EP4146690A1 - Antibodies against sars-cov-2 - Google Patents

Antibodies against sars-cov-2

Info

Publication number
EP4146690A1
EP4146690A1 EP21729694.6A EP21729694A EP4146690A1 EP 4146690 A1 EP4146690 A1 EP 4146690A1 EP 21729694 A EP21729694 A EP 21729694A EP 4146690 A1 EP4146690 A1 EP 4146690A1
Authority
EP
European Patent Office
Prior art keywords
seq
amino acid
antibody
antigen
less
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP21729694.6A
Other languages
German (de)
English (en)
French (fr)
Inventor
Davide Corti
Matteo Samuele PIZZUTO
Dora PINTO
Martina BELTRAMELLO
Anna De Marco
Elisabetta CAMERONI
Gyorgy Snell
Nadine CZUDNOCHOWSKI
Colin HAVENAR-DAUGHTON
Florian A. Lempp
Amalio Telenti
Fabrizia ZATTA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vir Biotechnology Inc
Original Assignee
Vir Biotechnology Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vir Biotechnology Inc filed Critical Vir Biotechnology Inc
Publication of EP4146690A1 publication Critical patent/EP4146690A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507—Comprising a combination of two or more separate antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41—Glycosylation, sialylation, or fucosylation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/72—Increased effector function due to an Fc-modification
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • Figures 1A-1D show binding of certain antibodies to SARS-CoV-2 Spike protein RBD and SARS-CoV-1 Spike protein RBD.
  • Human monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were recombinantly expressed and tested for RBD binding by ELISA.
  • Figure 1 A shows binding of five antibodies
  • Figure IB and Figure 1C each show binding of seven antibodies
  • Figure ID shows binding of four antibodies.
  • Two antibodies in the top panel of Figure IB are shown using black symbols.
  • S2X28 binding is represented by a line that stays at or near zero OD for the full range of concentrations tested.
  • S2X41 binding is represented by the curve with an EC50 of approximarely 20.01 ng/ml.
  • Figures 5A-5D show results from neutralization of infection assays using further antibodies against SARS-CoV-2 pseudotyped virus. Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested in neutralization assays (one antibody per assay) against murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein.
  • Figures 5A and 5C each show results for three antibodies.
  • Figure 5B shows results for two antibodies and Figure 5D shows results for four antibodies. Antibodies were tested at concentrations as indicated on the x-axis. Boxes on the right side of each figure, where present, show the calculated EC50 for the indicated antibody.
  • FIGS 6A and 6B show results from neutralization of infection assays using monoclonal antibodies against authentic SARS-CoV-2 virus.
  • Comparator antibody "S309-v2" comprises the VH amino acid sequence set forth in SEQ ID NO.: 342 and the VL amino acid sequence set forth in SEQ ID NO.: 346 (CDRH1-H3 and L1-L3 as set forth in SEQ ID NOs.:343-345 and 347-349, respectively), and is an engineered variant of an antibody isolated from a patient who recovered from SARS-CoV-1 infection.
  • Vero E6 cells cultured in DMEM supplemented with 10% FBS (VWR) and lx Penicillin/Streptomycin (Thermo Fisher Scientific) were seeded in white 96-well plates at 20,000 cells/well and attached overnight.
  • Serial 1:4 dilutions of the antibodies were incubated with 200 pfu of SARS-CoV-2 (isolate USA-WA1/2020, passage 3, passaged in Vero E6 cells) for 30 minutes at 37°C in a BSL-3 facility. Cell supernatant was removed and the virus-antibody mixture was added to the cells.
  • Figures 7A-7D show results from neutralization of infection assays using further antibodies against SARS-CoV-2 pseudotyped virus.
  • Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested in neutralization assays against murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein.
  • MLV murine leukemia virus
  • Figures 8A and 8B show binding of antibodies to SARS-CoV-2 Spike protein RBD and SARS-CoV-1 Spike protein RBD. Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested for RBD binding by ELISA.
  • Figure 8A shows binding of five antibodies and one comparator antibody, S309 (VH amino acid sequence of SEQ ID NO.: 139, VL amino acid sequence of SEQ ID NO.: 143; CDRH1-H3 and L1-L3 as set forth in SEQ ID NOs.: 140-142 and 144-146, respectively), isolated from a patient who recovered from SARS-CoV-1 infection.
  • Figure 8B shows binding of four antibodies and S309. In each of Figures 8 A and 8B, the left panel shows binding to SARS-CoV-2 RBD and the right panel shows binding to SARS-CoV-1 RBD. The boxes on the right side of each panel indicate the calculated EC50 value for the indicated antibody.
  • Figures 9A-9F show results from neutralization of infection assays using antibodies against SARS-CoV-2 pseudotyped virus.
  • Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested in neutralization assays against murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein.
  • Antibodies were tested at concentrations as indicated on the x-axis. Calculated IC50, IC80, and IC90 values (expressed as ng/ml) are shown below the graph in each figure.
  • FIGS 10A-10E show binding of antibodies to SARS-CoV-2 Spike protein RBD and SARS-CoV-1 Spike protein RBD (SARS-CoV-1 Spike protein RBD being labeled "SAR.S RBD" in the lower graph in each figure).
  • SARS-CoV-1 Spike protein RBD being labeled "SAR.S RBD" in the lower graph in each figure.
  • Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested for RBD binding by ELISA.
  • the top panel shows binding to SARS-CoV-2 RBD and the bottom panel shows binding to SARS-CoV-1 RBD.
  • the boxes on the right side of each figure, where present, show the calculated EC50 value for the indicated antibody.
  • Figures 11A-11D show results from neutralization of infection assays using certain monoclonal antibodies.
  • Antibodies were tested in neutralization assays against murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein.
  • Figure 11 A shows results for monoclonal antibodies S2X193 and S2X195.
  • Figure 1 IB shows results for monoclonal antibodies S2X219 and S2X244.
  • Figure 11C shows results for monoclonal antibodies S2X246 and S2X256.
  • Figure 1 ID shows results for monoclonal antibody S2X278.
  • the x-axis shows the total concentration of antibody. Calculated IC50, IC80, and IC90 values (expressed as ng/ml) are shown in the box on the right side of each figure.
  • Figures 12A-12D show results from neutralization of infection assays using certain monoclonal antibodies. Antibodies were expressed recombinantly and tested in neutralization assays against vesicular stomatitis virus (VSV) pseudotyped with SARS- CoV-2 Spike protein.
  • Figure 12A shows results for monoclonal antibodies S2X193 and S2X195, along with comparator antibody S2X190.
  • Figure 12B shows results for monoclonal antibody S2X219.
  • Figure 12C shows results for monoclonal antibodies S2X244, S2X246, and S2X256.
  • Figure 12D shows results for monoclonal antibodies S2X269 and S2X278. Antibodies were tested at concentrations indicated on the x-axis. Calculated IC50 and IC90 values (expressed as ng/ml) are shown at the bottom of each figure.
  • Figures 13A and 13B show the ability of certain monoclonal antibodies to inhibit binding by SARS-CoV-2 RBD to human ACE2.
  • ELISA plates were coated with recombinant human ACE2 at 2 ⁇ g/ml in PBS.
  • Serial dilutions of monoclonal antibodies were incubated with SARS-CoV-2 RBD at 20 ng/ml (RBD fused with mouse Fc, from Sino Biological) for 30 minutes at 37°C and then transferred onto the ACE2- coated plates for an additional 20 minute incubation at room temperature. Eleven serial dilutions were used, starting at 10 ⁇ g/ml and diluting at 1:3.
  • FIG. 13 A shows results for monoclonal antibodies S2X193 and S2X195, along with four comparator antibodies.
  • Figure 13B shows results for monoclonal antibodies S2X219, S2X244, S2X246, S2X256, S2X269, and S2X278. Calculated IC50 values are shown at or to the right of the graph in each figure.
  • Figures 14A-14H show binding affinity and avidity of certain monoclonal antibodies of the present disclosure to SARS-CoV-2 RBD, as measured by Octet.
  • Antibody (as indicated at the bottom-right of each figure) was loaded on Protein A pins at 2.7 ⁇ g/ml.
  • SARS-CoV-2 RBD was loaded for 5 minutes at 6 ⁇ g/ml, 1.5 ⁇ g/ml, or 0.4 ⁇ g/ml.
  • Dissociation was measured for 7 minutes.
  • the vertical dashed line in each figure indicates the start of the dissociation phase.
  • Figure 15 shows binding affinity and avidity of monoclonal antibodies S2X219 (first panel) and S2X193, S2X195, S2X244, S2X246, S2X256, S2X269, and S2X278, along with four comparator antibodies (second panel), to SARS-CoV-1 RBD as measured by Octet.
  • Antibody was loaded on Protein A pins at 2.7 ⁇ g/ml.
  • SARS-CoV- 1 RBD was loaded for 5 minutes at 6 ⁇ g/ml.
  • Dissociation was measured for 7 minutes.
  • the vertical dashed line in each graph indicates the start of the dissociation phase.
  • the order of the curves curves corresponds to the antibodies listed to the right of the graph (top to bottom).
  • the top curve corresponds to S2X127 and the bottom curve corresponds to S2X278.
  • Figures 16A-16D show neutralization of SARS-CoV-2 infection by certain monoclonal antibodies, as assessed by inhibition of nucleocapsid (NP) expression at 24 hours post infection.
  • Figure 16A shows neutralization of SARS-CoV-2 infection by monoclonal antibodies S2N22, S2N12, S2N28, S2N25, S2H58-v2, along with comparator antibody S309-v2 (VH amino acid sequence of SEQ ID NO.:342, VL amino acid sequence of SEQ ID NO.:346; CDRH1-H3 and L1-L3 as set forth in SEQ ID NOs.:343-345 and 347-349, respectively).
  • Figure 16B shows neutralization of SARS-CoV-2 infection by monoclonal antibodies S2E9, S2E6, S2E13, S2K4, S2E14, S2E7, and S2E12 (VH amino acid sequence of SEQ ID NO.:399, VL amino acid sequence of SEQ ID NO.:403; CDRH1-H3 and L1-L3 as set forth in SEQ ID NOs.:400, 766, 402 and 404-406, respectively), along with comparator antibody S309-v2.
  • Figure 16C shows neutralization of SARS-CoV-2 infection by monoclonal antibodies S2H37, S2H73, S2H40, S2H70, and S2H71, along with comparator antibody S309-v2 (with M428L/N434S Fc mutations).
  • Figure 16D shows neutralization of SARS-CoV-2 infection by monoclonal antibodies S2X30, S2H58-vl, S2H66, S2H62, and S2H30, along with comparator antibody S309-v2. Calculated IC50 values are shown below each graph.
  • Figures 17A-17C show results from neutralization of infection assays using certain monoclonal antibodies.
  • Figure 17A shows results for monoclonal antibodies S2M11 and S2M28.
  • Figure 17B shows results for monoclonal antibody S2M16.
  • Figure 17C shows results for monoclonal antibodies S2M7 and S2L49. Antibodies were tested in neutralization assays against murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein. The x-axis shows the total concentration of antibody. Calculated IC50, IC80, and IC90 values (expressed as ng/ml) are shown in the box below each graph.
  • MMV murine leukemia virus
  • Figures 18A-18E show binding of certain monoclonal antibodies to SARS- CoV-2 Spike protein, SARS-CoV-2 Spike protein RBD, SARS-CoV-1 Spike protein, and SARS-CoV-1 Spike protein RBD.
  • Antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested for Spike and Spike RBD binding by ELISA.
  • the boxes on the right side of each figure show calculated EC50 values (expressed as ng/ml).
  • Figures 19A-19E show results from neutralization of infection assays using certain monoclonal antibodies. Antibodies were tested in neutralization assays against murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein.
  • Figure 19A shows results for monoclonal antibodies S2X149 and S2X179.
  • Figure 19B shows results for monoclonal antibody S2D65.
  • Figure 19C shows results for monoclonal antibody S2D97.
  • Figure 19D shows results for monoclonal antibody S2D106.
  • Figure 19E shows results for monoclonal antibody S2H101. The x-axis shows the total concentration of antibody.
  • Figures 20A and 20B show binding of human monoclonal antibody S2X149 and comparator antibody S309-v2 LS (VH amino acid sequence of SEQ ID NO.:342, VL amino acid sequence of SEQ ID NO.:346; CDRH1-H3 and L1-L3 as set forth in SEQ ID NOs.:343-345 and 347-349, respectively; expressed as rlgGl with M428L and N434S Fc mutations) to SARS-CoV-1 Spike protein, SARS-CoV-1 Spike protein RBD, and SARS-CoV-2 Spike protein RBD.
  • Figure 20A shows binding of antibodies to SARS-CoV-1 Spike protein RBD (top panel) and SARS-CoV-1 Spike protein (bottom panel).
  • Figure 20B shows binding of antibodies to SARS-CoV-2 Spike protein RBD (top panel) and to an uncoated control plate (bottom panel). The boxes to the right of the graphs show calculated EC50 values.
  • Figures 21A and 21B show binding of human monoclonal antibody S2X179 and comparator antibody S2X200 to SARS-CoV-1 Spike protein, SARS-CoV-1 Spike protein RBD, and SARS-CoV-2 Spike protein RBD. Human monoclonal antibodies were expressed recombinantly and binding was tested by ELISA.
  • Figure 21 A shows binding of antibodies to SARS-CoV-1 Spike protein RBD (top panel) and SARS-CoV- 1 Spike protein (bottom panel).
  • Figure 21B shows binding of antibodies to SARS- CoV-2 Spike protein RBD (top panel) and to an uncoated control plate (bottom panel).
  • the box to the right of the top graph in Figure 21B shows calculated EC50 values for binding SARS-CoV-2 RBD.
  • Figures 22A and 22B show binding of human monoclonal antibodies S2H101, S2D65 (22A), S2D97, and S2D106 (22B) to SARS-CoV-2 Spike protein RBD. Antibodies were expressed recombinantly and binding was tested by ELISA. The boxes to the right of the graphs show calculated EC50 values.
  • Figures 23A and 23B show antibody inhibition of binding by SARS-CoV-2 RBD to human ACE2, as measured by ELISA.
  • Figure 23 A shows results for monoclonal antibody S2X149.
  • Figure 24B shows results for monoclonal antibody S2X179 and comparator antibody S2X200. Calculated IC50 values are shown to the right of each graph.
  • Figure 24 summarizes results of quantitative epitope-specific serology studies using monoclonal antibody S309 and other anti-Spike antibodies, as determined by binding competition, cryo-EM, and crystallography data. Underlined antibodies are cross-reactive with SARS-CoV-1.
  • Figures 25A and 25B show neutralization of SARS-CoV-2 infection by certain monoclonal antibodies.
  • Figure 25A shows results for four antibodies of the present disclosure, along with comparator antibodies S309 N55Q LS and S2X193.
  • S309 N55Q LS comprises the VH amino acid sequence set forth in SEQ ID NO:342 and the VL amino acid sequence set forth in SEQ ID NO: 346, and comprises an MLNS modification in the Fc region.
  • Figure 25B shows results for antibodies S2X129 and S2X132, along with four comparator antibodies. Calculated IC50 values are shown in the boxes below each graph. Calculated EC50 and EC90 values are shown at the bottom of each figure.
  • Figure 27 shows neutralization of infection by live SARS-CoV-2 by certain monoclonal antibodies. Data are from triplicate wells SARS-CoV-2-luc, MOI 0.1, 6h infection.
  • Figures 29A and 29B show binding (ELISA) of certain antibodies to SARS- CoV-2 RBD and Spike protein.
  • Figures 30A and 30B show binding of certain antibodies against SARS-CoV-2 RBD, SARS-CoV-2 S protein, and SARS-CoV-1 RBD.
  • Figures 31A and 31B show binding of antibody S2D106 to SARS-CoV-2 RBD in the presence of different concentrations of AAPH (2,2'-azobis(2-amidinopropane) dihydrochloride) or after UV irradiation. Both AAPH and UV radiation are used to induce oxidation stress in the antibody.
  • Figure 31 A shows binding of S2D106 to RBD as measured by indirect ELISA.
  • Figures 32A-32C show neutralization of infection (pseudovirus particles) by S2E12 and engineered variants thereof (see Table 22 in Example 9 for VH and VL sequences of S2E12 antibodies).
  • Figure 32A and Figure 32B show results from two repetitions of the same experiment.
  • Figure 32C shows results for a third experiment using S2E12 and other variants thereof.
  • Figures 33A and 33B show binding of certain antibodies to SARS-CoV-2 RBD as measured by indirect ELISA.
  • Figure 33A shows results for eight antibodies.
  • Figure 33B shows the average of results from duplicate experiments for six antibodies.
  • Figures 34A and 34B show binding of certain antibodies to SARS-CoV-2 RBD as measured by sandwich ELISA.
  • Figure 34A shows results for eight antibodies.
  • Figure 34B shows the average of results from duplicate experiments for six antibodies.
  • Figure 35 shows neutralization of infection using live SARS-CoV-2 virus by five antibodies.
  • the curve labeled "S2E12-11” was generated using antibody present in the supernatant of CHO cells transformed to express S2E12 antibody.
  • the curve labeled "S2E12 wt” was generated using purified antibody produced in transformed HEK cells.
  • Figure 36 shows binding of certain antibodies to SARS-CoV-2 Spike protein expressed on the surface of CHO cells, as measured by flow cytometry.
  • the calculated EC50 values for each antibody are shown in the legend to the right of each antibody name.
  • the curve labeled "S2E12-11” was generated using antibody present in the supernatant of CHO cells transformed to express S2E12 antibody.
  • the curve labeled "S2E12” was generated using purified antibody produced in transformed HEK cells.
  • Figures 37A and 37B show neutralization of infection using pseudovirus particles by certain monoclonal antibodies.
  • Figure 37 A and Figure 37B show results from two repetitions of the same experiment.
  • Figures 38A and 38B show binding of certain antibodies to SARS-CoV-2 RBD. Binding of comparator antibody S309-14 (S309 with VH W105F mutation, having similar affinity to RBD as S309) is also shown. Figure 38A shows binding as measured by indirect ELISA. Figure 38B shows binding as measured by sandwich ELISA. Each of Figures 38A and 38B show the average of results from duplicate experiments.
  • Figures 39A and 39B show characteristics of certain engineered S2E12 antibodies as compared to parental monoclonal antibody S2E12 (S2E12 values indicated as "WT" on the y-axis). Comparative data were generated using the assays listed in the legend on the right of each figure.
  • Figure 40 shows characteristics of certain engineered S2D106 antibodies as compared to parental monoclonal antibody S2D106 (S2D106 values indicated as "WT" on the y-axis). Comparative data were generated using the assays listed in the legend on the right of each figure.
  • Figure 41 shows expression (immunofluorescence) of DC-SIGN/L-SIGN, DC- SIGN, and ACE2 transgenes in HEK293T cells engineered to overexpress the indicated protein(s). See Example 14.
  • Figure 42 shows VSV pseudovirus infection levels in wild-type HEK293T cells and in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, or ACE2.
  • the pseudovirus expressed a recombinant SARS-CoV-2 spike protein with luciferase reporter. See Example 14.
  • Figure 43 shows neutralization by monoclonal antibody S309 (VH of SEQ ID NO.: 139, VL of SEQ ID NO.: 143) of VSV pseudovirus infection in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, or ACE2.
  • antibody S309 includes M428L and N434S Fc mutations. See Example 14.
  • Figure 44 shows live SARS-CoV-2 infection levels in wild-type HEK293T cells and in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, or ACE2. Infection was determined using a recombinant S protein with luciferase reporter. See Example 14.
  • Figure 45 shows neutralization by monoclonal antibody S309 (VH of SEQ ID NO.:139, VL of SEQ ID NO.: 143) oflive SARS-CoV-2 infection in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, or ACE2.
  • antibody S309 includes M428L and N434S Fc mutations. See Example 14.
  • Figure 46 shows expression (immunofluorescence) of DC-SIGN/L-SIGN, DC- SIGN, SIGLEC1, and ACE2 transgenes in HEK293T cells engineered to overexpress the indicated protein(s). See Example 14.
  • Figure 47 shows live SARS-CoV-2 infection levels in wild-type HEK293T cells and in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, SIGLEC-1, or ACE2. Infection was determined using a recombinant S protein with luciferase reporter. See Example 14.
  • Figure 48 shows neutralization by monoclonal antibody S309 (VH of SEQ ID NO.:139, VL of SEQ ID NO.: 143) oflive SARS-CoV-2 infection in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, SIGLEC-1, or ACE2.
  • antibody S309 includes M428L and N434S Fc mutations. See Example 14.
  • Figure 49 shows neutralization by monoclonal antibody S2E12-LS (VH of SEQ ID NO.:399, VL of SEQ ID NO.:403n M428L/N434S Fc mutations) oflive SARS- CoV-2 infection in HEK293T cells engineered to overexpress DC-SIGN, L-SIGN, SIGLEC-1, or ACE2.
  • antibody S2E12 includes M428L and N434S Fc mutations. See Example 14.
  • Figures 50A and 50B shows expression analysis of receptor proteins including CD209 (DC-SIGN) and SIGLEC proteins in several cell types. Size of dot correlates with the percentage of cells of the indicated type that express the protein, and intensity of dot shading correlates with the expression level of the protein. See Example 14.
  • Figure 51 shows infection by live SARS-CoV-2 expressing N-luciferase in HEK293T cells ("parental") or HEK293T cells stably expressing DC-SIGN, L-SIGN, SIGLEC-1, or ACE2.
  • Data represent experiments testing SARS-CoV-2 at three multiplicities of infection (MOI). See Example 14.
  • Figure 52 shows infection by SARS-CoV-2 pseudotyped VSV in HEK293T cells, HeLa cells, and MRC5 cells transiently transduced with lentivirus to express DC- SIGN, L-SIGN, SIGLEC-1, or ACE2. Uninfected cells are shown as negative control. See Example 14.
  • Figure 53 shows neutralization of infection by S2E12.
  • a panel of 7 cell lines (HeLa, 293T (wt), Vero E6, Huh7, 293T ACE2, MRC 5 - ACE2-TMPRS S2, A549- ACE2-TMPRS S2 clone 5, A549- ACE2-TMPRS S2 clone 10) were infected with SARS- CoV-2-Nluc in the presence of S2E12. Luciferase signal was quantified 24h post infection.
  • Figure 54 shows neutralization of infection by S2E12.
  • a panel of 7 cell lines (HeLa, 293T (wt), Vero E6, Huh7, 293T ACE2, MRC 5 - ACE2-TMPRS S2, A549- ACE2-TMPRSS2 clone 5, A549-ACE2-TMPRSS2 clone 10) were infected with VSV pseudotyped with the SARS-CoV-2 spike protein in the presence of S2E12-LS. Luciferase signal was quantified 24h post infection.
  • Figure 55 shows binding of purified, fluorescently-labeled SARS-CoV-2 spike protein binding to each of 7 cell lines as quantified by flow cytometry.
  • HeLa and 239T WT cells had he lowest MFIs, followed by Huh7 and VeroE6 cells.
  • Figures 56A and 56B show that both S309 (VH SEQ ID NO : 139; VL SEQ ID NO. : 143) or the combination of S309 and S2E12-LS provide robust in vivo protection against SARS-CoV-2 challenge.
  • Syrian hamsters were injected with the indicated amount of mAh 48 hours before intra-nasal challenge with SARS-CoV-2.
  • Fig. 56A top row, shows quantification of viral RNA in the lungs 4 days post-infection.
  • Fig 56A, middle row shows quantification of replicating virus in lung homogenates harvested 4 days post infection using a TCID50 assay.
  • Fig 56A, bottom row shows histological score of the lung tissue assessed 4 days post infection.
  • Fig. 56B shows that the concentration of mAbs measured in the serum before infection (day 0) inversely correlates with the viral RNA load in the lung 4 days post infection. See Example 14.
  • Figure 57 shows infection of HEK293T cells transfected to over-express ACE2 or one of a panel of selected lectins and receptor candidates by VSV-SARS-CoV-2 pseudovirus.
  • Figure 58 shows micrographs of stable HEK293T cell lines overexpressing DC- SIGN, L-SIGN, SIGLEC1, or ACE2 infected with authentic SARS-CoV-2 (MOI of 0.1), then fixed and immunostained for 24 hours for SARS-CoV-2 nucleoprotein (red)
  • Figure 59 shows quantification of luciferase levels in stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2, as measured 24 hours after infection with SARS-CoV-2 -Nluc.
  • Figure 60 shows quantification of luciferase levels in stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2 after incubation with different concentrations of anti-SIGLECl monoclonal antibody (clone 7-239) and infection with SARS-CoV-2-Nluc.
  • Figure 61 shows infection of cells transiently transduced to overexpress DC- SIGN, L-SIGN, SIGLEC1, or ACE2 by VSV-SARS-CoV-2 pseudovirus. Results for HEK293T cells (left panel), HeLa cells (center panel), and MRC5 cells (right panel) are shown.
  • Figure 62 shows infection of stable HEK293T cell lines overexpressing DC- SIGN, L-SIGN, SIGLEC1, or ACE2 after treatment with ACE2 siRNA followed by infection with VSV-SARS-CoV-2 pseudovirus.
  • Figure 63 shows infection of stable HEK293T cell lines overexpressing DC- SIGN, L-SIGN, SIGLEC1, or ACE2 after treatment with different concentrations of anti-ACE2 antibody (polyclonal serum) followed by infection with VSV-SARS-CoV-2 pseudovirus.
  • Figure 64 shows the distribution and expression of ACE2, DC-SIGN (CD209), L-SIGN (CLEC4M), and SIGLEC1 in the human lung cell atlas.
  • Figure 65 shows analysis of major cell types with detectable SARS-CoV-2 genome in bronchoalveolar lavage fluid or sputum of severe COVID-19 patients.
  • the single cell gene expression profiles are shown as a t-SNE (t-distributed stochastic neighbor embedding) plot, colored by cell type and sized by viral load.
  • t-SNE t-distributed stochastic neighbor embedding
  • Figure 66 shows analysis of major cell types with detectable SARS-CoV-2 genome in bronchoalveolar lavage fluid or sputum of severe COVID-19 patients. The cumulative fraction of cells (y-axis) with detected viral RNA per cell up to the corresponding logCPM (log(counts per million); x-axis) is shown for each of the indicated cell types.
  • Figure 68 shows the correlation of receptor transcript counts (y-axis of each plot) with SARS-CoV-2 RNA counts (x-axis of each plot) in macrophages and in secretory cells. Correlation is based on counts before log transformation from Ren et al.
  • Figure 69 shows, at right, results of trans-infection with VSV-SARS-CoV-2.
  • a schematic of the trans-infection process is shown in the left panel.
  • HeLa cells transduced with DC-SIGN, L-SIGN, or SIGLEC1 were incubated with VSV-SARS- CoV-2, extensively washed, and co-cultured with Vero-E6-TMPRSS2 susceptible target cells. Results in the presence or absence of target cells are shown in the right panel.
  • Figure 70 shows the results of trans-infection, where VSV-SARS-CoV-2 viral adsorption was performed in the presence or absence of an anti-SIGLECl blocking antibody.
  • Figure 71 shows neutralization of SARS-CoV-2 infection of Vero-E6 cells by antibodies S309, S2E12-LS, and S2X33.
  • S2E12-LS comprises the VH sequence of SEQ ID NO:399 and the VL sequence of SEQ ID NO:403, and M428L/N434S in Fc.
  • Figure 72 shows neutralization of SARS-CoV-2 infection of Vero-E6- TMPRSS2 cells by antibodies S309, S2E12-LS, and S2X33.
  • Figure 73 shows quantification of binding of purified, fluorescently-labeled SARS-CoV-2 spike protein or RBD to the indicated cell lines, as measured by flow cytometry.
  • A indicates cell line overexpressing ACE2;
  • T indicates cell line overexpressing TMPRSS2.
  • Figure 74 shows quantification of cellular ACE2 and TMPRSS2 transcripts in the indicated cell lines, as measured by RT-qPCR.
  • A indicates cell line overexpressing ACE2;
  • T indicates cell line overexpressing TMPRSS2.
  • Figure 75 shows neutralization of SARS-CoV-2-Nluc infection by antibodies S309, S2E12-LS, or S2X333. Each of the seven cell lines indicated was tested. Luciferase signal was quantified 24 hours post infection.
  • Figure 76 shows neutralization of VSV-SARS-CoV-2 pseudovirus infection by antibodies S309, S2E12-LS, or S2X333. Each of the seven cell lines indicated was tested. Luciferase signal was quantified 24 hours post infection.
  • Figure 77 shows cell-cell fusion of CHO cells expressing SARS-CoV-2 S protein (CHO-S) on the plasma membrane in the absence (top panels) or presence (bottom panels) of 5 ⁇ g/ml of antibody S2E12-LS, as measured by immune- fluorescence. Nuclei were stained with Hoechst dye; cytoplasm was stained with CellTracker Green.
  • Figure 78 shows CHO-S cell-cell fusion mediated by different spike-specific antibodies. Fusion was quantified using the Cytation 5 Imager (BioTek) and an object detection protocol that detected nuclei as objects and measured their size. The area of the objects in fused cells divided by the total area of all the objects multiplied by 100 provides the percentage of fused cells.
  • Figure 79 shows inhibition of S2E12-LS -induced cell-cell fusion of CHO-S cells by 15 ⁇ g/ml of the indicated antibodies.
  • Figure 80 shows S2E12-LS -induced uni-directional fusion (also referred to as trans-fusion) of S-positive CHO-S cells with fluorescently-labelled S-negative CHO cells in the absence of ACE2. Nuclei were stained with Hoechst dye; cytoplasm was stained with CellTracker Green.
  • Figure 81 shows neutralization of infection of a stable HEK293T cell line overexpressing ACE2 by authentic SARS-CoV-2 pre-incubated with the indicated antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV- 2 nucleoprotein.
  • Figure 82 shows neutralization of infection of a stable HEK293T cell line overexpressing SIGLEC1 by authentic SARS-CoV-2 pre-incubated with the indicated antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV- 2 nucleoprotein.
  • Figure 83 shows neutralization of infection of a stable HEK293T cell line overexpressing DC-SIGN by authentic SARS-CoV-2 pre-incubated with the indicated monoclonal antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV-2 nucleoprotein.
  • Figure 84 shows neutralization of infection of a stable HEK293T cell line overexpressing L-SIGN by authentic SARS-CoV-2 pre-incubated with the indicated monoclonal antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV-2 nucleoprotein.
  • Figure 85 shows a summary of the mechanisms of action of different classes of spike-specific antibodies.
  • Fusion inhibition refers to antibody-mediated inhibition of fusion between CHO-S cells and ACE2+ Vero-E6 cells.
  • Assessment of effector functions is based on antibody-dependent activation of human FcyRs, as measured using a bioluminescent reporter assay.
  • RBM Ia-IIa antibodies include S2E12, S2X259, S2X58, S2D106, Ly-CoV016, CT-P59, and REGN10933.
  • RBM lb antibodies include Ly-CoV555, REGN10987, and S2M11.
  • NTD antibodies include S2X333.
  • Stem helix antibodies include S2P6.
  • Figure 86 shows analysis of binding of antibodies targeting DC/L-SIGN, DC- SIGN, SIGLEC1, or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor, as measured by flow cytometry.
  • Figure 87 shows analysis of binding of antibodies targeting DC/L-SIGN, DC- SIGN, SIGLEC1, or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor, as measured by immunofluorescence.
  • Figure 88 shows infection of HEK293T cells stably over-expressing the indicated attachment receptor by VSV-SARS-CoV-2 pseudotyped with wild type spike protein (grey bars), or VSV-SARS-CoV-2 pseudotyped with spike protein bearing the mutations of the B 1.1.7 lineage (red bars). Luminescence was analyzed one day post infection.
  • Figure 89 shows neutralization of SARS-CoV-2 infection of Vero-E6 or Vero- E6-TMPRSS2 cells by 10 ⁇ g/ml of S309, S2E12-v2, and S2X333.
  • Cells were infected with SARS-CoV-2 (isolate USA-WA1/2020) at MOI 0.01 in the presence of the indicated antibodies. Cells were fixed 24h post infection and viral nucleocapsid protein was immunostained.
  • Figure 93 shows analysis of the protective effect of antibody S309 (left panels) or a combination of antibodies S309 and S2E12-LS (right panels) against SARS-CoV-2 challenge in Syrian hamsters. Top panels show histopathological score of lung tissue assessed four days post infection. Bottom panels show efficacy plots based on the correlation between the level of serum antibody measured at the time of infection (x- axis) and the level of SARS-CoV-2 viral RNA measured in lungs (y-axis) on day four after infection. The dotted lines represent the EC50 and EC90 for viral reduction.
  • Figure 95 shows analysis of the role of host effector function in SARS-CoV-2 challenge.
  • Syrian hamsters were injected with the indicated amount (mg/kg) of hamster IgG2a S309, either wt or Fc silenced (S309-N297A).
  • Top panel shows quantification of viral RNA in the lung 4 days post infection.
  • Center panel shows quantification of replicating virus in the lung 4 days post infection.
  • Bottom panel shows histopathological score in the lung 4 days post infection.
  • Control animals (white symbols) were injected with 4 mg/kg unrelated control isotype antibody.
  • Figure 96 shows inhibition of infection by SARS-CoV-2-Nluc in HeLa cells stably expressing DC-SIGN in the presence of the indicated antibodies.
  • Cells were infected at MOI of 0.04. Infection was analyzed by quantification of luminescent signal at 24 hours post infection.
  • Figure 97 shows neutralization of SARS-CoV-2 infection of HEK293T cells stably expressing ACE2 (top panel) or DC-SIGN (bottom panel) in the presence of the indicated antibodies.
  • Cells were infected at MOI of 0.02. Cells were fixed 24h post infection, viral nucleocapsid protein was immunostained and positive cells were quantified.
  • antibodies and antigen-binding fragments that bind to SARS-CoV-2 coronavirus (e.g, a SARS-CoV-2 surface glycoprotein and/or RBD, as described herein, in a SARS-CoV-2 virion and/or expressed on the surface of a cell infected by the SARS-CoV-2 coronavirus).
  • SARS-CoV-2 coronavirus e.g, a SARS-CoV-2 surface glycoprotein and/or RBD, as described herein, in a SARS-CoV-2 virion and/or expressed on the surface of a cell infected by the SARS-CoV-2 coronavirus.
  • presently disclosed antibodies and antigen-binding fragments can neutralize a SARS-CoV-2 infection in an in vitro model of infection and/or in an animal model of infection and/or in a human subject.
  • SARS-CoV-2 also referred to herein as "Wuhan seafood market phenomia virus", or “Wuhan coronavirus” or “Wuhan CoV”, or “novel CoV”, or “nCoV”, or “2019 nCoV”, or “Wuhan nCoV” is a betacoronavirus believed to be of lineage B (sarbecovirus).
  • SARS-CoV-2 was first identified in Wuhan, Hubei province, China, in late 2019 and spread within China and to other parts of the world by early 2020. Symptoms of SARS-CoV-2 infection include fever, dry cough, and dyspnea.
  • the amino acid sequence of the Wuhan-Hu-1 surface glycoprotein is provided in SEQ ID NO.:3.
  • the amino acid sequence of Wuhan-Hu-1 RBD is provided in SEQ ID NO.:4.
  • SARS-CoV-2 S protein has approximately 73% amino acid sequence identity with SARS-CoV-1.
  • the amino acid sequence of Wuhan-Hu-1 RBM is provided in SEQ ID NO.:5.
  • Wuhan-Hu-1 RBD has approximately 75% to 77% amino acid sequence similarity to SARS-CoV-1 RBD
  • Wuhan-Hu-1 RBM has approximately 50% amino acid sequence similarity to SARS-CoV-1 RBM.
  • SARS-CoV-2 variants There have been a number of emerging SARS-CoV-2 variants. Some SARS- CoV-2 variants contain an N439K mutation, which has enhanced binding affinity to the human ACE2 receptor (Thomson, E.C., et al., The circulating SARS-CoV-2 spike variant N439K maintains fitness while evading antibody-mediated immunity. bioRxiv, 2020). Some SARS-CoV-2 variants contain an N501 Y mutation, which is associated with increased transmissibility, including the lineages B.l.1.7 (also known as 20I/501Y.V1 and VOC 202012/01; (del69-70, dell44, N501Y, A570D, D614G,
  • SARS-CoV-2 variants include the Lineage B.1.1.28, which was first reported in Brazil; the Variant P.1, lineage B.1.1.28 (also known as 20J/501Y.V3), which was first reported in Japan; Variant L452R, which was first reported in California in the United States (Pan American Health Organization, Epidemiological update: Occurrence of variants of SARS-CoV-2 in the Americas, January 20, 2021, available at reliefweb.int/sites/reliefweb.int/files/resources/2021-jan-20-phe-epi-update-SARS- CoV-2.pdf).
  • SARS-CoV-2 variants include a SARS CoV-2 of clade 19A; SARS CoV-2 of clade 19B; a SARS CoV-2 of clade 20A; a SARS CoV-2 of clade 20B; a SARS CoV-2 of clade 20C; a SARS CoV-2 of clade 20D; a SARS CoV-2 of clade 20E (EU1); a SARS CoV-2 of clade 20F; a SARS CoV-2 of clade 20G; and SARS CoV-2 Bl.1.207; and other SARS CoV-2 lineages described in Rambaut, A., et al ., A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology.
  • SARS-CoV-2 includes Wuhan Hu-1 and variants thereof, including presently disclosed variants.
  • Other conservative substitutions groups include: sulfur-containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gin; small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, He, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.
  • protein or “polypeptide” refers to a polymer of amino acid residues. Proteins apply to naturally occurring amino acid polymers, as well as to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, and non-naturally occurring amino acid polymers. Variants of proteins, peptides, and polypeptides of this disclosure are also contemplated.
  • Nucleic acid molecule or “polynucleotide” or “polynucleic acid” refers to a polymeric compound including covalently linked nucleotides, which can be made up of natural subunits (e.g ., purine or pyrimidine bases) or non-natural subunits (e.g, morpholine ring).
  • Purine bases include adenine, guanine, hypoxanthine, and xanthine
  • pyrimidine bases include uracil, thymine, and cytosine.
  • Nucleic acid molecules include polyribonucleic acid (RNA), which includes mRNA, microRNA, siRNA, viral genomic RNA, and synthetic RNA, and polydeoxyribonucleic acid (DNA), which includes cDNA, genomic DNA, and synthetic DNA, either of which may be single or double stranded. If single-stranded, the nucleic acid molecule may be the coding strand or non-coding (anti-sense) strand.
  • a nucleic acid molecule encoding an amino acid sequence includes all nucleotide sequences that encode the same amino acid sequence. Some versions of the nucleotide sequences may also include intron(s) to the extent that the intron(s) would be removed through co- or post-transcriptional mechanisms. In other words, different nucleotide sequences may encode the same amino acid sequence as the result of the redundancy or degeneracy of the genetic code, or by splicing.
  • Variants of nucleic acid molecules of this disclosure are also contemplated. Variant nucleic acid molecules are at least 70%, 75%, 80%, 85%, 90%, and are preferably 95%, 96%, 97%, 98%, 99%, or 99.9% identical a nucleic acid molecule of a defined or reference polynucleotide as described herein, or that hybridize to a polynucleotide under stringent hybridization conditions of 0.015M sodium chloride, 0.0015M sodium citrate at about 65-68°C or 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide at about 42°C. Nucleic acid molecule variants retain the capacity to encode a binding domain thereof having a functionality described herein, such as binding a target molecule.
  • Percent sequence identity refers to a relationship between two or more sequences, as determined by comparing the sequences. Preferred methods to determine sequence identity are designed to give the best match between the sequences being compared. For example, the sequences are aligned for optimal comparison purposes (e.g ., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment). Further, non-homologous sequences may be disregarded for comparison purposes. The percent sequence identity referenced herein is calculated over the length of the reference sequence, unless indicated otherwise. Methods to determine sequence identity and similarity can be found in publicly available computer programs.
  • isolated means that the material is removed from its original environment (e.g, the natural environment if it is naturally occurring).
  • a naturally occurring nucleic acid or polypeptide present in a living animal is not isolated, but the same nucleic acid or polypeptide, separated from some or all of the co-existing materials in the natural system, is isolated.
  • nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g, a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide.
  • gene means the segment of DNA or RNA involved in producing a polypeptide chain; in certain contexts, it includes regions preceding and following the coding region (e.g ., 5’ untranslated region (UTR) and 3’ UTR) as well as intervening sequences (introns) between individual coding segments (exons).
  • regions preceding and following the coding region e.g ., 5’ untranslated region (UTR) and 3’ UTR
  • intervening sequences introns between individual coding segments (exons).
  • a “functional variant” refers to a polypeptide or polynucleotide that is structurally similar or substantially structurally similar to a parent or reference compound of this disclosure, but differs slightly in composition (e.g., one base, atom or functional group is different, added, or removed), such that the polypeptide or encoded polypeptide is capable of performing at least one function of the parent polypeptide with at least 50% efficiency, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% level of activity of the parent polypeptide.
  • the term "engineered,” “recombinant,” or “non-natural” refers to an organism, microorganism, cell, nucleic acid molecule, or vector that includes at least one genetic alteration or has been modified by introduction of an exogenous or heterologous nucleic acid molecule, wherein such alterations or modifications are introduced by genetic engineering (i.e., human intervention).
  • Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding functional RNA, proteins, fusion proteins or enzymes, or other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of a cell’s genetic material. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a polynucleotide, gene, or operon.
  • heterologous or non-endogenous or exogenous refers to any gene, protein, compound, nucleic acid molecule, or activity that is not native to a host cell or a subject, or any gene, protein, compound, nucleic acid molecule, or activity native to a host cell or a subject that has been altered.
  • Heterologous, non-endogenous, or exogenous includes genes, proteins, compounds, or nucleic acid molecules that have been mutated or otherwise altered such that the structure, activity, or both is different as between the native and altered genes, proteins, compounds, or nucleic acid molecules.
  • heterologous, non-endogenous, or exogenous genes, proteins, or nucleic acid molecules may not be endogenous to a host cell or a subject, but instead nucleic acids encoding such genes, proteins, or nucleic acid molecules may have been added to a host cell by conjugation, transformation, transfection, electroporation, or the like, wherein the added nucleic acid molecule may integrate into a host cell genome or can exist as extra-chromosomal genetic material (e.g., as a plasmid or other self-replicating vector).
  • expression refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene.
  • the process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post- translational modification, or any combination thereof.
  • An expressed nucleic acid molecule is typically operably linked to an expression control sequence (e.g., a promoter).
  • operably linked refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other.
  • a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
  • Unlinked means that the associated genetic elements are not closely associated with one another and the function of one does not affect the other.
  • more than one heterologous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as a plurality of individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a protein (e.g ., a heavy chain of an antibody), or any combination thereof.
  • a protein e.g ., a heavy chain of an antibody
  • two or more heterologous nucleic acid molecules can be introduced as a single nucleic acid molecule (e.g., on a single vector), on separate vectors, integrated into the host chromosome at a single site or multiple sites, or any combination thereof.
  • the number of referenced heterologous nucleic acid molecules or protein activities refers to the number of encoding nucleic acid molecules or the number of protein activities, not the number of separate nucleic acid molecules introduced into a host cell.
  • construct refers to any polynucleotide that contains a recombinant nucleic acid molecule (or, when the context clearly indicates, a fusion protein of the present disclosure).
  • a (polynucleotide) construct may be present in a vector (e.g., a bacterial vector, a viral vector) or may be integrated into a genome.
  • a "vector” is a nucleic acid molecule that is capable of transporting another nucleic acid molecule.
  • Vectors may be, for example, plasmids, cosmids, viruses, a RNA vector or a linear or circular DNA or RNA molecule that may include chromosomal, non-chromosomal, semi -synthetic or synthetic nucleic acid molecules.
  • Vectors of the present disclosure also include transposon systems (e.g., Sleeping Beauty, see, e.g, Geurts et al, Mol.
  • the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself or deliver the polynucleotide contained in the vector into the genome without the vector sequence.
  • plasmid "expression plasmid,” “virus,” and “vector” are often used interchangeably.
  • polynucleotides of the present disclosure may be operatively linked to certain elements of a vector.
  • polynucleotide sequences that are needed to effect the expression and processing of coding sequences to which they are ligated may be operatively linked.
  • Expression control sequences may include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and possibly sequences that enhance protein secretion.
  • Expression control sequences may be operatively linked if they are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • “Retroviruses” are viruses having an RNA genome, which is reverse-transcribed into DNA using a reverse transcriptase enzyme, the reverse-transcribed DNA is then incorporated into the host cell genome.
  • “Gammaretrovirus” refers to a genus of the retroviridae family. Examples of gammaretroviruses include mouse stem cell virus, murine leukemia virus, feline leukemia virus, feline sarcoma virus, and avian reticuloendotheliosis viruses.
  • Lentiviral vectors include HIV-based lentiviral vectors for gene delivery, which can be integrative or non-integrative, have relatively large packaging capacity, and can transduce a range of different cell types. Lentiviral vectors are usually generated following transient transfection of three (packaging, envelope, and transfer) or more plasmids into producer cells. Like HIV, lentiviral vectors enter the target cell through the interaction of viral surface glycoproteins with receptors on the cell surface. On entry, the viral RNA undergoes reverse transcription, which is mediated by the viral reverse transcriptase complex. The product of reverse transcription is a double-stranded linear viral DNA, which is the substrate for viral integration into the DNA of infected cells.
  • the viral vector can be a gammaretrovirus, e.g, Moloney murine leukemia virus (MLV)-derived vectors.
  • the viral vector can be a more complex retrovirus-derived vector, e.g, a lentivirus-derived vector. HIV-l-derived vectors belong to this category.
  • Other examples include lentivirus vectors derived from HIV-2, FIV, equine infectious anemia virus, SIV, and Maedi-Visna virus (ovine lentivirus).
  • Retroviral and lentiviral vector constructs and expression systems are also commercially available.
  • Other viral vectors also can be used for polynucleotide delivery including DNA viral vectors, including, for example adenovirus-based vectors and adeno-associated virus (AAV)-based vectors; vectors derived from herpes simplex viruses (HSVs), including amplicon vectors, replication-defective HSV and attenuated HSV (Krisky et al., Gene Ther. 5:1517, 1998).
  • HSVs herpes simplex viruses
  • the viral vector may also comprise additional sequences between the two (or more) transcripts allowing for bicistronic or multi cistronic expression.
  • additional sequences used in viral vectors include internal ribosome entry sites (IRES), furin cleavage sites, viral 2A peptide, or any combination thereof.
  • Plasmid vectors including DNA-based antibody or antigen-binding fragment- encoding plasmid vectors for direct administration to a subject, are described further herein.
  • the term "host” refers to a cell or microorganism targeted for genetic modification with a heterologous nucleic acid molecule to produce a polypeptide of interest (e.g ., an antibody of the present disclosure).
  • a host cell may include any individual cell or cell culture which may receive a vector or the incorporation of nucleic acids or express proteins. The term also encompasses progeny of the host cell, whether genetically or phenotypically the same or different. Suitable host cells may depend on the vector and may include mammalian cells, animal cells, human cells, simian cells, insect cells, yeast cells, and bacterial cells. These cells may be induced to incorporate the vector or other material by use of a viral vector, transformation via calcium phosphate precipitation, DEAE-dextran, electroporation, microinjection, or other methods. See , for example, Sambrook etal., Molecular Cloning: A Laboratory Manual 2d ed. (Cold Spring Harbor Laboratory, 1989).
  • a "host” refers to a cell or a subject infected with SARS-CoV-2.
  • Antigen refers to an immunogenic molecule that provokes an immune response. This immune response may involve antibody production, activation of specific immunologically-competent cells, activation of complement, antibody dependent cytotoxicicity, or any combination thereof.
  • An antigen immunogenic molecule
  • An antigen may be, for example, a peptide, glycopeptide, polypeptide, glycopolypeptide, polynucleotide, polysaccharide, lipid, or the like. It is readily apparent that an antigen can be synthesized, produced recombinantly, or derived from a biological sample. Exemplary biological samples that can contain one or more antigens include tissue samples, stool samples, cells, biological fluids, or combinations thereof.
  • Antigens can be produced by cells that have been modified or genetically engineered to express an antigen. Antigens can also be present in a SARS-CoV-2 (e.g, a surface glycoprotein or portion thereof), such as present in a virion, or expressed or presented on the surface of a cell infected by SARS-CoV-2.
  • SARS-CoV-2 e.g, a surface glycoprotein or portion thereof
  • the epitope can be comprised of consecutive amino acids (e.g ., a linear epitope), or can be comprised of amino acids from different parts or regions of the protein that are brought into proximity by protein folding (e.g., a discontinuous or conformational epitope), or non-contiguous amino acids that are in close proximity irrespective of protein folding.
  • an antibody or antigen-binding fragment of the present disclosure specifically binds to a SARS-CoV-2 surface glycoprotein.
  • “specifically binds” refers to an association or union of an antibody or antigen-binding fragment to an antigen with an affinity or K a (i.e., an equilibrium association constant of a particular binding interaction with units of 1/M) equal to or greater than 10 5 M -1 (which equals the ratio of the on-rate [K 0n ] to the off rate [K 0ff ] for this association reaction), while not significantly associating or uniting with any other molecules or components in a sample.
  • K a i.e., an equilibrium association constant of a particular binding interaction with units of 1/M
  • affinity may be defined as an equilibrium dissociation constant (K d ) of a particular binding interaction with units of M (e.g, 10 -5 M to 10 -13 M).
  • Antibodies may be classified as “high-affinity” antibodies or as “low- affinity” antibodies.
  • “High-affinity” antibodies refer to those antibodies having a K a of at least 10 7 M _1 , at least 10 8 M -1 , at least 10 9 M -1 , at least 10 10 M -1 , at least 10 11 M -1 , at least 10 12 M _1 , or at least 10 13 M -1 .
  • “Low-affinity” antibodies refer to those antibodies having a K a of up to 10 7 M '1 , up to 10 6 M -1 , up to 10 5 M -1 .
  • affinity may be defined as an equilibrium dissociation constant (K d ) of a particular binding interaction with units of M (e.g, 10 -5 M to 10 -13 M).
  • assays for identifying antibodies of the present disclosure that bind a particular target, as well as determining binding domain or binding protein affinities, such as Western blot, ELISA (e.g, direct, indirect, or sandwich), analytical ultracentrifugation, spectroscopy, and surface plasmon resonance (Biacore®) analysis (see, e.g., Scatchard etal., Ann. N.Y. Acad. Sci. 57:660, 1949; Wilson, Science 295: 2103, 2002; Wolff etal., Cancer Res. 53: 2560, 1993; and U.S. Patent Nos. 5,283,173, 5,468,614, or the equivalent). Assays for assessing affinity or apparent affinity or relative affinity are also known.
  • an antibody or antigen-binding fragment of the present disclosure binds to SARS-CoV-2 S protein RBD with a KD of less than about 4.5x10 -9 M, less than about 5x10 -9 M, less than about lx10 -10 M, less than about 5x 10 -10 M, less than about 1x 10 -11 M, less than about 5x10 -11 M, less than about lx10 -12 M, or less than about 5x 10 -12 M.
  • an antibody of the present disclosure is capable of neutralizing infection by SARS-CoV-2.
  • a “neutralizing antibody” is one that can neutralize, i.e., prevent, inhibit, reduce, impede, or interfere with, the ability of a pathogen to initiate and/or perpetuate an infection in a host.
  • neutralizing antibody and “an antibody that neutralizes” or “antibodies that neutralize” are used interchangeably herein.
  • an antibody or antigen-binding fragment, or a composition comprising two or more antibodies or antigen-binding fragments, of the present disclosure is capable of neutralizing a SARS-CoV-2 infection, or a virus pseudotyped with SARS-CoV-2 S protein, with an IC50 of about 0.8 to about 0.9 ⁇ g/ml.
  • an antibody or antigen-binding fragment, or a composition comprising two or more antibodies or antigen-binding fragments, of the present disclosure is capable of neutralizing a SARS-CoV-2 infection, or a virus pseudotyped with SARS-CoV-2 S protein, with an IC50 of about 0.5 to about 0.6 ⁇ g/ml.
  • antibody refers to an intact antibody comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, as well as any antigen-binding portion or fragment of an intact antibody that has or retains the ability to bind to the antigen target molecule recognized by the intact antibody, such as an scFv, Fab, or Fab'2 fragment.
  • an antibody or antigen-binding fragment comprises CDRs of a VH sequence according to any one of SEQ ID NOs.: 22, 32, 42, 52, 62, 72, 74, 84, 96, 106, 119, 129, 139, 150, 163, 173, 175, 178, 186, 189, 191, 198, 208, 218, 228, 240, 254, 264, 274, 284, 298, 312, 322, 332, 350,
  • an antibody or an antigen-binding fragment comprises a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRLl, a CDRL2, and a CDRL3, wherein: (i) the CDRH1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 23, 33, 43, 53, 63, 75, 85, 97, 107,
  • the CDRH3 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 25, 35, 45, 55, 65, 77, 87, 99, 109, 122, 132, 142, 149, 162, 164, 165,
  • the CDRL1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 27, 37, 47, 57, 67, 79, 89, 101, 111, 124, 134,
  • the CDRL2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 28, 38, 48, 58, 68, 80, 90, 102, 112, 125, 135, 145, 153, 167, 182, 193, 204, 214, 224, 234, 246, 260, 270, 280, 290, 304, 318, 328, 338, 375, 385, 395, 405, 415, 425, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550
  • the antibody or antigen-binding fragment is capable of preventing and/or neutralizing a SARS-CoV-2 infection in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.: (i) 23-25 and 27-29, respectively; (ii) 33-35 and 37-39, respectively; (iii) 43-45 and 47-49, respectively; (iv) 53-55 and 57-59, respectively; (v) 63-65 and 67-69, respectively; (vi) 75-77 and 79-81, respectively; (vii) 85-87 and 89-91, respectively; (viii) 97-99 and 101-103, respectively; (ix) 107-109 and 111-113, respectively; (x) 120-122 and 124-126, respectively; (xi) 130-132 and 134- 136, respectively; (xii) 23 or 147, any one of 24, 148 or 151, 25 or 149, any one of 27, 152, 155, 156, 158,
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:631, 632 or 635 or 637 or 639 or 641 or 643 or 645 or 647 or 649 or 651 or 653 or 655 or 657 or 659 or 661 or 663 or 665 or 667 or 669 or 671 or 673 or 675 or 677 or 679 or 681 or 683 or 685, 633, and 697-699, respectively.
  • the antibody or antigenbinding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:693-695 and 697-699, respectively.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID N0s.:400-402, and 404-406, respectively. In certain embodiments, the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 766, and 404-406, respectively. In certain embodiments, the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID N0s.:400-402, 404, 405, and 745, respectively.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 766, 404, 405, and 745, respectively.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID N0s.:400-402, 404, 405, and 747, respectively.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 766, 404, 405, and 747, respectively.
  • the antibody or antigen binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 751, and 404-406, respectively. In certain embodiments, the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 753, and 404-406, respectively. In certain embodiments, the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 755, and 404-406, respectively.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 757, and 404-406, respectively. In certain embodiments, the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.:400, 401, 760, and 404-406, respectively.
  • an antibody or an antigen-binding fragment of the present disclosure comprises a CDRH1, a CDRH2, a CDRH3, a CDRL1, a CDRL2, and a CDRL3, wherein each CDR is independently selected from a corresponding CDR of SARS-CoV-2 S2X16-vl mAb, SARS-CoV-2 S2X16-v2 mAb, SARS-CoV-2 S2X16-v3 mAb, SARS-CoV-2 S2X16-v4 mAb, SARS-CoV-2 S2X16-v5 mAb, SARS-CoV-2 S2X16-v6 mAb, SARS-CoV-2 S2X16-v7 mAb, SARS-CoV-2 S2X16-v8 mA,b SARS- CoV-2 S2X28-vl mAb, SARS-CoV-2 S2X30-vl mAb, SARS-CoV-2 S2X30-vl mAb, S
  • DNA in the germline variable (V), joining (J), and diversity (D) gene loci may be rearranged and insertions and/or deletions of nucleotides in the coding sequence may occur. Somatic mutations may be encoded by the resultant sequence, and can be identified by reference to a corresponding known germline sequence.
  • somatic mutations that are not critical to a desired property of the antibody e.g ., binding to a SARS-CoV-2 antigen
  • that confer an undesirable property upon the antibody e.g., an increased risk of immunogenicity in a subject administered the antibody
  • the antibody or antigen-binding fragment of the present disclosure comprises at least one more germline-encoded amino acid in a variable region as compared to a parent antibody or antigen-binding fragment, provided that the parent antibody or antigen binding fragment comprises one or more somatic mutations.
  • Variable region and CDR amino acid sequences of anti-SARS-CoV-2 antibodies of the present disclosure are provided in Table 2 herein.
  • Exemplary antibodies of the present disclosure include antibody S2E12 and engineered variants thereof.
  • Engineered S2E12 variants include "Antibody 409_1 l_4_v2", “Antibody 409_1 l_4_v3", “Antibody 409_1 l_4_v4", “Antibody 409_1 l_4_v5", “Antibody 409_1 l_4_v6", “Antibody 409_1 l_4_v7", “Antibody 409_1 l_4_v8", “Antibody 409_1 l_4_v9", “Antibody 409_1 l_4_vl0”, “Antibody 409_1 l_4_vl 1", “Antibody 409_1 l_4_vl2”, “Antibody 409_1 l_4_vl3".
  • an antibody or antigen-binding fragment comprises a CDRH1, a CDRH2, a CDRH3, a CDRL1, a CDRL2, and/or a CDRL3 selected from any of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences (respectively) provided in Table 1.
  • Table 1 also provides amino acid sequences that comprise S2E12 CDRH3 sequences and two amino acids (Ala-Ser) that are immediately N-terminal to CDRH3 in S2E12.
  • an antibody or antigen-binding fragment comprises: a CDRH1, a CDRH2, and/or a CDRH3 of the VH amino acid sequence set forth in any one of SEQ ID NOs.:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761; and a CDRL1, a CDRL2, and/or a CDRL3 of the VL amino acid sequence set forth in any one of SEQ ID NOs.:403, 738, 744, and 746 (i.e., according to any CDR numbering or determination method known in the art, such as IMGT, Rabat, Chothia, AHo, North, Contact, CCG, EU, or Martin (Enhanced Chothia)).
  • the antibody or antigen-binding fragment comprises the CDRH1, the CDRH2, and/or the CDRH3 of the VH amino acid sequence set forth in SEQ ID NO.:399, and the CDRL1, the CDRL2, and/or the CDRL3 of the VL amino acid sequence set forth in SEQ ID NO.:738, wherein the CDRs are according to IMGT.
  • the antibody or antigen-binding fragment comprises the CDRH1, the CDRH2, and the CDRH3 of the VH amino acid sequence set forth in SEQ ID NO.:399, and the CDRL1, the CDRL2, and the CDRL3 of the VL amino acid sequence set forth in SEQ ID NO.:738, wherein the CDRs are according to IMGT.
  • the antibody or antigen-binding fragment comprises a VH having at least 85% identity (e.g., 85%, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • VH amino acid sequence provided in Table 1 and/or a VL having at least 85% identity (e.g., 85%, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • the antibody or antigen-binding fragment comprises a VH having at least 90% identity identity to a VH amino acid sequence provided in Table 1 and/or a VL having at least 90% identity to a VL amino acid sequence provided in Table 1.
  • the antibody or antigen-binding fragment comprises a VH having at least 95% identity identity to a VH amino acid sequence provided in Table 1 and/or a VL having at least 95% identity to a VL amino acid sequence provided in Table 1.
  • the antibody or antigen-binding fragment comprises a VH having at least 99% identity identity to a VH amino acid sequence provided in Table 1 and/or a VL having at least 99% identity to a VL amino acid sequence provided in Table 1.
  • the antibody or antigen-binding fragment comprises a VH amino acid sequence selected from the VH amino acid sequences provided in Table 1 and a VL amino acid sequence selected from the VL amino acid sequence provided in Table 1.
  • S2E12 antibodies comprise a kappa light chain, e.g, klm3, IGKC*01.
  • an antibody, or an antigen-binding fragment thereof comprises a heavy chain variable domain (VH) comprising complementarity determining region (CDR)H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRL1, CDRL2, and CDRL3, wherein CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in: (a) SEQ ID NOs.:400, 401, 766, 404, 405, and 406, respectively; (b) SEQ ID NOs.:400, 401, 769, 404, 405, and 406, respectively; (c) SEQ ID NOs.:400, 401, 770, 404, 405, and 406, respectively; (d) SEQ ID NOs.:400, 401, 771, 404, 405, and 406, respectively; (e) SEQ ID NOs.:400, 401, 772, 404, 405, and 406, respectively; (f)
  • SEQ ID NOs.: 400, 401, 772, 404, 405, and 745 respectively; (1) SEQ ID NOs.: 400, 401, 773, 405, 405, and 745, respectively; (m) SEQ ID NOs.:400, 401, 766, 404, 405, and 747, respectively; (n) SEQ ID NOs.:400, 401, 769, 404, 405, and 747, respectively; (o) SEQ ID NOs.:400, 401, 770, 404, 405, and 747, respectively; (p) SEQ ID NOs.:400, 401,
  • the antibody or antigen-binding fragment comprises the amino acid sequences set forth in: (a) SEQ ID NOs.:400, 401, 402, 404, 405, and 406; (b) SEQ ID NOs.:400, 401, 751, 404, 405, and 406; (c) SEQ ID NOs.:400, 401, 753, 404, 405, and 406; (d) SEQ ID NOs.:400, 401, 755, 404, 405, and 406; (e) SEQ ID NOs.:400, 401, 757, 404, 405, and 406; (f) SEQ ID NOs.:400, 401, 760, 404, 405, and 406; (g) SEQ ID NOs.:400, 401, 402, 404, 405, and 745; (h) SEQ ID NOs.:400, 401, 751, 404, 405, and 745; (i) SEQ ID NOs.:400, 401, 753, 404, 406; (b
  • SEQ ID NOs.:400, 401, and 402 are amino acid sequences in VH
  • SEQ ID NOs.:404, 405, and 406 are amino acid sequences in VL.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:525-527 and 529-531, respectively.
  • the antibody or antigen-binding fragment comprises a VH having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in SEQ ID NO.:524, and a VL having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in SEQ ID NO.:528.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.: 585, 586, 587, 589, 590, and 591, respectively, or as set forth in SEQ ID NOs.:585, 625, 627, 589, 590, and 591, respectively.
  • the antibody or antigen-binding fragment comprises a VH having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in any one of SEQ ID NOs.:584, 624, 626, and 628, and a VL having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in SEQ ID NO.:588.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.: 229, 230, 231, 233, 234, and 235, respectively.
  • the antibody or antigen-binding fragment comprises a VH having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in any one of SEQ ID NOs.:228, 740, 741, 742, and 743, and a VL having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in SEQ ID NO.:232.
  • the antibody or antigen-binding fragment comprises a VH having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in any one of SEQ ID NOs.:228, 740, 741, 742, and 743, and a VL having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or comprising or consisting of, the amino acid sequence set forth in SEQ ID NO.:238.
  • an antibody or antigen-binding fragment comprises an amino acid modification (e.g ., a substitution mutation) to remove an undesired risk of oxidation, deamidation, and/or isomerization.
  • an amino acid modification e.g ., a substitution mutation
  • Variant antibodies provided herein include those that comprise one or more amino acid alterations in a variable region (e.g, VH, VL, framework or CDR) as compared to a presently disclosed antibody having a specific sequence, wherein the variant antibody is capable of binding to a SARS-CoV-2 antigen.
  • a variable region e.g, VH, VL, framework or CDR
  • the VH comprises or consists of an amino acid sequence having at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence according to any one of SEQ ID NOs.: 22, 32, 42, 52, 62, 72, 74, 84, 96, 106, 119, 129, 139, 150, 163, 173, 175, 178, 186, 189, 191, 198, 208, 218, 228, 240, 254,
  • the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid; and/or (ii) the VL comprises or consists of an amino acid sequence having at least 85% (e.g., having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence according to any one of SEQ ID NOs.: 26, 36, 46, 56, 66, 78, 88, 94, 100, 110, 123, 133, 143, 154,
  • variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid.
  • the VH has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, and the VL has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
  • the VH has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)identity to the amino acid sequence set forth in any one of SEQ ID NOs.:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, and the VL has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
  • the VH has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, and the VL has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
  • the VH has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, and the VL has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)identity to the amino acid sequence set forth in any one of SEQ ID NOs.:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, and the VL has at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)identity to the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:748 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:748 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:748 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:748 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:749 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:749 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:749 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:749 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:750 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:750 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:750 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:750 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:750 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:752 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:752 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:752 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:754 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:754 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:754 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:754 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:756 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:756 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:756 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:756 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:758 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:758 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:758 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:758 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:759 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:759 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:759 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.: 744.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:759 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:761 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:403. In some embodments, the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:761 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738. In some embodments, the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:761 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.: 744. In some embodments, the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO.:761 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO.:746.
  • the VH comprises or consists of any VH amino acid sequence set forth in Table 2
  • the VL comprises or consists of any VL amino acid sequence set forth in Table 2.
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.: (i) 22 and 26, respectively; (ii) 32 and 36, respectively; (iii) 42 and 46, respectively; (iv) 52 and 56, respectively; (v) 62 and 66, respectively; (vi) 72 and 66, respectively; (vii) 74 and 78, respectively; (viii) 84 and 88, respectively; (ix) 84 and 94, respectively; (x) 96 and 100, respectively; (xi) 106 and 110, respectively; (xii) 119 and 123, respectively; (xiii) 129 and 133, respectively; (xiv) 22 or 150 and 26, 154, or 157, respectively; (xv) 42 or 163 and 46 or 168, respectively; (xvi)
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.: 624, 626, or 628 and 588, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.: 630, 634, 636, 638, 640,
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:692 and 696, respectively.
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.: 399 and 738, respectively.
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:399 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:399 and 738, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:399 and 744, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:399 and 746, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:748 and 403, respectively.
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:749 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:750 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:752 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:754 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:756 and 403, respectively.
  • the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:758 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:759 and 403, respectively. In certain embodiments, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.:761 and 403, respectively.
  • CL refers to an "immunoglobulin light chain constant region” or a "light chain constant region,” i.e., a constant region from an antibody light chain.
  • CH refers to an "immunoglobulin heavy chain constant region” or a "heavy chain constant region,” which is further divisible, depending on the antibody isotype into CHI, CH2, and CH3 (IgA, IgD, IgG), or CHI, CH2, CH3, and CH4 domains (IgE, IgM).
  • CHI unimmunoglobulin heavy chain constant region
  • an antibody or antigen-binding fragment of the present disclosure comprises any one or more of: a CL, a CHI, a CH2, and a CH3.
  • a CL comprises an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO.: 8 or SEQ ID NO.: 9.
  • a CH1-CH2-CH3 (also referred-to as a CH1-CH3) comprises an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO.:6 or SEQ ID NO.:7.
  • an antibody or antigen-binding fragment of the present disclosure comprises a heavy chain polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO.:767 and a light chain polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO.:768.
  • production in a mammalian cell line can remove one or more C-terminal lysine of an antibody heavy chain (see, e.g., Liu et al. mAbs 6(5): 1145-1154 (2014)).
  • an antibody or antigen-binding fragment of the present disclosure can comprise a heavy chain, a CH1-CH3, a CH3, or an Fc polypeptide wherein a C-terminal lysine residue is present or is absent; in other words, encompassed are embodiments where the C-terminal residue of a heavy chain, a CHI CHI, or an Fc polypeptide is not a lysine due to removal of a C-terminal lysine, and embodiments where a lysine is the C-terminal residue.
  • a composition comprises a plurality of an antibody and/or an antigen-binding fragment of the present disclosure, wherein one or more antibody or antigen-binding fragment does not comprise a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide, and wherein one or more antibody or antigen-binding fragment comprises a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide.
  • a heavy chain can comprise or consist of the amino acid sequence set forth in SEQ ID NO.:767 without the C-terminal lysine.
  • a heavy chain or a CH1-CH3 can comprise of the amino acid sequence set forth in SEQ ID NO.:6 or SEQ ID ID NO.:7 without the C-terminal lysine.
  • a “Fab” fragment antigen binding is the part of an antibody that binds to antigens and includes the variable region and CHI of the heavy chain linked to the light chain via an inter-chain disulfide bond. Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody yields a single large F(ab')2 fragment that roughly corresponds to two disulfide linked Fab fragments having divalent antigen-binding activity and is still capable of cross-linking antigen.
  • Both the Fab and F(ab’)2 are examples of "antigenbinding fragments.”
  • Fab' fragments differ from Fab fragments by having additional few residues at the carboxy terminus of the CHI domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • Fab fragments may be joined, e.g ., by a peptide linker, to form a single chain Fab, also referred to herein as "scFab.”
  • a linker serves in full or in part to link or connect the Fab fragments in a single polypeptide chain.
  • a heavy chain- derived Fab fragment e.g., comprising, consisting of, or consisting essentially of VH + CHI, or "Fd”
  • a light chain-derived Fab fragment e.g., comprising, consisting of, or consisting essentially of VL + CL
  • a scFab may be arranged, in N-terminal to C-terminal direction, according to (heavy chain Fab fragment - linker - light chain Fab fragment) or (light chain Fab fragment - linker - heavy chain Fab fragment).
  • Peptide linkers and exemplary linker sequences for use in scFabs are discussed in further detail herein.
  • Fv is a small antibody fragment that contains a complete antigen-recognition and antigen-binding site. This fragment generally consists of a dimer of one heavy- and one light-chain variable region domain in tight, non-covalent association. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although typically at a lower affinity than the entire binding site.
  • Single-chain Fv also abbreviated as “sFv” or “scFv”
  • sFv single-chain Fv
  • the scFv polypeptide comprises a polypeptide linker disposed between and linking the VH and VL domains that enables the scFv to retain or form the desired structure for antigen binding.
  • a peptide linker can be incorporated into a fusion polypeptide using standard techniques well known in the art.
  • the antibody or antigen-binding fragment comprises a scFv comprising a VH domain, a VL domain, and a peptide linker linking the VH domain to the VL domain.
  • a scFv comprises a VH domain linked to a VL domain by a peptide linker, which can be in a VH-linker- VL orientation or in a VL-linker-VH orientation.
  • Any scFv of the present disclosure may be engineered so that the C-terminal end of the VL domain is linked by a short peptide sequence to the N-terminal end of the VH domain, or vice versa (i.e., (N)VL(C)-linker-(N)VH(C) or (N)VH(C)-linker-(N)VL(C).
  • a linker may be linked to an N-terminal portion or end of the VH domain, the VL domain, or both.
  • linker sequence may also be included in a linker sequence.
  • Other amino acid sequences which may be usefully employed as linker include those disclosed in Maratea et al, Gene 40:3946 (1985); Murphy et al, Proc. Natl. Acad. Sci. USA 83:8258 8262 (1986); U.S. Pat. No.
  • linkers include those comprising or consisting of the amino acid sequence set forth in any one or more of SEQ ID NOs: 10-21.
  • the linker comprises or consists of an amino acid sequence having at least 75% (i.e., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) identity to the amino acid sequence set forth in any one of SEQ ID NOs: 10-21.
  • scFv can be constructed using any combination of the VH and VL sequences or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences disclosed herein.
  • linker sequences are not required; for example, when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.
  • an antibody or antigen-binding fragment of the present disclosure is monospecific (e.g ., binds to a single epitope) or is multispecific (e.g, binds to multiple epitopes and/or target molecules).
  • Antibodies and antigen binding fragments may be constructed in various formats. Exemplary antibody formats disclosed in Spiess et al., Mol. Immunol.
  • FIT-Ig e.g, PCT Publication No.
  • the antibody or antigen-binding fragment comprises two or more of VH domains, two or more VL domains, or both (i.e., two or more VH domains and two or more VL domains).
  • an antigenbinding fragment comprises the format (N-terminal to C-terminal direction) VH-linker-VL-linker-VH-linker-VL, wherein the two VH sequences can be the same or different and the two VL sequences can be the same or different.
  • Such linked scFvs can include any combination of VH and VL domains arranged to bind to a given target, and in formats comprising two or more VH and/or two or more VL, one, two, or more different eptiopes or antigens may be bound. It will be appreciated that formats incorporating multiple antigen-binding domains may include VH and/or VL sequences in any combination or orientation.
  • the antigen-binding fragment can comprise the format VL-linker-VH- linker-VL-linker-VH, VH-linker-VL-linker-VL-linker-VH, or VL-linker-VH- linker-VH-linker-VL.
  • Monospecific or multispecific antibodies or antigen-binding fragments of the present disclosure constructed comprise any combination of the VH and VL sequences and/or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences disclosed herein.
  • a bispecific or multispecific antibody or antigen-binding fragment may, in some embodiments, comprise one, two, or more antigen-binding domains (e.g ., a VH and a VL) of the instant disclosure.
  • the antibody or antigenbinding fragment can be multispecific; e.g., bispecific, trispecific, or the like.
  • the antibody or antigen-binding fragment comprises: (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH and the second VH are different and each independently comprise an amino acid sequence having at least 85% (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) dentity to the amino acid sequence set forth in any one of SEQ ID NOs.: 22, 32, 42, 52, 62, 72, 74, 84, 96, 106, 119, 129, 139, 150, 163, 173, 175, 178, 186, 189, 191, 198, 208, 218, 228, 240, 298, 312, 322, 332, 350, 351, 353, 359, 361, 363, 365, 367, 368, 369,
  • first VL and the second VL are different and each independently comprise an amino acid sequence having at least 85% (e.g ., having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 26, 36, 46, 56, 66, 78, 88, 94, 100, 110, 123, 133, 143, 154, 157, 168, 194, 196, 202, 212, 222, 232, 238, 244, 250, 252, 258, 268, 278, 288, 294, 296, 302, 308, 310, 316, 326, 336,
  • first VH and the first VL together form a first antigen-binding site
  • second VH and the second VL together form a second antigen-binding site
  • the antibody or antigen-binding fragment comprises (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH comprises an amino acid sequence having at least 85% (e.g., having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 139 and 342 and the first VL comprises an amino acid sequence having at least 85% (e.g., having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)identity to the amino acid sequence set forth in any one of SEQ ID NOs.
  • the second VH comprises an amino acid sequence having at least 85 (e.g, having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 399, 748, 749, 750, 752, 754, 756, 758, 759, and 761 and the second VL comprises an amino acid sequence having at least 85(e.g., having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.:403, 744, and 746.
  • the antibody or antigen-binding fragment comprises a Fc polypeptide, or a fragment thereof.
  • the "Fc" fragment or Fc polypeptide comprises the carboxy -terminal portions (i.e., the CH2 and CH3 domains of IgG) of both antibody H chains that, in general, are held together by disulfides.
  • Antibody “effector functions” refer to those biological activities attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype.
  • antibody effector functions include: Clq binding and complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation.
  • modifications e.g ., amino acid substitutions
  • Fc domain may be made to an Fc domain in order to modify (e.g., improve, reduce, or ablate) one or more functionality of an Fc-containing polypeptide (e.g, an antibody of the present disclosure).
  • Such functions include, for example, Fc receptor (FcR) binding, antibody half-life modulation (e.g., by binding to FcRn), ADCC function, protein A binding, protein G binding, and complement binding.
  • Amino acid modifications that modify (e.g., improve, reduce, or ablate) Fc functionalities include, for example, the T250Q/M428L, M252Y/S254T/T256E, H433K/N434F, M428L/N434S, E233P/L234V/L235A/G236 + A327G/A330S/P331S, E333A,
  • the Clq protein complex can bind to at least two molecules of IgGl or one molecule of IgM when the immunoglobulin molecule(s) is attached to the antigenic target (Ward, E. S., and Ghetie, V., Ther. Immunol. 2 (1995) 77-94). Burton, D. R., described (Mol. Immunol.
  • FcR binding can be mediated by the interaction of the Fc moiety (of an antibody) with Fc receptors (FcRs), which are specialized cell surface receptors on cells including hematopoietic cells.
  • Fc receptors belong to the immunoglobulin superfamily, and shown to mediate both the removal of antibody-coated pathogens by phagocytosis of immune complexes, and the lysis of erythrocytes and various other cellular targets (e.g. tumor cells) coated with the corresponding antibody, via antibody dependent cell mediated cytotoxicity (ADCC; Van de Winkel, J. G., and Anderson, C. L., J. Leukoc. Biol. 49 (1991) 511-524).
  • ADCC antibody dependent cell mediated cytotoxicity
  • FcRs are defined by their specificity for immunoglobulin classes; Fc receptors for IgG antibodies are referred to as FcyR, for IgE as FceR, for IgA as FcaR and so on and neonatal Fc receptors are referred to as FcRn.
  • Fc receptor binding is described for example in Ravetch, J. V., and Kinet, J. P., Annu. Rev. Immunol. 9 (1991) 457-492; Capel, P. J., et al., Immunomethods 4 (1994) 25-34; de Haas, M., et al., J Lab. Clin. Med. 126 (1995) 330-341; and Gessner, J. E., et al., Ann. Hematol. 76 (1998) 231-248.
  • FcyR Fc domain of native IgG antibodies
  • FcyR In humans, three classes of FcyR have been characterized to-date, which are: (i) FcyRI (CD64), which binds monomeric IgG with high affinity and is expressed on macrophages, monocytes, neutrophils and eosinophils; (ii) FcyRII (CD32), which binds complexed IgG with medium to low affinity, is widely expressed, in particular on leukocytes, is believed to be a central player in antibody- mediated immunity, and which can be divided into FcyRIIA, FcyRIIB and FcyRIIC, which perform different functions in the immune system, but bind with similar low affinity to the IgG-Fc, and the ectodomains of these receptors are highly homologuous; and (iii) FcyRIII (CD 16), which binds IgG with medium to low affinity and has been found in two forms: FcyRIIIA, which has been found on NK cells, macrophages,
  • FcyRIIA is found on many cells involved in killing (e.g. macrophages, monocytes, neutrophils) and seems able to activate the killing process.
  • FcyRIIB seems to play a role in inhibitory processes and is found on B-cells, macrophages and on mast cells and eosinophils. Importantly, it has been shown that 75% of all FcyRIIB is found in the liver (Ganesan, L. P. et al, 2012: “FcyRIIb on liver sinusoidal endothelium clears small immune complexes,” Journal of Immunology 189: 4981-4988).
  • FcyRIIB is abundantly expressed on Liver Sinusoidal Endothelium, called LSEC, and in Kupffer cells in the liver and LSEC are the major site of small immune complexes clearance (Ganesan, L. P. et al, 2012: FcyRIIb on liver sinusoidal endothelium clears small immune complexes. Journal of Immunology 189: 4981-4988).
  • the antibodies disclosed herein and the antigenbinding fragments thereof comprise an Fc polypeptide or fragment thereof for binding to FcyRIIb, in particular an Fc region, such as, for example IgG-type antibodies.
  • FcyRIIb an Fc region
  • it is possible to engineer the Fc moiety to enhance FcyRIIB binding by introducing the mutations S267E and L328F as described by Chu, S. Y. et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies.
  • Molecular Immunology 45, 3926-3933 are examples of the FcyRIIb.
  • the antibodies of the present disclosure comprise an engineered Fc moiety with the mutations S267E and L328F, in particular as described by Chu, S. Y. et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies.
  • FcyRIIB may function to suppress further immunoglobulin production and isotype switching to, for example, the IgE class.
  • FcyRIIB On macrophages, FcyRIIB is thought to inhibit phagocytosis as mediated through FcyRIIA.
  • the B form On eosinophils and mast cells, the B form may help to suppress activation of these cells through IgE binding to its separate receptor.
  • modification in native IgG of at least one of E233- G236, P238, D265, N297, A327 and P329 reduces binding to FcyRI.
  • IgG2 residues at positions 233-236, substituted into corresponding positions IgGl and IgG4, reduces binding of IgGl and IgG4 to FcyRI by 10 3 -fold and eliminated the human monocyte response to antibody-sensitized red blood cells (Armour, K. L., et al. Eur. J. Immunol. 29 (1999) 2613-2624).
  • FcyRII binding reduced binding for FcyRIIA is found, e.g., for IgG mutation of at least one of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, R292 and K414.
  • Two allelic forms of human FcyRIIA are the "H131" variant, which binds to IgGl Fc with high affinity, and the "R131" variant, which binds to IgGl Fc with low affinity. See , e.g., Bruhns et al. , Blood 773:3716-3725 (2009).
  • FcyRIII binding reduced binding to FcyRIIIA is found, e.g., for mutation of at least one of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, S239, E269, E293, Y296, V303, A327, K338 and D376. Mapping of the binding sites on human IgGl for Fc receptors, the above- mentioned mutation sites, and methods for measuring binding to FcyRI and FcyRIIA, are described in Shields, R. L., et al., ./. Biol. Chem. 276 (2001) 6591 - 6604.
  • FcyRIIIA Two allelic forms of human FcyRIIIA are the "FI 58" variant, which binds to IgGl Fc with low affinity, and the "VI 58" variant, which binds to IgGl Fc with high affinity. See , e.g., Bruhns et al, Blood 773:3716-3725 (2009).
  • two regions of native IgG Fc appear to be involved in interactions between FcyRIIs and IgGs, namely (i) the lower hinge site of IgG Fc, in particular amino acid residues L, L, G, G (234 - 237, EU numbering), and (ii) the adjacent region of the CH2 domain of IgG Fc, in particular a loop and strands in the upper CH2 domain adjacent to the lower hinge region, e.g. in a region of P331 (Wines, B.D., et al., J. Immunol. 2000;
  • FcyRI appears to bind to the same site on IgG Fc
  • FcRn and Protein A bind to a different site on IgG Fc, which appears to be at the CH2-CH3 interface
  • mutations that increase binding affinity of an Fc polypeptide or fragment thereof of the present disclosure to a (i.e., one or more) Fey receptor (e.g., as compared to a reference Fc polypeptide or fragment thereof or containing the same that does not comprise the mutation(s)). See, e.g., Delillo and Ravetch, Cell 161(5): 1035-1045 (2015) and Ahmed et al., J. Struc. Biol. 194(1):78 (2016), the Fc mutations and techniques of which are incorporated herein by reference.
  • an antibody or antigen-binding fragment can comprise a Fc polypeptide or fragment thereof comprising a mutation selected from G236A; S239D; A330L; and I332E; or a combination comprising any two or more of the same; e.g., S239D/I332E; S239D/A330L/I332E;
  • G236 A/S239D/I332E G236A/A330L/I332E (also referred to herein as "GAALIE”); or G236A/S239D/A330L/I332E.
  • the Fc polypeptide or fragment thereof does not comprise S239D.
  • the Fc polypeptide or fragment thereof may comprise or consist of at least a portion of an Fc polypeptide or fragment thereof that is involved in binding to FcRn binding.
  • the Fc polypeptide or fragment thereof comprises one or more amino acid modifications that improve binding affinity for (e.g, enhance binding to) FcRn (e.g, at a pH of about 6.0) and, in some embodiments, thereby extend in vivo half-life of a molecule comprising the Fc polypeptide or fragment thereof (e.g., as compared to a reference Fc polypeptide or fragment thereof or antibody that is otherwise the same but does not comprise the modification(s)).
  • the Fc polypeptide or fragment thereof comprises or is derived from a IgG Fc and a half-life-extending mutation comprises any one or more of: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I Q31 II; D376V; T307A; E380A (EU numbering).
  • a half-life-extending mutation comprises M428L/N434S (also referred to herein as "MLNS").
  • a half-life-extending mutation comprises M252Y/S254T/T256E.
  • a half-life-extending mutation comprises T250Q/M428L. In certain embodiments, a half-life-extending mutation comprises P257EQ311I. In certain embodiments, a half-life-extending mutation comprises P257I/N434H. In certain embodiments, a half-life-extending mutation comprises D376V/N434H. In certain embodiments, a half-life-extending mutation comprises T307A/E380A/N434A. In some embodiments, an antibody or antigen-binding fragment includes a Fc moiety that comprises the substitution mtuations M428L/N434S.
  • an antibody or antigen-binding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mtuations G236A/A330L/I332E.
  • an antibody or antigen-binding fragment includes a (e.g., IgG) Fc moiety that comprises a G236A mutation, an A330L mutation, and a I332E mutation (GAALIE), and does not comprise a S239D mutation (e.g., comprises a native S at position 239).
  • an antibody or antigen-binding fragment includes an Fc polypeptide or fragment thereof that comprises the substitution mutations: M428L/N434S and G236A/A330L/I332E, and optionally does not comprise S239D.
  • an antibody or antigen-binding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mutations: M428L/N434S and G236A/S239D/A330L/I332E.
  • the antibody or antigen-binding fragment comprises a mutation that alters glycosylation, wherein the mutation that alters glycosylation comprises N297A, N297Q, or N297G, and/or the antibody or antigen-binding fragment is partially or fully aglycosylated and/or is partially or fully afucosylated.
  • Host cell lines and methods of making partially or fully aglycosylated or partially or fully afucosylated antibodies and antigen-binding fragments are known (see, e.g., PCT Publication No. WO 2016/181357; Suzuki et al. Clin. Cancer Res. 73(6):1875-82 (2007); Huang et al. MAbs 6:1-12 (2018)).
  • the antibody or antigen-binding fragment is capable of eliciting continued protection in vivo in a subject even once no detectable levels of the antibody or antigen-binding fragment can be found in the subject (i.e., when the antibody or antigen-binding fragment has been cleared from the subject following administration). Such protection is referred to herein as a vaccinal effect. Without wishing to be bound by theory, it is believed that dendritic cells can internalize complexes of antibody and antigen and thereafter induce or contribute to an endogenous immune response against antigen.
  • an antibody or antigen-binding fragment comprises one or more modifications, such as, for example, mutations in the Fc comprising G236A, A330L, and I332E, that are capable of activating dendritic cells that may induce, e.g ., T cell immunity to the antigen.
  • the antibody or antigen-binding fragment comprises a Fc polypeptide or a fragment thereof, including a CH2 (or a fragment thereof, a CH3 (or a fragment thereof), or a CH2 and a CH3, wherein the CH2, the CH3, or both can be of any isotype and may contain amino acid substitutions or other modifications as compared to a corresponding wild-type CH2 or CH3, respectively.
  • a Fc polypeptide of the present disclosure comprises two CH2-CH3 polypeptides that associate to form a dimer.
  • the antibody or antigen-binding fragment can be monoclonal.
  • the term "monoclonal antibody” (mAh) as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present, in some cases in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that include different antibodies directed against different epitopes, each monoclonal antibody is directed against a single epitope of the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies.
  • monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology first described by Kohler et al., Nature 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal, or plant cells (see, e.g, U.S. Pat. No. 4,816,567).
  • Monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991), for example.
  • Monoclonal antibodies may also be obtained using methods disclosed in PCT Publication No. WO 2004/076677A2.
  • Antibodies and antigen-binding fragments of the present disclosure include "chimeric antibodies" in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see, U.S. Pat. Nos. 4,816,567; 5,530,101 and 7,498,415; and Morrison et al, Proc. Natl. Acad. Sci. USA, 57:6851-6855 (1984)).
  • chimeric antibodies may comprise human and non-human residues.
  • chimeric antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. For further details, see Jones et al, Nature 321 :522-525 (1986); Riechmann et al, Nature 332:323-329 (1988); and Presta, Curr. Op. Struct.
  • Chimeric antibodies also include primatized and humanized antibodies.
  • a “humanized antibody” is generally considered to be a human antibody that has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are typically taken from a variable domain. Humanization may be performed following the method of Winter and co-workers (Jones et al, Nature, 321:522-525 (1986); Reichmann et al, Nature, 332:323-327 (1988); Verhoeyen et al, Science, 239:1534-1536 (1988)), by substituting non-human variable sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized” antibodies are chimeric antibodies (U.S. Pat. Nos.
  • a “humanized” antibody is one which is produced by a non-human cell or animal and comprises human sequences, e.g ., He domains.
  • human antibody is an antibody containing only sequences that are present in an antibody that is produced by a human.
  • human antibodies may comprise residues or modifications not found in a naturally occurring human antibody (e.g, an antibody that is isolated from a human), including those modifications and variant sequences described herein. These are typically made to further refine or enhance antibody performance.
  • human antibodies are produced by transgenic animals. For example, see U.S. Pat. Nos. 5,770,429; 6,596,541 and 7,049,426.
  • an antibody or antigen-binding fragment of the present disclosure is chimeric, humanized, or human.
  • an antibody or antigen-binding fragment of the present disclosure is capable of binding to a SARS-CoV-2 surface glycoprotein with an EC50 of less than 500 ng/ml, less than 250 ng/ml, less than 100 ng/ml, less than 90 ng/ml, less than 80 ng/ml, less than 70 ng/ml, less than 60 ng/ml, less than 50 ng/ml, less than 40 ng/ml, less than 30 ng/ml, less than 25 ng/ml, less than 20 ng/ml, less than 16 ng/ml, less than 15 ng/ml, less than 14 ng/ml, less than 13 ng/ml, less than 12 ng/ml, less than 10 ng/ml, less than 9 ng/ml, less than 8 ng/ml, less than 7 ng/ml, less than 6 ng/ml, less than 5 ng/ml, less than 4 ng/ml
  • antibody or antigen-binding fragment of the present disclosure is capable of binding to a SARS-CoV-2 surface glycoprotein RBD with an EC50 of less than 500 ng/ml, less than 250 ng/ml, less than 100 ng/ml, less than 90 ng/ml, less than 80 ng/ml, less than 70 ng/ml, less than 60 ng/ml, less than 50 ng/ml, less than 40 ng/ml, less than 30 ng/ml, less than 25 ng/ml, less than 20 ng/ml, less than 16 ng/ml, less than 15 ng/ml, less than 14 ng/ml, less than 13 ng/ml, less than 12 ng/ml, less than 10 ng/ml, less than 9 ng/ml, less than 8 ng/ml, less than 7 ng/ml, less than 6 ng/ml, less than 5 ng/ml, less than 4 ng/m
  • antibody or antigen-binding fragment of the present disclosure is capable of binding to a SARS-CoV-2 RBD with a KD of less than 5 x 10 -8 M, less than 4 x 10 -8 M, less than 3 x 10 -8 M, less than 2 x 10 -8 M, less than 1 x 10 -8 M, less than 5 x 10 -9 M, less than 1 x 10 -9 M, less than 5 x 10 -10 M, less than 1 x 10 -10 M, less than 5 x 10 -11 M, less than 1 x 10 -11 M, less than 5 x 10 -12 M, or less than 1 x 10 -12 M, as determined using biolayer interferometry (BLI), optionally using an Octet instrument with antibody or antigen-binding fragment loaded on Protein A pins, optionally at 2.7 ⁇ g/ml, and SARS-CoV-2 RBD loaded for 5 minutes at 6 ⁇ g/ml, 1.5 ⁇ g/ml, or 0.4 ⁇ g/
  • antibody or antigen-binding fragment of the present disclosure is capable of binding to a SARS-CoV-2 RBD with a KD of less than 6 x 10 -8 M, less than 5 x 10 -8 M, less than 4 x 10 -8 M, less than 3 x 10 -8 M, less than 2 x 10 -8 M, less than 1 x 10 -8 M, less than 5 x 10 -9 M, less than 4 x 10 -9 M, less than 3 x 10 -9 M, less than 2 x 10 -9 M, less than 1 x 10 -9 M, or less than 8 x 10 -10 M, as determined using surface plasmon resonance (SPR), optionally using a Biacore T200 instrument using a single-cycle kinetics approach.
  • SPR surface plasmon resonance
  • antibody or antigen-binding fragment of the present disclosure is capable of binding to a SARS-CoV-2 RBD and inhibiting an interaction between (i) the RBD and (ii) a human ACE2 and/or a human SIGLEC-1.
  • antibody or antigen-binding fragment of the present disclosure is capable of neutralizing: (i) infection by a SARS-CoV-2 pseudovirus, optionally: (i)(a) with a neutralization IC50 of less than 100 ng/ml, less than 90 ng/ml, less than 80 ng/ml, less than 70 ng/ml, less than 60 ng/ml, less than 50 ng/ml, less than 40 ng/ml, less than 30 ng/ml, less than 25 ng/ml, less than 20 ng/ml, less than 15 ng/ml, less than 10 ng/ml, less than 9 ng/ml, less than 8 ng/ml, less than 7 ng/ml, less than 6 ng/ml, less than 5 ng/ml, less than 4 ng/ml, less than 3 ng/ml, less than 2 ng/ml, or less than 1 ng/ml, preferably less than 10 ng/ml,
  • a HEK293T cell that expresses, optionally is engineered to overexpress, DC-SIGN, L-SIGN, SIGLEC, or ACE2; and/or (iv) infection by live SARS-CoV-2 in a host cell (e.g. a HEK293T cell) that expresses, optionally is engineered to overexpress, SIGLEC- 1 or ACE2, wherein neutralizing infection comprises fully neutralizing infection.
  • an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing infection by a SARS-CoV-2 variant that comprises any one of the following mutations in the surface glycoprotein as compared to a SARS- CoV-2 surface glycoprotein comprising SEQ ID NO.:3: N501Y; S477N; N439K; L452R; E484K; K417N; T478K; S494P; A520S; N501T; A522S; Y453F; P384L.
  • an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing infection by the SARS-CoV-2 variant with a potency that is less than 3-fold lower than the potency with which the antibody or antigen-binding fragment neutralizes infection by a SARS-CoV-2 comprising the surface glycoprotein amino acid sequence set forth in SEQ ID NO.:3.
  • an antibody or antigen-binding fragment of the present disclosure is capable of activating a FcyRIIa, a FcyRIIIa, or both, wherein, optionally :(i) the FcyRIIa comprises a H131 allele; and/or (ii) the FcyRIIIa comprises a V158 allele; and/or (iii) activation is determined using a SARS-CoV-2 S-expressing target cell, such as a CHO cell, and a reporter cell expressing a NFAT-driven reporter, such as luciferase.
  • an antibody or antigen-binding fragment of the present disclosure has an in vivo half-life in a non-human primate of between 20 and 30 days, or between 22 and 28 days, or between 23 and 27 days, or between 24 and 26 days, or of about 25 days.
  • an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 20 to about 30 ng/ml.
  • an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 10 to about 20 ng/ml.
  • an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 5 to about 10 ng/ml. In some embodiments, an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 1 to about 5 ng/ml.
  • an antibody or antigen-binding fragment of the present disclosure is capable of neutralizing infection by SARS-CoV-2 and does not compete with a human ACE2 for binding to the SARS-CoV-2S protein, wherein, optionally, the neutralizing comprises neutralizing infection in an in vitro model of infection.
  • an antibody or antigen-binding fragment of the present disclosure that competes for binding to a SARS-CoV-2 surface glycoprotein with an antibody or antigen-binding fragment of the present disclosure.
  • the present disclosure provides isolated polynucleotides that encode any of the presently disclosed antibodies or an antigen-binding fragment thereof, or a portion thereof (e.g ., a CDR, a VH, a VL, a heavy chain, or a light chain).
  • the polynucleotide is codon-optimized for expression in a host cell.
  • codon optimization can be performed using known techniques and tools, e.g., using the GenScript® OptimiumGeneTM tool; see also Scholten etal., Clin. Immunol. 119: 135, 2006).
  • Codon-optimized sequences include sequences that are partially codon-optimized ⁇ i.e., one or more codon is optimized for expression in the host cell) and those that are fully codon-optimized.
  • polynucleotides encoding antibodies and antigenbinding fragments of the present disclosure may possess different nucleotide sequences while still encoding a same antibody or antigen-binding fragment due to, for example, the degeneracy of the genetic code, splicing, and the like.
  • the polynucleotide comprises a polynucleotide having at least 50% (i.e., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the polynucleotide sequence according to any one or more of SEQ ID NOs.:30, 31, 40, 41, 50, 51, 60, 61, 70, 71, 73, 82, 83, 92, 93, 95, 104, 105, 114, 115, 116, 117, 118, 127, 128, 137, 138, 206, 207, 216, 217, 226, 227, 236, 237, 239, 248, 249, 251, 253, 262, 263, 272, 273,
  • a polynucleotide comprises (i) a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity to, or that comprises or consists of, the nucleotide sequence set forth in SEQ ID NO.:407; and (ii) a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity to, or that comprises or consists of, the nucleotide sequence set forth in SEQ ID NO.:408, 737, or 739.
  • the polynucleotide can comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • the RNA comprises messenger RNA (mRNA).
  • Vectors are also provided, wherein the vectors comprise or contain a polynucleotide as disclosed herein (e.g ., a polynucleotide that encodes an antibody or antigen-binding fragment that binds to SARS-CoV-2).
  • a vector can comprise any one or more of the vectors disclosed herein.
  • a vector is provided that comprises a DNA plasmid construct encoding the antibody or antigen-binding fragment, or a portion thereof (e.g., so-called "DMAb”; see, e.g, Muthumani et al, J Infect Dis. 214(3)369 -378 (2016); Muthumani etal., Hum Vaccin Immunother 9: 2253-2262 (2013));
  • a DNA plasmid construct comprises a single open reading frame encoding a heavy chain and a light chain (or a VH and a VL) of the antibody or antigen-binding fragment, wherein the sequence encoding the heavy chain and the sequence encoding the light chain are optionally separated by polynucleotide encoding a protease cleavage site and/or by a polynucleotide encoding a self-cleaving peptide.
  • the substituent components of the antibody or antigen-binding fragment are encoded by a polynucleotide comprised in a single plasmid. In other embodiments, the substituent components of the antibody or antigen-binding fragment are encoded by a polynucleotide comprised in two or more plasmids (e.g ., a first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL).
  • a first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH
  • a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL.
  • a single plasmid comprises a polynucleotide encoding a heavy chain and/or a light chain from two or more antibodies or antigenbinding fragments of the present disclosure.
  • An exemplary expression vector is pVaxl, available from Invitrogen®.
  • a DNA plasmid of the present disclosure can be delivered to a subject by, for example, electroporation (e.g., intramuscular electroporation), or with an appropriate formulation (e.g, hyaluronidase).
  • the present disclosure also provides a host cell expressing an antibody or antigen-binding fragment according to the present disclosure; or comprising or containing a vector or polynucleotide according the present disclosure.
  • the cells include but are not limited to, eukaryotic cells, e.g., yeast cells, animal cells, insect cells, plant cells; and prokaryotic cells, including E. coli.
  • the cells are mammalian cells.
  • the cells are a mammalian cell line such as CHO cells (e.g, DHFR- CHO cells (Urlaub et al, PNAS 77:4216 (1980)), human embryonic kidney cells (e.g, HEK293T cells), PER.C6 cells, Y0 cells, Sp2/0 cells.
  • NS0 cells human liver cells, e.g. Hepa RG cells, myeloma cells or hybridoma cells.
  • mammalian host cell lines include mouse sertoli cells (e.g, TM4 cells); monkey kidney CV1 line transformed by SV40 (COS-7); baby hamster kidney cells (BHK); African green monkey kidney cells (VERO-76); monkey kidney cells (CV1); human cervical carcinoma cells (HELA); human lung cells (W138); human liver cells (Hep G2); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3 A); mouse mammary tumor (MMT 060562); TRI cells; MRC 5 cells; and FS4 cells.
  • Mammalian host cell lines suitable for antibody production also include those described in, for example, Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (B. K. C. Lo, ed., Humana Press, Totowa, N.J.), pp. 255-268 (2003).
  • a host cell is a prokaryotic cell, such as an E. coli.
  • a prokaryotic cell such as an E. coli.
  • the expression of peptides in prokaryotic cells such as E. coli is well established (see, e.g., Pluckthun, A. Bio/Technology 9:545-551 (1991).
  • antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed.
  • For expression of antibody fragments and polypeptides in bacteria see, e.g., U.S. Pat. Nos. 5,648,237; 5,789,199; and 5,840,523.
  • the cell may be transfected with a vector according to the present description with an expression vector.
  • transfection refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g. mRNA) molecules, into cells, such as into eukaryotic cells.
  • RNA e.g. mRNA
  • transfection encompasses any method known to the skilled person for introducing nucleic acid molecules into cells, such as into eukaryotic cells, including into mammalian cells.
  • Such methods encompass, for example, electroporation, lipofection, e.g, based on cationic lipids and/or liposomes, calcium phosphate precipitation, nanoparticle based transfection, virus based transfection, or transfection based on cationic polymers, such as DEAE-dextran or polyethylenimine, etc.
  • the introduction is non-viral.
  • host cells of the present disclosure may be transfected stably or transiently with a vector according to the present disclosure, e.g. for expressing an antibody, or an antigen-binding fragment thereof, according to the present disclosure.
  • the cells may be stably transfected with the vector as described herein.
  • cells may be transiently transfected with a vector according to the present disclosure encoding an antibody or antigen-binding fragment as disclosed herein.
  • a polynucleotide may be heterologous to the host cell.
  • the present disclosure also provides recombinant host cells that heterologously express an antibody or antigen-binding fragment of the present disclosure.
  • the cell may be of a species that is different to the species from which the antibody was fully or partially obtained (e.g ., CHO cells expressing a human antibody or an engineered human antibody).
  • the cell type of the host cell does not express the antibody or antigen-binding fragment in nature.
  • the host cell may impart a post-translational modification (PTM; e.g., glysocylation or fucosylation) on the antibody or antigen-binding fragment that is not present in a native state of the antibody or antigen-binding fragment (or in a native state of a parent antibody from which the antibody or antigen binding fragment was engineered or derived).
  • PTM post-translational modification
  • Such a PTM may result in a functional difference (e.g, reduced immunogenicity).
  • an antibody or antigen-binding fragment of the present disclosure that is produced by a host cell as disclosed herein may include one or more post-translational modification that is distinct from the antibody (or parent antibody) in its native state (e.g, a human antibody produced by a CHO cell can comprise a more post-translational modification that is distinct from the antibody when isolated from the human and/or produced by the native human B cell or plasma cell).
  • Insect cells useful expressing a binding protein of the present disclosure include, for example, Spodoptera frugipera Sf9 cells, Trichoplusia ni BTI-TN5B1-4 cells, and Spodoptera frugipera SfSWTOl “MimicTM” cells. See, e.g., Palmberger et al., J. Biotechnol. 753(3-4): 160-166 (2011). Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for transfection of Spodoptera frugiperda cells.
  • Eukaryotic microbes such as filamentous fungi or yeast are also suitable hosts for cloning or expressing protein-encoding vectors, and include fungi and yeast strains with "humanized” glycosylation pathways, resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat.
  • Plant cells can also be utilized as hosts for expressing a binding protein of the present disclosure.
  • PLANTIBODIESTM technology described in, for example, U.S. Pat. Nos. 5,959,177; 6,040,498; 6,420,548;
  • the host cell comprises a mammalian cell.
  • the host cell is a CHO cell, a HEK293 cell, a PER.C6 cell, a Y0 cell, a Sp2/0 cell, aNSO cell, a human liver cell, a myeloma cell, or a hybridoma cell.
  • the present disclosure provides methods for producing an antibody, or antigen-binding fragment, wherein the methods comprise culturing a host cell of the present disclosure under conditions and for a time sufficient to produce the antibody, or the antigen-binding fragment.
  • Methods useful for isolating and purifying recombinantly produced antibodies may include obtaining supernatants from suitable host cell/vector systems that secrete the recombinant antibody into culture media and then concentrating the media using a commercially available filter. Following concentration, the concentrate may be applied to a single suitable purification matrix or to a series of suitable matrices, such as an affinity matrix or an ion exchange resin. One or more reverse phase HPLC steps may be employed to further purify a recombinant polypeptide. These purification methods may also be employed when isolating an immunogen from its natural environment.
  • Methods for large scale production of one or more of the isolated/recombinant antibody described herein include batch cell culture, which is monitored and controlled to maintain appropriate culture conditions. Purification of soluble antibodies may be performed according to methods described herein and known in the art and that comport with laws and guidelines of domestic and foreign regulatory agencies.
  • compositions that comprise any one or more of the presently disclosed antibodies, antigen-binding fragments, polynucleotides, vectors, or host cells, singly or in any combination, and can further comprise a pharmaceutically acceptable carrier, excipient, or diluent. Carriers, excipients, and diluents are discussed in further detail herein.
  • a composition comprises two or more different antibodies or antigen-binding fragments according to the present disclosure.
  • antibodies or antigen-binding fragments to be used in a combination each independently have one or more of the following characteristics: neutralize naturally occurring SARS-CoV-2 variants; do not compete with one another for Spike protein binding; bind distinct Spike protein epitopes; have a reduced formation of resistance to SARS-CoV-2; when in a combination, have a reduced formation of resistance to SARS-CoV-2; potently neutralize live SARS-CoV-2 virus; exhibit additive or synergistic effects on neutralization of live SARS-CoV-2 virus when used in combination; exhibit effector functions; are protective in relevant animal model(s) of infection; are capable of being produced in sufficient quantities for large-scale production.
  • a composition comprises two or more different antibodies or antigen-binding fragments, which can be two or more presently disclosed antibodies or antigen-binding fragments.
  • an antibody or antigen-binding fragment thereof can be comprised in a composition that further comprises an antibody or antigen-binding fragment that comprises: (i) CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:343-345 and 347-349, respectively; or (ii) CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.: 140-142 and 144-146, respectively; or (iii) VH and VL amino acid sequences as set forth in SEQ ID NOs.:342 and 346, respectively; or (iv) VH and VL amino acid sequences as set forth in SEQ ID NOs.: 139 and 143,
  • a composition comprises a first antibody or antigen binding fragment, comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 32 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 36; and a second antibody or antigen- binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 139, and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 143.
  • a composition comprises a first antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 33-35, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 37-39, respectively, and a second antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid
  • a composition comprises a first antibody or antigenbinding fragment, comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 139 or 342 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 143 or 346; and a second antibody or antigen-binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 399, 748, 749, 750, 752, 754, 756, 758, 759, or 761, and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 403, 744, or 746.
  • compositions that comprise (i) a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and inhibiting an interaction between the SARS-CoV-2 surface glycoprotein and a first cell surface receptor selected from ACE2, DC-SIGN, L-SIGN, and SIGLEC-1; and (ii) a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and inhibiting an interaction between the SARS-CoV-2 surface glycoprotein and a second cell surface receptor selected from ACE2, DC-SIGN, L-SIGN, and SIGLEC-1, wherein the first cell surface receptor and the second cell surface receptor are different.
  • neutralization of infection can be achieved or improved by combingin antibodies or antigen-binding fragments, the binding of which to SARS-CoV-2 inhibits interactions between the SARS-CoV-2 and two or more cell surface receptors; e.g. , an attachment receptor and an entry receptor, two entry receptors, two attachment receptors, or the like.
  • Methods of using such antibody combinations to treat or prevent a SARS-CoV-2 infection are also provided.
  • a composition comprises a first vector comprising a first plasmid, and a second vector comprising a second plasmid, wherein the first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL of the antibody or antigen-binding fragment thereof.
  • a composition comprises a polynucleotide (e.g., mRNA) coupled to a suitable delivery vehicle or carrier.
  • Exemplary vehicles or carriers for administration to a human subject include a lipid or lipid-derived delivery vehicle, such as a liposome, solid lipid nanoparticle, oily suspension, submicron lipid emulsion, lipid microbubble, inverse lipid micelle, cochlear liposome, lipid microtubule, lipid microcylinder, or lipid nanoparticle (LNP) or a nanoscale platform (see, e.g., Li et al. Wilery Interdiscip Rev. Nanomed Nanobiotechnol. 77(2):el530 (2019)).
  • LNP lipid nanoparticle
  • Principles, reagents, and techniques for designing appropriate mRNA and and formulating mRNA-LNP and delivering the same are described in, for example, Pardi et al.
  • lipid nanoparticles e.g, ionizable cationic lipid/phosphatidylcholine/cholesterol/PEG-lipid; ionizable lipid:distearoyl PC:cholesterol:polyethylene glycol lipid
  • subcutaneous, intramuscular, intradermal, intravenous, intraperitoneal, and intratracheal administration of the same, are incorporated herein by reference.
  • Methods of diagnosis may include contacting an antibody, antibody fragment (e.g., antigen binding fragment) with a sample.
  • Such samples may be isolated from a subject, for example an isolated tissue sample taken from, for example, nasal passages, sinus cavities, salivary glands, lung, liver, pancreas, kidney, ear, eye, placenta, alimentary tract, heart, ovaries, pituitary, adrenals, thyroid, brain, skin or blood.
  • the methods of diagnosis may also include the detection of an antigen/antibody complex, in particular following the contacting of an antibody or antibody fragment with a sample.
  • Such a detection step can be performed at the bench, i.e. without any contact to the human or animal body.
  • detection methods are well-known to the person skilled in the art and include, e.g ., ELISA (enzyme-linked immunosorbent assay), including direct, indirect, and sandwich ELISA.
  • Other detection methods include, but are not limited to, immunohistochemistry (IHC), flow cytometry (e.g, FACS), Western blot, immunocytochemistry (ICC), enzyme-linked immunospot (ELISPOT), and immunoprecipitation (IP).
  • IHC immunohistochemistry
  • FACS flow cytometry
  • ICC immunocytochemistry
  • ELISPOT enzyme-linked immunospot
  • IP immunoprecipitation
  • Antibodies and antigen-binding fragments used in detection methods can be, for example, fluorescently or otherwise detectably labeled (e.g., directly conjugated to a fluorophore or comprising a fluorophore- secondary conjugate).
  • Treatment refers to medical management of a disease, disorder, or condition of a subject (e.g, a human or non-human mammal, such as a primate, horse, cat, dog, goat, mouse, or rat).
  • an appropriate dose or treatment regimen comprising an antibody or composition of the present disclosure is administered in an amount sufficient to elicit a therapeutic or prophylactic benefit.
  • Therapeutic or prophylactic/preventive benefit includes improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay or prevention of disease progression; remission; survival; prolonged survival; or any combination thereof.
  • therapeutic or prophylactic/preventive benefit includes reduction or prevention of hospitalization for treatment of a SARS-CoV-2 infection (i.e., in a statistically significant manner).
  • therapeutic or prophylactic/preventive benefit includes a reduced duration of hospitalization for treatment of a SARS-CoV-2 infection (i.e., in a statistically significant manner).
  • therapeutic or prophylactic/preventive benefit includes a reduced or abrogated need for respiratory intervention, such as intubation and/or the use of a respirator device.
  • therapeutic or prophylactic/preventive benefit includes reversing a late-stage disease pathology and/or reducing mortality.
  • a “therapeutically effective amount” or “effective amount” of an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition of this disclosure refers to an amount of the composition or molecule sufficient to result in a therapeutic effect, including improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay of disease progression; remission; survival; or prolonged survival in a statistically significant manner.
  • a therapeutically effective amount refers to the effects of that ingredient or cell expressing that ingredient alone.
  • a therapeutically effective amount refers to the combined amounts of active ingredients or combined adjunctive active ingredient with a cell expressing an active ingredient that results in a therapeutic effect, whether administered serially, sequentially, or simultaneously.
  • a combination may comprise, for example, two different antibodies that specifically bind a SARS- CoV-2 antigen, which in certain embodiments, may be the same or different SARS-CoV-2 antigen, and/or can comprise the same or different epitopes.
  • methods for treating a SARS-CoV-2 infection in a subject, wherein the methods comprise administering to the subject an effective amount of an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition as disclosed herein.
  • Subjects that can be treated by the present disclosure are, in general, human and other primate subjects, such as monkeys and apes for veterinary medicine purposes. Other model organisms, such as mice and rats, may also be treated according to the present disclosure.
  • the subject may be a human subject.
  • the subjects can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric subjects.
  • a subject treated according to the present disclosure comprises one or more risk factors.
  • a human subject treated according to the present disclosure is an infant, a child, a young adult, an adult of middle age, or an elderly person. In certain embodiments, a human subject treated according to the present disclosure is less than 1 year old, or is 1 to 5 years old, or is between 5 and 125 years old (e.g, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100,
  • a human subject treated according to the present disclosure is 0- 19 years old, 20-44 years old, 45-54 years old, 55-64 years old, 65-74 years old, 75-84 years old, or 85 years old, or older. Persons of middle, and especially of elderly age are believed to be at particular risk.
  • the human subject is 45-54 years old, 55-64 years old, 65-74 years old, 75-84 years old, or 85 years old, or older.
  • the human subject is biologically male. In some embodiments, the human subject is biologically female.
  • a human subject treated according to the present disclosure is a resident of a nursing home or a long-term care facility, is a hospice care worker, is a healthcare provider or healthcare worker, is a first responder, is a family member or other close contact of a subject diagnosed with or suspected of having a SARS-CoV-2 infection, is overweight or clinically obese, is or has been a smoker, has or had chronic obstructive pulmonary disease (COPD), is asthmatic (e.g., having moderate to severe asthma), has an autoimmune disease or condition (e.g, diabetes), and/or has a compromised or depleted immune system (e.g, due to AIDS/HIV infection, a cancer such as a blood cancer, a lymphodepleting therapy such as a chemotherapy, a bone marrow or organ transplantation, or a genetic immune condition), has chronic liver disease, has cardiovascular disease, has a pulmonary or heart defect, works or otherwise spends time in close proximity with others, such as in a factory, shipping center, hospital
  • COPD
  • a subject treated according to the present disclosure has received a vaccine for SARS-CoV-2 and the vaccine is determined to be ineffective (i.e., at least partially, or completely, ineffective), e.g ., by post-vaccine infection or symptoms in the subject, by clinical diagnosis or scientific or regulatory consensus.
  • treatment is administered as peri-exposure prophylaxis.
  • treatment is administered to a subject with mild-to-moderate disease, which may be in an outpatient setting.
  • treatment is administered to a subject with moderate-to-severe disease, such as requiring hospitalization.
  • Typical routes of administering the presently disclosed compositions thus include, without limitation, oral, topical, transdermal, inhalation, parenteral, sublingual, buccal, rectal, vaginal, and intranasal.
  • parenteral includes subcutaneous injections, intravenous, intramuscular, intrasternal injection or infusion techniques.
  • administering comprises administering by a route that is selected from oral, intravenous, parenteral, intragastric, intrapleural, intrapulmonary, intrarectal, intradermal, intraperitoneal, intratumoral, subcutaneous, topical, transdermal, intracisternal, intrathecal, intranasal, and intramuscular.
  • a method comprises orally administering the antibody, antigenbinding fragment, polynucleotide, vector, host cell, or composition to the subject.
  • compositions according to certain embodiments of the present invention are formulated so as to allow the active ingredients contained therein to be bioavailable upon administration of the composition to a patient.
  • Compositions that will be administered to a subject or patient may take the form of one or more dosage units, where for example, a tablet may be a single dosage unit, and a container of a herein described an antibody or antigen-binding in aerosol form may hold a plurality of dosage units.
  • Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practice of Pharmacy, 20th Edition (Philadelphia College of Pharmacy and Science, 2000).
  • composition to be administered will, in any event, contain an effective amount of an antibody or antigen-binding fragment, polynucleotide, vector, host cell, or composition of the present disclosure, for treatment of a disease or condition of interest in accordance with teachings herein.
  • a composition may be in the form of a solid or liquid.
  • the carrier(s) are particulate, so that the compositions are, for example, in tablet or powder form.
  • the carrier(s) may be liquid, with the compositions being, for example, an oral oil, injectable liquid or an aerosol, which is useful in, for example, inhalatory administration.
  • the pharmaceutical composition is preferably in either solid or liquid form, where semi solid, semi liquid, suspension and gel forms are included within the forms considered herein as either solid or liquid.
  • the pharmaceutical composition may be formulated into a powder, granule, compressed tablet, pill, capsule, chewing gum, wafer or the like.
  • a solid composition will typically contain one or more inert diluents or edible carriers.
  • binders such as carboxymethylcellulose, ethyl cellulose, microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, sodium alginate, Primogel, corn starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; a flavoring agent such as peppermint, methyl salicylate or orange flavoring; and a coloring agent.
  • a liquid carrier such as polyethylene glycol or oil.
  • the composition may be in the form of a liquid, for example, an elixir, syrup, solution, emulsion or suspension.
  • the liquid may be for oral administration or for delivery by injection, as two examples.
  • preferred compositions contain, in addition to the present compounds, one or more of a sweetening agent, preservatives, dye/colorant and flavor enhancer.
  • a surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonic agent may be included.
  • Liquid pharmaceutical compositions may include one or more of the following adjuvants: sterile diluents such as water for injection, saline solution, preferably physiological saline, Ringer’s solution, isotonic sodium chloride, fixed oils such as synthetic mono or diglycerides which may serve as the solvent or suspending medium, polyethylene glycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • Physiological saline is a preferred adjuvant.
  • a liquid composition intended for either parenteral or oral administration should contain an amount of an antibody or antigen-binding fragment as herein disclosed such that a suitable dosage will be obtained. Typically, this amount is at least 0.01% of the antibody or antigen-binding fragment in the composition. When intended for oral administration, this amount may be varied to be between 0.1 and about 70% of the weight of the composition. Certain oral pharmaceutical compositions contain between about 4% and about 75% of the antibody or antigen-binding fragment. In certain embodiments, pharmaceutical compositions and preparations according to the present invention are prepared so that a parenteral dosage unit contains between 0.01 to 10% by weight of antibody or antigen-binding fragment prior to dilution.
  • the composition may be intended for topical administration, in which case the carrier may suitably comprise a solution, emulsion, ointment or gel base.
  • the base may comprise one or more of the following: petrolatum, lanolin, polyethylene glycols, bee wax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers. Thickening agents may be present in a composition for topical administration. If intended for transdermal administration, the composition may include a transdermal patch or iontophoresis device.
  • the pharmaceutical composition may be intended for rectal administration, in the form, for example, of a suppository, which will melt in the rectum and release the drug.
  • the composition for rectal administration may contain an oleaginous base as a suitable nonirritating excipient.
  • bases include, without limitation, lanolin, cocoa butter and polyethylene glycol.
  • a composition may include various materials which modify the physical form of a solid or liquid dosage unit.
  • the composition may include materials that form a coating shell around the active ingredients.
  • the materials that form the coating shell are typically inert, and may be selected from, for example, sugar, shellac, and other enteric coating agents.
  • the active ingredients may be encased in a gelatin capsule.
  • the composition in solid or liquid form may include an agent that binds to the antibody or antigen-binding fragment of the disclosure and thereby assists in the delivery of the compound. Suitable agents that may act in this capacity include monoclonal or polyclonal antibodies, one or more proteins or a liposome.
  • the composition may consist essentially of dosage units that can be administered as an aerosol.
  • aerosol is used to denote a variety of systems ranging from those of colloidal nature to systems consisting of pressurized packages. Delivery may be by a liquefied or compressed gas or by a suitable pump system that dispenses the active ingredients. Aerosols may be delivered in single phase, bi phasic, or tri phasic systems in order to deliver the active ingredient(s). Delivery of the aerosol includes the necessary container, activators, valves, subcontainers, and the like, which together may form a kit. One of ordinary skill in the art, without undue experimentation, may determine preferred aerosols. It will be understood that compositions of the present disclosure also encompass carrier molecules for polynucleotides, as described herein (e.g ., lipid nanoparticles, nanoscale delivery platforms, and the like).
  • compositions may be prepared by methodology well known in the pharmaceutical art.
  • a composition intended to be administered by injection can be prepared by combining a composition that comprises an antibody, antigen-binding fragment thereof, or antibody conjugate as described herein and optionally, one or more of salts, buffers and/or stabilizers, with sterile, distilled water so as to form a solution.
  • a surfactant may be added to facilitate the formation of a homogeneous solution or suspension.
  • Surfactants are compounds that non-covalently interact with the peptide composition so as to facilitate dissolution or homogeneous suspension of the antibody or antigen-binding fragment thereof in the aqueous delivery system.
  • an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (such as described herein, including an improved clinical outcome (e.g., a decrease in frequency, duration, or severity of diarrhea or associated dehydration, or inflammation, or longer disease-free and/or overall survival, or a lessening of symptom severity).
  • a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder.
  • Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.
  • compositions are administered in an effective amount (e.g, to treat a coronavirus infection), which will vary depending upon a variety of factors including the activity of the specific compound employed; the metabolic stability and length of action of the compound; the age, body weight, general health, sex, and diet of the subject; the mode and time of administration; the rate of excretion; the drug combination; the severity of the particular disorder or condition; and the subject undergoing therapy.
  • an effective amount e.g, to treat a coronavirus infection
  • test subjects will exhibit about a 10% up to about a 99% reduction in one or more symptoms associated with the disease or disorder being treated as compared to placebo-treated or other suitable control subjects.
  • a therapeutically effective daily dose of an antibody or antigen binding fragment is (for a 70 kg mammal) from about 0.001 mg/kg (i.e., 0.07 mg) to about 100 mg/kg (i.e., 7.0 g); preferably a therapeutically effective dose is (for a 70 kg mammal) from about 0.01 mg/kg (i.e., 0.7 mg) to about 50 mg/kg (i.e., 3.5 g); more preferably a therapeutically effective dose is (for a 70 kg mammal) from about 1 mg/kg (i.e., 70 mg) to about 25 mg/kg (i.e., 1.75 g).
  • a therapeutically effective dose may be different than for an antibody or antigen-binding fragment.
  • a method comprises administering the antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition to the subject at 2, 3, 4, 5, 6, 7, 8, 9, 10 times, or more.
  • a method comprises administering the antibody, antigen-binding fragment, or composition to the subject a plurality of times, wherein a second or successive administration is performed at about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 24, about 48, about 74, about 96 hours, or more, following a first or prior administration, respectively.
  • a method comprises administering the antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition at least one time prior to the subject being infected by SARS-CoV-2.
  • compositions comprising an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition of the present disclosure may also be administered simultaneously with, prior to, or after administration of one or more other therapeutic agents.
  • combination therapy may include administration of a single pharmaceutical dosage formulation which contains a compound of the invention and one or more additional active agents, as well as administration of compositions comprising an antibody or antigen-binding fragment of the disclosure and each active agent in its own separate dosage formulation.
  • an antibody or antigen-binding fragment thereof as described herein and the other active agent can be administered to the patient together in a single oral dosage composition such as a tablet or capsule, or each agent administered in separate oral dosage formulations.
  • an antibody or antigen-binding fragment as described herein and the other active agent can be administered to the subject together in a single parenteral dosage composition such as in a saline solution or other physiologically acceptable solution, or each agent administered in separate parenteral dosage formulations.
  • a single parenteral dosage composition such as in a saline solution or other physiologically acceptable solution, or each agent administered in separate parenteral dosage formulations.
  • the compositions comprising an antibody or antigen-binding fragment and one or more additional active agents can be administered at essentially the same time, i.e., concurrently, or at separately staggered times, i.e., sequentially and in any order; combination therapy is understood to include all these regimens.
  • a combination therapy comprises one or more anti-SARS-CoV-2 antibody (or one or more nucleic acid, host cell, vector, or composition) of the present disclosure and one or more antiinflammatory agent and/or one or more anti-viral agent.
  • the one or more anti-inflammatory agent comprises a corticosteroid such as, for example, dexamethasone, prednisone, or the like.
  • the one or more anti-inflammatory agents comprise a cytokine antagonist such as, for example, an antibody that binds to IL6 (such as siltuximab), or to IL-6R (such as tocilizumab), or to IL-Ib, IL-7, IL-8, IL-9, IL- 10, FGF, G-CSF, GM-CSF, IFN-g, IP-10, MCP-1, MIP-1A, MIP1-B, PDGR, TNF-a, or VEGF.
  • a cytokine antagonist such as, for example, an antibody that binds to IL6 (such as siltuximab), or to IL-6R (such as tocilizumab), or to IL-Ib, IL-7, IL-8, IL-9, IL- 10, FGF, G-CSF, GM-CSF, IFN-g, IP-10, MCP-1, MIP-1A, MIP1-B, PDGR, TNF-a,
  • the one or more anti-viral agents comprise nucleotide analogs or nucelotide analog prodrugs such as, for example, remdesivir, sofosbuvir, acyclovir, and zidovudine.
  • an anti-viral agent comprises lopinavir, ritonavir, favipiravir, or any combination thereof.
  • a combination therapy comprises leronlimab.
  • Antiinflammatory agents for use in a combination therapy of the present disclosure also include non-steroidal anti-inflammatory drugs (NSAIDS).
  • the one or more antibody or one or more nucleic acid, host cell, vector, or composition
  • the one or more anti-inflammatory agent and/or one or the more antiviral agent can be administered in any order and any sequence, or together.
  • an antibody (or one or more nucleic acid, host cell, vector, or composition) is administered to a subject who has previously received one or more anti-inflammatory agent and/or one or more antiviral agent.
  • one or more anti-inflammatory agent and/or one or more antiviral agent is administered to a subject who has previously received an antibody (or one or more nucleic acid, host cell, vector, or composition).
  • a combination therapy comprises two or more anti-SARS-CoV-2 antibodies, either or both of which can be antibodies of the present disclosure.
  • a method can comprise administering a first antibody to a subject who has received a second antibody, or can comprise administering two or more antibodies together.
  • a method is provided that comprises administering to the subject (a) a first antibody or antigen-binding fragment, when the subject has received a second antibody or antigen-binding fragment; (b) the second antibody or antigen-binding fragment, when the subject has received the first antibody or antigen-binding fragment; or (c) the first antibody or antigen-binding fragment, and the second antibody or antigen-binding fragment.
  • any presently disclosed antibody can be used in a method of treating or preventing a SARS-CoV-2 infection, wherein the method further comprises use of an antibody or antigen-binding fragment that comprises: (i) CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:343-345 and 347-349, respectively; or (ii) CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.: 140-142 and 144-146, respectively; or (iii) VH and VL amino acid sequences as set forth in SEQ ID NOs.:342 and 346, respectively; or (iv) VH and VL amino acid sequences as set forth in SEQ ID NOs.: 139 and 143, respectively.
  • an antibody or antigen-binding fragment that comprises: (i) CDRH1, CDRH2, CDRH3, CDRL1, CDRL2,
  • an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition is provided for use in a method of treating a SARS-CoV-2 infection in a subject.
  • an antibody, antigen-binding fragment, or composition is provided for use in a method of manufacturing or preparing a medicament for treating a SARS-CoV-2 infection in a subject.
  • Embodiment 1 An antibody, or antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein:
  • the CDRH1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 400, 23, 33, 43, 53, 63, 75, 85, 97, 107, 120, 130, 140, 147, 160, 170, 174, 183, 190, 199, 209, 219, 229, 241, 255, 265, 275, 285, 299, 313, 323, 333, 370, 380, 390, 410, 420, 430, 435, 445, 455, 465, 475, 485, 495, 505, 515, 525, 535, 545, 555, 565, 575, 585, 595, 605, 615, 631, and 693, or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid;
  • the CDRH2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 401, 24, 34, 44, 54, 64, 76, 86, 98, 108, 121, 131, 141, 148, 151, 161, 171, 184, 200, 210, 220, 230, 242, 256, 266, 276, 286, 300, 314, 324, 334,
  • the CDRH3 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 766, 25, 35, 45, 55, 65, 77, 87, 99, 109, 122, 132, 142, 149, 162, 164, 165, 172, 176, 177, 179, 180, 185, 187, 188, 201, 211, 221, 231, 243, 257,
  • the CDRL1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 404, 27, 37, 47, 57, 67, 79, 89, 101, 111, 124, 134, 144,
  • the CDRL2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 405, 28, 38, 48, 58, 68, 80, 90, 102, 112, 125, 135, 145,
  • the CDRL3 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 406, 29, 39, 49, 59, 69, 81, 91, 103, 113, 126, 136, 146,
  • the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • Embodiment 2 The antibody or antigen-binding fragment of
  • Embodimentl which is capable of neutralizing a SARS-CoV-2 infection in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • Embodiment 3 The antibody or antigen-binding fragment of any one of
  • Embodiments 1-2 comprising CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NOs.: (i) 400, 401, 766, and 404-406, respectively; (ii)400-402 and 404-406, respectively; (iii) 43-45 and 47-49, respectively; (iv) 53-55 and 57-59, respectively; (v) 63-65 and 67-69, respectively; (vi) 75-77 and 79-81, respectively; (vii) 85-87 and 89-91, respectively; (viii) 97-99 and 101-103, respectively; (ix) 107-109 and 111-113, respectively; (x) 120-122 and 124-126, respectively; (xi) 130-132 and 134-136, respectively; (xii) 23 or 147, any one of 24, 148 or 151, 25 or 149, any one of 27, 152, 155, 156, 158, or 159, 28 or
  • Embodiment 4 An antibody, or antigen-binding fragment thereof, comprising the CDRH1, the CDRH2, and the CDRH3 of the VH amino acid sequence set forth in SEQ ID NO.:399, and the CDRL1, the CDRL2 or a variant of the CDRL2 comprising one, two, or three amino acid substiutions, wherein each of the one, two, or three amino acid substitutions is optionally a conservative amino acid substitution, and the CDRL3 of the VL amino acid sequence set forth in SEQ ID NO.:738, wherein the CDRs are according to IMGT, and wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • Embodiment 5 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) comprising complementarity determining region (CDR)H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRLl, CDRL2, and CDRL3, wherein CDRH1, CDRH2, CDRH3, CDRLl, CDRL2, and CDRL3 comprise the amino acid sequences set forth in: (a) SEQ ID NOs.:400, 401, 766, 404, 405, and 406, respectively; (b) SEQ ID NOs.:400, 401, 769, 404, 405, and 406, respectively; (c) SEQ ID NOs.:400, 401, 770, 404, 405, and 406, respectively; (d) SEQ ID NOs.:400, 401, 771, 404, 405, and 406, respectively; (e) SEQ ID NOs.:400, 401, 772, 404, 405, and 406, respectively; (f
  • Embodiment 6 The antibody or antigen-binding fragment thereof of
  • Embodiment 5 comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 comprise the amino acid sequences set forth in: (a) SEQ ID NOs.:400, 401, 766, 404, 405, and 406, respectively.
  • Embodiment 7 The antibody or antigen-binding fragment of any one of
  • Embodiments 4-6 comprising the amino acid sequences set forth in: (a) SEQ ID NOs.:400, 401, 402, 404, 405, and 406; (b) SEQ ID NOs.:400, 401, 751, 404, 405, and 406; (c) SEQ ID NOs.:400, 401, 753, 404, 405, and 406; (d) SEQ ID NOs.:400, 401, 755, 404, 405, and 406; (e) SEQ ID NOs.:400, 401, 757, 404, 405, and 406; (f) SEQ ID NOs.:400, 401, 760, 404, 405, and 406; (g) SEQ ID NOs.:400, 401, 402, 404, 405, and 745; (h) SEQ ID NOs.:400, 401, 751, 404, 405, and 745; (i) SEQ ID NOs.:400, 401, 753, 404, 405, and 745; (
  • Embodiments 4-7 comprising, in VH, the amino acid sequence set forth in SEQ ID NO.: 400, the amino acid sequence set forth in SEQ ID NO.:401, and the amino acid sequence set forth in SEQ ID NO.:402, and in VL, the amino acid sequence set forth in SEQ ID NO.:404, the amino acid sequence set forth in SEQ ID NO.:405, and the amino acid sequence set forth in SEQ ID NO.:406.
  • Embodiment 9 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) comprising complementarity determining region (CDR)H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRL1, CDRL2, and CDRL3, wherein CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 comprise the amino acid sequences set forth in SEQ ID NOs.:525, 526, 527, 529, 530, and 531, respectively, and wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • CDR complementarity determining region
  • VL light chain variable domain
  • CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 comprise the amino acid sequences set forth in SEQ ID NOs.:525, 5
  • Embodiment 10 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) comprising complementarity determining region (CDR)H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRLl, CDRL2, and CDRL3, wherein CDRHl, CDRH2, CDRH3, CDRLl, CDRL2, and CDRL3 comprise the amino acid sequences set forth in SEQ ID NOs.:585, 586 or 625, 587 or 627, 589, 590, and 591, respectively, and wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • CDR complementarity determining region
  • VL light chain variable domain
  • CDRHl, CDRH2, CDRH3, CDRLl, CDRL2, and CDRL3 comprise the amino acid sequences set forth
  • Embodiment 11 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) comprising complementarity determining region (CDR)H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRL1, CDRL2, and CDRL3, wherein CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 comprise the amino acid sequences set forth in SEQ ID NOs.:229, 230, 231, 233, 234, and 235, respectively, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • CDR complementarity determining region
  • VL light chain variable domain
  • CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 comprise the amino acid sequences set forth in SEQ ID NOs.:229, 230
  • Embodiment 12 The antibody or antigen-binding fragment of any one of Embodiments 1-11, wherein:
  • the VH comprises or consists of an amino acid sequence having at least
  • variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid;
  • the VL comprises or consists of an amino acid sequence having at least
  • variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid.
  • Embodiment 13 The antibody or antigen-binding fragment of any one of Embodiments 1-12, wherein the VH comprises or consists of an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of an amino acid sequence having at least 85% identity to the amino acid sequence set forth in SEQ ID NO.:403 or SEQ ID NO.:738.
  • Embodiment 14 The antibody or antigen-binding fragment of any one of Embodiments 1-13, wherein the VH comprises or consists of an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO.:403 or SEQ ID NO.:738.
  • Embodiment 15 The antibody or antigen-binding fragment of any one of Embodiments 1-14, wherein the VH comprises or consists of an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of an amino acid sequence having at least 95% identity to the amino acid sequence set forth in SEQ ID NO.:403 or SEQ ID NO.:738.
  • Embodiment 16 The antibody or antigen-binding fragment of any one of Embodiments 1-15, wherein the VH comprises or consists of an amino acid sequence having at least 97% identity to the amino acid sequence set forth in SEQ ID NO.:399 and the VL comprises or consists of an amino acid sequence having at least 97% identity to the amino acid sequence set forth in SEQ ID NO.:403 or SEQ ID NO.:738.
  • VH comprises or consists of an amino acid sequence having at least 99% identity to the amino acid sequence set forth in SEQ ID NO.:399
  • VL comprises or consists of an amino acid sequence having at least 99% identity to the amino acid sequence set forth in SEQ ID NO.:403 or SEQ ID NO.:738.
  • Embodiment 18 The antibody or antigen-binding fragment of any one of
  • Embodiments 1-12 wherein the VH and the VL have at least 85% identity (e.g 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) to the amino acid sequences set forth in:
  • Embodiment 19 The antibody or antigen-binding fragment of any one of Embodiments 1-18, wherein the VH comprises or consists of any VH amino acid sequence set forth in Table 2, and wherein the VL comprises or consists of any VL amino acid sequence set forth in Table 2, wherein, optionally, the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs.: (i) 399 and 403 or 738, respectively; (ii) 32 and 36, respectively; (iii) 42 and 46, respectively; (iv) 52 and 56, respectively; (v) 62 and 66, respectively; (vi) 72 and 66, respectively; (vii)
  • Embodiment 20 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO:399 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:738, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 21 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO:399 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:403, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 22 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:403, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 23 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:738, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • Embodiment 24 Embodiment 24.
  • An antibody, or an antigen-binding fragment thereof comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:744, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 25 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs:399, 748, 749, 750, 752, 754, 756, 758, 759, and 761, the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:746, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 26 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in SEQ ID NO:524 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:528, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 27 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs.:584, 624, 626, and 628 and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:588, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 29 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs.:228, 740, 741, 742, and 743, and the VL comprises or consists of the amino acid sequence set forth in SEQ ID NO:238, wherein the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS-CoV-2 expressed on a cell surface of a host cell and/or on a virion.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 30 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 32 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 36.
  • Embodiment 31 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 32 and the VL comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 36.
  • Embodiment 31 An antibody, or an antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises or consists of the amino acid sequence as set forth in SEQ ID NO: 32 and the VL comprises or
  • An antibody, or an antigen-binding fragment thereof comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 33-35, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 37-39, respectively.
  • VH heavy chain variable domain
  • VL light chain variable domain
  • Embodiment 32 The antibody or antigen-binding fragment of any one of Embodiments 3-31, which is capable of neutralizing a SARS-CoV-2 infection in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • Embodiment 33 The antibody or antigen-binding fragment of any one of Embodiments 1-32, which:
  • (ii) is capable of blocking an interaction between SARS-CoV-2 (e.g, SARS- CoV-2 RBM) and human ACE2;
  • SARS-CoV-2 e.g, SARS- CoV-2 RBM
  • human ACE2 e.g, SARS-CoV-2 RBM
  • (v) is cross-reactive against SARS-CoV-2 and SARS-CoV-1 coronavirus; (vii) recognizes an epitope in the SARS-CoV-2 surface glycoprotein that is not in the ACE2 RBM;
  • (viii) is capable of binding to a SARS-CoV-2 S protein trimer in a prefusion conformation
  • Embodiment 34 any combination of (i)-(viii).
  • Embodiment 34 The antibody or antigen-binding fragment of any one of Embodiments 1-33, which is a IgG, IgA, IgM, IgE, or IgD isotype.
  • Embodiment 35 The antibody or antigen-binding fragment of any one of Embodiments 1-34, which is an IgG isotype selected from IgGl, IgG2, IgG3, and IgG4.
  • Embodiment 36 The antibody or antigen-binding fragment of any one of
  • Embodiments 1-35 which is human, humanized, or chimeric.
  • Embodiment 37 The antibody or antigen-binding fragment of any one of Embodiments 1-36, wherein the antibody, or the antigen-binding fragment, comprises a human antibody, a monoclonal antibody, a purified antibody, a single chain antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a scFv, or a scFab.
  • Embodiment 38 The antibody or antigen-binding fragment of Embodiment 37, wherein the scFv comprises more than one VH domain and more than one VL domain.
  • Embodiment 39 The antibody or antigen-binding fragment of any one of
  • Embodiments 1-38 wherein the antibody or antigen-binding fragment is a multi-specific antibody or antigen binding fragment.
  • Embodiment 40 The antibody or antigen-binding fragment of Embodiment 39, wherein the antibody or antigen binding fragment is a bispecific antibody or antigen-binding fragment.
  • Embodiment 41 The antibody or antigen-binding fragment of Embodiment
  • first VH and the second VH are different and each independently comprise an amino acid sequence having at least 85% (e.g, 85%, 86%, 87%, 88%,
  • first VL and the second VL are different and each independently comprise an amino acid sequence having at least 85% (e.g, 85%, 86%, 87%, 88%,
  • Embodiment 42 The antibody or antigen-binding fragment of Embodiment 40 or 41, comprising: (i) a first VH and a first VL; and
  • the first VL comprises an amino acid sequence having at least 85% (i.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 139 and 342 and the first VL comprises an amino acid sequence having at least 85% (i.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 143 and 346 and wherein the second VH comprises an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity
  • Embodiment 43 The antibody or antigen-binding fragment of Embodiment 39 or 40, comprising a first antigen-binding portion having a first specificity and a second antigen-binding portion having a second specificity, wherein the first antigen- binding portion comprises a VH that comprises or consists of the amino acid sequence set forth in SEQ ID NO:399 and a VL that comprises or consists of the amino acid sequence set forth in SEQ ID NO.:738 or SEQ ID NO.:403.
  • Embodiment 44 The antibody or antigen-binding fragment of Embodiment 43, wherein the second antigen-binding portion comprises a VH that comprises or consists of the amino acid sequence set forth in SEQ ID NO.: 139 and a VL that comprises or consists of the amino acid sequence set forth in SEQ ID NO.: 143.
  • Embodiment 45 The antibody or antigen-binding fragment of Embodiment 43, wherein the second antigen-binding portion comprises a VH that comprises or consists of the amino acid sequence set forth in SEQ ID NO.: 342 and a VL that comprises or consists of the amino acid sequence set forth in SEQ ID NO. :346.
  • Embodiment 46 The antibody or antigen-binding fragment of any one of Embodiments 1-45, wherein the antibody or antigen-binding fragment further comprises a Fc polypeptide or a fragment thereof.
  • Embodiment 47 The antibody or antigen-binding fragment of Embodiment 46, wherein the Fc polypeptide or fragment thereof comprises:
  • Embodiment 48 The antibody or antigen-binding fragment of Embodiment
  • mutation that enhances binding to a FcRn comprises: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I; Q311I; D376V; T307A; E380A; or any combination thereof.
  • Embodiment 49 The antibody or antigen-binding fragment of Embodiment 47 or 48, wherein the mutation that enhances binding to FcRn comprises: (i)
  • M428L/N434S M252Y/S254T/T256E; (iii) T250Q/M428L; (iv) 257I/Q31 II; (v) P257I/N434H; (vi) D376V/N434H; (vii) T307A/E380A/N434A; or (viii) any combination of (i)-(vii).
  • Embodiment 50 The antibody or antigen-binding fragment of any one of Embodiments 47-49, wherein the mutation that enhances binding to FcRn comprises M428L/N434S.
  • Embodiment 51 The antibody or antigen-binding fragment of any one of Embodiments 47-50, wherein the mutation that enhances binding to a FcyR comprises S239D; I332E; A330L; G236A; or any combination thereof.
  • Embodiment 52 The antibody or antigen-binding fragment of any one of Embodiments 47-51, wherein the mutation that enhances binding to a FcyR comprises: (i) S239D/I332E; (ii) S239D/A330L/I332E; (iii) G236A/S239D/I332E; or
  • Embodiment 53 The antibody or antigen-binding fragment of any one of Embodiments 47-52, wherein the Fc polypeptide comprises a L234A mutation and a L235A mutation.
  • Embodiment 54 The antibody or antigen-binding fragment of any one of Embodiments 1-53, which comprises a mutation that alters glycosylation, wherein the mutation that alters glycosylation comprises N297A, N297Q, or N297G, and/or which is aglycosylated and/or afucosylated.
  • Embodiment 55 The antibody or antigen-binding fragment of any one of Embodiments 1-54, which is capable of binding to a SARS-CoV-2 surface glycoprotein with an EC50 of less than 500 ng/ml, less than 250 ng/ml, less than 100 ng/ml, less than 90 ng/ml, less than 80 ng/ml, less than 70 ng/ml, less than 60 ng/ml, less than 50 ng/ml, less than 40 ng/ml, less than 30 ng/ml, less than 25 ng/ml, less than 20 ng/ml, less than 16 ng/ml, less than 15 ng/ml, less than 14 ng/ml, less than 13 ng/ml, less than 12 ng/ml, less than 10 ng/ml, less than 9 ng/ml, less than 8 ng/ml, less than 7 ng/ml, less than 6 ng/ml, less than 5 ng/ml
  • Embodiment 56 The antibody or antigen-binding fragment of any one of Embodiments 1-55, which is capable of binding to a SARS-CoV-2 surface glycoprotein RBD with an EC50 of less than 500 ng/ml, less than 250 ng/ml, less than 100 ng/ml, less than 90 ng/ml, less than 80 ng/ml, less than 70 ng/ml, less than 60 ng/ml, less than 50 ng/ml, less than 40 ng/ml, less than 30 ng/ml, less than 25 ng/ml, less than 20 ng/ml, less than 16 ng/ml, less than 15 ng/ml, less than 14 ng/ml, less than 13 ng/ml, less than 12 ng/ml, less than 10 ng/ml, less than 9 ng/ml, less than 8 ng/ml, less than 7 ng/ml, less than 6 ng/ml, less than 5 ng/
  • Embodiment 57 The antibody or antigen-binding fragment of any one of Embodiments 1-56, which is capable of binding to a SARS-CoV-2 RBD with a KD of less than 5 x 10 -8 M, less than 4 x 10 -8 M, less than 3 x 10 -8 M, less than 2 x 10 -8 M, less than 1 x 10 -8 M, less than 5 x 10 -9 M, less than 1 x 10 -9 M, less than 5 x 10 -10 M, less than 1 x 10 -10 M, less than 5 x 10 -11 M, less than 1 x 10 -11 M, less than 5 x 10 -12 M, or less than 1 x 10 -12 M, as determined using biolayer interferometry (BLI), optionally using an Octet instrument with antibody or antigen-binding fragment loaded on Protein A pins, optionally at 2.7 ⁇ g/ml, and SARS-CoV-2 RBD loaded for 5 minutes at 6 ⁇ g/ml, 1.5 ⁇ g
  • Embodiment 58 The antibody or antigen-binding fragment of any one of Embodiments 1-57, which is capable of binding to a SARS-CoV-2 RBD with a KD of less than 6 x 10 -8 M, less than 5 x 10 -8 M, less than 4 x 10 -8 M, less than 3 x 10 -8 M, less than 2 x 10 -8 M, less than 1 x 10 -8 M, less than 5 x 10 -9 M, less than 4 x 10 -9 M, less than 3 x 10 -9 M, less than 2 x 10 -9 M, less than 1 x 10 -9 M, or less than 8 x 10 -10 M, as determined using surface plasmon resonance (SPR), optionally using a Biacore T200 instrument using a single-cycle kinetics approach.
  • SPR surface plasmon resonance
  • Embodiment 59 The antibody or antigen-binding fragment of any one of claims 1-58, which is capable of binding to a SARS-CoV-2 RBD and inhibiting an interaction between (i) the RBD and (ii) a human ACE2 and/or a human SIGLEC-1.
  • Embodiment 60 The antibody or antigen-binding fragment of any one of Embodiments 1-59, which is capable of neutralizing:
  • the SARS-CoV-2 pseudovirus comprises a VSV pseudovirus and/or a MLV pseudovirus;
  • a host cell e.g . a HEK293T cell
  • expresses optionally is engineered to overexpress, DC-SIGN, L-SIGN, SIGLEC, or ACE2; and/or
  • Embodiment 61 The antibody or antigen-binding fragment of any one of Embodiments 1-60, which is capable of neutralizing infection by a SARS-CoV-2 variant that comprises any one of the following mutations in the surface glycoprotein as compared to a SARS-CoV-2 surface glycoprotein comprising SEQ ID NO.:3: N501Y; S477N; N439K; L452R; E484K; K417N; T478K; S494P; A520S; N501T; A522S; Y453F; P384L.
  • Embodiment 62 The antibody or antigen-binding fragment of Embodiment 61, which is capable of neutralizing infection by the SARS-CoV-2 variant with a potency that is less than 3-fold lower than the potency with which the antibody or antigen-binding fragment neutralizes infection by a SARS-CoV-2 comprising the surface glycoprotein amino acid sequence set forth in SEQ ID NO.:3.
  • Embodiment 63 The antibody or antigen-binding fragment of any one of Embodiments 1-62, which is capable of activating a FcyRIIa, a FcyRIIIa, or both, wherein, optionally :(i)the FcyRIIa comprises a H131 allele; and/or
  • Embodiment 64 The antibody or antigen-binding fragment of any one of Embodiments 1-63, comprising: (a) the CH1-CH3 amino acid sequence set forth in SEQ ID NO.: 6 and the
  • Embodiment 65 An isolated antibody comprising:
  • Embodiment 66 The antibody or antigen-binding fragment of any one of Embodiments 1-65, which has an in vivo half-life in a non-human primate of between 20 and 30 days, or between 22 and 28 days, or between 23 and 27 days, or between 24 and 26 days, or of about 25 days.
  • Embodiment 67 The antibody or antigen-binding fragment of any one of
  • Embodiments 1-66 wherein the antibody or antigen-binding fragment is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 20 to about 30 ng/ml.
  • Embodiment 68 The antibody or antigen-binding fragment of any one of Embodiments 1-66, wherein the antibody or antigen-binding fragment is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 10 to about 20 ng/ml.
  • Embodiment 69 The antibody or antigen-binding fragment of any one of Embodiments 1-66, wherein the antibody or antigen-binding fragment is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 5 to about 10 ng/ml.
  • Embodiment 70 The antibody or antigen-binding fragment of any one of Embodiments 1-66, wherein the antibody or antigen-binding fragment is capable of neutralizing a SARS-CoV-2 infection and/or of neutralizing an infection of a target cell with an IC50 of about 1 to about 5 ng/ml.
  • Embodiment 71 The antibody or antigen-binding fragment of any one of
  • Embodiments 1-70 wherein the antibody or antigen-binding fragment is capable of neutralizing infection by SARS-CoV-2 and does not compete with a human ACE2 for binding to the SARS-CoV-2S protein, wherein, optionally, the neutralizing comprises neutralizing infection in an in vitro model of infection.
  • Embodiment 72 An antibody, or an antigen-binding fragment thereof, that competes for binding to a SARS-CoV-2 surface glycoprotein with the antibody or antigen-binding fragment of any one of Embodiments 1-71.
  • Embodiment 73 An isolated polynucleotide encoding the antibody or antigen-binding fragment of any one of Embodiments 1-72, or encoding a VH, a heavy chain, a VL, and/or a light chain of the antibody or the antigen-binding fragment.
  • Embodiment 74 The polynucleotide of Embodimenf73, wherein the polynucleotide comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), wherein the RNA optionally comprises messenger RNA (mRNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • mRNA messenger RNA
  • Embodiment 75 The polynucleotide of Embodiment73 or 74, which is codon-optimized for expression in a host cell.
  • Embodiment 76 The polynucleotide of any one of Embodiments 73-75, comprising a polynucleotide having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identity to, or comprises or consists of, the polynucleotide sequence according to any one or more of SEQ ID NOs.: 30, 31, 40, 41, 50, 51, 60, 61,
  • Embodiment 77 The polynucleotide of any one of Embodiments 73-76, comprising:
  • Embodiment 78 A recombinant vector comprising the polynucleotide of any one of Embodiments 73-77.
  • Embodiment 79 A host cell comprising the polynucleotide of any one of Embodiments 77 and/or the vector of Embodimenf78, wherein the polynucleotide is heterologous to the host cell.
  • Embodiment 80 A human B cell comprising the polynucleotide of any one of Embodiments 73-77, wherein polynucleotide is heterologous to the human B cell and/or wherein the human B cell is immortalized.
  • Embodiment 81 A composition comprising: (i) the antibody or antigenbinding fragment of any one of Embodiments 1-72; (ii) the polynucleotide of any one of Embodiments 73-77; (iii) the recombinant vector of Embodiment 78; (iv) the host cell of Embodiment 79; and/or (v)the human B cell of Embodiment 80, and a pharmaceutically acceptable excipient, carrier, or diluent.
  • Embodiment 82 The composition of Embodiment 81, comprising two or more antibodies or antigen-binding fragments of any of Embodiments 1-72.
  • Embodiment 83 The composition of Embodiment 82, comprising:
  • a first antibody or antigen-binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 32 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 36; and (ii) a second antibody or antigen-binding fragment comprising, a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 139 and a VL comprising of consisting of the amino acid sequence as set forth in SEQ ID NO: 143.
  • Embodiment 84 The composition of Embodiment 82, comprising:
  • a first antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 33-35, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 37-39, respectively; and
  • a second antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 140-142, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 144-146, respectively.
  • Embodiment 85 The composition of Embodiment 82, comprising:
  • a first antibody or antigen-binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 139 or 342 and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO:
  • Embodiment 86 a second antibody or antigen-binding fragment comprising a VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 399, 748, 749, 750, 752, 754, 756, 758, 759, or 761, and a VL comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 403, 744, or 746.
  • Embodiment 86 The composition of Embodiment 82, comprising:
  • a first antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 140-142, respectively, or 343-345, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 144-146, respectively; and
  • a second antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein the CDRH1, CDRH2, and CDRH3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 400, 401, and any one of 751, 753, 755, 757, 760, respectively, and the CDRL1, CDRL2, and CDRL3 comprise or consist of the amino acid sequences set forth in SEQ ID NOs: 404, 405, and any one of 406, 745, and 747, respectively.
  • Embodiment 87 A composition comprising:
  • VH comprising or consisting of the amino acid sequence as set forth in SEQ ID NO: 139 and
  • VL comprising of consisting of the amino acid sequence as set forth in SEQ ID NO: 143.
  • Embodiment 88 A composition comprising: (i) a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • VH comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences set forth in SEQ ID NOs.:400, 402, and 766, respectively, and
  • a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • VH comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences set forth in SEQ ID NOs.:140, 141 or 344, and 142, respectively, and
  • Embodiment 89 A composition comprising:
  • a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • Embodiment 90 The composition of any one of Embodiments 82-89, wherein the first antibody or antigen-binding fragment and the second antibody or antigen-binding fragment each comprise an IgGl Fc polypeptide comprising a M428L mutation and a N434S mutation.
  • Embodiment 91 The composition of any one of Embodiments 82-90, wherein the first antibody or antigen-binding fragment and the second antibody or antigen-binding fragment each comprise an IgGl Fc polypeptide comprising a G236A mutation, a A330L mutation, and a I332E mutation.
  • Embodiment 92 A composition comprising the polynucleotide of any one of Embodiments 73-77 encapsulated in a carrier molecule, wherein the carrier molecule optionally comprises a lipid, a lipid-derived delivery vehicle, such as a liposome, a solid lipid nanoparticle, an oily suspension, a submicron lipid emulsion, a lipid microbubble, an inverse lipid micelle, a cochlear liposome, a lipid microtubule, a lipid microcylinder, lipid nanoparticle (LNP), or a nanoscale platform.
  • a lipid-derived delivery vehicle such as a liposome, a solid lipid nanoparticle, an oily suspension, a submicron lipid emulsion, a lipid microbubble, an inverse lipid micelle, a cochlear liposome, a lipid microtubule, a lipid microcylinder, lipid nanoparticle (LNP), or a
  • Embodiment 93 A composition comprising:
  • a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and inhibiting an interaction between the SARS- CoV-2 surface glycoprotein and a first cell surface receptor selected from ACE2, DC- SIGN, L-SIGN, and SIGLEC-1; and
  • a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and inhibiting an interaction between the SARS-CoV-2 surface glycoprotein and a second cell surface receptor selected from ACE2, DC-SIGN, L-SIGN, and SIGLEC-1, wherein the first cell surface receptor and the second cell surface receptor are different.
  • a coronavirus infection e.g.
  • a SARS-CoV-2 infection in a subject, the method comprising administering to the subject an effective amount of: (i) the antibody or antigen-binding fragment of any one of Embodiments 1-72; (ii) the polynucleotide of any one of Embodiments 73-77;
  • Embodiment 95 A method of treating a coronavirus infection, e.g. a SARS-CoV-2 infection, in a subject, the method comprising administering to the subject:
  • a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • VH comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences set forth in SEQ ID NOs.:400, 402, and 766, respectively, and
  • a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • VH comprising the CDRH1, CDRH2, and CDRH3 amino acid sequences set forth in SEQ ID NOs.:140, 141 or 344, and 142, respectively, and
  • Embodiment 96 A method of treating a coronavirus infection, e.g. a SARS-CoV-2 infection, in a subject, the method comprising administering to the subject:
  • a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and comprises
  • Embodiment 97 A method of preventing or treating or neutralizing a coronavirus infection in a subject, the method comprising administering to a subject who has received a first antibody or antigen binding fragment comprising:
  • Embodiment 98 A method of preventing or treating or neutralizing a coronavirus infection in a subject, the method comprising administering to a subject who has received a first antibody or antigen binding fragment comprising:
  • Embodiment 99 A method of preventing or treating or neutralizing a coronavirus infection in a subject, the method comprising administering to a subject who has received a first antibody or antigen binding fragment comprising:
  • Embodiment 100 A method of preventing or treating or neutralizing a coronavirus infection in a subject, the method comprising administering to a subject who has received a first antibody or antigen binding fragment comprising:
  • Embodiment 102 The method of any one of Embodiments 95-101, wherein the first antibody or antigen-binding fragment and the second antibody or antigenbinding fragment each comprise an IgGl Fc polypeptide comprising a G236A mutation, a A330L mutation, and a I332E mutation.
  • Embodiment 103 A method of treating a coronavirus (e.g. SARS-CoV-2) infection in a subject, the method comprising administering to the subject: (i) a first antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and inhibiting an interaction between the SARS- CoV-2 surface glycoprotein and a first cell surface receptor selected from ACE2, DC- SIGN, L-SIGN, and SIGLEC-1; and
  • a second antibody or antigen-binding fragment that is capable of binding to a SARS-CoV-2 surface glycoprotein and inhibiting an interaction between the SARS-CoV-2 surface glycoprotein and a second cell surface receptor selected from ACE2, DC-SIGN, L-SIGN, and SIGLEC-1, wherein the first cell surface receptor and the second cell surface receptor are different.
  • Embodiment 104 The antibody or antigen-binding fragment of any one of claims 1-72, the polynucleotide of any one of Embodiments 73-77, the recombinant vector of Embodiment 78, the host cell of Embodiment 79, the human B cell of Embodiment 80, and/or the composition of any one of Embodiments 81-93 for use in a method of treating a coronavirus (e.g. SARS-CoV-2) infection in a subject.
  • a coronavirus e.g. SARS-CoV-2
  • Embodiment 105 The antibody or antigen-binding fragment of any one of claims 1-72, the polynucleotide of any one of Embodiments 73-77, the recombinant vector of Embodimenf78, the host cell of Embodiment 79, the human B cell of Embodiment 80, and/or the composition of any one of Embodiments 81-93 for use in the preparation of a medicament for the treatment of a coronavirus (e.g. SARS-CoV-2) infection in a subject.
  • a coronavirus e.g. SARS-CoV-2
  • Embodiment 106 A method for in vitro diagnosis of a coronavirus (e.g. SARS-CoV-2) infection, the method comprising:
  • Embodiment 107 The method of Embodiment 106, wherein the sample comprises blood isolated from the subject.
  • Monoclonal antibodies were isolated from human patients who recovered from SARS-CoV-2 infection. Briefly, EBV-immortalized memory B cells were sorted based on binding to the full ectodomain of SARS-CoV-2 Spike protein in the trimeric prefusion conformation. A biotin moiety was attached to the C-terminus of the Spike protein and the biotinylated Spike was coupled to fluorescent streptavidin (AF647 fluorophore) and used to stain the B cells, which were then sorted for binding to trimeric prefusion Spike protein based on fluorescence. Monoclonal antibodies identified by this process were recombinantly expressed in ExpiCHO cells transiently co-transfected with plasmids expressing the heavy and light chains.
  • fluorescent streptavidin AF647 fluorophore
  • Binding of monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection to the RBD of SARS-CoV-1 and SARS-CoV-2 Spike protein was assessed using enzyme-linked immunosorbent assays (ELISA).
  • 96-well plates were coated with SARS-CoV-2 RBD (produced in- house; residues 331-550 of spike from BetaCoV/Wuhan-Hu-1/2019, accession number MN908947), or SARS-CoV (also described herein as SARS-CoV-1) RBD (Sino Biological). Wells were washed and blocked with PBS+1%BSA for 1 hour at room temperature and were then incubated with serially diluted recombinant monoclonal antibodies for 1 hour at room temperature.
  • SARS-CoV-2 RBD produced in- house; residues 331-550 of spike from BetaCoV/Wuhan-Hu-1/2019, accession number MN908947
  • SARS-CoV also described herein as SARS-CoV-1 RBD (Sino Biological). Wells were washed and blocked with PBS+1%BSA for 1 hour at room temperature and were then incubated with serially diluted recombinant monoclonal antibodies for 1 hour at room temperature.
  • Bound antibodies were detected by incubating alkaline phosphatase-conjugated goat anti-human IgG (Southern Biotechnology: 2040-04) for 1 hour at room temperature and were developed by 1 mg/ml p-nitrophenylphosphate substrate in 0.1 M glycine buffer (pH 10.4) for 30 minutes at room temperature.
  • the optical density (OD) values were measured at a wavelength of 405 nm in an ELISA reader (Powerwave 340/96 spectrophotometer, BioTek).
  • ELISA assay results are shown in Figures 1 A-1D. In each figure, binding to RBD of SARS-CoV-2 is shown in the top panel and binding to RBD of SARS-CoV-1 is shown in the bottom panel. Calculated EC50 values (in ng/ml) are shown in the boxes on the right side of the figures and in Table 3.
  • Binding of additional antibodies to SARS-CoV-2 RBD was determined using similar methods. Results are shown in Figures 22A and 22B. Calculated EC50 values are shown in the boxes to the right of each graph.
  • 96-well plates were coated with SARS-CoV Spike SI Subunit Protein (Sino Biological), SARS-CoV-2 RBD (produced in house; residues 331-550 of spike from BetaCoV/Wuhan-Hu-1 /2019, accession number MN908947), or SARS-CoV RBD (Sino Biological).
  • Wells were washed and blocked with PBS+1%BSA for 1 hour at room temperature and were then incubated with serially diluted recombinant monoclonal antibodies for 1 hour at room temperature.
  • Bound antibodies were detected by incubating alkaline phosphatase-conjugated goat anti-human IgG (Southern Biotechnology: 2040-04) for 1 hour at room temperature and were developed by 1 mg/ml p-nitrophenylphosphate substrate in 0.1 M glycine buffer (pH 10.4) for 30 minutes at room temperature.
  • the optical density (OD) values were measured at a wavelength of 405 nm in an ELISA reader (Powerwave 340/96 spectrophotometer, BioTek).
  • Binding of additional monoclonal antibodies to SARS-CoV- 1 Spike protein, SARS-CoV- 1 Spike RBD, and SARS-CoV-2 Spike RBD was determined by similar methods. Results are shown in Figures 20A, 20B, 21 A, and 21B. Boxes to the right of the graphs show calculated EC50 values (ng/ml).
  • Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and tested in neutralization assays against SARS-CoV-2 pseudotyped virus.
  • Murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein (SARS-CoV-2pp) was used.
  • VeroE6 cells were used as target cells and were seeded one day before addition of virus and antibodies.
  • SARS-CoV-2pp was activated with trypsin TPCK at lOug/ml.
  • Activated SARS-CoV-2pp was added to a dilution series of antibodies and incubated for 48 hours. Starting concentration for antibodies was 5ug/ml per antibody, 3 -fold dilution. Luminescence was measured after aspirating cell culture supernatant and adding Bio-Glo substrate (Promega). Results are shown in Figures 3A-3F.
  • Antibody S2E12 shown in Figure 9E comprises the VH amino acid sequence of SEQ ID NO.:399 (CDRH1-H3 of SEQ ID NOs.AOO, 401, and 766, respectively) and the VL amino acid sequence of SEQ ID NO.:403 (CDRL1-CDRL3 of SEQ ID N0s.:404-406, respectively).
  • Monoclonal antibodies isolated from patients who recovered from SARS-CoV-2 infection were expressed recombinantly and were tested in neutralization assays against live SARS-CoV-2 virus.
  • Vero E6 cells cultured in DMEM supplemented with 10% FBS (VWR) and lx Penicillin/Streptomycin (Thermo Fisher Scientific) were seeded in white 96-well plates at 20,000 cells/well and attached overnight.
  • Serial 1:4 dilutions of the monoclonal antibodies were incubated with 200 pfu of SARS-CoV-2 (isolate USA- WA1/2020, passage 3, passaged in Vero E6 cells) for 30 minutes at 37°C in a BSL-3 facility. Cell supernatant was removed and the virus-antibody mixture was added to the cells.
  • S2E12 comprises the VH amino acid sequence set forth in SEQ ID NO.:399 (CDRH1-H3 as set forth in SEQ ID NOs.:400, 401, and 766, respectively), and the VL amino acid sequence set forth in SEQ ID NO.:403 (CDRL1-L3 as set forth in SEQ ID N0s.:404-406, respectively).
  • Calculated IC50 (ng/ml) values are shown in Tables 9-12.
  • Calculated EC50 and EC90 values are shown in Tables 13-16. Table 9.
  • FIG. 25A shows results for four antibodies, along with comparator antibodies S309 N55Q LS and S2X193.
  • S309 N55Q LS (also referred-to herein as S309-v2) comprises the VH sequence as set forth in SEQ ID NO:342 and the VL sequence as set forth in SEQ ID NO: 346, and comprises M428L and N434S mutations in the Fc region.
  • Figure 25B shows results for antibodies S2X129 and S2X132, along with four comparator antibodies.
  • IC50 and interpolated EC50 and EC90 values are shown in Table 17.
  • Recombinant IgGl antibodies are produced using the VH and VL sequences of antibodies S2X16, S2X30, S2X35, and S2X47, or engineered variants thereof. The combinations are produced as indicated in Table 20. Each of the antibodies is produced by transient transfection and expression of a plasmid vector encoding the recombinant antibody in HD 293F cells (GenScript). Cells are harvested on day 4 and IgG expression is validated by Western blot and protein A titer analysis.
  • Recombinant IgGl antibodies are produced using the VH and VL sequences of monoclonal antibodies S2H58 and S2N22, or engineered variants thereof. The combinations are produced as indicated in Table 21. Each of the antibodies is produced by transient transfection and expression of a plasmid vector encoding the recombinant antibody in HD 293F cells (GenScript). Cells are harvested on day 4 and IgG expression is validated by Western blot and protein A titer analysis. Table 21.
  • VH and VL sequences of monoclonal antibody S2E12 and engineered variants thereof V-region amino acid sequences of S2E12 and certain engineered S2E12 variants are summarized in Table
  • VSV SARS-CoV-2 pseudotyped virus
  • Recombinant monoclonal antibodies were serially diluted and incubated with a constant amount of VSV-deltaG-luc pseudotyped with SARS-CoV-2 (strain BetaCoV/Wuhan-Hu- 1 /2019, accession number MN908947) for 1.5 hours at 37 °C.
  • VeroE6 cells were then added in complete DMEM medium and plates were incubated for 24 hours at 37 °C.
  • culture medium was aspirated and luciferase substrate Bio-Glo Luciferase assay system (Promega AG) warmed to room temperature was added. After 10 minutes incubation in the dark on a shaker, signals were measured in a luminometer using 1 second integration time. Results for certain monoclonal antibodies are shown in Figures 12A-12D.
  • S2X246, S2X256, S2X269, and S2X278, along with four comparator antibodies, to SARS-CoV-1 RBD was also measured by Octet.
  • Antibody was loaded on Protein A pins at 2.7 ⁇ g/ml.
  • SARS-CoV-1 RBD was loaded for 5 minutes at 6 ⁇ g/ml.
  • Dissociation was measured for 7 minutes. Results are shown in Figure 15. In each graph, the vertical dashed line indicates the start of the dissociation phase.
  • S2E12 and S2E12 variant antibodies to SARS-CoV-2 RBD were measured by surface plasmon resonance (SPR).
  • SPR experiments were carried out with a Biacore T200 instrument using a single-cycle kinetics approach. Antibodies were captured on the surface and increasing concentrations of purified SARS-CoV-2 RBD were injected. Association and dissociation kinetics were monitored and fit to a binding model to determine affinity.
  • Antibody "S2E12-11" was obtained from the supernatant of CHO cells transformed to express S2E12 antibody.
  • Antibody S2E12 WT (VH of SEQ ID NO.:399, VL of SEQ ID NO.:403) was generated using purified antibody produced in transformed HEK cells.
  • KD/KD WT lists the KD value for the indicated antibody divided by the KD value for S2E12 WT.
  • KD WT/KD lists the KD value for S2E12 WT divided by the KD value for the indicated antibody. Blank cells indicate that no binding was measured using this assay. Table 23.
  • a panel of seven cell lines (HeLa, 293T (wt), Vero E6, Huh7, 293T ACE2, MRC 5-ACE2-TMPRSS2, A549- ACE2-TMPRS S2 clone 5, A549-ACE2-TMPRSS2 clone 10) were infected with SARS-CoV-2-Nluc or VSV pseudotyped with the SARS- CoV-2 spike protein in the presence of S309. Luciferase signal was quantified 24h post infection. S309 maximum neutralization values were as shown in Table 25. Table 25. Maximum Neutralization Values of S309
  • S2E12 neutralization data are shown in Figure 53 (SARS-CoV-2-Nluc) and Figure 54 (pseudotyped VSV). Notably, S2E12 showed comparable neutralizing activity on all target cells.
  • ACE2 Selected lectins and published receptor candidates were screened using HEK293T cells infected with SARS-CoV-2 VSV pseudoviruses.
  • ACE2 DC-SIGN, L- SIGN, and SIGLEC-1 gave the highest signals.
  • ACE2 provided a signal of approximately 10 5 relative luminescence units (RLUs), and DC-SIGN, SIGLEC-1, and L-SIGN had signals of approximately 10 4 RLUs. All other lectins/candidates tested gave signals of approximately 10 2 - 10 3 RLUs.
  • HEK 293T, HeLa and MRC5 cells were transiently transduced to overexpress DC-SIGN, L-SIGN, SIGLEC1 or ACE2 and infected with SARS-CoV-2 VSV pseudoviruses. Uninfected cells and untransduced cells were included as controls.
  • ACE2 In HEK293T cells, ACE2, DC-SIGN, SIGLEC-1, and L-SIGN all provided substantial increases in infection.
  • ACE2 In HeLa and MRC5 cells, only ACE2 increased infection.
  • Stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC-1 or ACE2 were infected with authentic SARS-CoV-2 (MOI 0.1), fixed and immunostained at 24 hours for the SARS-CoV-2 nucleoprotein. Wild-type cells (infected and uninfected) were used as controls. Increased staining was observed in cells overexpressing DC-SIGN, L-SIGN, or SIGLEC-1, and staining was significantly increased in cells overexpressing ACE2.
  • Stable cell lines were infected with SARS-CoV-2-Nluc and luciferase levels were quantified at 24 hours.
  • RLUs uninfected (approx. 10 2 -10 3 RLUs); parental 293T (approx. 10 4 RLUs); DC-SIGN (approx. 10 5 RLUs); L-SIGN (approx. 10 5 RLUs); SIGLEC-1 (approx. 10 5 -10 6 RLUs); ACE2 (>10 7 RLUs).
  • Stable cell lines were incubated with different concentration of anti-SIGLECl mAb (clone 7-239) and infected with SARS-CoV-2-Nluc. Infection as a percentage of untreated cells remained near to exceeded 100% in 293T cells expressing DC-SIGN, L- SIGN, or ACE2, but dropped to below 50% (0.2 ⁇ g/ml anti-SIGLEC) to close to 0 (1 ⁇ g/ml or 5 ⁇ g/ml anti-SIGLEC) in 293T cells expressing SIGLEC-1.
  • Single cell expression levels of selected potential SARS-CoV-2 (co)receptor candidates were determined in different lung cell types derived from the Human Lung Cell Atlas (nature.com/articles/s41586-020-2922-4).
  • DC-SIGN, L-SIGN and SIGLEC- 1 are expressed in a variety of cell types in the lung at levels similar to or even higher than ACE2.
  • Binding of antibodies targeting DC-/L-SIGN, DC-SIGN, SIGLEC1 or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor was analyzed by flow cytometry and immunofluorescence analysis.
  • HEK 293T cells over-expressing the respective attachment receptors were infected with VSV pseudotyped with SARS- COV-2 wildtype spike or spike bearing mutations of the Bl.1.7 lineage. Luminescence was analyzed one day post infection. Infection was increased in cells expressing the attachment receptors. Infection by VSV pseudotyped with either spike was similar for each test group. Cells expressing ACE2 gave the highest luminescence signal.
  • Vero E6 cells in vitro differentiated moDCs or PBMCs were infected with SARS-CoV-2 at MOI 0.01. At 24h post infection, cells were fixed, immunostained for viral nucleocapsid protein and infected cells were quantified. Only VeroE6 cells showed infection (approximately 7% of cells). Supernatant of the infected cells was taken at 24, 48 and 72h and infectious viral titer was quantified by FFU assay on Vero E6 cells.
  • ACE2 DC-SIGN (CD209), L-SIGN (CLEC4M), SIGLEC1 transcript counts were correlated with SARS-CoV-2 RNA counts in macrophages and in secretory cells. Correlation was based on counts (before log transformation), from Ren et al. Cell 2021.
  • Neutralizing activity of S309 against the VSV pseudovirus was assessed in the engineered HEK293T cells. Data are shown in Figure 45; S309 fully neutralized infection via DC-SIGN and L-SIGN, and neutralized infection via ACE2 to a lesser extent.
  • S309 antibody VH of SEQ ID NO.:139, VL of SEQ ID NO.:143
  • S2E12 antibody VH of SEQ ID NO.:399, VL of SEQ ID NO.:403 were expressed as recombinant IgGl with M428L and N434S mutations.
  • stable cell HEK293T lines were generated as described above to overexpress DC-SIGN/L-SIGN, DC-SIGN, SIGLEC-1, or ACE2. Expression data are shown in Figure 46.
  • 293T cells, HeLa cells, and MRC5 cells were transiently transduced with lentivirus encoding DC-SIGN, L-SIGN, SIGLEC-1 or ACE2 and infected with VSV pseudovirus three days after transduction. Data are shown in Figure 52. While the 293T cells showed a low level of susceptibility (compare uninfected with untransduced), HeLa and MRC5 cells were completely refractory to the virus. The low level of infection in 293T cells can be increased by expression of L-SIGN, DC-SIGN, or SIGLEC-1, consistent with a role for these proteins as as attachment factors.
  • the HeLa and MRC5 cells remained refractory to infection even after expression of L-SIGN, DC-SIGN, or SIGLEC-1, and only become susceptible after expression of ACE2. These data indicate that L-SIGN, DC-SIGN, and SIGLEC-1 are not primary receptors for SARS-CoV-2.
  • S2E12-v2 shown in Figure 99 as "S2E12" having the VH amino acid sequence of SEQ ID NO:399 and the VL amino acid sequence of SEQ ID NO:738, and comprising M428L and N434S Fc mutations.
  • S2E12-v2 MLNS had a mean T1/2 (across 3 animals) of 25.4 days.
  • SARS-CoV-2 mutations were investigated.
  • the following individual mutations in SARS-CoV-2 S had less than a 3-fold decrease on neutralization of S2E12 against live SARS-CoV-2 or SARS-CoV-2 pseudovirus: N501Y; S477N; N439K; L452R; E484K; K417N; T478K; S494P; A520S; N501T; A522S; Y453F; P384L.
  • ExpiCHO cells were transfected with S protein of SARS-CoV-2.
  • the monoclonal antibodies were then tested by flow-cytometry at 10 ⁇ g/ml for their ability to stain ExpiCHO cells expressing the S protein of SARS-CoV-2 transfectants.
  • the full-length S gene of SARS-CoV-2 strain (2019-nCoV-S) isolate BetaCo V/W uhan-Hu- 1 /2019 (accession number MN908947) was codon optimized for human cell expression and cloned into the phCMVl expression vector (Genlantis).
  • Expi-CHO cells were transiently transfected with phCMVl-SARS-CoV-2-S, phCMVl - MERS-CoV-S (Londonl/2012), SARS-spike_pcDNA.3 (strain SARS) or the empty phCMVl (Mock) using Expifectamine CHO Enhancer.
  • anti-His sensors (BIOSENSOR ANTI PENT A-HIS (HIS IK)) were used to immobilize the SI subunit protein of SARS-CoV (Sino Biological Europe GmbH). Sensors were hydrated for 10 min with Kinetics Buffer (KB; 0.01% endotoxin-free BSA, 0.002 L Tween-20, 0.005% NaN3 in PBS). SARS-CoV SI subunit protein was then loaded for 8 min at a concentration of 10 ⁇ g/ml in KB.
  • Kinetics Buffer KB; 0.01% endotoxin-free BSA, 0.002 L Tween-20, 0.005% NaN3 in PBS.
  • Antibodies were associated for 6 min at 15 ⁇ g/ml for full length mAbs nCoV-10 and nCov-6 mAbs or 5 ⁇ g/ml for Fab nCoV-4, and in a subsequent experiment comprising nCoV-1 all at 10 ⁇ g/ml. Competing antibodies were then associated at the same concentration for additional 6 mins.
  • ACE2-His Bio-Techne AG
  • HIS2 anti -HIS
  • SARS-CoV-1 RBD-rabbitFc or SARS-CoV-2 RBD-mouseFc SARS-CoV-2 RBD-mouseFc at 1 ⁇ g/ml was associated for 15 minutes, after a preincubation with or without antibody (30 ⁇ g/ml, 30 minutes). Dissociation was monitored for 5 minutes.
  • Protein A biosensors (Pall ForteBio) were used to immobilize recombinant antibodies at 2.7 ⁇ g/ml for 1 minute, after a hydration step for 10 minutes with Kinetics Buffer. Association curves were recorded for 5min by incubating the antibody-coated sensors with different concentration of SARS-CoV-1 RBD (Sino Biological) or SARS-CoV-2 RBD (produced in house; residues 331-550 of spike from BetaCoV/Wuhan-Hu-1/2019, accession number MN908947). Highest RBD concentration tested was lOug/ml, then 1 :2.5 serially diluted. Dissociation was recorded for 9min by moving the sensors to wells containing KB. KD values were calculated using a global fit model (Octet). Octet Red96 (ForteBio) equipment was used.
  • SARS-CoV-2 Spike SI Subunit Protein strain WH20 protein
  • ELISA enzyme-linked immunosorbent assays
  • Bound mAbs were detected by incubating alkaline phosphatase-conjugated goat anti-human IgG (Southern Biotechnology: 2040-04) for 1 h at room temperature and were developed by 1 mg/ml p-nitrophenylphosphate substrate in 0.1 M glycine buffer (pH 10.4) for 30 min at room temperature.
  • the optical density (OD) values were measured at a wavelength of 405 nm in an ELISA reader (Powerwave 340/96 spectrophotometer, BioTek).
  • Murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein (SARS-CoV-2pp) or SARS-CoV-1 Spike protein (SARS- CoV-lpp) were used.
  • DBT cells stably transfected with ACE2 (DBT-ACE2) were used as target cells.
  • SARS-CoV-2pp or SARS-CoV-lpp was activated with trypsin TPCK at lOug/ml.
  • Activated SARS-CoV-2pp or SARS-CoV-lpp was added to a dilution series of antibodies (starting 50ug/ml final concentration per antibody, 3-fold dilution).
  • DBT- ACE2 cells were added to the antibody-virus mixtures and incubated for 48h. Luminescence was measured after aspirating cell culture supernatant and adding steady - GLO substrate (Promega).
  • pseudoparticle neutralization assays use a VSV- based luciferase reporter pseudotyping system (Kerafast). VSV pseudoparticles and antibody are mixed in DMEM and allowed to incubate for 30 minutes at 37C. The infection mixture is then allowed to incubate with Vero E6 cells for lh at 37C, followed by the addition of DMEM with Pen-Strep and 10% FBS (infection mixture is not removed). The cells are incubated at 37C for 18-24 hours. Luciferase is measured using an Ensight Plate Reader (Perkin Elmer) after the addition of Bio-Glo reagent (Promega).
  • S304, S306, S309, S310, and S315 were expressed as rlgG-LS antibodies.
  • the LS mutation confers a longer half-life in vivo. (Zalevsky et al. (2010) Enhanced antibody half-life improves in vivo activity. Nature Biotechnology, 28(2), 157-159)
  • SARS-CoV-2 genomics sequences were downloaded from GISAID on March 29th 2020, using the “complete (>29,000 bp)” and “low coverage exclusion” filters.
  • Bat and pangolin sequences were removed to yield human-only sequences.
  • Sourced SARS-CoV genome sequences comprised all the major published strains, such as Urbani, Tor2, TW1, P2, Frankfurtl, among others.
  • Pangolin sequences as shown by Tsan-Yuk Lam et al were sourced from GISAID.
  • Bat sequences from the three clades of Sarbecoviruses as shown by Lu et al (Lancet 2020) were sourced from Genbank.
  • Civet and racoon dog sequences were similarly sourced from Genbank.
  • Lentiviruses were generated by co-transfection of Lenti-X 293T cells (Takara) with lentiviral expression plasmids encoding DC-SIGN (CD209), L-SIGN (CLEC4M), SIGLEC1, TMPRSS2 or ACE2 (all obtained from Genecopoeia) and the respective lentiviral helper plasmids. Forty-eight hours post transfection, lentivirus in the supernatant was harvested and concentrated by ultracentrifugation for 2 h at 20,000 rpm.
  • Lenti-X 293T (Takara), Vero E6 (ATCC), MRC5 (Sigma-Aldrich), A549 (ATCC) were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h. Cell lines overexpressing two transgenes were transduced subsequently. Selection with puromycin and/or blasticidin (Gibco) was started two days after transduction and selection reagent was kept in the growth medium for all subsequent culturing. Single cell clones were derived from the A549-ACE2-TMPRSS2 cell line, all other cell lines represent cell pools.
  • SARS-CoV-2 isolated USA- WA1/2020, passage 3, passaged in Vero E6 cells
  • Neutralization was determined using SARS-CoV-2-Nluc, an infectious clone of SARS-CoV-2 (based on strain 2019-nCoV/USA_WAl/2020) encoding nanoluciferase in place of the viral ORF7, which demonstrates comparable growth kinetics to wild type virus (Xie et al., Nat Comm, 2020, https://doi.org/10.1038/s41467-020-19055-7).
  • Cells were seeded into black-walled, clear-bottom 96-well plates at 20,000 cells/well (293T cells were seeded into poly-L-lysine-coated wells at 35,000 cells/well) and cultured overnight at 37°C.
  • Lenti-X 293T cells (Takara) were seeded in 10-cm dishes for 80% next day confluency. The next day, cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP 009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Mirus Bio) according to the manufacturer’s instructions. One day post-transfection, cells were infected with VSV(G* ⁇ G-luciferase) (Kerafast) at an MOI of 3 infectious units/cell.
  • Viral inoculum was washed off after one hour and cells were incubated for another day at 37°C.
  • the cell supernatant containing SARS-CoV-2 pseudotyped VSV was collected at day 2 post-transfection, centrifuged at 1000 x g for 5 minutes to remove cellular debris, aliquoted, and frozen at -80°C.
  • Lenti-X 293T cells were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia): ACE2 (NM 021804), DC-SIGN (NM_021155), L-SIGN (BC110614), LGALS3 (NM_002306), SIGLEC1 (NM_023068), SIGLEC3 (XM_057602), SIGLEC9 (BC035365), SIGLEC10 (NM_033130), MGL (NM_182906), MINCLE (NM_014358), CD147 (NM_198589), ASGR1 (NM_001671.4), ASGR2 (NM_080913), NRP1 (NM_003873).
  • HEK 293T cells were seeded onto poly-D-Lysine-coated 96-well plates (Sigma- Aldrich) and fixed 24 h after seeding with 4% paraformaldehyde for 30 min, followed by two PBS (pH 7.4) washes and permeabilization with 0.25% Triton X-100 in PBS for 30 min.
  • Cells were incubated with primary antibodies anti-DC-SIGN/L-SIGN (Biolegend, cat. 845002, 1:500 dilution), anti-DC-SIGN (Cell Signaling, cat. 13193 S, 1:500 dilution), anti-SIGLECl (Biolegend, cat.
  • Intracellular levels of ACE2 (Forward Primer: CAAGAGCAAACGGTTGAACAC, Reverse Primer: CCAGAGCCTCTCATTGTAGTCT), HPRT (Forward Primer: CCTGGCGTCGTGATTAGTG, Reverse Primer: ACACCCTTTCCAAATCCTCAG), and TMPRSS2 (Forward Primer: CAAGTGCTCCRACTCTGGGAT, Reverse Primer: AACACACCGRTTCTCGTCCTC) were quantified using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s protocol. Levels of ACE2 and TMPRSS2 were normalized to HPRT. Hela cells were used as the reference sample. All qPCRs were run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems).
  • Prefusion-stabilized SARS2 D614G spike (comprising amino acid sequence Q14 to K1211) with a C-terminal TEV cleavage site, T4 bacteriophage fibritin foldon, 8x His-, Avi- and EPEA-tag was transfected into HEK293 Freestyle cells, using 293fectin as a transfection reagent. Cells were left to produce protein for three days at 37°C. Afterwards, supernatant was harvested by centrifuging cells for 30 minutes at 500 xg, followed by another spin for 30 minutes at 4000 xg.
  • SARS2 D614G spike was eluted, using 10 column volumes of 100 mM Tris, 200 mM NaCl and 3.8 mM SEPEA peptide. Elution peak was concentrated and injected on a Superose 6 increase 10/300 GL gel filtration column, using 50 mM Tris pH 8 and 200 mM NaCl as a running buffer. SEC fractions corresponding to monodisperse SARS2 D614G spike were collected and flash frozen in liquid nitrogen for storage at -80°C.
  • Purified SARS2 D614G spike protein was biotinylated using BirA500 biotinylation kit from Avidity. To 50 ug of spike protein, 5 ug of BirA, and 11 uL of BiomixA and BiomixB was added. Final spike protein concentration during the biotinylation reaction was ⁇ 1 uM. The reaction was left to proceed for 16 hours at 4°C. Then, protein was desalted using two Zeba spin columns pre-equilibrated with lx PBS pH 7.4.
  • HEK 293T cells expressing DC-SIGN, L-SIGN, SIGLEC1 or ACE2 were resuspended at 4xl0 6 cells/mL and 100 ⁇ L per well were seeded onto V-bottom 96-well plates (Corning, 3894). The plate was centrifuged at 2,000 rpm for 5 minutes and washed with PBS (pH 7.4). The cells were resuspended in 200 ⁇ L of PBS containing ghost violet 510 viability dye (Cell Signaling, cat. 13-0870-T100, 1:1,000 dilution), incubated for 15 minutes on ice and then washed.
  • PBS PBS containing ghost violet 510 viability dye
  • the cells were resuspended in 100 ⁇ L of FACS buffer prepared with 0.5% BSA (Sigma-Aldrich) in PBS containing the primary antibodies at a 1:100 dilution: mouse anti-DC/L-SIGN (Biolegend, cat.
  • Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647-strep, Invitrogen, S21374) at a 1:20 ratio by volume for 20 min at room temperature. The labeled proteins were then stored at 4°C until further use. Cells were dissociated with Tr ⁇ LE Express (Gibco, 12605-010) and 10 5 cells were transferred to each well of a 96-well V bottom plate (Coming, 3894).
  • SARS-CoV-2-specific mAbs Human mAbs were isolated from plasma cells or memory B cells of SARS- CoV-2 immune donors, as previously described. Recombinant antibodies were expressed in ExpiCHO cells at 37°C and 8% CO2. Cells were transfected using ExpiFectamine. Transfected cells were supplemented 1 day after transfection with ExpiCHO Feed and ExpiFectamine CHO Enhancer. Cell culture supernatant was collected eight days after transfection and filtered through a 0.2 pm filter.
  • Recombinant antibodies were affinity purified on an AKTA xpress FPLC device using 5 mL HiTrapTM MabSelectTM PrismA columns followed by buffer exchange to Histidine buffer (20 mM Histidine, 8% sucrose, pH 6) using HiPrep 26/10 desalting columns
  • the SARS-CoV-2 strain used in this study BetaCov/Belgium/GHB-03021/2020 (EPI ISL 109407976
  • a close relation with the prototypic Wuhan-Hu-1 2019-nCoV (GenBank accession 112 number MN908947.3) strain was confirmed by phylogenetic analysis. Infectious virus was isolated by serial passaging on HuH7 and Vero E6 cells; passage 6 virus was used for the study described here. The titer of the virus stock was determined by end-point dilution on Vero E6 cells by the Reed and Muench method.
  • Vero E6 cells African green monkey kidney, ATCC CRL-1586 were cultured in minimal essential medium (Gibco) supplemented with 10% fetal bovine serum (Integra), 1% L- glutamine (Gibco) and 1% bicarbonate (Gibco). End-point titrations were performed with medium containing 2% fetal bovine serum instead of 10%.
  • Animals were prophylactically treated 48h before infection by intraperitoneal administration (i.p.) and monitored for appearance, behavior, and weight.
  • hamsters were euthanized by i.p. injection of 500 ⁇ L Dolethal (200 mg/mL sodium pentobarbital, Vetoquinol SA).
  • Lungs were collected and viral RNA and infectious virus were quantified by RT-qPCR and end-point virus titration, respectively. Blood samples were collected before infection for PK analysis.
  • RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One- Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid.
  • Standards of SARS-CoV-2 cDNA (IDT) were used to express viral genome copies per mg tissue or per mL serum.
  • Lung tissues were homogenized using bead disruption (Precellys) in 350 ⁇ L minimal essential medium and centrifuged (10,000 rpm, 5min, 4°C) to pellet the cell debris.
  • Precellys bead disruption
  • endpoint titrations were performed on confluent Vero E6 cells in 96- well plates.
  • Viral titers were calculated by the Reed and Muench method using the Lindenbach calculator and were expressed as 50% tissue culture infectious dose (TCID50) per mg tissue. Histology
  • the scored parameters were the following: congestion, intra-alveolar hemorrhagic, apoptotic bodies in bronchus wall, necrotizing bronchiolitis, perivascular edema, bronchopneumonia, perivascular inflammation, peribronchial inflammation and vasculitis.
  • Immunocomplexes were generated by complexing S309 mAh (hamster IgG, either wt or N297A) with a biotinylated anti-idiotype fab fragment and Alexa-488- streptavidin, using a precise molar ratio (4:8:1, respectively). Pre-generated fluorescent IC were serially diluted incubated at 4°C for 3 hrs with freshly revitalized hamster splenocytes, obtained from a naive animal. Cellular binding was then evaluated by cytometry upon exclusion of dead cells and physical gating on monocyte population. Results are expressed as Alexa-488 mean florescent intensity of the entire monocyte population.
  • HLCA Human Lung Cell Atlas
  • Github github.com/krasnowlab/HLCA
  • Processed single-cell transcriptome data and annotation of lung epithelial and immune cells from SARS- CoV-2 infected individuals were downloaded from NCBI GEO database (ID: GSE158055) and Github (github.com/zhangzlab/covid_balf).
  • Available sequence data from the second single-cell transcriptomics study by Liao et al. were downloaded from NCBI SRA (ID: PRJNA608742) for inspection of reads corresponding to viral RNA.
  • the proportion of sgRNA relative to genomic RNA was estimated by counting TRS- containing reads supporting a leader-TRS junction.
  • leader- TRS junction reads were adapted from Alexandersen et al. The viral genome reference and TRS annotation was based on Wuhan-Hu-1 NC 045512.2/MN908947 49 . Only 2 samples from individuals with severe COVID-19 had detectable leader- TRS junction reads (SRR11181958, SRR11181959).
  • Patent Application No. 63/153,784, filed February 25, 2021, and U.S. Patent Application No. 63/170, 368, filed April 2, 2021, are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Oncology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Communicable Diseases (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pulmonology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
EP21729694.6A 2020-05-08 2021-05-07 Antibodies against sars-cov-2 Pending EP4146690A1 (en)

Applications Claiming Priority (15)

Application Number Priority Date Filing Date Title
US202063022392P 2020-05-08 2020-05-08
US202063024372P 2020-05-13 2020-05-13
US202063027814P 2020-05-20 2020-05-20
US202063029338P 2020-05-22 2020-05-22
US202063031286P 2020-05-28 2020-05-28
US202063033045P 2020-06-01 2020-06-01
US202063036683P 2020-06-09 2020-06-09
US202063039939P 2020-06-16 2020-06-16
US202063046465P 2020-06-30 2020-06-30
US202063057767P 2020-07-28 2020-07-28
US202063090667P 2020-10-12 2020-10-12
US202063113450P 2020-11-13 2020-11-13
US202163153784P 2021-02-25 2021-02-25
US202163170368P 2021-04-02 2021-04-02
PCT/US2021/031442 WO2021226560A1 (en) 2020-05-08 2021-05-07 Antibodies against sars-cov-2

Publications (1)

Publication Number Publication Date
EP4146690A1 true EP4146690A1 (en) 2023-03-15

Family

ID=76250434

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21729694.6A Pending EP4146690A1 (en) 2020-05-08 2021-05-07 Antibodies against sars-cov-2

Country Status (11)

Country Link
EP (1) EP4146690A1 (ko)
JP (1) JP2023525039A (ko)
KR (1) KR20230010676A (ko)
AU (1) AU2021268361A1 (ko)
BR (1) BR112022022523A2 (ko)
CA (1) CA3177169A1 (ko)
CL (1) CL2022003085A1 (ko)
CO (1) CO2022017670A2 (ko)
IL (1) IL297988A (ko)
MX (1) MX2022013886A (ko)
WO (1) WO2021226560A1 (ko)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW202146442A (zh) * 2020-02-26 2021-12-16 美商維爾生物科技股份有限公司 抗sars-cov-2抗體及使用其之方法
PE20221893A1 (es) 2020-04-02 2022-12-13 Regeneron Pharma Anticuerpos contra glicoproteina de espicula anti-sars-cov-2 y fragmentos de union al antigeno
JP2023534923A (ja) 2020-07-06 2023-08-15 フラッグシップ パイオニアリング イノベーションズ シックス，エルエルシー ＳＡＲＳ－ＣｏＶ－２を標的にする抗原結合分子
EP4204446A1 (en) 2020-08-26 2023-07-05 Flagship Pioneering Innovations VI, LLC Antigen binding molecules targeting sars-cov-2
WO2022263638A1 (en) * 2021-06-17 2022-12-22 Centre Hospitalier Universitaire Vaudois (C.H.U.V.) Anti-sars-cov-2 antibodies and use thereof in the treatment of sars-cov-2 infection
US20230125469A1 (en) * 2021-07-14 2023-04-27 Regeneron Pharmaceuticals, Inc. Anti-SARS-CoV-2-Spike Glycoprotein Antibodies and Antigen-Binding Fragments
WO2023201256A1 (en) * 2022-04-12 2023-10-19 Vir Biotechnology, Inc. High dose antibody therapies for sars-cov-2 infection
WO2023215910A1 (en) 2022-05-06 2023-11-09 Generate Biomedicines, Inc. Antigen binding molecules targeting sars-cov-2
WO2023224714A1 (en) * 2022-05-16 2023-11-23 Lawrence Livermore National Security, Llc Repaired therapeutic and prophylactic antibodies against sars-cov-2 variants
WO2023235827A2 (en) * 2022-06-03 2023-12-07 The Rockefeller University Coronavirus-inhibiting antibodies
WO2024006472A1 (en) 2022-06-30 2024-01-04 Vir Biotechnology, Inc. Antibodies that bind to multiple sarbecoviruses
WO2024081269A1 (en) * 2022-10-10 2024-04-18 Dixit Rohan Therapeutic combinations and methods to treat long covid
WO2024102674A1 (en) 2022-11-13 2024-05-16 Generate Biomedicines, Inc. Antigen binding molecules targeting sars-cov-2

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4751180A (en) 1985-03-28 1988-06-14 Chiron Corporation Expression using fused genes providing for protein product
US4935233A (en) 1985-12-02 1990-06-19 G. D. Searle And Company Covalently linked polypeptide cell modulators
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5959177A (en) 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
WO1993006217A1 (en) 1991-09-19 1993-04-01 Genentech, Inc. EXPRESSION IN E. COLI OF ANTIBODY FRAGMENTS HAVING AT LEAST A CYSTEINE PRESENT AS A FREE THIOL, USE FOR THE PRODUCTION OF BIFUNCTIONAL F(ab')2 ANTIBODIES
US5789199A (en) 1994-11-03 1998-08-04 Genentech, Inc. Process for bacterial production of polypeptides
US5840523A (en) 1995-03-01 1998-11-24 Genetech, Inc. Methods and compositions for secretion of heterologous polypeptides
US6040498A (en) 1998-08-11 2000-03-21 North Caroline State University Genetically engineered duckweed
US6833268B1 (en) 1999-06-10 2004-12-21 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
AU782626B2 (en) 1999-10-04 2005-08-18 Medicago Inc. Method for regulating transcription of foreign genes
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
WO2004076677A2 (en) 2003-02-26 2004-09-10 Institute For Research In Biomedicine Monoclonal antibody production by ebv transformation of b cells
US7498415B2 (en) 2003-09-24 2009-03-03 Kyowa Hakko Kogyo Co., Ltd. Recombinant antibody against human insulin-like growth factor
US7612181B2 (en) 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
US8119772B2 (en) 2006-09-29 2012-02-21 California Institute Of Technology MART-1 T cell receptors
CN106459182B (zh) 2013-12-30 2021-09-03 岸迈生物科技有限公司 串联fab免疫球蛋白及其用途
WO2016181357A1 (en) 2015-05-13 2016-11-17 Zumutor Biologics, Inc. Afucosylated protein, cell expressing said protein and associated methods
WO2019024979A1 (en) 2017-07-31 2019-02-07 Institute For Research In Biomedicine FUNCTIONAL DOMAIN ANTIBODIES IN THE ELBOW REGION
US11845796B2 (en) 2017-09-22 2023-12-19 WuXi Biologics Ireland Limited Bispecific polypeptide complexes

Also Published As

Publication number Publication date
AU2021268361A1 (en) 2022-12-08
MX2022013886A (es) 2022-11-30
CA3177169A1 (en) 2021-11-11
KR20230010676A (ko) 2023-01-19
WO2021226560A1 (en) 2021-11-11
IL297988A (en) 2023-01-01
JP2023525039A (ja) 2023-06-14
BR112022022523A2 (pt) 2023-01-10
CL2022003085A1 (es) 2023-09-01
CO2022017670A2 (es) 2023-03-07

Similar Documents

Publication Publication Date Title
EP3872091B1 (en) Antibodies against sars-cov-2
EP4146690A1 (en) Antibodies against sars-cov-2
US20240059757A1 (en) Antibodies against sars-cov-2 and methods of using the same
WO2021203053A1 (en) Immunotherapy targeting a conserved region in sars coronaviruses
EP4217385A2 (en) Antibodies against sars-cov-2
EP4251279A1 (en) Antibodies that bind to multiple betacoronaviruses
WO2022204202A1 (en) Antibodies that bind to multiple sarbecoviruses
EP4247844A1 (en) Antibodies against influenza a viruses
US20240092876A1 (en) Broadly neutralizing antibodies against influenza neuraminidase
TW202204395A (zh) 抗sars-cov-2之抗體及使用其之方法
TW202210505A (zh) 抗sars-cov-2之抗體
WO2024006472A1 (en) Antibodies that bind to multiple sarbecoviruses
WO2024118998A2 (en) Engineered anti-sars-cov-2 antibodies and methods of using the same
WO2023230445A2 (en) Broadly neutralizing antibodies against influenza neuraminidase
TW202417477A (zh) 與多種嚴重急性呼吸道症候群β型冠狀病毒結合之抗體
WO2024112818A1 (en) Engineered anti-sars-cov-2 antibodies and uses thereof
WO2023245078A1 (en) Anti-parvovirus antibodies and uses thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20221207

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20231019