the present invention, the term “amount of molecules of the extracellular matrix organized” means the number of molecules of the extracellular matrix arranged and functional within the extracellular matrix.

Within the meaning of the present invention, the term "maintaining the quantity of molecules of the extracellular matrix organized" means preventing a reduction in molecules of the extracellular matrix organized compared to the quantity of molecules of the extracellular matrix organized measured in the absence of an inhibitor of Let-7b or of the extract according to the invention.

Within the meaning of the present invention, the term "increase the quantity of molecules of the extracellular matrix organized" means an increase in the quantity of molecules of the extracellular matrix organized with respect to the quantity of molecules of the extracellular matrix organized measured in absence of a Let-7b inhibitor or of the extract according to the invention.

The quantity of organized extracellular matrix molecules, in particular collagen fibers and/or elastic fibers, and the quality of their organization can be measured according to the method as described in patent EP2721408 of the applicant.

Another object of the present invention relates to the cosmetic and/or nutraceutical use of a Let-7b inhibitor or of an aqueous extract of Hippophae rhamnoides seed according to the invention for maintaining and/or increasing the synthesis of glycosaminoglycans especially chondroitin sulfates.

For the purposes of the present invention, the term “maintaining the synthesis of glycosaminoglycans, in particular of chondroitin sulfates” means preventing a reduction in the level of synthesis of glycosaminoglycans, in particular of chondroitin sulfate, compared to the level of synthesis of glycosaminoglycans, in particular of chondroitin sulfate, detected in the absence of an inhibitor of Let-7b or of the extract according to the invention.

Within the meaning of the present invention, the term “increase the synthesis of glycosaminoglycans, in particular chondroitin sulfates”, means an increase in the level of synthesis of glycosaminoglycans, in particular chondroitin sulfates, preferably by at least 10% in the presence of an inhibitor of Let -7b or Hippophae rhamnoïde seed extract, preferably at least 50%, more preferably at least 70% relative to the level of synthesis of glycosaminoglycans, in particular chondroitin sulfate detected in the absence of an inhibitor of Let-7b or of the extract according to the invention.

According to a preferred mode of the invention, the aqueous extract of Hippophae rhamnoïde seed is a cosmetic extract, topically acceptable.

According to another preferred mode of the invention, the Let-7b inhibitor is topically acceptable.

Within the meaning of the present invention, the term "topically acceptable" means an ingredient suitable for topical application, non-toxic, non-irritating to healthy skin, in particular the healthy scalp, and/or healthy mucous membranes, inducing no allergic response, which is not chemically unstable.

The Let-7b inhibitor or the extract according to the invention is applied to healthy skin which may be all or part of the healthy skin, and/or healthy mucous membranes of the body and/or the face and/or the scalp, preferentially the legs, thighs, arms, stomach, décolleté, neck, armpits, again preferentially all or part of the face, preferentially at the level of the cheeks and/or the angular zone of the face (commonly called roundness of the face or V of the face).

The Let-7b inhibitor or the aqueous extract of Hippophae rhamnoides seed can be used alone as a cosmetic and/or nutraceutical active ingredient or included in a cosmetic and/or nutraceutical composition.

When it is used alone in the form of active ingredient, the extract according to the invention is preferably in the form of a powder and dissolved in a particularly polar solvent, such as water, an alcohol, a polyol, a glycol, or one of their mixtures, in the presence or not of glycerine.

In a particular embodiment of the invention, the extract according to the invention is mixed with maltodextrin. In this case, maltodextrin makes it possible to obtain a non-hygroscopic cosmetic and/or nutraceutical ingredient.

Advantageously an amount of at least 20% (w/w) by weight relative to the total weight of the extract and the maltodextrin, preferably of at least 50% (w/w), even more preferably of at least 70 % (w/w) by weight of maltodextrin, is then added to the extract. The extract can then be concentrated by evaporation of the solvent or dried, for example by freeze-drying or by atomization. Preferably, the extract is dried by atomization.

Advantageously in this case, the cosmetic ingredient is as described in Example 6.

A subject of the present invention is also the cosmetic use of the extract according to the invention topically on healthy skin, in particular the scalp, and/or the mucous membranes in a cosmetic composition comprising at least one cosmetically acceptable excipient.

A subject of the present invention is also the use of the aqueous extract of Hippophae rhamnoïde seed in a cosmetic and/or nutraceutical composition comprising at least one cosmetically acceptable excipient, and in which the extract is present at a concentration of 1×10 ^-4 % to 10% (w/v) by weight of extract according to the invention relative to the total volume of the composition, preferably from 1x10 ^-4 % to 5% (w/v), still advantageously from 1x10 ^-3 % to 0.5% (w/v) by weight of extract according to the invention relative to the total volume of the composition.

In a particular embodiment of the invention, the cosmetic composition contains 0.2% (w/v) by weight of aqueous extract of Hippophae rhamnoïde seed relative to the total volume of the composition.

Preferably, the extract is used in a composition as described in Example 7.

In one embodiment of the invention, the extract is used in a cosmetic and/or nutraceutical composition to inhibit the expression of Let-7b and/or to maintain and/or improve the biomechanical properties of healthy skin and/or or healthy mucous membranes in particular for maintaining and/or improving the firmness and/or the elasticity and/or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis, and/or for maintaining or improving the quality of the organization of the extracellular matrix, to maintain or increase the quantity of molecules of the extracellular matrix organized, in particular collagen fibers and/or elastic fibers, and/or to maintain or increase the synthesis of glycosaminoglycans, in particular chondroitin sulfates.

.

According to the invention, the cosmetic composition may also comprise a cosmetically acceptable vehicle. By "cosmetically acceptable vehicle" is meant a vehicle suitable for use in contact with human skin cells, in particular cells of the epidermis, without toxicity, irritation, undue allergic response and the like, and proportionate to a benefit/ reasonable risk. It may for example be maltodextrin.

The composition according to the invention can be administered topically and/or orally. Advantageously, it is administered topically.

The cosmetic composition may also contain one or more cosmetically acceptable excipients chosen from surfactants and/or emulsifiers, preservatives, buffering agents, chelating agents, denaturants, opacifying agents, pH adjusters, reducing agents, stabilizers, thickeners, gelling agents, film-forming polymers, fillers, matting agents, shine agents, pigments, colorants, perfumes, and mixtures thereof. The PCPC (Personal Care Products Council) describes various cosmetic excipients suitable for use in the present invention.

Advantageously, the excipient(s) are chosen from the group comprising polyglycerols, esters, polymers and cellulose derivatives, lanolin derivatives, phospholipids, lactoferrins, lactoperoxidases, sucrose-based stabilizers, vitamin E and its derivatives, xanthan gums, natural and synthetic waxes, vegetable oils, triglycerides, unsaponifiables, phytosterols, silicones, protein hydrolysates, betaines, aminoxides, plant extracts, sucrose esters , titanium dioxides, glycines, and parabens, and more preferably from the group comprising steareth-2, steareth-21, glycol-15 stearyl ether, cetearyl alcohol, phenoxyethanol, methylparaben, ethylparaben, propylparaben, butylparaben, butylene glycol, caprylyl glycol, natural tocopherols, glycerin, dihydroxycetyl sodium phosphate, isopropyl hydroxycetyl ether, glycol stearate, triisononanoine, octyl cocoate, polyacrylamide, l isoparaffin, laureth-7, carbomer, propylene glycol, hexylene glycol, glycerol, bisabolol, dimethicone, sodium hydroxide, PEG 30-dipolyhydroxysterate, capric/caprylic triglycerides, cetearyl octanoate , dibutyl adipate, grapeseed oil, jojoba oil, magnesium sulfate, EDTA, cyclomethicone, xanthan gum, citric acid, sodium lauryl sulfate, waxes and mineral oils, isostearyl isostearate, propylene glycol dipelargonate, propylene glycol isostearate, PEG 8, beeswax, glycerides of hydrogenated palm heart oil, lanolin oil, sesame oil, cetyl lactate, lanolin alcohol, castor oil, titanium dioxide, lactose, sucrose, low density polyethylene, isotonic saline solution, and mixtures thereof.

The cosmetic composition according to the invention can be chosen from an aqueous solution, a cream or an aqueous gel, in particular a shower gel, a milk, an emulsion, a microemulsion or a nanoemulsion, in particular oil-in-water or water-in-oil. or multiple or silicone, a mask, a serum, a lotion, a liquid soap, an ointment, a foam, a patch, preferably a cream, a milk, an emulsion, a mask, a serum.

The composition used according to the invention may also contain cosmetic active ingredients leading to a complementary or synergistic effect, such as anti-aging active ingredients. Mention will be made, among these active agents, of active agents stimulating the synthesis of macromolecules in the dermis or preventing their degradation, agents stimulating the proliferation of keratinocytes, soothing and moisturizing agents, or even agents active in regulating the size of pores and/or their opening.

Among the anti-aging active ingredients, we can mention:

- an agent stimulating the synthesis of fibronectin, in particular a corn extract, such an extract being in particular marketed by BASF Beauty Care Solutions France under the name Deliner™ and the palmitoyl pentapeptide marketed by the company SEDERMA under the trade name Matrixyl®;

- an agent stimulating the formation of collagen fibers such as an extract of Origanum majorana marketed under the name Dermagenist™ by the applicant.

- an agent stimulating the expression of perlecan and dystoglycan in the extracellular matrix and/or in the basal epithelial membrane, such as for example an extract of Polygonum bistorta marketed under the name Perlaura™ by BASF Beauty Care Solutions France.

- an agent for protecting the fibroblast growth factor (FGF2) of the extracellular matrix against its degradation and/or its denaturation, in particular an extract of Hibiscus Abelmoscus as described in the patent application in the name of BASF Beauty Care Solutions France filed under number FR0654316 and marketed by BASF Beauty Care Solutions France under the name Linefactor ™ and/or a fibroblast growth stimulating agent, for example a fermented soy extract containing peptides, known under the name Phytokine™ marketed by BASF Beauty Care Solutions France and also described in patent application EP1119344B1 (Laboratoires Expanscience), and preferably a combination of these two extracts;

- an agent stimulating the synthesis of laminin, in particular a malt extract modified by biotechnology, such an extract being in particular marketed by BASF Beauty Care Solutions France under the name Basaline™;

- an agent stimulating the expression and/or activity of Hyaluronan synthase 2 (HAS2) such as the plant extracts described in patent application FR2 893 252 Al and in particular an aqueous extract of Galanga (Alpinia galanga) and marketed by BASF Beauty Care Solutions France under the name Hyalufix™;

- an agent stimulating the synthesis of lysyl oxidase like (LOXL) such as an extract of Geophila cordifolia and those described in patent application FR2855968, and in particular an extract of dill and marketed by BASF Beauty Care Solutions France under the name Lys'lastine™;

- an agent stimulating the synthesis of intracellular ATP, in particular an extract of Laminaria digitata seaweed marketed by BASF Beauty Care Solutions France under the name Seanergilium ^TM ;

- an active ingredient stimulating the synthesis of glycosaminoglycans, such as the fermentation product of milk;

- a collagen-stimulating active ingredient such as retinol and/or vitamin C;

- an active ingredient that inhibits metalloproteinases (MMP) such as more particularly MMP 1, 2, 3, 9 such as retinoids and derivatives, oligopeptides and lipopeptides, lipoamino acids, Argania spinosa leaf extract marketed by BASF Beauty Care solutions France SAS under the name Arganyl™; lycopene; isoflavones, quercetin, kaempferol, apigenin.

- an agent for increasing the expression of LOX to increase the architecture of the epidermis, such as for example an extract of Cichorium intybus marketed under the name LOX-AGE™ by BASF Beauty Care Solutions France.

- an agent for increasing the deglycation of collagen and/or increasing the expression of type I collagen such as a combination of an extract of Salvia miltiorrhiza leaves and niacin marketed by BASF Beauty Care Solutions France under the name CollRepair™ .

- an agent stimulating the synthesis of lumican and collagen such as a synthetic acetyl tetrapeptide Gln Asp Val His marketed by BASF Beauty Care Solutions France under the name Dermican™ and described in patent application WO2005120554A1.

- an agent for protecting and stimulating elastin, collagen, such as the extract of Manilkara multinervis leaves marketed by BASF Beauty Care Solutions France under the name Elestan™ and the root extract of Eperua falcata marketed by BASF Beauty Care Solutions France under the name Eperuline™

As soothing agents that can preferably be used in the composition according to the invention, mention may be made of: pentacyclic triterpenes, ursolic acid and its salts, oleanolic acid and its salts, betulinic acid and its salts, the salts of salicylic acid and in particular zinc salicylate, bisabolol, allantoin, omega-3 unsaturated oils, cortisone, hydrocortisone, indomethacin and beta methasone, anti-inflammatory active agents, and in particular those described in application FR2847267, in particular the root extract of Pueraria lobata marketed under the name Inhipase® by BASF Beauty Care Solutions France SAS, the extracts of Theobroma cacao.

Among the active agents on the regulation of the size of the pores and/or their opening, mention will be made by way of example of an extract of Cichorium intybus marketed under the name LOX-AGE™ by BASF Beauty Care Solutions France and/or on the production of sebum, mention will be made by way of example of synthetic sarcosine marketed under the name of Mat-XS™ Clinical and/or an extract of Orthosiphon stamineus as described in patent application WO2010063674 in the name of BASF Beauty Care Solutions France and marketed under the name MAT XS™ Bright.

As moisturizing agents that can preferably be used in the composition according to the invention, mention may be made of: a combination of pullulan, sodium hyaluronate and sodium alginate such as that marketed by BASF Beauty Care Solutions France under the name Patch2O™.

Other aims, characteristics and advantages of the invention will appear clearly to those skilled in the art following reading of the explanatory description which refers to examples which are given solely by way of illustration and which cannot in no way limit the scope of the invention.

The examples form an integral part of the present invention and any feature appearing new with respect to any state of the prior art from the description taken as a whole, including the examples, forms an integral part of the invention in its function and in its generality. Thus, each example is general in scope.

On the other hand, in the examples, all the percentages are given by weight, unless otherwise indicated, the temperature is expressed in degrees Celsius unless otherwise indicated, and the pressure is atmospheric pressure, unless otherwise indicated.

Example 1: Preparation of the aqueous extract of the seed of Hippophae rhamnoides according to the invention .

Example 1a) Aqueous Seed Extraction of Hippophae rhamnoides according to the invention

A quantity of 20% by weight of seeds of Hippophae rhamnoïde compared to the total weight of seeds and water was ground in a robot grinder then homogenized for a few seconds using a homogenizer before being extracted in water. as the sole solvent at room temperature for a period of 2 hours. The extract was then centrifuged and the pellet removed. The extract obtained is then filtered through 0.1-0.3 micrometer filters and then freeze-dried.

Example 1b) Supercritical Seed Extraction of Hippophae rhamnoides according to the invention

A quantity of 10% by weight of seed of Hippophae rhamnoïde was ground in a robot grinder before being extracted by supercritical extraction with carbon dioxide at 60 bars, 30° C. for 80 minutes.

The coproduct of the supercritical carbon dioxide extraction of Hippophae rhamnoïde was introduced into osmosed water for 1 hour at 80°C +/- 2°C with stirring and the pH was adjusted to 5.4 +/- 0.2. The mixture was then allowed to cool to 23°C +/-3°C. The extract was then coarsely sieved then centrifuged and the supernatant was discarded. Finally, the extract was filtered to 0.1 - 0.3 microns. An amount of 60% to 80% (w/w) of maltodextrin relative to the total weight of the mixture, was added. The extract obtained was then filtered again and then atomized at a temperature of 180°C.

Example 2: Determination of target proteins of Let-7b.

The concentration variation of the five proteins identified as potentially regulated by Let-7b were measured by Western Blot through a gain-loss of function experiment.

Total proteins were extracted 72 hours and 96 hours after transfection of Let-7b complementary synthetic RNA (ref 4100945-101, EXIQON, ACCACACAACCTACTACCTC (SEQ ID No: 2)) inhibiting its activity and synthetic RNA having the same sequence as Let-7b (ref 470775-001, EXIQON, TGAGGTAGTAGGTTGTGTGGTT (SEQ ID No: 1)) mimicking its activity in the primary fibroblast (obtained by biopsy on female subject, 47 years old).

10 µg of protein were separated on acrylamide gel (NuPAGE Novex 4-12% BBos-Tris gel ® – Invitrogen®) and transferred to nicocellulose membrane (GE Amersham®). The proteins were specifically detected using primary antibodies (anti-XYLT1, anti-CHSY3 and anti-TGFBR2 from Santa Cruz Biotechnology®, anti-FBN1 from Thermofisher technologies® and anti-ITGB3 from Cell signaling technology®). The control was carried out using an anti-HRP-b-actin antibody (Sigma®). The intensity of the signal obtained for each band was measured using data processing software (ImageJ® - Gel analyzer algorithm).

Protein Normalized protein expression in control fibroblast Relative level of protein expression in the fibroblast transfected with a Let-7b inhibitor compared to the control fibroblast. FBN1 1 + 70% XYLT1 1 + 190% TGFBR2 1 + 110% Actin 1 1

Table 1: Analysis of the results of Western Blots performed with or without transfection of a Let-7b inhibitor.

Protein Normalized protein expression in control fibroblast Relative level of protein expression in the fibroblast transfected with an RNA mimicking the activity of Let-7b compared to the control fibroblast. ITGB3 1 - 80% CHSY3 1 - 58% Actin 1 1

Table 2: Analysis of the results of Western Blots carried out with or without transfection of an RNA mimicking the activity of Let-7b.

Conclusion

The miRNA Let-7b has a negative influence on the synthesis of FBN1, XYLT1, TGFBR2, ITGB3 and CHSY3, in particular on XYLT1 and CHSY3.

Example 3: Quantification of Let-7b in the presence or absence of a potentially active substance.

3.1 Cultivation

Fibroblasts from healthy dermis were isolated by trypsination (abdomen, woman between 53 and 68 years old) and cultured in DMEM® medium (Dubecco's Modified Eagle Medium® – Life Technologie®) containing 10% (v/v) calf serum and antibiotics, then incubated at 37°C in the presence of 5% (v/v) CO ₂ for 24 hours. The cells were then placed in the presence or not of the potentially active substance at two different concentrations, 0.003% (w/v) and 0.02% (w/v) by weight of extract according to the invention relative to the total volume. culture medium, for 48 hours without fetal calf serum and in the presence of 5% CO ₂ .

3.2 Quantization

The total RNAs were extracted from the different cultures (cultures carried out as presented in example 3.1, in the presence or absence of the active substance as presented in example 1b) using a nucleic acid isolation kit ( NucléoSpin miRNA® - Marcherey-Nagel®) with physical separation between long and short RNAs. Optical density measurement at 260nm and 280nm then allows validation of the quality and quantity of RNA.

Following this, the reverse transcription step was performed on 1µg of short RNAs from different conditions tested in a final volume of 20µL using a reverse transcription kit (miScript II RT kit®, Qiagen® ). The reaction mixture was incubated for one hour at 37°, then the reverse transcription enzymes were inactivated by increasing the temperature to 95°C for 5 minutes and the reaction mixture was stored at -20°C until quantitative PCR analysis.

The quantitative PCR step was performed using three types of primers (presented in the table below). The first allows the amplification of Let-7b miRNAs and the next two are used for the amplification of small nuclear RNAs in order to develop calibration curves by the delta-delta-Ct method. This step is carried out in 1 μL of reverse transcription reaction mixture diluted to 1/250 using specific oligonucleotides and a PCR quantification kit in a thermocycler (LightCycler® 480 Roche®). Each test is carried out in duplicate. The fluorescence of the SYBR Green contained in the kit is measured after each amplification cycle. The melting curves are produced following each qPCR.

Primer sens hsa-let-7b-5p TGAGGTAGTAGGTTGTGTGGTT SEQ ID NO: 3

Sense primer snoRNA U6 ATGTTATGATGATGGGCGAAATGT SEQ ID NO: 4

Sense primer snRNA U1A TTACCTGGCAGGGGAGATAC SEQ ID NO: 5

Poly T antisense primer TTTTTTTTTTTTTTT SEQ ID NO: 6

Unprocessed control Aqueous extract of Hippophae rhamnoïde seed 0.003% (w/v) in the medium Aqueous extract of Hippophae rhamnoïde seed 0.02% (w/v) in the medium Amount of Let-7b vs untreated (in %) 100 82 61 Standard error 0 6 11 P-value 0.047 0.028

Table 3: Decrease in the concentration of Let-7b in the human fibroblast in the presence of the extract according to the invention .

Conclusion

The extracts according to the invention induce a decrease in the expression of Let-7b by 18% and 39% for respective concentrations of 0.003% (w/v) and 0.02% (w/v) by weight of extract according to the invention relative to the total volume of the composition in the medium, relative to the untreated control.

Example 4: Assessment in vitro improvement of the biomechanical properties of the dermis.

The density and firmness of the dermis are measured using the low pressure and relaxation indentation test on dermal equivalent.

The dermal equivalent used corresponds to the Applicant's Mimederm® technology. For its manufacture, 500,000 cells/cm2 of primary human fibroblasts (dermis of the breast, 18-year-old female donor) were seeded on a collagen sponge (Mimedisk® from the Applicant) in DMEM/HAM F12 medium (Life Technologies®) supplemented with 20% fetal bovine serum. The culture medium was changed daily with 50 μg/mL of ascorbic acid. From the ^3rd day of culture, the dermis were treated or not with 0.02% (w / v) of the aqueous extract of seed of Hippophae rhamnoïde according to example 1b), by weight of extract according to the invention with respect to the total volume of the composition . Culture of treated and untreated dermal equivalents were stopped after 28 days.

The low pressure and relaxation indentation test was then performed on the dermal equivalents thus obtained. The test was repeated three times for each sample at constant penetration depth (100 µm), displacement is applied at constant indentation speed (δ¼ 50 µm/s for 120 seconds). Data is collected at a sampling rate of 1kHz.

The indenter used is a spherical PTFE indenter, with a radius of curvature R¼1.6 mm. The tests were carried out in an air-conditioned room with a controlled temperature of 22 to 24°C and a relative humidity of approximately 30% to 40%.

Conclusion

Following the treatment, the Applicant noted that the extract according to the invention induces a 14% increase in the Young's modulus compared to the untreated control (p=0.06), which demonstrates that the extract causes a increase in the biomechanical properties of the dermis.

Example 5: In vivo study on human volunteer.

A study on human volunteers was carried out in order to test the effectiveness of a formulation, containing 0.2% (w/v) of the extract described in example 1b, vis-à-vis the major signs of loss of the biomechanical properties of the dermis, in particular the sagging of the skin.

1. Study protocol.

27 Caucasian women, aged 55 to 70, with a loss of skin firmness and elasticity were subjected to a randomized double-blind test comprising the application twice a day for 56 days of the formulation described in the example on half the face and a placebo on the other half. The results were measured at the start of treatment (D0), after 28 days (D28) and after 56 days (D56) under dermatological control.

1. Study of variations in the density and elasticity of the dermis

The variations in the density and elasticity of the dermis were measured using a high-resolution ultrasound scanner (Dub SkinScanner – TPM, 22Mhz) measuring the hyperechoic density factor, corresponding to the percentage of measured pixels having an intensity strong (between 200 and 255).

Conclusion

The Applicant observed that the extract according to the invention caused a significant increase in the hyperechoic density factor of approximately 26% compared to the placebo after 56 days of application.

1. Study of variations in skin firmness

Variations in skin firmness were measured at the level of the lower corner of the face using a device for measuring skin firmness of the SkinFibroMeter® type (DelfinTechnologies®). An increase in this factor corresponds to an increase in the firmness of the dermis.

Conclusion

The Applicant observed that the extract according to the invention caused a significant increase in the firmness of the skin of the cheeks of about 18.5% compared to the placebo after 56 days of application, which means that the composition comprising the extract according to the invention increased the density and elasticity of the dermis.

Example 6: Cosmetic ingredient comprising an aqueous extract of the seed of Hippophae rhamnoides.

Aqueous extract of Hippophae rhamnoïde seed obtained according to Example 1b) 30% by weight Maltodextrin 70% by weight

Example 7: Cosmetic composition comprising an aqueous extract of the seed of Hippophae rhamnoides.

The procedure is carried out according to the methods known to those skilled in the art for mixing together the various phases A, B, C, D below to prepare a composition according to the present invention. The proportions are expressed in %.

Stage A

Propylheptyl caprylate 4.00

Dicaprylyl carbonate 4.00

Sodium polyacrylate 0.70

Phase B

Water 69.55

Propylene glycol, phenoxyethanol, chlorphenesin, methylparaben 2.50

Glycerine, glyceryl polyacrylate 10.00

Butylene glycol 5.00

Disodium EDTA 0.05

Stage C

Sclerotium gum 2.00

Stage D

Cosmetic ingredient according to example 6 0.20

Water 2.00

Items

1. Cosmetic and/or nutraceutical use of an aqueous extract of the seed of Hippophae rhamnoïde for inhibiting the expression of Let-7b in healthy skin and/or healthy mucous membranes or for maintaining or improving the biomechanical properties of healthy skin and/or or healthy mucous membranes, in particular the firmness, the elasticity and/or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis.
2. Use according to item 1, to inhibit the expression of Let-7b in the healthy dermis and/or the healthy basal laminae, in particular of the healthy dermoepidermal junction, preferentially in the healthy dermis.
3. Use according to one of items 1 or 2 to inhibit the expression of Let-7b in healthy fibroblasts.
4. Use according to any one of items 1 to 3 for maintaining or improving the quality of the organization of the extracellular matrix, for maintaining or increasing the quantity of molecules of the extracellular matrix organized, in particular collagen fibers and/or fibers elastic, and / or to maintain or increase the synthesis of glycosaminoglycans, in particular of chondroitin sulphates.
5. Use according to any one of items 1 to 4, wherein the aqueous extract of Hippophae rhamnoides seed is obtained by aqueous extraction of the coproduct of supercritical carbon dioxide extraction of Hippophae rhamnoides seed.
6. Use according to any one of items 1 to 5, in which the aqueous extraction of the Hippophae rhamnoïde seed is carried out with a solvent comprising at least 60% by weight, advantageously at least 70% by weight, in particular at least 80% by weight, more particularly at least 90% by weight, in particular at least 95% by weight, of water relative to the total weight of the aqueous solution.
7. Use according to any one of items 1 to 6, wherein the aqueous extraction of the seed of Hippophae rhamnoides is carried out with water as the sole solvent.
8. Use of an extract according to any one of items 1 to 7, in which the Hippophae rhamnoides extract is present in a cosmetic and/or nutraceutical composition comprising at least one cosmetically acceptable excipient, and in which the extract is present at a concentration of 1x10 ^-4 % to 10% (w/v) by weight of extract according to the invention relative to the total volume of the composition, preferably from 1x10 ^-4 % to 5% (w/v), again advantageously from 1x10 ^-3 % to 0.5% (w/v) by weight of extract according to the invention relative to the total volume of the composition.
9. Cosmetic care process comprising the application, preferably topically, of an aqueous extract of Hippophae rhamnoïde seed according to any one of items 1 to 8 and/or of a cosmetic composition comprising it, at the level of the healthy skin, in particular healthy scalp, and/or healthy mucous membranes, for inhibiting the expression of Let-7b in healthy skin and/or healthy mucous membranes or for maintaining or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular for maintaining or improving the firmness, elasticity and/or density of healthy skin and/or healthy mucous membranes, in particular healthy dermis, preferably for maintaining or improving the quality of the organization of the extracellular matrix, to maintain or improve the organization of collagen fibers and/or elastic fibers, and/or to increase the synthesis of glycosaminoglycans, in particular of chondroitin sulphates.
10. Cosmetic care process according to item 9 , in which the application is carried out on all or a healthy part of the body and/or the face and/or the scalp, preferably the legs, thighs, arms, stomach, neckline, neck, armpits, all or part of the face, preferably in the cheeks and/or the angular area of the face.

Claims (13)

Method for using a Let-7b inhibitor in cosmetics and/or nutraceuticals, comprising the following steps:

1. Bringing target cells into contact with a potential Let-7b inhibitor,
2. Quantification of Let-7b expression,
3. Selection of potential Let-7b inhibitor if Let-7b expression is decreased,
4. Use of the potential Let-7b inhibitor selected as an active principle in cosmetics and/or in nutraceuticals.

Process according to Claim 1, in which the Let-7b inhibitor is used to maintain or improve the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular to maintain or improve firmness, elasticity and/or or the density of the healthy skin and/or of the healthy mucous membranes, in particular of the healthy dermis. A method according to claim 1 or 2, wherein the Let-7b inhibitor is used to maintain or improve the quality of extracellular matrix organization, to maintain or improve the amount of extracellular matrix molecules organized , in particular collagen fibers and/or elastic fibers, and/or for maintaining or increasing the synthesis of glycosaminoglycans, in particular chondroitin sulphates. A method according to any of claims 1 to 3, wherein the target cells are healthy human fibroblasts. Method according to any one of Claims 1 to 4, in which the quantification step is a direct quantification of the quantity of Let-7b and/or an indirect quantification by measuring the variation in the quantity of target proteins and/ or their corresponding mRNAs. Process according to Claim 5, in which the proteins to be regulated and/or their corresponding mRNAs are fibrillin 1 (FBN1) and/or xylosyl transferase 1 (XYTL1) and/or the TGF beta 2 receptor (TGFBR2) and/or the integrin beta 3 (ITGB3) and/or chondroitin sulfate synthase 3 (CHSY3), preferentially xylosyl transferase 1 (XYTL1) and/or integrin beta 3 (ITGB3) and/or chondroitin sulfate synthase 3 (CHSY3), still preferentially xylosyl transferase 1 (XYTL1) and/or chondroitin sulfate synthase 3 (CHSY3). A method according to any of claims 1 to 6, wherein the quantification of Let-7b expression is performed by direct quantification by RT-qPCR. Process according to any one of Claims 1 to 7, in which the potential inhibitor is present at a concentration ranging from 1x10 ^-4 % to 10% (w/v), preferentially from 0.001% to 0.1% (w/ v), more preferably from 0.003% to 0.02% (w/v) by weight of Let-7b inhibitor relative to the volume of the culture medium. Cosmetic and/or nutraceutical use of a Let-7b inhibitor for maintaining or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular the firmness, elasticity and/or density of healthy skin and / or healthy mucous membranes, in particular healthy dermis. Use according to claim 9, for maintaining or improving the quality of the organization of the extracellular matrix, for maintaining or increasing the quantity of molecules of the organized extracellular matrix, in particular collagen fibers and/or elastic fibers, and/or to maintain or increase the synthesis of glycosaminoglycans, in particular chondroitin sulphates. Use according to claim 9 or 10, wherein the Let-7b inhibitor is selected by the method according to any of claims 1 to 8. Cosmetic care process comprising the topical application of a Let-7b inhibitor and/or of a cosmetic composition comprising it, at the level of the healthy skin, in particular the healthy scalp, and/or the healthy mucous membranes, for maintaining or improving the biomechanical properties of healthy skin and/or healthy mucous membranes, in particular the firmness, elasticity and/or density of healthy skin and/or healthy mucous membranes, in particular healthy dermis. Cosmetic care process according to claim 12 , in which the application is carried out on all or a healthy part of the body and/or the face and/or the scalp, preferably the legs, thighs, arms, stomach, décolleté , the neck, the armpits, all or part of the face, preferably at the level of the cheeks and/or the angular zone of the face.