WO2019069007A1

WO2019069007A1 - Process for using a let-7b inhibitor in cosmetics and/or nutraceuticals

Info

Publication number: WO2019069007A1
Application number: PCT/FR2018/052417
Authority: WO
Inventors: Vincent Bardey; Corinne Reymermier
Original assignee: Basf Beauty Care Solutions France Sas
Priority date: 2017-10-03
Filing date: 2018-10-02
Publication date: 2019-04-11
Also published as: CN111148506A; FR3071742B1; FR3071742A1

Abstract

The present invention relates to a process for using a let-7b inhibitor in cosmetics and/or nutraceuticals and in particular to the cosmetic or nutraceutical use of an aqueous extract of Hippophae rhamnoïdes seed having a let-7b inhibitory capacity in order to inhibit the expression of let-7b in the skin and/or the mucous membranes in order to maintain or improve the biomechanical properties thereof, especially the firmness, elasticity and/or density thereof.

Description

Method of using a Let-7b inhibitor in cosmetics and / or

nutraceutical

The present invention relates to a method of using a potential inhibitor of hsa-Let-7b-5p microRNA (hereinafter Let-7b) in the cosmetic and / or nutraceutical fields.

The present invention also relates to the use of a new cosmetic and / or nutraceutical ingredient and a composition comprising it for inhibiting the expression of Let-7b, especially in healthy skin and / or healthy mucous membranes, and / or to maintain and / or improve the biomechanical properties of healthy skin and / or healthy mucous membranes. The structure and properties of the skin change under the effect of complex biological, physical and biomechanical processes, resulting in a loss of elasticity, firmness, density of the dermis. This results in loosening and unsightly collapse of the skin of the body, including that of the face.

From a structural point of view, alterations in the biomechanical properties of the skin are usually due to changes in the organization of the extracellular matrix of the dermis. They include the deregulation of the synthesis of glycosaminoglycans (or GAG), including chondroitin sulphates, involved in structural functions and physiological regulation in the skin. These changes also include alterations in the polymerization and crosslinking of collagen and elastin fibers. In this case, these fiber networks lose their biomechanical properties, the skin loses its support function and collapses.

These phenomena are caused by intrinsic factors on the one hand, including genetic factors, as well as by extrinsic factors on the other, such as ultraviolet rays and / or smoking and / or pollution. These may include epigenetic modifications including regulation by microRNAs.

Endogenous microRNAs (or miRNAs) are a family of small non-coding RNAs, typically 20 to 24 nucleotides in length, that negatively regulate gene expression at the post-transcriptional level. They bind base to the 3'-UTR regions of their target mRNAs, resulting in their degradations and consequently the decrease or inhibition of translation of the corresponding proteins into the cell. In the 2000s, early work showed that these molecules play a role as biological regulators and are involved in many life processes. The understanding of epigenetic regulations and the discovery of mRNAs targeted by miRNAs has since become a major issue, particularly in the therapeutic and cosmetic fields.

Prediction by sequence alignment assisted by computational algorithms is one of the methods used for these purposes. However, experimental results suggest that even perfect alignment is not the absolute proof of the in vivo interaction of miRNA and its target. Indeed, the expression of miRNAs and mRNAs being specific cell, the sequence alignment prediction suffers because it does not take into account the co-expression, or not, of the two entities in the cell.

The Applicant has discovered that Let-7b regulates the genetically negative epi synthesis of five proteins in fibroblasts: fibrillin 1 (FBN1), xylosyl transferase 1 (XYLT1), TGF beta 2 receptor (TGFBR2), integrin beta 3 (ITGB3) and chondroitin sulfate synthase 3 (CHSY3). (See example 2)

The CHSY3 and XYLT1 proteins are responsible for the synthesis of chondroitin sulphates such as decorin and biglycan which are necessary for the assembly of glycosaminoglycan chains (GAG), which are themselves involved in the organization of collagen fibers and elastic fibers. within the extracellular matrix.

TGFBR2 is one of two receptors of the TGF-beta signaling pathway. It participates in the regulation of healing and tissue repair. In addition, the non-expression of TGFBR2 causes the slowing down of the scar contraction phenomenon and delays the reorganization of the collagen of the dermis within the extracellular matrix.

FNB1 is a major component of the myofibrils that serve as a framework within the extracellular matrix for the deposition of tropoelastin during the synthesis of elastic fibers.

ITGB3 participates in the integrin complex and is involved in cell-matrix interactions through its binding with fibrilin 1, influencing the extracellular matrix deposition and the 3D structure of the dermis.

The Applicant has therefore discovered that the increase in Let-7b, in addition to negatively regulating the synthesis of collagen in the dermis, plays a major role in the loss of organization of the extracellular matrix of the dermis, in particular the organization of collagen fibers, elastic fibers and GAGs. This miRNA is thus responsible for reducing the firmness, elasticity and density of healthy skin and / or healthy mucous membranes.

The Applicant has found, as explained in application EP2721408, that the extracellular matrix (ECM) molecules are synthesized in native form in the cells in contact with the MEC. From the intracellular compartment, they are excreted outside the cells. After maturing phenomena, they organize and combine in a network that forms the MEC. They are then in their functional form. Certain cosmetic active ingredients can globally stimulate the collagen synthesis of the ECM without, however, visualizing an improvement in the functionality of the collagen, that is to say, no increase in the collagen content in the MEK or increasing the fiber content of organized collagens. The Applicant has also found that certain ingredients improve the functionality of the collagen, that is to say the quality of the organization of the collagen fibers in the MEK and / or the amount of collagen fibers organized in the MEK without, however, measuring increase in procollagen synthesis. An important synthesis of ECM molecules by cells in culture measured in the intracellular and / or extracellular medium does not necessarily result in a larger amount of functional molecules.

The invention thus also relates to the cosmetic and / or nutraceutical use of a Let-7b inhibitor to improve the functionality of the extracellular matrix molecules. Thus, it aims to use a Let-7b inhibitor to maintain and / or improve the quality of the organization of the extracellular matrix, and / or to maintain and / or improve the quantity of organized extracellular matrix molecules. , in particular collagen fibers and / or elastic fibers and / or to maintain and / or increase the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

Therefore, the cosmetic and / or nutraceutical use of an inhibitor of the expression of Let-7b makes it possible to maintain and / or to improve the biomechanical properties of healthy skin and / or healthy mucous membranes, preferentially the firmness and and / or the elasticity and / or the density of healthy skin and / or healthy mucous membranes, in particular of the healthy dermis. This new cosmetic target being identified, it is therefore necessary to determine a new way to test possible inhibitors.

Indeed, as detailed above, miRNAs such as Let-7b have a specific cell expression. The Applicant has therefore developed a method of using a potential inhibitor of Let-7b to take into account the specific expression of miRNAs and mRNAs.

Thanks to the latter, the applicant has discovered that the aqueous extract of seed Hippophae rhamnoïdes L. (hereinafter abbreviated Hippophae rhamnoïdes) is an inhibitor of expression Let-7b particularly interesting for its use in cosmetics and / or in nutraceuticals for maintain and / or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, including maintaining and / or increasing the firmness and / or elasticity and / or density of healthy skin and / or healthy mucous membranes, particular of the healthy dermis, and / or to maintain and / or improve the quality of the organization of the extracellular matrix and / or to maintain and / or increase the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or or elastic fibers and / or to maintain and / or increase the synthesis of glycosaminoglycans, especially chondroitin sulfates.

Hippophae rhamnoïdes, also known as sea buckthorn, is a species of woody plant found in Europe, especially in Germany, and in Asia, especially in China, belonging to the family of Eléagnacées.

The use of sea buckthorn berry has been known in Tibetan traditional medicine for more than a thousand years, and the plant is widely used in traditional Chinese medicine especially for treating cardiovascular diseases. The Greeks also used the Hippophae rhamnoid fruit for its analgesic properties, to treat stomach pains and scurvy. Seed oil is widely used, especially in cosmetics as an age, but also as a dietary supplement or in dermatology for the healing of burns, and this, because of its high content of polyunsaturated fatty acids.

The production of Hippophae rhamnoid seed oil generates a residue consisting of the aqueous fraction of the seed. This last fraction is usually eliminated and constitutes a consequent loss of material. In a particularly unexpected manner, the Applicant discovered that this aqueous fraction of the plant, hitherto little studied, was carrying many activities that are the subject of this patent.

The patents FR2840809, JP4933768 and JP4495925 disclose the use of the hydrophilic fraction of the fruit of Hippophae rhamnoid as an anti-aging agent. However, none of his patents discloses the use of an aqueous extract of Hippophae rhamnoid seed.

Patent Application EP2282750 describes the use of the residue of supercritical CO ₂ extraction of Hippophae rhamnoid berries then extracted by aqueous extraction to maintain a healthy skin, reduce aging of the skin, to maintain and improve elasticity skin, or as an active ingredient to promote skin regeneration and healing. This application does not however disclose the cosmetic use of an aqueous extract of Hippophae rhamnoid seed KR101276141 discloses a method for extracting Hippophae rhamnoid seed for removing oily compounds comprising the use of alcohol in GC as an extraction solvent and vacuum filtration using diatomite. The extract obtained has anti-oxidant and antibacterial properties and can in particular be used as an active ingredient in a composition to prevent aging of the skin. This patent does not however disclose the cosmetic use of an aqueous extract of Hippophae rhamnoid seed to inhibit expression of Let-7b to maintain and / or improve the biomechanical properties of the skin.

Thus to the knowledge of the Applicant, none of the prior arts discloses the cosmetic use and / or nutraceutical use of an aqueous extract of Hippophae rhamnoid seed to maintain and / or improve the biomechanical properties of the skin, including maintaining and and / or to increase the firmness and / or elasticity and / or density of the skin, in particular of the healthy dermis and / or to maintain and / or improve the quality of the organization of the extracellular matrix and / or to maintain and and / or increasing the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or elastic fibers and / or for maintaining and / or increasing the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

A first aspect of the invention is to provide a method of using Let-7b inhibitors.

A second aspect of the present invention is also to provide a new cosmetic active ingredient and / or nutraceutical capable of inhibiting the expression of Let-7b, especially in the skin. Such an ingredient has the advantage of maintaining and / or improving the biomechanical properties of healthy skin and / or healthy mucous membranes, especially the firmness and / or elasticity and / or density of healthy skin and / or mucous membranes. healthy, in particular the healthy dermis and / or to maintain and / or improve the quality of the organization of the extracellular matrix and / or to maintain and / or improve the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or elastic fibers and / or to maintain and / or increase the synthesis of glycosaminoglycans, especially chondroitin sulphates.

Another aspect of the present invention is also to use a non-upgraded fraction of Hippophae rhamnoïdes, in particular in the manufacture of cosmetic compositions. The advantage of this new cosmetic active ingredient is to be topically acceptable for the skin, especially the scalp, and / or the mucous membranes, non-toxic, easily available, easily manufactured and packaged on an industrial scale. The present invention firstly relates to a method of using a Let-7b inhibitor in cosmetics and / or nutraceuticals, comprising the following steps: a) bringing the target cells into contact with a potential inhibitor of Let-7b b) Quantification of Let-7b expression, c) Selection of the potential inhibitor of Let-7b if the expression of Let-7b is decreased, d) Use of the potential inhibitor of Let-7b selected in as an active ingredient in cosmetics and / or nutraceuticals.

For the purposes of the present invention, the term "potential inhibitor" means any extract of plant, animal and / or prokaryotic biological material as well as any molecule or mixture of molecules resulting from chemical synthesis and their mixtures. Preferably, the potential inhibitor is an extract of plant biological material.

This extract and / or this synthetic molecule is selected as a "Let-7b inhibitor" when the amount of Let-7b measured by RT-qPCR after contacting the potential inhibitor is less than the amount measured in the no contacting of the potential inhibitor, under identical conditions of temperature, contact time, and operating conditions, or comparable. Preferably, it is an inhibition of at least 10% in the presence of the potential inhibitor Let-7b, more preferably at least 30% relative to the amount of Let-7b measured in the absence of the potential inhibitor according to the invention.

By Let-7b is understood hsa-Let-7b-5p. Its sequence of this microRNA is described of SEQ ID NO: 1.

Step a) corresponds to the contacting, that is to say the addition of the potential inhibitor in the target cell and / or in the culture medium of said target cell. Preferentially, the target cells are fibroblasts, preferably human, preferably healthy. Advantageously, the fibroblasts are those which express Let-7b, more preferably, the fibroblasts are derived from the connective tissue of the skin.

For the purposes of the present invention, the term "target cell" is understood to mean the set of cells in which the target proteins and / or their corresponding mRNAs and Let-7b are coexpressed. For the purposes of the present invention, the term "target proteins and / or the corresponding mRNA" means all the proteins and / or mRNAs coding for these proteins whose expression is regulated by Let-7b. Preferably, the proteins to be regulated and / or their corresponding mRNAs are fibrillin 1 (FBN1) and / or xylosyl transferase 1 (XYLT1) and / or the TGF beta 2 receptor (TGFBR2) and / or integrin beta 3 ( ITGB3) and / or chondroitin sulfate synthase 3 (CHSY3), preferably xylosyl transferase 1 (XYLT1) and / or integrin beta 3 (ITGB3) and / or chondroitin sulfate synthase 3 (CHSY3), more preferably xylosyl transferase 1 (XYLT1) and / or chondroitin sulfate synthase 3 (CHSY3).

Unless otherwise indicated, "healthy" cells and in particular "healthy" fibroblasts are understood to mean cells, and in particular fibroblasts that have no pathology.

The target cells are preferably fibroblasts. Advantageously, the fibroblasts are those which express Let-7b, more preferably the fibroblasts are derived from the connective tissue of the skin.

The target cells are previously cultured according to conventional culture methods known to those skilled in the art. Preferably, the target cells are cultured in DMEM® medium (Dubecco's Modified Eagle Medium® - Life Technologie®).

According to an advantageous embodiment of the process according to the invention, the potential inhibitor is present at a concentration ranging from 1 × 10 ^-4 % to 10% (w / v), preferentially from 0.001% to 0.1% (w / v). still more preferably from 0.003% to 0.02% (w / v) by weight of Let-7b inhibitor relative to the volume of the culture medium Advantageously, the tested concentrations of potential inhibitor are 0.003% at 0.02% (w / v) by weight of the Let-7b inhibitor relative to the total volume of the culture medium Preferably, the contacting is carried out for a period ranging from 12 hours to 72 hours. advantageously, it is about 48 hours.

Advantageously, the contacting is carried out at a temperature ranging from 20 ° C to 45 ° C, preferably at room temperature, preferably at about 37 ° C.

By way of example, and without limitation, the cells can be cultured according to the protocol detailed in Example 3.1. Step b), called quantification is a step of measuring the expression of Let-7b. It can be performed by any known method of measuring molecular biology. The quantization step is a direct quantification by measuring the amount of Let-7b and / or indirect quantification by measuring the amount of Let-7b regulated proteins and / or their corresponding mRNAs.

It may be the direct quantification by measurement of the amount of Let-7b, in particular by measurement on RNA chips and / or by real-time reverse transcription polymerase chain reaction measurement (RT-qPCR or real time RT-PCR).

It may also be indirect quantification by measuring the quantity of the target proteins and / or corresponding mRNAs. The amount of corresponding protein and / or mRNA is inversely correlated to the expression level of Let-7b. The quantification of the target mRNAs can be done by measurement on RNA chips and / or by real time reverse transcription polymerase chain reaction (RT-qPCR or real time RT-PCR). Quantification of the target proteins can be done by Western Blot. Preferably, the quantification of Let-7b expression is carried out by direct quantification by RT-qPCR.

Advantageously and not limitatively, step b) can be performed according to the protocol described in Example 3.2.

Step c), said selection comprises comparing the results of step b) with respect to one or more positive controls of the inhibition of Let-7b and / or with respect to one or more negative controls of the inhibition of Let-7b and / or between several potentially active substances between it and / or with respect to the absence of any added substance in culture medium and / or in the cell. Preferably, the comparison is made with respect to the quantity measured in the absence of any added substance in the culture medium and / or in the cell.

Advantageously, the Applicant considers, in the context of the invention, that the selection of the potentially active molecules during the screening can be carried out for inhibitions of the synthesis of Let-7b described as strong. For the purposes of the present invention, the term "strong inhibition" means any inhibition greater than or equal to 30% of the reference activity. This reference activity is measured without the target cell being brought into contact with the potentially active substance under identical or comparable conditions of temperature, contact time, and operating conditions. In a preferred embodiment of the method of use according to the invention, the Let-7b inhibitor is an aqueous extract of Hippophae rhamnoid seed.

Step d) corresponds to the use of the selected Let-7b inhibitor, as active ingredient in cosmetics and / or nutraceuticals.

The subject of the invention is also a process for the use of a Let-7b inhibitor in cosmetics and / or nutraceuticals as described, in which the Let-7b inhibitor is used to maintain and / or improve the properties. biomechanics of healthy skin and / or healthy mucous membranes, in particular for maintaining and / or improving the firmness and / or elasticity and / or the density of healthy skin and / or healthy mucous membranes, especially of healthy dermis.

The subject of the invention is also a method of using a Let-7b inhibitor in cosmetics and / or nutraceuticals as described, in which the Let-7b inhibitor is used to maintain and / or improve the firmness and / or density of healthy skin and / or healthy mucous membranes, especially of healthy dermis.

The invention also relates to a method for using a Let-7b inhibitor in cosmetics and / or nutraceuticals as described, in which the Let-7b inhibitor is used to maintain and / or improve the quality the organization of the extracellular matrix and / or to maintain and / or improve the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or elastic fibers and / or to maintain and / or increase the synthesis of glycosaminoglycans, especially chondroitin sulphates.

The present invention also relates to the cosmetic and / or nutraceutical use of an aqueous extract of H / ppophae rhamnoid seed to inhibit the expression of Let-7b in healthy skin and / or healthy mucous membranes and / or to maintain and / or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, including firmness and / or elasticity and / or density of healthy skin and / or healthy mucous membranes, particularly healthy dermis . The subject of the present invention is also a cosmetic care method comprising the application, preferably topically, of an aqueous extract of Hippophae rhamnoid seed and / or a cosmetic composition comprising it, at the level of healthy skin. , including healthy scalp, and / or healthy mucous membranes, to inhibit the expression of Let-7b in healthy skin and / or healthy mucous membranes or to maintain or enhance properties biomechanics of healthy skin and / or healthy mucous membranes, in particular to maintain or improve the firmness, elasticity and / or density of healthy skin and / or healthy mucous membranes, in particular healthy dermis. The application can be performed on all or part of the healthy body and / or face and / or scalp, preferably the legs, thighs, arms, belly, décolleté, neck, armpits, all or part of the face, preferably at the level of the cheeks and / or the angular area of the face.

In particular, the cosmetic and / or nutraceutical use or the method are implemented to maintain or improve the quality of the organization of the extracellular matrix, to maintain or improve the quantity of organized extracellular matrix molecules, in particular fibers collagen and / or elastic fibers, and / or to maintain or increase the synthesis of glycosaminoglycans, especially chondroitin sulfates.

The extract according to the invention is a seed extract. For the purposes of the present invention, the seed corresponds to the berry (or fruit) of H / ppophae rhamnoid freed from the fleshy part, otherwise called pericarp.

The extract can be obtained by methods of aqueous extraction of plants known in the field, for example by maceration of at least a portion of the seed, preferably ranging from 1% to 90% (w / w) by weight. , preferably ranging from 1% to 50% (w / w) by weight, more preferably ranging from 5% to 20% (w / w) by weight, relative to the total weight of the seed part and the solvent, in water or a mixture of solvent such as water / alcohol, water / glycol or water / polyol. For example, the extract may be obtained by extraction in a water / ethanol mixture, particularly in proportion of 70/30 by volume, respectively. Preferably, the extract is obtained by aqueous extraction with water alone.

For the purposes of the present invention, the term "aqueous extraction" is understood to mean any extraction carried out with an aqueous solution comprising at least 60% (w / w) by weight, advantageously at least 70% (w / w) by weight, in particular less than 80% (w / w) by weight, more particularly at least 90% (w / w) by weight, particularly at least 95% (w / w) by weight, of water relative to the total weight of the aqueous solution. According to a preferred embodiment, the aqueous extraction of the Hippophae rhamnoid seed is carried out with water as sole solvent. According to an advantageous embodiment, the extract can thus be obtained by aqueous extraction carried out with an amount ranging from 1% to 50% (w / w) by weight of Hippophae rhamnoid seed relative to the total weight of Hippophae seed. rhamnoid and solvent, preferentially with water as the sole solvent.

The extract may be obtained by aqueous extraction carried out at a temperature ranging from 4 ° C. to 95 ° C., preferably from 20 ° C. to 95 ° C., more preferably from 50 ° to 95 ° C., preferably from 70 ° C. to 90 ° C. ° C. In a particular embodiment, the extraction is carried out at about 80 ° C. The extraction can be carried out for a period of 1 hour to 24 hours, preferably from 1 hour to 12 hours, more preferably from 1 hour to 6 hours. Advantageously, the extraction is carried out for a period of 2 to 3 hours.

Preferably, the extract is prepared according to the protocol described in Example 1a).

An additional step of adding maltodextrin can be performed. Advantageously, an amount of at least 20% (w / w) by weight relative to the total weight of the extract and maltodextrin, preferably at least 50% (w / w), more preferably at least 70% by weight. % (w / w) by weight of maltodextrin, is then added to the extract. The extract can then be concentrated by evaporation of the solvent and / or dried by freeze-drying and / or by spraying.

In a preferred embodiment of the invention, the extract is spray-dried after addition of maltodextrin in the solution.

In a preferred embodiment of the invention, the rhamnoid Hippophae seed is first extracted by supercritical extraction with carbon dioxide.

According to this embodiment, the aqueous extract of Hippophae rhamnoid seed is obtained by aqueous extraction of the co-product of the supercritical extraction with carbon dioxide of the Hippophae rhamnoid seed.

Supercritical extraction with carbon dioxide is a technique known to those skilled in the art to isolate the oily fraction of the compound to be extracted for use for various applications. The residue of this extraction is called "co-product" within the meaning of the present invention and contains all the compounds not extracted by said technique. It is therefore the delipidated fraction of the Hippophae rhamnoid seed. In the sense of the presentation, the aqueous extract of H / pophae rhamnoid seed contains trace lipid compounds only. Preferably, the extract comprises a concentration ranging from 1 × 10 ^-6 % to 1% (w / w) of lipid compounds relative to the total weight of the extract, more preferably between 0.01% and 1% (w / w). ), advantageously the extract contains between 0.1 and 1% (w / w) of lipid compounds relative to the total weight of the extract.

This extraction technique makes it possible to obtain a coproduct devoid of residual solvent that can be more easily isolated and integrated into a cosmetic and / or nutraceutical composition.

It can be carried out in the presence or absence of a co-solvent, advantageously it is carried out without co-solvent. It can be carried out at a pressure ranging from 50 to 80 bar and at a temperature ranging from 25 to 70 ° C, preferably it is carried out at about 60 bar and about 30 ° C. The duration of the supercritical extraction can range from 30 to 120 minutes, preferably from 60 to 100 minutes.

The coproduct is then extracted by an aqueous extraction as described above. Preferably, the extract is prepared according to the protocol described in Example 1b).

Another aspect of the invention relates to the use of a Let-7b inhibitor to maintain or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, including firmness, elasticity and / or healthy skin density and / or healthy mucous membranes, especially healthy dermis.

Furthermore, the invention also relates to a cosmetic care method comprising the application, preferentially topically, of a Let-7b inhibitor and / or a cosmetic composition comprising it, at the level of healthy skin. , including healthy scalp, and / or healthy mucous membranes, for maintaining or improving the biomechanical properties of healthy skin and / or healthy mucous membranes, including firmness, elasticity and / or density of healthy skin and / or or healthy mucous membranes, especially healthy dermis. The application can be performed on all or part of the healthy body and / or face and / or scalp, preferably the legs, thighs, arms, belly, décolleté, neck, armpits, all or part of the face, preferably at the level of the cheeks and / or the angular zone of the face.

Preferably, the method and the use are implemented to maintain or improve the quality of the organization of the extracellular matrix, to maintain or increase the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or of the elastic fibers, and / or to maintain or increase the synthesis of glycosaminoglycans, especially chondroitin sulphates.

In a particular embodiment, the Let-7b inhibitor is selected by the method according to the present invention as described above. A number of Let-7b inhibitors are available to those skilled in the art. For example, an oligonucleotide complementary to the Let-7b sequence may be mentioned, such as that of sequence SEQ ID NO: 2.

The present invention relates to a cosmetic composition comprising a Let-7b inhibitor and at least one cosmetically acceptable excipient. In one embodiment of the invention, the cosmetic care method comprises;

a) The identification of an area of healthy skin that is desired to inhibit the expression of Let-7b in healthy skin and / or mucous membranes or to maintain or improve the biomechanical properties of healthy skin and / or mucous membranes healthy, especially the firmness, elasticity and / or density of healthy skin and / or healthy mucous membranes, particularly of healthy dermis; and, b) The topical application of the extract of the Hippophae rhamnoid extract according to the invention, preferably a cosmetic composition containing the Hippophae rhamnoid extract according to the invention, on this skin zone.

In an alternative embodiment of the invention, the cosmetic care method comprises; a) The identification of a zone of healthy skin presenting a non-pathological loss of firmness, elasticity and / or density of healthy skin and / or healthy mucous membranes, in particular healthy dermis; and,

b) The topical application of the extract of the Hippophae rhamnoid extract according to the invention, preferably a cosmetic composition containing the Hippophae rhamnoid extract according to the invention, on this skin zone.

For the purposes of the present invention, the term "cosmetic use and / or cosmetic composition" means a use and / or a non-pharmaceutical composition, that is to say which does not require a therapeutic treatment, that is to say say intended for any area of healthy skin including healthy scalp, and / or healthy mucosa.

For the purposes of the present invention, the term "nutraceutical use and / or nutraceutical composition" means a use and / or a non-pharmaceutical oral administration composition, that is to say that does not require therapeutic treatment.

The term "healthy skin" and / or "healthy mucosa" and / or "healthy scalp" means an area of skin and / or mucosa and / or scalp on which the extract is applied according to the so-called "non-pathological" invention by a dermatologist, that is to say not having any infection, scar, disease, or wounds or wounds and / or other dermatoses.

The term "mucous membrane" is intended to mean the ocular mucosa, the vaginal mucosa, the urogenital mucosa, the anal mucosa, the nasal mucosa and / or the oral, labial and / or gingival mucosa, preferentially the ocular and / or oral mucous membranes. .

For the purposes of the present invention, the term "inhibit the expression of Let-7b" decreases the amount of Let-7b, especially in healthy skin and / or healthy mucous membranes, preferentially in the healthy dermis. Preferably, it is an inhibition of at least 10% in the presence of the aqueous extract of Hippophae rhamnoid seed, more preferably at least 30% relative to the amount of Let-7b measured in l absence of the extract according to the invention.

According to one particular embodiment of the invention, it is the use of the aqueous extract of Hippophae rhamnoid seed according to the invention for inhibiting the expression of Let-7b in the healthy dermis and / or the blades. basal healthy, especially healthy dermoepidermal junction, preferentially in the healthy dermis.

According to a preferred embodiment of the invention, it is the use of the aqueous extract of Hippophae rhamnoid seed according to the invention to inhibit the expression of Let-7b level in healthy fibroblasts.

The amount of Let-7b can be measured by any known method of molecular biology quantification. It can be the direct quantification of the amount of Let-7b miRNA, in particular by measurement on RNA chips and / or by real-time reverse transcription polymerase chain reaction measurement (RT-qPCR or RT real time). -PCR). Preferably, the amount of Let-7b is measured by RT-qPCR according to standard methods known to those skilled in the art. Even more preferentially, it is measured according to Example 3.2.

For the purposes of the present invention, the term "biomechanical property of healthy skin and / or healthy mucous membranes" means firmness and / or elasticity and / or density and / or compressive strength and / or resistance to stretching and / or flexibility and / or extensibility and / or the ability to resist the deformation of healthy skin and / or healthy mucous membranes, particularly of healthy dermis. Preferentially it is the firmness and / or the elasticity and / or the density of healthy skin and / or healthy mucous membranes, in particular of the healthy dermis. The biomechanical properties of healthy skin and / or healthy mucous membranes can be studied by measurement techniques known to those skilled in the art in particular by traction, torsion, suction, indentation, levatometry, ballistometry, ultrasound scanner with high resolution or elastography, preferentially by indentation, by ultrasound scanner at high resolution. Advantageously, the biomechanical properties of healthy skin and / or healthy mucosa are studied according to the protocol described in Example 5.

For the purposes of the present invention, the term "maintain the biomechanical properties of healthy skin and / or healthy mucous membranes" prevents a decrease in the biomechanical properties of healthy skin and / or healthy mucous membranes, in particular firmness and / or elasticity and / or density of healthy skin and / or healthy mucous membranes, in particular of the healthy dermis, with respect to the biomechanical properties of healthy skin and / or healthy mucous membranes in the absence of the extract according to the invention. For the purposes of the present invention, the term "improve the biomechanical properties of healthy skin and / or healthy mucous membranes" means an increase in the biomechanical properties of healthy skin and / or healthy mucous membranes, in particular the firmness and / or the elasticity and / or the density of healthy skin and / or healthy mucous membranes, in particular of the healthy dermis, preferably at least 10% in the presence of the inhibitor of Let-7b or the aqueous extract of seed to ' Hippophae rhamnoid compared to the biomechanical properties of healthy skin and / or healthy mucosa measured in the absence of the inhibitor Let-7b or the extract according to the invention.

According to a particular embodiment, the subject of the invention is the cosmetic and / or nutraceutical use of an inhibitor of Let-7b or of an aqueous extract of Hippophae rhamnoid seed according to the invention for maintaining and / or to increase the firmness and / or density of healthy skin and / or healthy mucous membranes, especially of the healthy dermis.

In particular, the maintenance and / or improvement of the biomechanical properties of healthy skin makes it possible to limit and / or reduce the slackening of the healthy skin of the face, in particular at the level of the cheeks and / or the angular zone of the face ( commonly called rounded face or V of the face).

Another subject of the present invention relates to the cosmetic and / or nutraceutical use of a Let-7b inhibitor or an aqueous extract of Hippophae rhamnoid seed according to the invention for maintaining and / or improving the quality of the organization of the extracellular matrix, in particular collagen fibers and / or elastic fibers. For the purposes of the present invention, the term "quality of the organization of the extracellular matrix" means the level of functional organization of the molecules that constitute the extracellular matrix. As explained in the introduction of the application, the proteins FBN1 and / or XYLT1 and / or TGFBR2 and / or ITGB3 and / or CHSY3 are involved in the deposition and / or organization of the extracellular matrix and are negatively regulated by the Let-7b. The inhibition of Let-7b leads to a decrease in the inhibition of these proteins and makes it possible to maintain and / or improve the quality of the organization of the extracellular matrix.

For the purposes of the present invention, the term "maintain the quality of the organization of the extracellular matrix" prevents a reduction in the organization of the cell matrix, in particular by limiting the downregulation of the proteins FBN1 and / or XYLT1 and / or TGFBR2 and / or ITGB3 and / or CHSY3 with respect to the organization of the extracellular matrix visualized in the absence of a Let-7b inhibitor or the extract according to the invention. For the purposes of the present invention, the term "improve the quality of the organization of the extracellular matrix" means an improvement in the organization of the extracellular matrix, in particular by limiting the downregulation of the proteins FBN1 and / or XYLT1 and / or TGFBR2 and / or ITGB3 and / or CHSY3 with respect to the organization of the extracellular matrix visualized in the absence of a Let-7b inhibitor or of the extract according to the invention.

The visualization of the functional organization of the extracellular matrix may be performed by immunohistochemical techniques or according to the method as described in patent EP2721408 of the applicant. Another subject of the present invention relates to the cosmetic and / or nutraceutical use of a Let-7b inhibitor or an aqueous extract of Hippophae rhamnoid seed according to the invention for maintaining and / or increasing the quantity of molecules. organized extracellular matrix, especially collagen fibers and / or elastic fibers. For the purposes of the present invention, the term "quantity of organized extracellular matrix molecules" means the number of molecules of the extracellular matrix arranged and functional within the extracellular matrix. Within the meaning of the present invention, the term "maintain the quantity of organized extracellular matrix molecules" prevents a reduction of organized extracellular matrix molecules relative to the quantity of organized extracellular matrix molecules measured in the absence of an inhibitor of Let-7b or the extract according to the invention.

Within the meaning of the present invention, the term "increase the quantity of organized extracellular matrix molecules" means an increase in the amount of organized extracellular matrix molecules relative to the quantity of organized extracellular matrix molecules measured in the absence of an inhibitor of Let-7b or of the extract according to the invention.

The amount of organized extracellular matrix molecule, in particular collagen fibers and / or elastic fibers, and the quality of their organization can be measured according to the method as described in patent EP2721408 of the applicant.

Another subject of the present invention relates to the cosmetic and / or nutraceutical use of a Let-7b inhibitor or an aqueous extract of H / ppophae rhamnoides according to the invention for maintaining and / or increasing the synthesis. glycosaminoglycans including chondroitin sulphates.

For the purposes of the present invention, the term "maintain the synthesis of glycosaminoglycans including chondroitin sulphates" prevent a decrease in the level of synthesis of glycosaminoglycans, including chondroitin sulfate, compared to the level of synthesis of glycosaminoglycans, including chondroitin sulfate, detected in the absence of a Let-7b inhibitor or the extract according to the invention.

For the purposes of the present invention, the term "increase the synthesis of glycosaminoglycans including chondroitin sulphates" means an increase in the level of synthesis of glycosaminoglycans, especially chondroitin sulphates, preferably at least 10% in the presence of an inhibitor of Let-7b or H / ppophae rhamnoid seed extract, preferably at least 50%, more preferably at least 70% relative to the level of synthesis of glycosaminoglycans, including chondroitin sulphate detected in the absence of an inhibitor of Let-7b or of the extract according to the invention.

According to a preferred embodiment of the invention, the aqueous extract of H / ppophae rhamnoid is a cosmetic extract, topically acceptable. According to another preferred embodiment of the invention, the Let-7b inhibitor is topically acceptable.

For the purpose of the present invention, the term "topically acceptable" means an ingredient suitable for a topical application, non-toxic, non-irritating for healthy skin, especially the healthy scalp, and / or healthy mucous membranes, n ' inducing no allergic response, which is not chemically unstable.

The inhibitor of Let-7b or the extract according to the invention is applied to a healthy skin that may be all or part of the healthy skin, and / or healthy mucous membranes of the body and / or face and / or scalp, preferentially the legs, thighs, arms, abdomen, décolleté, neck, armpits, still preferably all or part of the face, preferably in the cheeks and / or the angular area of the face (commonly called rounded face or V of the face). The inhibitor of Let-7b or the aqueous extract of Hippophae rhamnoid seed can be used alone as a cosmetic active ingredient and / or nutraceutical or included in a cosmetic and / or nutraceutical composition.

When used alone in the form of an active ingredient, the extract according to the invention is preferably in the form of a powder and dissolved in a particularly polar solvent, such as water, an alcohol, a polyol, a glycol, or one of their mixtures, in the presence or absence of glycerine. In a particular embodiment of the invention, the extract according to the invention is mixed with maltodextrin. In this case, maltodextrin makes it possible to obtain a non-hygroscopic cosmetic and / or nutraceutical ingredient.

Advantageously, an amount of at least 20% (w / w) by weight relative to the total weight of the extract and maltodextrin, preferably at least 50% (w / w), more preferably at least 70% by weight. % (w / w) by weight of maltodextrin, is then added to the extract. The extract can then be concentrated by evaporation of the solvent or dried for example by lyophilization or by spraying. Preferably, the extract is spray-dried. Advantageously in this case, the cosmetic ingredient is as described in Example 6.

The present invention also relates to the cosmetic use of the extract according to the invention topically on healthy skin, especially the scalp, and / or mucous membranes in a cosmetic composition comprising at least one cosmetically acceptable excipient. The subject of the present invention is also the use of the aqueous extract of Hippophae rhamnoid seed in a cosmetic and / or nutraceutical composition comprising at least one cosmetically acceptable excipient, and in which the extract is present at a concentration of 1x10. ^"4 % to 10% (w / v) by weight of extract according to the invention relative to the total volume of the composition, preferably from 1 × 10 ^-4 % to 5% (w / v), more advantageously from 1 × 10 ^-3 % to 0.5% (w / v) by weight of extract according to the invention relative to the total volume of the composition.

In a particular embodiment of the invention, the cosmetic composition contains 0.2% (w / v) by weight of aqueous extract of Hippophae rhamnoid seed with respect to the total volume of the composition.

Preferably, the extract is used in a composition as described in Example 7.

In one embodiment of the invention, the extract is used in a cosmetic and / or nutraceutical composition for inhibiting the expression of Let-7b and / or for maintaining and / or improving the biomechanical properties of healthy skin and / or or healthy mucous membranes in particular for maintaining and / or improving the firmness and / or elasticity and / or density of healthy skin and / or mucous membranes, including healthy dermis, and / or for maintaining or improving the quality of the organization of the extracellular matrix, to maintain or increase the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or elastic fibers, and / or to maintain or increase the synthesis of glycosaminoglycans, in particular chondroitin sulphates.

According to the invention, the cosmetic composition may further comprise a cosmetically acceptable vehicle. By "cosmetically acceptable vehicle" is meant a vehicle adapted for use in contact with cutaneous human cells, in particular the cells of the epidermis, without toxicity, irritation, undue allergic response and the like, and proportionate to an advantage ratio. reasonable risk. It may be for example maltodextrin.

The composition according to the invention can be administered topically and / or orally. Advantageously, it is administered topically.

The cosmetic composition may furthermore contain one or more cosmetically acceptable excipients chosen from surfactants and / or emulsifiers, preservatives, buffering agents, chelating agents, denaturants, opacifying agents, pH adjusters, reducing agents, stabilizing agents, thickeners, gelling agents, film-forming polymers, fillers, matting agents, gloss agents, pigments, dyes, perfumes, and mixtures thereof. The Personal Care Products Council (PCPC) describes various cosmetic excipients suitable for use in the present invention.

Advantageously, the excipient or excipients are chosen from the group comprising polyglycerols, esters, polymers and cellulose derivatives, lanolin derivatives, phospholipids, lactoferrins, lactoperoxidases, sucrose stabilizers, vitamin E and its derivatives, xanthan gums, natural and synthetic waxes, vegetable oils, triglycerides, unsaponifiables, phytosterols, silicones, protein hydrolysates, betaines, aminoxides, plant extracts, sucrose esters , titanium dioxides, glycines, and parabens, and more preferably from the group comprising steareth-2, steareth-21, glycol-15 stearyl ether, cetearyl alcohol, phenoxyethanol, methylparaben, ethylparaben, propylparaben, butylparaben, butylene glycol, caprylyl glycol, natural tocopherols, glycerine, dihydroxycetyl sodium phosphate, isopropyl hydroxyketyl ether, glycol stearate, triisononanoine, octyl cocoate, polyacrylamide, isoparaffin, laureth-7, a carbomer, propylene glycol, hexylene glycol, glycerol, bisabolol, dimethicone, sodium hydroxide, PEG-30-dipolyhydroxystate, capric / caprylic triglycerides, cetearyl octanoate, dibutyl adipate, grape seed oil, jojoba oil, magnesium sulfate, EDTA, cyclomethicone, xanthan gum, citric acid, sodium lauryl sulfate, waxes and mineral oils, isostearyl isostearate, propylene glycol dipelargonate, propylene glycol isostearate, PEG 8, bee, glycerides of hydrogenated palm heart oil, lanolin oil, sesame oil, cetyl lactate, lanolin alcohol, castor oil, titanium dioxide, lactose, sucrose , low density polyethylene, a salted isotonic solution, and their mixtures.

The cosmetic composition according to the invention may be chosen from an aqueous solution, an aqueous cream or gel, in particular a shower gel, a milk, an emulsion, a microemulsion or a nanoemulsion, especially oil-in-water or water-in-oil or multiple or silicone, a mask, a serum, a lotion, a liquid soap, an ointment, a mousse, a patch, preferably a cream, a milk, an emulsion, a mask, a serum.

The composition used according to the invention may further contain cosmetic active ingredients leading to a complementary or synergistic effect such as anti-aging active agents. We will mention these active ingredients stimulating the synthesis of macromolecules of the dermis or preventing their degradation, agents stimulating the proliferation of keratinocytes, soothing agents, moisturizers, or active agents on the regulation of the pore size and / or their opening.

Anti-aging active ingredients include:

an agent stimulating the synthesis of fibronectin, in particular a corn extract, such an extract being in particular marketed by BASF Beauty Care Solutions France under the name Deliner ™ and the palmitoyl pentapeptide marketed by SEDERMA under the trade name Matrixyl®;

an agent stimulating the formation of collagen fibers such as an extract of Origanum majorana marketed under the name Dermagenist ™ by the Applicant.

an agent stimulating the expression of perlecane and dystoglycan in the extracellular matrix and / or in the basal epithelial membrane, for example an extract of Polygonum bistorta sold under the name Perlaura ™ by BASF Beauty Care Solutions France.

an agent for protecting the fibroblast growth factor (FGF2) of the extracellular matrix against its degradation and / or denaturation, in particular an Hibiscus Abelmoscus extract as described in the patent application on behalf of BASF Beauty Care Solutions France filed under the number FR0654316 and marketed by BASF Beauty Care Solutions France under the name Linefactor ™ and / or a fibroblast growth stimulating agent, for example a fermented soy extract containing peptides, known under the name Phytokine ™ marketed by BASF Beauty Care Solutions France and also described in the patent application EP1119344B1 (Laboratoires Expanscience), and preferably a combination of these two extracts;

an agent stimulating the synthesis of laminin, in particular a biotechnologically modified malt extract, such an extract being in particular marketed by BASF Beauty Care Solutions

France under the name Basaline ™;

an agent stimulating the expression and / or the activity of Hyaluronan synthase 2 (HAS2), such as the plant extracts described in patent application FR 2 893 252 A1 and in particular an aqueous extract of Galanga (Alpinia galanga) and marketed by BASF Beauty Care Solutions France under the name Hyalufix ™;

an agent stimulating the synthesis of lysyl oxidase like (LOXL) such as an extract of Geophila cordifolia and those described in the patent application FR2855968, and in particular a dill extract marketed by BASF Beauty Care Solutions France under the name Lys'lastine ™;

an agent stimulating the synthesis of intracellular ATP, in particular an extract of the seaweed Laminaria digitata marketed by BASF Beauty Care Solutions France under the name of Seanergilium ™; an active stimulating the synthesis of glycosaminoglycans, such as the product of fermentation of milk;

a collagen stimulating active agent such as retinol and / or vitamin C;

an active inhibitor of metalloproteinases (MMP) such as more particularly MMPs 1, 2, 3, 9 such as retinoids and derivatives, oligopeptides and lipopeptides, lipoamino acids, extract of Argania spinosa leaves marketed by BASF Beauty Care Solutions France SAS under the name Arganyl ™; lycopene; isoflavones, quercetin, kaempferol, apigenin.

an agent for increasing the expression of LOX to increase the architecture of the epidermis, for example an extract of Cichorium intybus marketed under the name LOX-AGE ™ by BASF Beauty Care Solutions France.

an agent for increasing the deglycation of collagen and / or increasing the expression of type I collagen such as a combination of an extract of Salvia miltiorrhiza and niacin leaves marketed by BASF Beauty Care Solutions France under the name ColIRepair ™ .

an agent stimulating the synthesis of lumican and collagen such as a synthetic acetyl Gin Asp Val His tetrapeptide marketed by BASF Beauty Care Solutions France under the name

Dermican ™ and described in patent application WO2005120554A1.

an agent for protecting and stimulating elastin, collagen such as the extract of Manilkara multinervis leaves marketed by BASF Beauty Care Solutions France under the name Elestan ™ and the Eperua falcata root extract marketed by BASF Beauty Care Solutions France under the name Eperuline ™

As stabilizing agents which are preferably used in the composition according to the invention, mention may be made of: pentacyclic triterpenes, ursolic acid and its salts, oleanolic acid and its salts, betulinic acid and its salts, and the salts thereof. salicylic acid and in particular zinc salicylate, bisabolol, allantoin, omega 3 unsaturated oils, cortisone, hydrocortisone, indomethacin and beta-methasone, anti-inflammatory active agents, and especially those described in US Pat. the application FR2847267, in particular the extract of Pueraria lobata root marketed under the name Inhipase® by BASF Beauty Care Solutions France SAS, extracts of Theobroma cacao.

Among the active agents on the regulation of the pore size and / or their opening, mention may be made by way of example of a Cichorium intybus extract marketed under the name of LOX-AGE ™ by BASF Beauty Care Solutions France and / or on the production of sebum, mention may be made, for example, of synthetic sarcosine marketed under the name of Mat-XS ™ Clinical and / or an extract of Orthosiphon stamineus as described in patent application WO2010063674 in the name of BASF Beauty Care Solutions France and marketed as MAT XS ™ Bright. As moisturizing agents that are preferably used in the composition according to the invention, mention may be made of: a combination of pullulan, sodium hyaluronate and sodium alginate such as that marketed by BASF Beauty Care Solutions France under the name Patch20 ™. Other objects, features and advantages of the invention will become apparent to those skilled in the art following the reading of the explanatory description which refers to examples which are given by way of illustration only and which can not in in no way limit the scope of the invention.

The examples are an integral part of the present invention and any features appearing novel from any prior art from the description taken as a whole, including the examples, form an integral part of the invention in its function and its generality. Thus, each example has a general scope.

On the other hand, in the examples, all percentages are by weight, unless otherwise indicated, the temperature is in degrees Celsius unless otherwise indicated, and the pressure is atmospheric pressure, unless otherwise indicated.

Example 1 Preparation of the aqueous extract of Hippoohae rhamnoid seed according to the invention.

Example la) An aqueous extraction of Hippophae rhamnoid seed according to the invention

A quantity of 20% by weight of Hippophae rhamnoid seeds (origin Germany) with respect to the total weight of seeds and water was crushed by the grinding robot and then homogenized for a few seconds using a homogenizer before being extracted. in water as the sole solvent at room temperature for a period of 2 hours. The extract was then centrifuged and the pellet removed. The resulting extract is then filtered through 0.1-0.3 micron filters and then lyophilized.

EXAMPLE 1b) Supercritical Extraction of Hippophae Rhamnoid Seed According to the Invention

An amount of 10% by weight of Hippophae rhamnoid seed (origin Germany) was milled to the milling robot before being extracted by supercritical extraction with carbon dioxide at 60 bar, 30 ° C for 80 minutes. The co-product of the supercritical carbon dioxide extraction of Hippophae rhamnoid was introduced into osmosis water at 80 ° C +/- 2 ° C with stirring and the pH was adjusted to 5.4 +/- 0.2. The mixture was then allowed to cool to 23 ° C +/- 3 ° C. The extract was then roughly screened and centrifuged and the supernatant removed. Finally, the extract was filtered to 0.1-0.3 micrometers. 60% to 80% (w / w) of maltodextrin relative to the total weight of the mixture was added. The extract obtained was then filtered again and then atomized at a temperature of 180 ° C.

Example 2: Determination of the Let-7b target proteins. The concentration variation of the five proteins identified as potentially regulated by Let-7b was measured by Western Blot through a gain-loss function experiment.

Total proteins were extracted 72 hours and 96 hours after transfection of synthetic RNA complementary to Let-7b (ref 4100945-101, EXIQON, ACCACACAACCTACTACCTC (SEQ ID No: 2)) inhibiting its activity and synthesis RNA having the same sequence as Let-7b (ref. 470775-001, EXIQON, TGAGGTAGTAGGTTGTGTGGTT (SEQ ID NO: 1)) mimicking its activity in the primary fibroblast (obtained by biopsy on female subject, 47 years old).

10 μg of protein were separated on acrylamide gel (NuPAGE Novex 4-12% BBos-Tris gel®-Invitrogen®) and transferred to nicocellulose membrane (GE Amersham®). The proteins were specifically detected using primary antibodies (anti-XYLTl, anti-CHSY3 and anti-TGFBR2 from Santa Cruz Biotechnology®, anti-FBN1 from Thermofisher technologies® and anti-ITGB3 from Ceii signaling technology®). The control was carried out using an anti-HRP-b-actin antibody (Sigma®). The intensity of the signal obtained for each band was measured using a data processing software (ImageJ® - Gel analyzer aigorithm).

Table 1: Analysis of Western blot results performed with or without transfection of a Let-7b inhibitor. Relative level of expression of the protein in the fibroblast

Expression of the protein

transfected with an RNA

Normalized protein in the fibroblast

mimicking the activity of Let-7b control

compared to the control fibroblast.

ITGB3 1 - 80%

CHSY3 1 - 58%

Actin 1 1

Table 2: Analysis of results of Western blots performed with or without transfection of an RNA mimicking the activity of Let-7b.

Conclusion

The Let-7b miRNA has a negative influence on the synthesis of FBN1, XYLTi, TGFBR2, ITGB3 and CH5Y3, in particular on XYLTI and CHSY3.

Example 3 Quantification of Let-7b in the Presence or Not of Potentially Active Substance

3.1 Culture Fibroblasts derived from healthy dermas were isolated by trypsination (abdomen, female between 53 and 68 years old) and grown in DMEM® medium (Dubecco's Modified Eagle Medium® - Life Technologie®) containing 10% (v / v) serum fetal calf and antibiotics, then incubated at 37 ° C in the presence of 5% (v / v) C0 ₂ for 24 hours. The cells were then placed in the presence or absence of the potentially active substance at two different concentrations, 0.003% (w / v) and 0.02% (w / v) by weight of extract according to the invention relative to the total volume. of the culture medium, for 48 hours without fetal calf serum and in the presence of 5% of C0 ₂ .

3.2 Quantification

The total RNAs were extracted from the different cultures (cultures produced as presented in Example 3.1, in the presence or absence of the active substance as presented in Example 1b) using a nucleic acid isolation kit ( NucleoSpin miRNA® - Marcherey-Nagel®) with physical separation between long and short RNAs. The optical density measurement at 260 nm and 280 nm then allows the validation of the quality and quantity of RNA.

Following this, the reverse transcription step was performed on lpg of short RNAs from different conditions tested in a final volume of 20 μL using a transcription kit. inverse (miScript II RT kit®, Qiagen®). The reaction mixture was incubated for one hour at 37 °, then the reverse transcription enzymes were inactivated by increasing the temperature to 95 ° C for 5 minutes and the reaction mixture was stored at -20 ° C until the reaction was complete. quantitative PCR analysis. The quantitative PCR step was performed using three types of primers (shown in the table below). The first allows the amplification of Let-7b miRNAs, and the next two are used to amplify small nuclear RNAs in order to develop delta-delta-Ct calibration curves. This step is carried out in 1 μl of reverse transcription reaction diluted to 1/250 using specific oligonucleotides and a PCR quantization kit in a thermal cycler (LightCycler® 480 Roche®). Each test is performed in duplicate. The SYBR Green fluorescence contained in the kit is measured after each amplification cycle. The merge curves are performed following each qPCR.

Primer meaning hsa-let-7b-5p TGAGGTAGTAGGTTGTGTGGTT SEQ ID NO: 3

Primer sense snoRNA U6 ATGTTATGATGATGGGCGAAATGT SEQ ID NO: 4 Primer sense snRNA U1 TO TTACCTGGCAGGGGAGATAC SEQ ID NO: 5

Polyester antisense primer I SEQ ID NO: 6

Table 3: Decrease in the concentration of Let-7b in the human fibroblast in the presence of the extract according to the invention. Conclusion

The extracts according to the invention induce a decrease in the expression of Let-7b of 18% and 39% for respective concentrations at 0.003% (w / v) and 0.02% (w / v) by weight of extract according to the invention relative to the total volume of the composition in the medium, compared to the untreated control. Example 4: In vitro evaluation of the improvement of the biomechanical properties of the dermis.

Density and firmness of the dermis are measured using the low pressure indentation and dermal equivalent relaxation test. The dermal equivalent used corresponds to the Mimederm® technology of the Applicant. For its manufacture, 500,000 cells / cm 2 of human primary fibroblasts (breast derm, 18-year-old female donor) were seeded on a collagen sponge (Mimedisk® of the Applicant) in DMEM / HAM F12 medium (Life Technologies®) supplemented with 20% fetal calf serum. The culture medium was changed daily with 50pg / mL of ascorbic acid. From the ^3rd day of culture, the dermis were treated or not with 0.02% (w / v) of the aqueous extract of seed H / ppophae Rhamnoides according to Example lb), by weight of extract according to the invention with respect to the total volume of the composition. Culture of treated and untreated dermal equivalents was stopped after 28 days.

The indentation test at low pressure and relaxation was then performed on the dermal equivalents thus obtained. The test was repeated three times for each sample with constant penetration depth (ΙΟΟμιτι), the displacement is applied at constant indentation speed (δ¼ 50 μιτι / s for 120 seconds). The data is collected at a sampling rate of 1kHz.

The indenter used is a PTFE spherical indenter, with a radius of curvature R 1/4, 6 mm. The tests were carried out in an air-conditioned room at a controlled temperature of 22 to 24 ° C and a relative humidity of about 30% to 40%.

Conclusion

Following the treatment, the Applicant has found that the extract according to the invention induces a 14% increase in the dYoung modulus compared to the untreated control (p = 0.06), which shows that the extract leads to an increase in biomechanical properties of the dermis.

Example 5 In Vivo Study on Human Volunteer

A human volunteer study was performed to test the efficacy of a formulation, containing 0.2% (w / v) of the extract described in Example 1b, vis-à-vis the major signs of the loss of biomechanical properties of the dermis, including sagging skin. 1. Protocol of the study.

27 Caucasian women, aged 55 to 70 years, with loss of skin firmness and elasticity were randomized to a double-blind test including twice-daily application for 56 days of the formulation described in example on half of the face and a placebo on the other half. The results were measured at the beginning of treatment (D0), after

28 days (D28) and after 56 days (D56) under dermatological control.

2. Study of the variations of the density and elasticity of the dermis

Variations in dermal density and elasticity were measured using a high resolution ultrasonic scanner (Dub SkinScanner - TPM, 22Mhz) measuring the hyperechoic density factor, corresponding to the measured pixel percentage having an intensity strong (between 200 and 255).

Conclusion

The Applicant has observed that the extract according to the invention causes an increase in the significant hyperechoic density factor of about 26% compared to placebo after 56 days of application.

3. Study of the variations of the firmness of the skin

Variations in skin firmness were measured at the lower angle of the face using a SkinFibroMeter® Skin Firming Device (DelfinTechnologies®). An increase in this factor corresponds to an increase in the firmness of the dermis.

Conclusion

The Applicant has observed that the extract according to the invention causes a significant increase in the firmness of the skin of the cheeks of about 18.5% compared to the placebo after 56 days of application, which means that the composition comprising the Extract according to the invention has increased the density and elasticity of the dermis. Example 6 Cosmetic Ingredient comprising an aqueous extract of Hippophae rhamnoid seed.

EXAMPLE 7 Cosmetic Composition Comprising a Bleeding Seed Extract of / ppophae rhamnoïdes

The procedure is carried out according to the methods known to those skilled in the art for mixing together the various phases A, B, C, D below to prepare a composition according to the present invention. The proportions are expressed in%.

Phase A

Propylheptyl caprylate 4.00

Dicaprylyl carbonate 4.00

Sodium polyacrylate 0.70

Phase B

Water 69.55

Propylene glycol, phenoxyethanol, chlorphenesin, methylparaben 2.50

Glycerin, glyceryl polyacrylate 10.00

Butylene glycol 5.00

Disodium EDTA 0.05

Phase C

Sclerotium gum 2.00

Phase D

Cosmetic ingredient according to Example 6 0.20

Water 2.00

Claims

claims

1. Cosmetic and / or nutraceutical use of an aqueous extract of Hippophae rhamnoid seed to inhibit the expression of Let-7b in healthy skin and / or healthy mucous membranes or to maintain or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, in particular the firmness, elasticity and / or density of healthy skin and / or healthy mucous membranes, in particular of the healthy dermis.

2. Use according to claim 1 for inhibiting the expression of Let-7b in the healthy dermis and / or the healthy basal laminae, in particular of the healthy dermoepidermal junction, preferentially in the healthy dermis.

3. Use according to one of claims 1 or 2 for inhibiting the expression of Let-7b in healthy fibroblasts.

4. Use according to any one of claims 1 to 3 for maintaining or improving the quality of the organization of the extracellular matrix, for maintaining or increasing the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or elastic fibers, and / or to maintain or increase the synthesis of glycosaminoglycans, especially chondroitin sulphates.

Use according to any one of claims 1 to 4, wherein the aqueous extract of Hippophae rhamnoid seed is obtained by aqueous extraction of the coproduct from the supercritical carbon dioxide extraction of the Hippophae rhamnoid seed.

6. Use according to any one of claims 1 to 5, wherein the aqueous extraction of the Hippophae rhamnoid seed is carried out with a solvent comprising at least 60% by weight, preferably at least 70% by weight, in particular at least 80% by weight, more particularly at least 90% by weight, particularly at least 95% by weight, of water relative to the total weight of the aqueous solution.

7. Use according to any one of claims 1 to 6, wherein the aqueous extraction of the Hippophae rhamnoid seed is carried out with water as sole solvent.

8. Use of an extract according to any one of claims 1 to 7, wherein the Hippophae rhamnoid extract is present in a cosmetic and / or nutraceutical composition comprising at least one cosmetically acceptable excipient, and wherein the The extract is present at a concentration of 1 × 10 ^-4 % to 10% (w / v) by weight of extract according to the invention relative to the total volume of the composition, preferably from 1 × 10 ^-4 % to 5% (w / v). ), more advantageously from 1 × 10 ^-3 % to 0.5% (w / v) by weight of extract according to the invention relative to the total volume of the composition.

9. Cosmetic treatment process comprising the application, preferably topically, of an aqueous extract of seed Hippophae rhamnoïdes according to any one of claims 1 to 8 and / or a cosmetic composition comprising it, at level of healthy skin, including healthy scalp, and / or healthy mucous membranes, to inhibit the expression of Let-7b in healthy skin and / or healthy mucous membranes or to maintain or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, particularly for maintaining or improving the firmness, elasticity and / or density of healthy skin and / or healthy mucous membranes, particularly of the healthy dermis, preferably to maintain or improve the quality of the skin. the organization of the extracellular matrix, to maintain or improve the organization of collagen fibers and / or elastic fibers, and / or to increase the synthesis of glycosaminoglycans, especially chondroitin sulfates.

10. Cosmetic treatment method according to claim 9, wherein the application is performed on all or part of the healthy body and / or face and / or scalp, preferably the legs, thighs, arms, belly, the décolleté, the neck, the armpits, all or part of the face, preferably at the level of the cheeks and / or the angular area of the face.

11. A method of using a Let-7b inhibitor in cosmetics and / or nutraceuticals, comprising the following steps:

a) bringing the target cells into contact with a potential inhibitor of Let-7b, b) Quantifying the expression of Let-7b,

c) Selection of the potential inhibitor of Let-7b if the expression of Let-7b is decreased, d) Use of the potential inhibitor of Let-7b selected as the active ingredient in cosmetics and / or nutraceuticals.

The method according to claim 11, wherein the Let-7b inhibitor is used to maintain or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, especially to maintain or improve firmness, elasticity. and / or the density of healthy skin and / or healthy mucous membranes, including healthy dermis.

13. The method according to claim 11, in which the Let-7b inhibitor is used to maintain or improve the quality of the organization of the extracellular matrix, to maintain or improve the quantity of molecules in the matrix. organized extracellular agents, in particular collagen fibers and / or elastic fibers, and / or to maintain or increase the synthesis of glycosaminoglycans, especially chondroitin sulphates.

The method of any one of claims 11 to 13, wherein the target cells are healthy human fibroblasts.

The method according to any one of claims 11 to 14, wherein the quantization step is a direct quantification of the amount of Let-7b and / or indirect quantization by measuring the change in the amount of target proteins. and / or their corresponding mRNAs.

The method according to any of claims 11 to 15, wherein the proteins to be regulated and / or their corresponding mRNAs are fibrillin 1 (FBN1) and / or xylosyl transferase 1 (XYTL1) and / or TGF beta receptor. 2 (TGFBR2) and / or integrin beta 3 (ITGB3) and / or chondroitin sulfate synthase 3 (CHSY3), preferentially xylosyl transferase 1 (XYTL1) and / or integrin beta 3 (ITGB3) and / or chondroitin sulfate synthase 3 (CHSY3), more preferably xylosyl transferase 1 (XYTL1) and / or chondroitin sulfate synthase 3 (CHSY3).

The method of any one of claims 11 to 16, wherein the quantification of Let-7b expression is performed by direct quantification by RT-qPCR.

18. Process according to any one of claims 11 to 17, in which the potential inhibitor is present at a concentration ranging from 1 × 10 ^-4 % to 10% (w / v), preferably from 0.001% to 0.1% ( p / v), more preferably from 0.003% to 0.02% (w / v) by weight of Let-7b inhibitor relative to the volume of the culture medium.

19. Cosmetic and / or nutraceutical use of a Let-7b inhibitor to maintain or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, including firmness, elasticity and / or density of the skin healthy and / or healthy mucous membranes, especially healthy dermis.

20. Use according to claim 19, for maintaining or improving the quality of the organization of the extracellular matrix, for maintaining or increasing the quantity of organized extracellular matrix molecules, in particular collagen fibers and / or elastic fibers, and or to maintain or increase the synthesis of glycosaminoglycans, especially chondroitin sulphates.

The use of claim 19 or 20, wherein the Let-7b inhibitor is selected by the method of any one of claims 11 to 18.

22. Cosmetic treatment process comprising the topical application of a Let-7b inhibitor and / or a cosmetic composition comprising it, at the level of the healthy skin, in particular the healthy scalp, and / or the mucous membranes healthy, to maintain or improve the biomechanical properties of healthy skin and / or healthy mucous membranes, including the firmness, elasticity and / or density of healthy skin and / or healthy mucous membranes, especially healthy dermis.

23. Cosmetic treatment method according to claim 22, wherein the application is performed on all or part of the healthy body and / or face and / or scalp, preferably the legs, thighs, arms, belly, the décolleté, the neck, the armpits, all or part of the face, preferably at the level of the cheeks and / or the angular area of the face.