EP4237078A1 - Nkd2 als target zur behandlung von nierenfibrose - Google Patents
Nkd2 als target zur behandlung von nierenfibroseInfo
- Publication number
- EP4237078A1 EP4237078A1 EP21802638.3A EP21802638A EP4237078A1 EP 4237078 A1 EP4237078 A1 EP 4237078A1 EP 21802638 A EP21802638 A EP 21802638A EP 4237078 A1 EP4237078 A1 EP 4237078A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- nkd2
- cells
- protein
- cell
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/20—Screening for compounds of potential therapeutic value cell-free systems
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/34—Genitourinary disorders
- G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy
Definitions
- NKD2 AS A TARGET FOR THE TREATMENT OF KIDNEY FIBROSIS
- the present invention relates to the role of the Nkd2 protein (Naked Cuticle Homolog 2) in the development of chronic kidney disease, in particular progressive chronic kidney disease and kidney fibrosis.
- the present invention relates to methods for identifying compounds that bind to the Nkd2 protein and to the use of Nkd2 to screen and identify Nkd2-interacting compounds.
- the invention further relates to pharmaceutical compositions for use in the treatment of kidney disease, in particular pharmaceutical compositions comprising agents which bind to and/or inhibit Nkd2 protein.
- Chronic kidney disease affects more than 10% of the world's population and its prevalence is increasing. Regardless of the initial type of damage, the final common course of kidney damage is renal fibrosis. Renal fibrosis is the hallmark of chronic kidney disease progression, but antifibrotic therapies are currently lacking. The extent of renal fibrosis is inextricably linked to the loss of renal function and the clinical course of CKD, which is why renal fibrosis is considered an important therapeutic target in CKD.
- There are no approved therapies for the treatment of renal fibrosis mainly because the cellular origin, the functional heterogeneity and the regulation of the scar-forming cells in the human kidney are still unclear and a large Provide the source of the discussion in this area (Duffield 2014; Falke et al. 2015).
- the only treatment options are continuous kidney replacement therapy (dialysis) and kidney transplantation. Both options are associated with high personal inconveniences for the patient and also represent a high economic burden for the national health systems. Therefore, novel therapeutic approaches are very desirable.
- Renal fibrosis is defined by excessive deposition of extracellular matrix that disrupts and replaces the functional parenchyma, leading to organ failure.
- the histological structure of the kidney can be divided into three main compartments, all of which can be affected by fibrosis, specifically termed glomerulosclerosis in the glomeruli, interstitial fibrosis in the tubulointerstitium, and atherosclerosis and perivascular fibrosis in the vasculature (Djudjai and Boor 2019).
- Renal fibrosis is characterized by high expression, secretion, and accumulation of extracellular matrix (ECM) proteins such as collagen-1.
- ECM extracellular matrix
- Myofibroblasts represent the main source of ECM during renal fibrosis, although their cellular origin remains controversial (Duffield 2014; Friedman et al 2013; Kriz et al 2011; Kramann and DiRocco 2013). Sequencing and mapping of single-cell RNA enables the dissection of the cellular heterogeneity of complex tissues and disease processes and provides new insights into disease-mediating cell populations and mechanisms (Ramachandran et al 2019; Dobie and Henderson 2019).
- the object on which the present invention is based is to provide methods and means for identifying active substances, compounds and compositions, and the said active substances, compounds and compositions for use in the treatment of chronic kidney diseases.
- the present invention provides methods and means for identifying drugs, compounds and compositions for use in the treatment of chronic kidney disease, particularly for identifying potent drugs, compounds and compositions for use in the treatment of progressive chronic kidney disease and renal fibrosis.
- the inventors found that the naked cuticle homolog 2 (NKD2) protein is produced in terminally differentiated myofibroblasts involved in renal fibrosis, but not in cells expressing marker proteins for pericytes and fibroblasts and only at low levels express extracellular matrix protein. It was also found that Nkd2-expressing cells have an increased activity of pro-fibrotic signal transduction pathways. The inventors further found that a reduction in fibrosis can be achieved by deleting the Nkd2 gene or knocking down Nkd2 expression, thereby identifying the gene as relevant to extracellular matrix production and fibrosis.
- Nkd2 naked cuticle homolog 2
- Nkd2 as a new target and thus a new therapeutic approach for the development of therapeutics that inhibit Nkd2 gene expression and/or NKD2 protein activity using small molecular weight drugs (Smols), peptides or biologicals.
- Smols small molecular weight drugs
- ECM extracellular matrix
- a further object of the present invention was to provide a method for identifying an active substance which binds to and/or inhibits the Naked Cuticle Homolog 2 (NKD2) protein or a fragment thereof.
- Another object of the present invention is to provide pharmaceutical compositions containing these agents and processes for preparing such pharmaceutical compositions based on the findings described above.
- FIG. 1 Schematic representation of the nephron structure and the associated cell types
- neuronal nal cells
- the creation and representation of the interaction network was made using the ggraph R package software (https://cran.r-proiect.org/web/packages/ggraph/index.html), i. Scaled representation of the gene expression of the top 10 specific genes in each cell type/cell cluster.
- the gene ranking per cluster was created using genesortR.
- Cell clusters are shown in columns and genes as rows. Each column contains the average expression of all cells within a cluster.
- Figure ld_l shows expressions of genes that are overexpressed.
- Figure ld_2 shows genes with a depleted/reduced gene expression, e.
- CKD chronic kidney disease
- eGFR calculated glomerular filtration rate
- f UMAP representation of 31,875 CD 10+ (CD 10+) single cell transcriptomes stratified according to the clinical parameters of the patients, g. Log-fold change in cell cycle stage in epithelial cells from healthy subjects and patients with CKD plotted against a random distribution model. Positive numbers represent gain, negative numbers represent depletion, h.
- ECM extracellular matrix, CD 10 cells
- j Violin blot representation of the ECM score stratified according to the cell type and the distinction between healthy and CKD in CD10 cells. P-values of differences in the eGFR categories: mesenchymal cells (p ⁇ 0.001), immune cells (p ⁇ 0.001), epithelial cells (p ⁇ 0.001), endothelial cells (p ⁇ 0.001).
- k Violin blot representation of the ECM score for mesenchymal cells stratified according to the cell type and the distinction between healthy and CKD.
- fibroblast 1 (Fibl), fibroblast 2 (Fib2), fibroblast 3 (Fib3), pericytes (Pe), vascular smooth muscle cells (VSMCs), mesangial cells (mesa) , myofibroblast 1 (MF1), myofibroblast 2 (MF2), myofibroblast 3 (MF3), mesangial cells (mesa), macrophage 1 (MCI), macrophage 2 (MC2), dendritic cells (DC), arteriolar endothelial cells (art), glomerular endothelial cells (GC), vasa recta (VR), inflamed endothelium (iEn), proximal tubular cells (PT), inflamed proximal tubular cells (iPT), intercalating cells (IC), collecting duct principal cells (PC), thick ascending portion of loop of Henle (TAL) b.
- fibroblast 1 (Fibl), fibroblast 2 (Fib2), fibroblast 3 (Fib3), pericytes (P
- Top left Gene expression dynamics for overexpression over a pseudo timeline for lineage 1 (pericytes to myofibroblasts, see e.). Cells (in columns) were arranged along the pseudo-time axis. Genes (in rows) that correlate with pseudotime were selected and blotted along the pseudotime (see Methods). Each column contains the mean of 10 cells. Genes were grouped into 7 groups according to their pseudo-time expression pattern. Selected example genes are listed. Bottom left: Representation corresponding to top left, however, reduced gene expressions are shown. Top right: Cell cycle phases as a percentage of each 2000 cells are shown as a function of pseudotime. Bottom right: amplification of the PID signal cascade depending on the pseudo time.
- FIG. 3 a. Top: Fate tracing experiment design. Bottom: Representation of the PDGFRbCreER-tdTomato positive cells in the mouse kidney in the model of UUO (unilateral ureteral obstruction) and in the control operated mouse (SHAM). Above: detection of PDGFRß-tdtom and DAPI; middle: detection of PDGFRß-tdtom; Bottom: Evidence of DAPI b. Representative image of a Collal in-situ hybridization of a PDGFRbCreER;tdTomato kidney after UUO surgery.
- RNA in situ hybridization shows co-localization of Coll aI expression in PDGFRa/PDGFRb double positive cells.
- Collal/PDFGRa/PDFRb triple-positive cells (arrows) are sporadically detectable in the interstitium of the kidney.
- Left Collal expression and ECM score in CD 10 negative cells ( Figure Ib-c) stratified according to PDGFRa and PDGFRb expression.
- TMA trichrome-stained human kidney tissue array
- DAPI nuclear staining
- fibroblast 1 Fibl
- myofibroblast 1 MF1
- myofibroblast 2 MF2
- myofibroblast 3 MF3
- endothelial cells EC
- inflamed proximal tubular cells iPT
- undetermined mesenchymal cells uM
- macrophages/monocytes MC
- Figure 5 a. Expression of Nkd2 shown as UMAP from Figure 4c. (murine Pdgfra/b double positive cells), b. Percent of Collal positive and negative cells (data see a) stratified according to Pdgfra and Nkd2 expression. Collal-negative cells are mostly PDGFRa/Nkd2 double-negative cells, while Collal-positive cells are mostly also PDGFRa/Nkd2 double-positive. c. Scaled gene expression of genes whose expression correlates positively (Figure 5c_l) or negatively (Figure 5c_2) to Nkd2 expression in human PDGFRb cells, shown in Figure 2 ac. d.
- a HA tag was attached to the exogenously overexpressed protein, g. Expression of Collal, Fibronectin (Fn) and Acta2 (aSMA) quantified by qPCR after Nkd2 overexpression in human immortalized PDGFRb+ cells treated with transforming growth factor beta (TGFb) or vehicle (PBS), h. Verification of the Nkd2 knock-out using Western blot analysis in multiple single cell clones (1,2,3) compared to non-targeting gRNA clones (NTG). The Nkd2 protein expression is completely deleted in clone 2 due to a large insert, while in clones l and 3 only reduced Nkd2 protein expression is caused by smaller indel j.
- GSEA Gene set enrichment analysis of ECM genes in Nkd2-dysregulated PDGFRb kidney cells. "Shallow” was detected in clones 1+3, in which the NKD2 protein is still detectable. "Severe” was detected in clone 2, k. Change in the strength of the PID signaling cascade in PDGFRb+ NKD2-KO clones and overexpression (up means increased regulation of the genes under the indicated condition and down means down-regulated genes) 1. Representative image of a multiplex RNA in situ hybridization of PDGFRa, PDGFRb and NKD2 in human iPSC-derived kidney organoids.
- the present invention relates to a method for reducing the expression and/or secretion of extracellular matrix (ECM) proteins by a given cell, the method comprising at least one step selected from the group consisting of
- nkd2 gene knock-down can be achieved, for example, by nkd2 gene knock-down, knock-out, conditional gene knock-out, gene modification, RNA interference, siRNA and/or antisense RNA.
- antisense molecules such as antisense oligonucleotides, antisense conjugates or catalytic nucleic acid molecules such as ribozymes. Such molecules can be produced in the cell using expression vectors or introduced into the cell from the outside.
- the antisense oligonucleotides can be chemically modified in order to increase their stability and/or binding affinity.
- the chemical modification of the backbone chemistry of antisense oligonucleotides for example, by phosphorothioates, phosphorodithioates. Phosphoroamidites, alkyl phosphotriesters or boranophosphates have been described in the prior art (e.g. WO00/49034A1).
- NKD2 protein in the cell can be achieved, for example, by proteases or other proteolytic molecules. These can be synthesized heterologously in the cell by means of expression vectors or synthesized to an increased extent in the cell by increasing the homologous gene expression of protease-encoding genes or introduced into the cell from the outside. Inhibition or reduction of NKD2 protein activity can be achieved using an agent that binds to the Naked Cuticle Homolog 2 (NKD2) protein.
- Naked Cuticle Homolog 2 (NKD2) protein an agent that binds to the Naked Cuticle Homolog 2 (NKD2) protein.
- the given cell is a kidney cell, more preferably a kidney myofibroblast cell, most preferably a terminally differentiated kidney myofibroblast cell.
- the NKD2 protein has been shown to be a WNT antagonist.
- the naked cuticle (NKD) family includes the Drosophila naked cuticle and its two vertebrate orthologues, the naked cuticle homologs 1 (NKD1) and 2 (NKD2).
- the Nkd2 gene locus is located on chromosome 5p 15.3. Loss of heterozygosity has been found to be common in these regions in various tumor types, including breast cancer.
- Both NKD1 and NKD2 have been reported to antagonize canonical Wnt signaling by interacting with Disheveled via their EF hand-like motifs (Hu et al 2006).
- NKD2 has been shown to bind to Disheveled via its TGFa binding region (Li et al. 2004).
- Human NKD1 and 2 are only 40% identical to each other, while they are about 70% identical to their respective murine orthologues.
- NKD2 The C-terminus of NKD2 is highly disordered, while the N-terminus of NKD2 contains most of the functional domain, which includes myristoylation, an EF hand motif, a disheveled binding region, and a vesicle recognition and membrane targeting motif (Li et al 2004; Rousset et al 2001; Zeng et al 2000). NKD2 is thought to function as a switch protein through its diverse functional motifs (Hu et al 2006). The promoter region of NKD2 is hypermethylated in glioblastoma cells.
- Nkd2 was found to be exclusively expressed in terminally differentiated PDGFRa+/PDGFRb+ myofibroblasts, which express high levels of the extracellular matrix protein collagen-1. This and other matrix proteins are produced by myofibroblasts, which predominantly arise through differentiation from fibroblasts and pericytes. More than 40% of all collagen-1-producing cells have been shown to be Nkd2/PDGFRa+. Cells expressing marker proteins for pericytes and fibroblasts and secreting only low levels of matrix proteins lack Nkd2 expression.
- Nkd2- expressing myofibroblasts demonstrated an increased activity of pro-fibrotic signal transduction pathways such as TGF, Wnt and TNF signal transduction pathways.
- pro-fibrotic signal transduction pathways such as TGF, Wnt and TNF signal transduction pathways.
- Nkd2 overexpression and depletion experiments it was shown that Nkd2 is relevant for the production of extracellular matrix proteins. Lentiviral overexpression of Nkd2 in human fibroblasts resulted in increased expression of pro-fibrotic matrix proteins such as collagen-1 and fibronectin after stimulation by the pro-fibrotic factor TGF-. It could be shown that the CRISPR/Cas9-mediated knockout of Nkd2 leads to a significant reduction in the expression of collagen-1, fibronectin and ACTA2. Knock-down of Nkd2 using siRNA in organoids covering all compartments of the human kidney in which fibrotic changes were induced by stimulation with IL1-13 resulted in reduced collagen-1 expression and fibrosis.
- the NKD2 protein may be mammalian, non-primate, primate, and particularly human NKD2 protein or a fragment thereof.
- the present invention relates to a method for identifying an active substance which binds to the Naked Cuticle Homolog 2 (NKD2) protein or a fragment thereof.
- the method can include at least the following steps
- the agent to be screened and identified according to the present invention is an NKD2 inhibitor or antagonist.
- the drug according to the present invention can be selected from the group consisting of a low molecular weight compound, a peptide and a biologic.
- the term “low molecular weight compound”, “small molecule”("smol") or “chemical drug” refers to an organic compound with a low molecular weight ( ⁇ 1,000 daltons), often with a size of the order of 1 nm.
- Many drugs are small molecules. Such small molecules can regulate a biological process. Small molecules may be able to inhibit a specific function of a protein.
- the term “small molecule” specifically refers to molecules that bind to specific biological macromolecules and act as an effector by altering the activity or function of a target.
- acetylsalicylic acid (ASA) is considered a low molecular weight compound, measuring 180 daltons and made up of 21 atoms. Such small molecules often have little ability to elicit an immune response and remain relatively stable over time.
- biological is preferably an antibody, or an antigen-binding fragment thereof, or an antigen-binding derivative thereof, or an antibody-like protein, or an aptamer.
- the agent is a member of a compound library.
- the compound library can e.g. B. include low molecular weight compounds, peptides or biological compounds.
- (combinatorial) compound library refers to collections of chemical compounds, small molecules, peptides, or macromolecules such as proteins, in which several different combinations of related chemical, peptide, or biological species are included that are used together in a particular screen -assays or identification steps can be used.
- the present invention relates to the use of a nucleic acid which encodes the naked cuticle homolog 2 or a fragment thereof or the Naked Cuticle Homolog 2 (NKD2) protein or a fragment thereof, in a method for identifying an agent that binds to NKD2 or a fragment thereof, as described above.
- the present invention relates to an antibody or an antigen-binding fragment or derivative thereof or an antibody-like protein which specifically binds to the NKD2 protein.
- the antibody or antigen-binding fragment or derivative thereof or antibody-like protein inhibits NKD2 activity, i.e. acts as an inhibitor or antagonist of NKD2.
- antibody refers to a protein composed of one or more polypeptide chains encoded by immunoglobulin genes or fragments of immunoglobulin genes or cDNAs derived from them. These immunoglobulin genes include the constant region light chain kappa, lambda and heavy chain alpha, delta, epsilon, gamma and mu genes, as well as any of the many different variable region genes.
- the basic structural unit of immunoglobulin is usually a tetramer composed of two identical pairs of polypeptide chains, the light chains (L, with a molecular weight of about 25 kDa) and heavy chains (H, with a molecular weight of about 50- 70 kDa).
- Each heavy chain consists of a heavy chain variable region (abbreviated as VH or VH) and a heavy chain constant region (abbreviated as CH or CH).
- the heavy chain constant region consists of three domains, namely CH1, CH2 and CH3.
- Each light chain contains a light chain variable region (abbreviated as VL or VL) and a light chain constant region (abbreviated as CL or CL).
- VH and VL regions can be further subdivided into regions of hypervariability, also termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
- CDR complementarity determining regions
- FR framework regions
- Each VH and VL region consists of three CDRs and four FRs arranged from the amino terminus to the carboxy terminus in the order FR1, CDRI, FR2, CDR2, FR3, CDR3, FR4 are.
- the heavy and light chain variable regions form a binding domain that interacts with an antigen.
- the CDRs are most important for the binding of the antibody or the antigen-binding part of it.
- the FRs can be replaced with other sequences as long as the three-dimensional structure required for binding of the antigen is preserved. Structural changes in the construct usually lead to a loss of sufficient binding to the antigen.
- antigen-binding portion of antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to the antigen in its native form.
- antigen-binding portions of the antibody include an Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains, an F(ab')2 fragment, a bivalent fragment consisting of two Fab comprises fragments linked by a disulfide bond at the hinge region, an Fd fragment consisting of the VH and CHI domains, an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, and a dAb fragment consisting of a VH domain and an isolated complementarity determining region (CDR).
- CDR complementarity determining region
- the antibody, antibody fragment or antibody derivative thereof according to the present invention may be a monoclonal antibody.
- the antibody can be of the isotype IgA, IgD, IgE, IgG or IgM.
- mAb monoclonal antibody
- mAb refers to an antibody composition having a homogeneous antibody population, i.e. a homogeneous population consisting of whole immunoglobulin or a fragment or derivative thereof.
- a homogeneous antibody population i.e. a homogeneous population consisting of whole immunoglobulin or a fragment or derivative thereof.
- Such an antibody is particularly preferably selected from the group consisting of IgG, IgD, IgE, IgA and/or IgM, or a fragment or derivative thereof.
- fragment refers to fragments of such an antibody that retain target binding capacities, e.g. B. a CDR (complementarity determining region), a hypervariable region, a variable domain (Fv), an IgG heavy chain (consisting of VH, CHI, hinge, CH2 and CH3 regions), an IgG light chain (consisting of VL and CL regions) and/or a Fab and /or F(ab)2.
- CDR complementarity determining region
- Fv variable domain
- IgG heavy chain consististing of VH, CHI, hinge, CH2 and CH3 regions
- IgG light chain consististing of VL and CL regions
- derivative refers to protein constructs that are structurally different from, but still share some structural relationship with, the current antibody concept, e.g. B. scFv, Fab and / or F (ab) 2, as well as to bi-, tri- or higher specific antibody constructs. All of these elements are explained below.
- antibody derivatives known to those skilled in the art are diabodies, camelid antibodies, domain antibodies, bivalent homodimers with two chains consisting of scFvs, IgAs (two IgG structures linked by a J chain and a secretory component), shark Antibodies, antibodies consisting of New World primate framework plus non-New World primate CDR, dimerized constructs comprising CH3+VL+VH, other framework protein formats comprising CDRs, and antibody conjugates.
- antibody-like protein refers to a protein that has been engineered (e.g., by mutagenesis of Ig loops) to specifically bind to a target molecule.
- an antibody-like protein comprises at least one variable peptide loop linked to a protein backbone at both ends. This dual structural constraint increases the binding affinity of the antibody-like protein to a level comparable to that of an antibody.
- the length of the variable peptide loop typically consists of 10 to 20 amino acids.
- the scaffold protein can be any protein with good solubility properties.
- the scaffold protein is a small globular protein.
- Antibody-like proteins include, without limitation, affibodies, anticalins, and designed ankyrin proteins and affilin proteins.
- Antibody-like proteins can be derived from large libraries of mutants, e.g. B. by panning from large phage display libraries, and can be isolated in analogy to regular antibodies. Also, antibody-like binding proteins can be obtained by combinatorial mutagenesis of surface-exposed residues in globular proteins.
- Fab refers to an IgG fragment comprising the antigen-binding region, which fragment is composed of a constant and a variable domain from each heavy and light chain of the antibody.
- F(ab)2 refers to an IgG fragment consisting of two Fab fragments linked by disulfide bonds.
- scFv refers to a single chain variable fragment that is a fusion of the variable regions of immunoglobulin heavy and light chains joined by a short linker, usually serine (S) and/or glycine (G) residues included. This chimeric molecule retains the specificity of the original immunoglobulin despite the removal of the constant regions and the introduction of a linker peptide.
- Modified antibody formats are e.g. B. bi- or trispecific antibody constructs, antibody-based fusion proteins, immunoconjugates and the like.
- IgG, scFv, Fab and/or F(ab)2 are antibody formats well known to those skilled in the art. Appropriate activation techniques can be found in relevant textbooks.
- the antibody or antigen-binding fragment or antigen-binding derivative thereof is a murine, chimeric, humanized or human antibody or antigen-binding fragment or antigen-binding derivative thereof.
- Mouse-derived monoclonal antibodies can cause undesirable immunological side effects because they contain a protein from another species that can elicit antibodies.
- antibody humanization and maturation methods have been developed to generate antibody molecules with minimal immunogenicity for human application, while ideally retaining the specificity and affinity of the parent non-human antibody.
- the framework regions of a mouse mAb are replaced by corresponding human framework regions (so-called CDR grafting).
- WO200907861 discloses the generation of humanized forms of mouse antibodies by linking the CDR regions of non-human antibodies to human constant regions using recombinant DNA technology.
- US6548640 to Medical Research Council describes CDR transplantation techniques and US5859205 to Celltech describes the production of humanised antibodies.
- humanized antibody refers to an antibody, fragment or derivative thereof in which at least part of the constant regions and/or the framework regions and optionally part of the CDR regions of the antibody are derived from human immunoglobulin sequences or adapted to it.
- the present invention relates to an active ingredient obtained by the identification method described above.
- the active ingredient has the ability to specifically bind to the protein Naked Cuticle Homolog 2 (NKD2).
- the active substance binds specifically with a high or particularly high affinity and/or avidity to the NKD2 protein or a fragment thereof.
- the drug when bound to NKD2, reduces or inhibits NKD2 activity.
- the term "specifically bind" as used herein means that the drug has a dissociation constant KD to the NKD2 protein molecule or epitope thereof of at most about 100M.
- the KD is about 100M or lower, about 50M or lower, about 30M or lower, about 20M or lower, about 10M or lower, about 5M or lower, about 1M or lower, about 900 nM or lower, about 800 nM or lower, about 700 nM or lower, about 600 nM or lower, about 500 nM or lower, about 400 nM or lower, about 300 nM or lower, about 200 nM or lower, about 100 nM or lower, about 90 nM or lower, about 80 nM or lower, about 70 nM or lower, about 60 nM or lower, about 50 nM or lower, about 40 nM or lower, about 30 nM or lower, about 20 nM or lower, or about 10 nM or lower, about 1 nM or lower, about 900 p
- the active ingredient may be for use in the treatment of chronic kidney disease, particularly where the chronic kidney disease is progressive chronic kidney disease and/or renal fibrosis.
- the active agent may be a low molecular weight compound (smol), a peptide or a biologic, preferably the biologic is an antibody, a fragment thereof or a derivative thereof, or an antibody-like protein or an aptamer.
- smol low molecular weight compound
- peptide a peptide or a biologic
- the biologic is an antibody, a fragment thereof or a derivative thereof, or an antibody-like protein or an aptamer.
- the low-molecular compound according to the present invention can, in addition to other chemical backbones, substituents, groups or residues, for example, alkyl, alkenyl, alkynyl, alkoxy, aryl, alkylene, arylene, amino, halogen, carboxylate derivative, cycloalkyl -, carbonyl derivative, heterocycloalkyl, heteroaryl, heteroarylene, sulfonate, sulfate, phosphonate, phosphate, phosphine, phosphine oxide groups.
- substituents, groups or residues for example, alkyl, alkenyl, alkynyl, alkoxy, aryl, alkylene, arylene, amino, halogen, carboxylate derivative, cycloalkyl -, carbonyl derivative, heterocycloalkyl, heteroaryl, heteroarylene, sulfonate, sulfate, phosphonate, phosphate, phosphine,
- the present invention relates to the use of an active substance which binds to the protein naked cuticle homolog 2 (NKD2) and/or inhibits this in a method for treating chronic kidney disease, the chronic kidney disease preferably being progressive is chronic kidney disease and/or renal fibrosis.
- the drug when bound to NKD2, inhibits NKD2 activity.
- the present invention relates to a method of treating or preventing chronic kidney disease, the method comprising administering an agent that binds to and/or inhibits Naked Cuticle Homolog 2 (NKD2) protein in a therapeutically effective amount or dose includes a human or animal subject.
- NBD2 Naked Cuticle Homolog 2
- the term "effective amount” means a dose or an amount effective in dosages and for periods of time necessary to achieve a desired to achieve result. Effective amounts may vary depending on such factors as the disease state, the patient's age, sex and/or weight, the pharmaceutical formulation, the type of disease being treated, and the like, but can nonetheless be routinely determined by one skilled in the art.
- the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising the antibody or antigen-binding fragment or derivative thereof or antibody-like protein as described above, or the active ingredient as described above, and optionally one or more pharmaceutically acceptable excipients includes.
- the excipients can be selected from the group consisting of pharmaceutically acceptable buffers, surfactants, diluents, carriers, excipients, fillers, binders, lubricants, glidants, disintegrants, adsorbents and/or preservatives.
- the present invention relates to a method for the production of a pharmaceutical composition, comprising
- the present invention relates to a composition
- a composition comprising a combination of (i) the antibody or antigen-binding fragment or derivative thereof or antibody-like protein as described above, or the active ingredient which binds to naked cuticle homolog 2 (NKD2 ) protein as described above or the pharmaceutical composition as described above and (ii) one or more other therapeutically active compounds.
- NBD2 naked cuticle homolog 2
- the pharmaceutical composition may comprise one or more pharmaceutically acceptable buffers, surfactants, diluents, carriers, excipients, fillers, binders, lubricants, disinfectants, adsorbents and/or preservatives.
- Said pharmaceutical composition can be administered in the form of powder, tablet, pill, capsule or bead.
- the pharmaceutical formulation may be ready for administration, while in lyophilized form the formulation may be converted to a liquid form, e.g. B. by adding water for injections containing a preservative such.
- benzyl alcohol antioxidants such as vitamin A, vitamin E, vitamin C, retinyl palmitate and selenium, the amino acids cysteine and methionine, citric acid and sodium citrate, synthetic preservatives such as the parabens methylparaben and propylparaben may or may not contain.
- the pharmaceutical formulation may also contain one or more stabilizers, e.g. B. an amino acid, a sugar polyol, a disaccharide and / or a polysaccharide can be.
- the pharmaceutical formulation may further contain one or more surfactants, one or more isotonizing agents and/or one or more metal ion chelating agents and/or one or more preservatives.
- the pharmaceutical formulation as described herein may be suitable for at least oral, parenteral, intravenous, intramuscular or subcutaneous administration.
- the conjugate according to the present invention may be provided in a depot formulation, allowing for sustained release of the active ingredient over a period of time.
- a primary packaging such. a pre-filled syringe or pen, vial or infusion bag, comprising the formulation according to the preceding aspect of the invention.
- the pre-filled syringe or pen may contain the formulation either in freeze-dried form (which then needs to be reconstituted with e.g. water for injections before administration) or in aqueous form.
- the syringe or pen is often a disposable, single-use item and can have a volume of between 0.1 and 20 ml.
- the syringe or pen can also be a reusable syringe or a multi-dose pen.
- the present invention relates to a therapeutic kit comprising:
- Kidney tissue was harvested from normal and tumor regions by the surgeon. Tissue was frozen on dry ice or placed in prechilled University of Wisconsin solution (#BTLBUW, Bridge to Life Ltd., Columbia, U.S.) and transported to our laboratory on ice. The tissues were cut into approx. 0.5-1mm3 pieces and then transferred to a C-tube (Miltenyi Biotec) and processed on a gentle-MACS (Miltenyi Biotec) with the spleen 4 program. The tissue was then digested for 30 min at 37°C with shaking at 300 RPM in a digestion solution containing 25 pg/ml Liberase TL (Roche) and 50 pg/ml DNase (Sigma) in RPMI (Gibco).
- the samples were processed again on a gentle-MACS (Miltenyi Biotec) with the same program.
- the resulting suspension was passed through a 70 pm cell strainer (Falcon), washed with 45 ml cold PBS and centrifuged at 500 g for 5 minutes at 4°C. Cells were counted with a trypan blue stained hemocytometer. Live single cells were enriched for fibroblasts by FACS sorting and gating for DAPI-negative cells with further enrichment of epithelial cells by CDIO staining or PDGFRß staining, on average it took 5-6 hours from obtaining biopsies to preparing the single cell suspensions.
- PDGFRßCreERt2 ie B6-Cg-Gt(Pdgfrß-cre/ERT2)6096Rha/J, JAX Stock #029684
- Rosa26tdTomato ie B6-Cg-Gt(ROSA)26Sorttm(CAG-tdTomato)Hze/J JAX Stock #007909
- the offspring were genotyped by PCR according to the Jackson Laboratories protocol.
- Pdgfrb-BAC-eGFP reporter mice were developed by N. Heintz (The Rockefeller University) for the GENSAT project. All mice were genotyped by PCR.
- mice were kept under specific pathogen-free conditions accommodated at the University of Edinburgh or the RWTH Aachen. UUO was performed as previously described.2 Briefly, after a flank incision, the left ureter was ligated with two 7.0 ties (Ethicon) at the level of the inferior pole. The mice were sacrificed on day 10 after surgery. The animal testing protocols have been approved by LANUV-NRW, Germany and by the UK Home Office Regulations. All animal testing was performed in accordance with their guidelines. Male PDGFRbeGFP mice born within 10 days and aged between 9 and 11 weeks at the time of surgery were used for SMART-Seq2 and sacrificed as indicated.
- PDGFRbCreER;tdTomato mice (8 weeks old, 2 males/3 females) received tamoxifen three times by gavage (10 mg po) followed by a 21-day washout period, and then underwent UUO surgery or sham surgery (as above) and sacrificed 10 days after surgery.
- mice were perfused via the left heart with 20 ml of 0.9% NaCl to remove residual blood from the vasculature.
- the kidneys were surgically removed, cut into small slices and placed in a 15 ml tube (Falcon) on ice-cold PBS with 1% FCS.
- Falcon 15 ml tube
- FCS 1% FCS
- Cells were labeled with the following monoclonal direct fluorochrome conjugated antibodies: anti-CD10 human (clone HI 10a, biolegend), anti-PDGFRb mouse (clone PR7212, R&D), anti-PDGFRalpha mouse (clone APA5, biolegend), anti- CD31 mouse (clone Megl3.3, biolegend), anti-CD45 mouse (clone 30 F11).
- anti-CD10 human clone HI 10a, biolegend
- anti-PDGFRb mouse clone PR7212, R&D
- anti-PDGFRalpha mouse clone APA5, biolegend
- anti- CD31 mouse clone Megl3.3, biolegend
- anti-CD45 mouse clone 30 F11
- the cells were pre-incubated with Fc block (TruStainFx human, TruStainFx mouse clone 91, biolegend) and then incubated with the above-mentioned antibodies for 30 minutes on ice, diluted in 2% FBS/PBS, protected from light.
- Goat anti-mouse Dyelight 405 (poly24091, biolegend) was used as a secondary antibody for staining with human anti-PDGFRb. All compensations were made at the time of recording performed using single color stains and negative stains and fluorescence minus one controls.
- the cells were sorted in semi-purity mode with the SONY SH800 sorter (Sony Biotechnology; 100 um nozzle sorting chip Sony) aiming for an efficiency of >80%.
- SONY SH800 sorter Spin-Propane Sorter
- FACS Aria II device Becton Dickinson, Basel, Switzerland.
- single cells were processed by SciLifeLab - Eukaryotic Single cell Genomic Facility (Karolinska Institute). Before shipping, the single cells were sorted into wells of a 384-well plate with prepared lysis buffer. The libraries were sequenced on an Illumina HiSeq 4500. The single cell solution of cells and primary human kidney cells were run in parallel on a Chromium Single Cell Chip kit and the libraries were processed using Chromium Single Cell 3' Library Kit V2 and i7 Multiplex Kit (PN-120236, PN-120237, PN-120262, lOx Genomics) according to the manufacturer's protocol. The quality of the library was determined using the DL 000 ScreenTape on the 2200 TapeStation System (Agilent Technologies). Sequencing was performed on an Illumina Novaseq platform with Sl and S2 flow cells (Ilumina).
- PAS-stained sections of the kidneys were collocatedly analyzed and evaluated by an experienced nephropathologist. All sections were examined for specific renal disease, but no evidence of specific glomerular or tubulointerstitial or vascular disease was noted apart from age-related changes or hypertensive nephropathy. The extent of interstitial fibrosis and tubular atrophy were assessed as two separate parameters in % of cortical area affected. The extent of global glomerulosclerosis was estimated as % of global sclerotic glomeruli out of all glomeruli. The extent of arteriosclerosis, i. H.
- the fibroelastic thickening of the intima compared to the thickness of the media was rated on a scale of 0 to 3, where 0 - none, 1 - mild ( ⁇ 50%), 2 - moderate (51-100%) and 3 - severe ( >100% thickened intima compared to media).
- Kidney tissue was fixed in 4% formalin for 2 hours at RT and frozen in OCT overnight after dehydration in 30% sucrose. Using 5-10 ⁇ m cryosections, slides were blocked in 5% donkey serum, followed by a 1 hour incubation of the primary antibody, washing 3 times for 5 minutes in PBS, and then incubating the secondary antibodies for 45 minutes. After DAPI (4',6*-'diamidino-2-phenylindole) staining (Roche, 1:10,000), slides were mounted with ProLong Gold (Invitrogen, #P10144).
- anti-mouse PDGFRa AF1062, 1:100, R&D
- anti-CD10 human clone HI10a, 1:100, biolegend
- anti-HNF4a clone C11F12, 1:100, cell signalling
- Pan -Cytokeratin type I/II Invitrogen, Ref. MA1-82041
- Dachl Sigma, HPA012672
- Collal Abeam, ab34710), ERG (abeam, ab92513), AF488 donkey anti-goat (1:100, Jackson Immuno Research ), AF647 donkey anti-rabbit (1:200, Jackson Immuno Research).
- Images were acquired with a Nikon AIR confocal microscope using 40X and 60X objectives (Nikon). The raw data was processed with Nikon software or ImageJ.
- Paraffin-embedded, formalin-fixed kidney samples from 98 non-tumorous human kidney samples from the Biobank Eschweiler/Aachen were selected on the basis of a previously performed PAS staining. Regions were randomly selected per sample and a 2 mm nucleus was harvested from each kidney sample using the TMArrayerTM (Pathology Devices, Beecher Instruments, Riverside, USA). Each core was placed in a recipient block in a 2 mm grid covering approximately 2.5 cm 2 and 5 micron thick sections were cut and processed using standard histological techniques.
- In situ hybridization was performed using formalin-fixed, paraffin-embedded tissue samples and the RNAScope Multiplex Detection KIT V2 (RNAScope, #323100) following the manufacturer's protocol with minor modifications.
- the antigen retrieval was carried out for 22 min at 96°C instead of 15 min at 99°C in a water bath. 3-5 drops of the pretreatment-1 solution were incubated for 10 minutes at RT after performing the antigen retrieval. The washing steps were performed three times for 5 minutes.
- RNAscope assay Hs-PDGFRß #548991-C1, Hs-PDGFRa #604481-C3, Hs-Collal #401891, Hs-COL1A1 #401891-C2, Hs-MEG3 #400821, Hs-NKD2 #581951-C2 (targeting 236-1694 of NM 033120.
- PDGFRb+ cells were isolated from the healthy human renal cortex of a nephrectomy specimen (71 year old male patient) by preparing a single cell suspension (as described above) followed by MACS separation (Miltenyi biotec, autoMACS Pro Separator, # 130-092- 545, autoMACS Columns #130-021-101 For the isolation, the single cell suspension was stained in two steps, first using a specific PDGFRb antibody (R&D # MAB 1263 antibody, dilution 1:100) and then a second incubation step with an anti- Mouse IgG1 MicroBeads solution (Miltenyi, #130-047-102,) After MACS, the cells were cultured in DMEM media (Thermo Fisher # 31885) containing 10% FCS and 1% penicillin/streptomycin for 14 days and immortalized with SV40LT and HTERT as follows Retroviral particles were prepared by transient transfection of HEK293T cells with TransIT-LT (Minis) Two types
- Retroviral particles were concentrated 100x with the Retro-X concentrator (Clontech) 48 hours after transfection. The cell transduction took place by incubating the target cells with serial dilutions of the retroviral supernatants (1:1 mixture of the concentrated particles with SV40-LT or hTERT) for 48 h. The infected PDGFRb+ cells were then selected 72 hours after the transfection for 7 days with 2 ⁇ g/ml puromycin. Cultivation of human induced pluripotent stem cells (iPSC) derived kidney organoids
- Human iPSC-15 clone 0001 was obtained from the Stem Cell Facility at Radboud University Center, Nijmegen, The Netherlands. Human iPSC were grown on Geltrex-coated plates in E8 medium (Life Technologies). At 70-80% confluence, the iPSC were separated with 0.5 mM EDTA and the cell aggregates were reseeded by splitting in a 1:3 ratio. Human iPSC were generated using a modified protocol based on Takasato et al. (Nature, 2015) and seeded at a density of 18,000 cells per cm2 on Geltrex-coated plates (Greiner).
- the NKD2 siRNA knockdown was performed according to the manufacturer's protocol (DharmaFECT transfection reagent and NKD2-specific smartpool siRNA, both Horizon Discovery).
- the transfection master mix and scrambled controls were prepared in Essential 6 medium (Gibco) and added to the organoids. After an initial incubation of 24 hours, the transfection master mixes were refreshed and IL-1 ⁇ (Sigma-Aldrich) was added at a concentration of 100 ng/ml to induce fibrosis.
- the IL-1 ⁇ challenge along with the transfection master mix boost was repeated every 24 h for two subsequent days. 96 hours after the start of transfection, the organoids were harvested and prepared for paraffin sections. Fluorescence in situ hybridization (FISH) and immunofluorescence staining were performed as described above.
- FISH Fluorescence in situ hybridization
- TGFb 100-21-10UG, Peprotech
- TGFb 100-21-10UG, Peprotech
- T-5224 (c-Fos/AP-1 Inhibitor, Cayman Chemicals, #22904) was dissolved in DMSO and stored at -80°C. DMSO was always added in equal proportions to the control wells.
- the WST-1 assay using PDGFRb cells was performed in 96 wells as recommended by the manufacturer (Roche Applied Science). Briefly, 1x10 A 4 PDGFRb cells were seeded into each well of 96-well plates and the cells were treated with T-5224 or vehicle (DMSO) at the indicated concentrations in triplicate. Cells were incubated for 2h with the WST-1 reagent before being harvested at the times indicated. The absorption was measured both at 450 nm and at 650 nm (as a reference). sgRNA:CRISPR-Cas9 vector construction, virus production and transduction
- the NKD2-specific guide RNA forward 5'-CACCGACTCCAGTGCGATGTCGG -3'; reverse 5'-AAACCCGAGACATCGCACTGGAGTC -3' was cloned into pL-CRISPR.EFS.GFP (Addgene #57818) by BsmBI restriction digestion. Lentiviral particles were produced by transient co-transfection of HEK293T cells with the lentiviral transfer plasmid, the packaging plasmid psPAX2 (Addgene #12260) and the VSVG packaging plasmid pMD2.G (Addgene #12259) using TransIT-LT (Minis).
- Viral supernatants were collected 48-72 hours after transfection, clarified by centrifugation, supplemented with 10% FCS and Polybrene (Sigma-Aldrich, final concentration of 8 ⁇ g/ml) and 0.45 ⁇ m filtered (Millipore; SLHP033RS).
- FCS and Polybrene Sigma-Aldrich, final concentration of 8 ⁇ g/ml
- eGFP expressing cells were individually sorted into 96 well plates.
- the expanded colonies were screened for mutations using a mismatch detection assay: gDNA spanning the CRISPR target site was PCR amplified and analyzed by T7EI digestion (T7 endonuclease, NEB M0302S).
- the PCR product was transfected into the pCRTM 4Blunt-TOPO vector (Thermo Scientific K287520) subcloned. At least 6 colonies per CRISPR clone were grown and sent for Sanger sequencing (clone C2: 30 colonies were sequenced). A western blot was performed to demonstrate complete knockout of NKD2.
- Western blots were performed according to standard protocols. Briefly, cell lysates were prepared with RIPA buffer and protease inhibitor cocktail (Roche). The protein concentrations of the lysates were quantified using the BCA assay (#23225, Pierce, ThermoScientific). Protein lysates were heated for 5 min at 95°C in 4x SDS sample loading buffer (BioRad) and loaded into 10% SDS-Page gels.
- the human NKD2 cDNA was amplified by PCR using the primer sequences 5'-atggggaaactgcagtcgaag-3' and 5'-ctaggacgggtggaagtggt-3'. Restriction sites and N-terminal IxHA tag were introduced into the PCR product with the primers 5'-cactcgaggccaccatgtacccatacgatgttccagattacgctgggaaactgcagtcgaag -3' and 5'-acggaattcctaggacgggtggaagtg-3'.
- pMIG was a gift from William Hahn (Addgene plasmid #9044; http://n2t.net/addgene:9044; RRID:Addgene_9044).
- pUMVC packaging plasmid pUMVC
- pMD2.G pseudotyping plasmid pMD2.G
- Viral supernatants were collected 48-72 hours post-transfection, clarified by centrifugation, supplemented with 10% FCS and Polybrene (Sigma-Aldrich, final concentration of 8 pg/ml) and 0.45 ⁇ m filtered (Millipore; SLHP033RS). The cell transduction took place by incubating the PDGFß cells with viral supernatants for 48 h. eGFP expressing cells were individually sorted.
- sequencing libraries were prepared using the KAPA RNA HyperPrep Kit with RiboErase (Kapa Biosystems) according to the manufacturer's protocol.
- the sequencing libraries were quantified using quantitative PCR (New England Biolabs, Ipswich, USA), pooled equimolarly, the final pool normalized to 1.4 nM and denatured with 0.2 N NaOH and neutralized with 400 nM Tris pH 8.0 prior to sequencing.
- Final sequencing was performed on a NextSeq platform (Illumina) according to manufacturer's protocols (Illumina, CA, USA).
- PDGFRa/b pos cells were FACS-sorted as described above from freshly isolated UUO kidneys, washed twice with cold PBS and centrifuged at 500g for 5 minutes. The cell pellets were then lysed in 50 ⁇ l ice-cold lysis buffer (10mM Tris-HCl, pH7.5; 10mM NaCl, 3mM MgC12, 0.08% NP40 substitute [74385, Sigma], 0.01% digitonin [G9441, Promega]) and immediately centrifuged at 500g for 9 minutes.
- the pellets were resuspended in 50 ⁇ l of a transposase reaction mix containing 25 ⁇ l 2xTD buffer (20mM Tris-HCl, pH7.6, 10mM MgCl2, 20% DMF), 0.5 ⁇ l Tagment DNA enzyme 1 [15027865, Illumina] and 24.5 ⁇ l nuclease-free water.
- the transposition reaction was incubated at 37°C for 30 min at 350 rpm in a thermoshaker.
- the transposed DNA was then cleaned using a MinElute Reaction Cleanup Kit (28204, Qiagen) and eluted in 15 ⁇ l of nuclease-free water.
- Transposed DNA was amplified by PCR (14 cycles total) using NEB Next 2x Master Mix (M0541S; New England Biolabs) with custom Nextera PCR primers.
- the first PCR was performed with 50pl volume and 6 cycles using NEB Next 2x master mix and 1.25pM custom primers; the second RT-PCR was in 15 ⁇ l volume for 20 cycles using 5 ⁇ l (10%) of the pre-amplified mix plus 0.125
- the amplified DNA library was purified with the MinElute PCR Purification Kit (28004, Qiagen) and eluted in 20 ⁇ l of 10 mM Tris-HCl (pH 8).
- the quality of the library was visualized using the Agilent DL 000 ScreenTape on the 2200 TapeStation System (Agilent Technologies).
- the ATAC-seq libraries were loaded onto the Illumina NextSeq 500 for 75-bp paired-end sequencing.
- the initial single-cell transcriptome data were processed at the Eukaryotic Single-Cell Genomics Facility at the Science for Life Laboratory in Sweden.
- the reads obtained were mapped to the mmlO build of the mouse genome (concatenated with transcripts for eGFP and the ERCC spike-in set) to obtain a count for each endogenous gene, spike-in and eGFP transcript per cell.
- Ribosomal RNA genes, ribosomal proteins and ribosomal pseudo-genes were filtered out.
- We found that cells lacking alignments that mapped to either eGFP or PDGFRb were clustered into a single cluster after unsupervised cell clustering (see below). Therefore, we decided to remove these cells and performed all analysis and clustering without considering these cells (17 cells).
- the Fastq files were processed with Alevin and Salmon (Alevin parameter -1 ISR, Salmon version 0.13.1) using gene code v29 human transcriptome and gene code vM20 mouse transcriptome as reference transcriptomes.
- the Alevin parameter "Expected Cells" was set equal to three times the number of cells estimated by the Knie method applied to the read counts per cell barcodes distribution. Therefore, the UMI count matrix generated by Alevin produced a large number of putative cells that we were later able to filter (see next section).
- RNA genes (0-1% average of detected RNA content per cell) and mitochondrial-encoded genes (0-80% average of detected RNA content per cell) from the main gene expression matrix. Mitochondrially encoded genes were removed to avoid introducing unwanted variations between cells solely from changes in mitochondrial content could depend.
- the loglO(total UMI counts per cell) distribution from the count matrix generated by Alevin typically showed a bimodal distribution, so loglO(total UMI counts per cell) were calculated using the R package mclust v5.4.3 clustered into two clusters with modelNames set to "E". Cells belonging to the cluster with the higher counts were retained.
- cells were filtered based on mitochondrial RNA content and preference for highly expressed genes as follows: (1) Cells were analyzed using a two-component bivariate Gaussian mixture scaled to loglO(total UMI counts per cell) and percent of mitochondrial UMI learned per cell were clustered into two clusters. Clustering was performed using the R package Mclust with modelNames set to "EU”. Cells that fell into the cluster with cells with higher mitochondrial content were excluded. This filtering step was only performed for libraries that showed a clear bimodal distribution of mitochondrial content (only three 10x libraries in this study). (2) The total number of UMIs per cell should correlate with the total number of unique genes recognized.
- Mitochondria-based filtering was not performed for CD10+ libraries because a high number of mitochondrial reads is expected from proximal tubular epithelial cell libraries. Note that not all filtering steps were performed for all libraries, as this depends on the quality of each library and the distribution of UMI cell genes.
- the experimental strategy involved obtaining separate libraries from CD 10+ and CD 10- cell fractions, which served to mitigate the class imbalance at the level of cell type coverage by the 1Ox Chromium protocol.
- Step 1 After quality control and cell filtering (see above), the cells in each 10x library were clustered separately and each cell cluster was assigned to one of 6 main cell types: CD 10+ epithelial, CD 10- epithelial, immune, endothelial, mesenchymal and neuronal cells.
- Step 2 For each of the 6 major cell types, cells from all 10x libraries were integrated together. Inter-cell variability caused by engineering was corrected and cells were clustered using unsupervised graphene clustering. This process resulted in 6 separate maps for endothelial cells, CD 10+ epithelial cells, CD 10- epithelial cells, mesenchymal cells, immune cells and nerve cells. Each map consists of cells from multiple 10x libraries.
- Step 3 We integrated 3 single-cell maps for: (1) CD10+ cells (proximal tubule/ Figure 1), (2) CD 10— cells (proximal tubule-depleted/ Figure 1), and (3) PDGFRb+ cells (mesenchymal/ Figure 2) by combining the single-cell expression (UMI counts) and clustering information from all major cell-type single maps of each data set from step 2. All diagrams in the manuscript are then reproducible from these 3 integrated maps.
- variable genes were determined using the Scran R package's decomposeVar function, after calling the trendVar function on the ERCC transcripts6. Genes with an FDR ⁇ 0.01 and a biological component of variance > 1 were retained as highly variable genes. With these variable genes, we followed the same clustering approach as described for the lOx Chromium data, but we performed only 2 clustering iterations and did not vary the number of nearest neighbors.
- the script used to analyze the mouse Smart-Seq2 data is available here: https://github.com/mahmoudibrahim/KidneyMap/blob/master/make_intergrated_maps/mouse PDGFRBpositive.r .
- a per-cluster gene ranking was generated using the sortGenes function in the R package genesorteR with the binarizeMethod set to "adaptiveMedian” (Smart-Seq2 data) or to "naive” (10x data).
- Smart-Seq2 data Smart-Seq2 data
- naive 10x data 10x data.
- a cell cluster can represent either a true cell type or another cell state.
- Integrated full-map UMAP projections ( Figures 1, 2, 3, 4, 5) were generated using the UMAP Python package (https://github.com/lmcinnes/umap) on the reduced corrected dimensions returned by fastMNN were generated with min dist set to 0.6 and the number of neighbors set to the square root of the number of cells.
- Local UMAP projections ( Figure 1, Figure 4) were generated by setting min dist to 1 as these parameters tend to result in more geometrically accurate embeddings (see https://umap-leam.readthedocs.io/en/latest/) .
- Diffusion maps were created using the Destiny R package (https://github.com/theislab/destiny), also using the fastMNN was used as input and the number of neighbors was set to the square root of the number of cells.
- the R package Slingshot was used for inference of family trees and inference of pseudo-time cell orders based on the UMAP/Diffusion Map projection.
- Cell clustering (Step 2 of the integration strategy, see above) was used as the input cell cluster. Starting and ending clusters were chosen based on reasonable expectation given our prior knowledge, as described in Street et al. discussed and recommended (e.g. myofibroblast is the end cluster in a pericyte/fibroblast/myofibroblast map).
- Genes whose expression varied with cell order were defined as those whose normalized expression correlated with cell order, quantified by Spearman's correlation coefficient at a Bonferroni-Hochberg-corrected p-value cutoff of 0.001.
- Gene clusters and expression heatmaps (e.g. Fig. 2f-top) were generated by arranging the cells along the pseudo-time predicted by SlingShot and using the genesortR function plotMarkerHeat. This function clusters genes using the k-means algorithm, and we have set the plot and clustering to average every 10 cells along pseudo-time. Pathway enrichment and cell cycle analyzes were calculated by clustering all 2000 cells along pseudotime.
- KEGG pathway and PID pathway downloaded from MSigDB 327,28 in November 2019 as ".gmt" files.
- Pathway enrichment analysis was performed with the clusterProfiler R package using the top 100 genes for each cell cluster/cell group as defined by the sortGenes function from the genesortR package. The enricher function was used, setting minGSSize to 10 and maxGSize to 200. The top 5 terms by q-value for each cell cluster/group were plotted as heatmaps of -loglO(q-value).
- the Gene Ontology Biological Process analysis was performed for the top 200 genes using the same method. The enricher function was used with minGSSize set to 100 and maxGSize set to 500.
- Scaled gene expression heatmaps as shown in Figure 2d were generated using the plotMarkerHeat and plotTopMarkerHeat functions in the R package genesorteR.
- the heatmaps for the proportion of cells expressed, as shown in Figure 3d, were generated using the plotBinaryHeat function from the genesortR R package.
- Heatmaps, the log2 -fold-changes and Feature enrichments as shown in Figure 5j,k were created using the ComplexHeatmap R package (v. 2.4.2).
- STAR version 2.7.0e was used to map ATAC-Seq reads to the mmlO genome assembly, keeping only uniquely mapped pairs (settings: alignEndsType EndToEnd, alignlntronMax 1, alignMatesGapMax 2000, alignEndsProtrude 100 ConcordantPair, outFilterMultimapNmax 1, outFilterScoreMinOverLread 0.9, outFilterMatchNminOverLread 0.9).
- JAMM version 1.0.7rev5
- ATAC-Seq Signal Bigwig files were generated using the JAMM SignalGenerator pipeline (settings: -f 38,38 -n depth).
- each open chromatin ATAC-Seq peak was assigned to a gene corresponding to the closest annotated transcription start site using the bedtools closest function, using 100 kb as the maximum possible assignment distance.
- ATAC-Seq peak ranking per scRNA-Seq cluster was determined by ranking peaks according to the ranking of their associated gene in the single-cell RNA-Seq cluster.
- the top 2000 ATAC-Seq peaks for each scRNA-Seq cluster were selected and XXmotif was used for de novo motif search for each scRNA-Seq cluster and each open chromatin region separately (settings: — revcomp — merge- motif threshold MEDIUM).
- the resulting network was drawn as an undirected network (since the regulators are not known beforehand) using the ggraph package (https://cran.r-project.org/web/packages/ggraph/index.html) and labeled with the Louvain Algorithm implemented in igraph package clustered in 4 modules.
- CellPhoneDB (v.2.1.1) was used to estimate cell-cell interactions between the cell types found in the human CDIO fraction. Version 2.0.0 of the database and normalized gene expression were used as input, with default parameters (10% of cells expressing the ligand/receptor). Interactions with a p-value ⁇ 0.05 were considered significant. Only ligand-receptor interactions where only and at least one partner of the interacting pair was a receptor were considered based on the annotation from the database, discarding receptor-receptor and other interactions without a clear receptor.
- Ligand-receptor interactions from signaling pathways involved in renal fibrosis were identified using membership from the KEGG database for Hedgehog, Notch, TGFb and WNT signaling and the REACTOME database for EGFR signaling from MSigDB 3 and manual curation for PDGF signaling.
- Gene expression was quantified at the transcriptional level using Salmon vl.1.0 with the parameters — validatMappings and — gcBias turned on for the human gene code v29 transcriptome.
- the transcript-level counts were aggregated to gene-level counts with the import in the R package tximport, with countsFromAbundance set to "lengthScaledTPM”.
- the R-package Limma (v.3.44.1) was used to test for differential gene expression between Nkd2-disrupted human kidneys PDGFRb+ compared to their control after Voom transformation by empirical Bayesian method.
- Example 2 Single cell atlas of human chronic kidney disease
- Cell cycle analysis of the CD10+ proximal tubular cell clusters showed an increased Cyclization in CKD, likely reflecting an epithelial repair response (Fig. lg)
- Fig. lh Fatty acid metabolism has been described as one of the major dysregulated pathways in human and mouse kidneys, causing tubular dedifferentiation and fibrosis (Kang et al. 2015).
- Example 3 Origin of extracellular matrix in human chronic kidney disease
- ECM extracellular matrix
- ECM epithelial mesenchymal transition
- Example 4 Different pericyte and fibroblast subpopulations are the main source of myofibroblasts in human renal fibrosis
- Pseudo-time trajectory and diffusion map analyzes of the major ECM-expressing cellular subtypes from the PDGFRb+ populations revealed three Major sources of myofibroblasts in human kidneys: 1) Notch3+/RGS5+/PDGFRa- pericytes, 2) Meg3+/PDGFRa+ fibroblasts, and 3) Colecl I+/CXCL12+ fibroblasts (Fig. 2e).
- the diffusion mapping locates the non-CKD cells primarily within the low ECM-expressing pericytes and fibroblast populations, suggesting a potential differentiation pathway from low-ECM, non-CKD mesenchymal cells (pericytes and fibroblasts) to high-ECM CKD myofibroblasts (Fig. 2e).
- TGFb signaling was predominant in lineage 2 pseudotime analysis (Figure 2g).
- Myofibroblast 1 which probably represents fully differentiated myofibroblasts, expressed high levels of TGFb ligands and lower levels of TGFb receptors.
- the opposite was observed for fibroblast 1, suggesting a mechanism by which myofibroblasts can promote fibroblast differentiation.
- API activator protein 1
- Postn osteoglycin
- API acts as a suppressor could work.
- ligand-receptor analyzes Efremova et al. 2020 to clarify which cell types interact with the main ECM-expressing mesenchymal cells (fibroblasts, pericytes and myofibroblasts). While we observed that the fewest signals originated from healthy proximal tubular epithelium, injured proximal tubular epithelium was among the top signaling partners of the mesenchyme, consistent with tubular-interstitial signaling as a hallmark of renal fibrosis (Venkatachalam et al 2015).
- Example 5 Dual-positive PDGFRa+/PDGFRb+ mesenchymal cells represent the majority of ECM-expressing cells in human and mouse renal fibrosis
- Example 6 PDGFRa+/PDGFRb+ cells are heterogeneous and contain different fibroblast cell stages
- UMAP embedding of PDGFRa+/PDGFRb+ cells revealed four major, distinct populations corresponding to mesenchyme (fibroblasts and myofibroblasts), epithelial, endothelial, and immune cells (Fig. 4c-d). All of these cell types have previously been discussed as possible cellular origins of renal fibrosis (Duffield et al 2014; Wang et al 2017; Kramann et al 2018). Notably, we could not detect undifferentiated pericytes in these PDGFRa+/PDGFRb+ data, since human and mouse pericytes are PDGFRa- (Fig. 2e, 3g).
- Non-mesenchymal cells expressed significantly less PDGFRb, PDGFRa, ECM and collagen than mesenchymal cells (Fig. 4d-e), supporting the observation in our human data that non-mesenchymal cells contribute to the scar formation process to a small extent (Fig. 1,2 ).
- the computationally derived doublet scores do not indicate that these matrix-expressing non-mesenchymal cell populations are likely doublets.
- fibroblast 1 characterized by Scara5 and Meg3 expression
- myofibroblast consisting of different myofibroblast subpopulations Fig. 4c- d.
- myofibroblasts 1 correspond to the terminally differentiated myofibroblasts with the highest ECM expression, preceded in the pseudodifferentiation time by myofibroblasts 2 (Ogn+), while fibroblasts 1 appear as a "progenitor" population of non-activated fibroblasts (Fig. 2e) .
- the fibroblast 1 cells in the PDGFRa+/PDGFRb+ data can be distinguished from the myofibroblasts by three main features: First, Coll5al, a myofibroblast-specific collagen in mice (Fig. 3g), was expressed at a lower level in the fibroblast 1 than in the myofibroblast cluster (Fig. 4f). Second, although Meg3 is also expressed in a fraction of the proximal tubular cells and glomerular endothelium, it was only detected in fibroblasts 1 within the mesenchymal populations (Fig. 4d). We confirmed the presence of a Meg3+ PDGFRa+/PDGFRb+ mesenchymal subpopulation in human kidneys by in situ hybridization (Fig. 4h-i), suggesting the presence of a fibroblast 1-like subpopulation in human kidneys suggests. Third, the fibroblast 1 cells are Scara5+ but Frzb-, again showing that they are distinct from myofibroblasts.
- fibroblast 1 was generated as a distinct fibroblast population.
- This analysis suggested fibroblast 1 (Meg3+, Scara5+) and myofibroblast 2 (Coll4al+, Ogn+) as early states, myofibroblast 3a as intermediate states, and myofibroblast la (Nrp3+, Nkd2+), 1b (Grem2+), and 3b (Frzb+) as terminal states ( Fig. 4j).
- fibroblast 1 and myofibroblast 2 are the main source of myofibroblasts in mouse renal fibrosis.
- Myofibroblasts 2 (Ogn+/Coll4al+) could exist in healthy mouse kidneys or arise as an intermediate state through differentiation of pericytes into myofibroblasts (Fig. 2e, human data).
- the expression of angiotensin receptor 1 (AGTRla) is enriched in myofibroblasts 2 and could indicate their pericyte origin (Fig. 4j).
- myofibroblasts 1 Pdgfrb+/Pdgfra+/Postn+ high ECM-expressing myofibroblasts (referred to as myofibroblasts 1 in this manuscript) derived from Pdgfrb+/Pdgfra-/Notch3+ pericytes, Pdgfrb+/Pdgfra+/ Scara5+ fibroblasts (fibroblast 1) and Pdgfrb+/Pdgfra+/Cxcll2+ fibroblasts (fibroblast 2) arise.
- Pericytes potentially differentiate into myofibroblasts 1 via an intermediate ECM-expressing Pdgfrb+/Pdgfra+/Ogn+/Coll4al+ state (myofibroblasts 2).
- Example 7 Different fibroblast and myofibroblast states are distinguished by specific transcription factor regulatory programs
- Myofibroblasts la differed from myofibroblasts 1b and showed an accumulation of ATF.
- Myofibroblasts 2 and 3b showed accumulation of the orphan receptor NRF4A1, previously reported to be an important regulator of TGFb signaling and fibrosis (Palumbo-Zerr et al 2015).
- Fibroblasts 1 showed enrichment of AP-1 (JunZFos) motifs ( Figure 4k), consistent with their putative role described in our human data. RNA expression of these factors selected by ATAC-Seq is consistent with the enrichment of sequence motifs ( Figure 4k) and highlights divergent transcriptional regulation between fibroblast 1, myofibroblast 2, and other myofibroblast populations.
- fibroblast 1 and myofibroblasts are distinct populations with different enriched signaling pathways ( Figure 41). Therefore, fibroblast 1 and myofibroblast subtypes are likely distinct ECM-expressing mesenchymal cell types harboring specific transcription factor regulatory programs.
- Nkd2 is required for collagen expression in human kidney PDGFRb+ cells and is a potential therapeutic target in renal fibrosis
- scRNA-seq data we generated could be used to identify potential therapeutic targets in human renal fibrosis.
- Nkd2 is specifically expressed in Pdgfra+/Pdgfrb+ terminally differentiated mouse myofibroblasts (Fig. 5a), such that Nkd2/PDGFRa dual-positive cells accounted for >40% of all Collal+ cells (Fig. 5b).
- NKD2 is a marker for myofibroblasts with high ECM content, with its expression positively correlating with Postn and ECM expression and anticorrelating with genes associated with pericytes and fibroblasts (Fig. 5c). Furthermore, NKD2+ myofibroblasts were associated with increased TGFb, Wnt, and TNFa pathway activity compared to NKD2 cells.
- TMA human kidney tissue microarray
- a subpopulation of human PDGFRa/PDGFRb expressing cells also expresses Nkd2 (Fig. 5d-e).
- the abundance of PDGFRa/PDGFRb/Nkd2 co-expressing cells was higher in patients with more severe interstitial fibrosis (Fig. 5e).
- Nkd2 has been documented as a Wnt signaling pathway and TNFa modulator (Zhao et al 2015; Hu and Li 2010; Hu et al 2010; Li et al 2004).
- we used our human PDGFRb+ data to predict a gene regulatory network focused on genes correlated with Nkd2 using the GRNboost2 framework.
- the resulting network was organized into 4 gene regulatory modules, including ribosomal proteins (module 1), genes associated with ECM expression (module 2), genes associated with pericytes (module 3), and genes associated with non-activated fibroblasts connections (module 4).
- this gene cluster contains various Wnt modulators and effectors such as Kif26b, Lefl, and Wnt4 in addition to Nkd2.
- Nkd2 is placed with ECM genes and is linked to Etvl and Lamp5, and indirectly through Lamp5 to Coll al. This analysis suggests a possible mechanism by which Nkd2 is regulated by Etvl (a member of the Ets factor family) and acts by affecting paracrine signaling through Lamp5.
- Nkd2 Lentiviral overexpression of Nkd2 in our human PDGFRb cell line resulted in increased expression of key pro-fibrotic ECM molecules such as collal and fibronectin in response to TGFb (Fig. 5f-g).
- the CRISPR/Cas9 knockout of Nkd2 resulted in a significant reduction in the expression of collal, fibronectin and ACTA2 in the presence or absence of TGFb (Fig. 5h-i).
- RNA-seq from cells overexpressing Nkd2 showed upregulation of ECM regulators and ECM glycoproteins, while RNA-seq from Nkd2 knockout clones showed loss of ECM regulators, ECM glycoproteins and collagens (Fig. 5j) .
- iPSC induced pluripotent stem cell
- Example 9 Screening for drugs that bind to and/or inhibit NDK2 protein
- Screening experiments allow for the identification and validation of small molecule therapeutic compounds, peptides and/or biologics that bind to and/or inhibit the activity of the NKD2 protein.
- DNA-encoded substance libraries are generated and screened as described (Kunig et al. 2018).
- recombinant NKD2 protein or fragments thereof which carry a His tag are expressed in E. coli, insect cells or mammalian cells.
- the purified NKD2 protein is incubated with the compound library and isolated by immunoprecipitation.
- Compounds bound to the NKD2 protein are identified by Sanger sequencing of DNA barcodes.
- the identified compounds are then tested for their effect on the function of NKD2, the Differentiation of myofibroblast cells, the expression and secretion of matrix proteins such as collagen 1, and the development of renal fibrosis were tested.
- experimental mouse in vivo models of renal fibrosis are used.
- a human cell-based in vitro fluorochrome reporter system will be established, for example monitoring the expression of the eGFP-NKD2 Fusion protein or a luciferase-based reporter system is used to screen compound libraries in 384- to 1,536-well assays for the identification of compounds that reduce eGFP fluorescence or luciferase levels as a readout.
- the expression of these human NKD2 fusion reporter constructs in said cells can, for. B. by transfection and selection via resistance gene cassettes or by viral transduction.
- VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA-4/fibronectin binding site.
- Proximal tubular cells contain a phenotypically distinct, scattered cell population involved in tubular regeneration. J Pathol. 229, 645-659 (2013).
- Wilson PC et al. The Single Cell Transcriptomic Landscape of Early Human Diabetic Nephropathy. doi:10.1101/645424. Wu, H. et al. Single-Cell Transcriptomics of a Human Kidney Allograft Biopsy Specimen Defines a Diverse Inflammatory Response. J.Am. society nephrol. (2016) doi:10.1681/ASN.2018020125.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Urology & Nephrology (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE102020128677.5A DE102020128677A1 (de) | 2020-10-30 | 2020-10-30 | Ein neues Target zur Behandlung der Nierenfibrose |
| PCT/EP2021/080068 WO2022090434A1 (de) | 2020-10-30 | 2021-10-28 | Nkd2 als target zur behandlung von nierenfibrose |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4237078A1 true EP4237078A1 (de) | 2023-09-06 |
Family
ID=78528918
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP21802638.3A Pending EP4237078A1 (de) | 2020-10-30 | 2021-10-28 | Nkd2 als target zur behandlung von nierenfibrose |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20240391985A1 (enExample) |
| EP (1) | EP4237078A1 (enExample) |
| JP (1) | JP2023549706A (enExample) |
| KR (1) | KR20230098243A (enExample) |
| CN (1) | CN116783210A (enExample) |
| CA (1) | CA3195914A1 (enExample) |
| DE (1) | DE102020128677A1 (enExample) |
| WO (1) | WO2022090434A1 (enExample) |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6548640B1 (en) | 1986-03-27 | 2003-04-15 | Btg International Limited | Altered antibodies |
| US5859205A (en) | 1989-12-21 | 1999-01-12 | Celltech Limited | Humanised antibodies |
| WO2000049034A1 (en) | 1999-02-17 | 2000-08-24 | The Board Of Trustees Of The Leland Stanford Junior University | Naked cuticle genes and their uses |
| AU2003207708A1 (en) * | 2002-02-20 | 2003-09-09 | Sirna Therapeutics, Inc. | Rna interference mediated inhibition of map kinase genes |
| DE202007018529U1 (de) | 2007-07-07 | 2008-12-04 | Chamalow S.A. | Implantierbarer Funkfrequenzdefibrillator R.F. |
| WO2015120257A2 (en) * | 2014-02-06 | 2015-08-13 | The Brigham And Women's Hospital, Inc. | Uses of gli1 in detecting tissue fibrosis |
-
2020
- 2020-10-30 DE DE102020128677.5A patent/DE102020128677A1/de active Pending
-
2021
- 2021-10-28 KR KR1020237017649A patent/KR20230098243A/ko active Pending
- 2021-10-28 JP JP2023526269A patent/JP2023549706A/ja active Pending
- 2021-10-28 CN CN202180087798.6A patent/CN116783210A/zh active Pending
- 2021-10-28 US US18/249,694 patent/US20240391985A1/en active Pending
- 2021-10-28 CA CA3195914A patent/CA3195914A1/en active Pending
- 2021-10-28 EP EP21802638.3A patent/EP4237078A1/de active Pending
- 2021-10-28 WO PCT/EP2021/080068 patent/WO2022090434A1/de not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| US20240391985A1 (en) | 2024-11-28 |
| CN116783210A (zh) | 2023-09-19 |
| DE102020128677A1 (de) | 2022-05-05 |
| JP2023549706A (ja) | 2023-11-29 |
| KR20230098243A (ko) | 2023-07-03 |
| CA3195914A1 (en) | 2022-05-05 |
| WO2022090434A1 (de) | 2022-05-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Konkimalla et al. | Transitional cell states sculpt tissue topology during lung regeneration | |
| Chen et al. | Type I collagen deletion in αSMA+ myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer | |
| Rock et al. | Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition | |
| Rinon et al. | p53 coordinates cranial neural crest cell growth and epithelial-mesenchymal transition/delamination processes | |
| Bryant et al. | Identification of regenerative roadblocks via repeat deployment of limb regeneration in axolotls | |
| Sciascia et al. | Renal fibrosis in lupus nephritis | |
| Larouche et al. | Murine muscle stem cell response to perturbations of the neuromuscular junction are attenuated with aging | |
| Chen et al. | Cross-species single-cell analysis uncovers the immunopathological mechanisms associated with IgA nephropathy progression | |
| Duerr et al. | A constitutively expressed fluorescent ubiquitination-based cell-cycle indicator (FUCCI) in axolotls for studying tissue regeneration | |
| Hagiwara et al. | RAGE deletion confers renoprotection by reducing responsiveness to transforming growth factor-β and increasing resistance to apoptosis | |
| JP2025090705A (ja) | 心筋線維化の処置のためのαV-インテグリン(CD51)阻害剤の使用 | |
| JP2019520074A (ja) | 操作された心筋細胞およびその使用 | |
| JP2022546253A (ja) | 細胞外マトリクスの調節 | |
| Zhu et al. | Biomimetic topological micropattern arrays regulate the heterogeneity of cellular fates in lung fibroblasts between fibrosis and invasion | |
| Zhou et al. | Single‐Cell Analysis Reveals Fibroblast‐Derived Migrasomes as CXCL12 Carriers Promoting Skin Wound Repair | |
| WO2022090434A1 (de) | Nkd2 als target zur behandlung von nierenfibrose | |
| WO2024121113A1 (de) | Adamts12 als zielmolekül zur behandlung chronischer niereninsuffizienz und nierenfibrose | |
| WO2004005540A2 (de) | Verwendungen von an ngal bindenden substanzen zur diagnose und behandlung von krebserkrankungen | |
| JP2023515681A (ja) | 線維症を予防するための線維芽細胞の活性化調節 | |
| US20240165195A1 (en) | Use of alpha-v-integrin (cd51) inhibitors for the treatment of cardiac fibrosis | |
| Sato et al. | β-III tubulin identifies anti-fibrotic state of pericytes in pulmonary fibrosis | |
| KR102698088B1 (ko) | Ctcf매개 전사체 응축 촉진용 조성물 | |
| Li et al. | Skeletal Muscle Stem Cells Modulate Niche Function in Duchenne Muscular Dystrophy through YY1-CCL5 Axis | |
| Melica | Glomerular crescents derive from hyperplasia of single progenitors and drug enhancing their differentiation into podocytes attenuates crescentic glomerulonephritis | |
| Hsu | Co-opted Functions of the SIX1 Homeobox Transcription Factor Maintain Myoblastic Programs in Fusion-Negative Rhabdomyosarcoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20230526 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |