EP3759246A1 - Procédé d'amplification d'un acide nucléique à spécificité améliorée - Google Patents

Procédé d'amplification d'un acide nucléique à spécificité améliorée

Info

Publication number
EP3759246A1
EP3759246A1 EP19710329.4A EP19710329A EP3759246A1 EP 3759246 A1 EP3759246 A1 EP 3759246A1 EP 19710329 A EP19710329 A EP 19710329A EP 3759246 A1 EP3759246 A1 EP 3759246A1
Authority
EP
European Patent Office
Prior art keywords
primer
sequence
oligonucleotide
region
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP19710329.4A
Other languages
German (de)
English (en)
Inventor
Dmitry Cherkasov
Christian GRUNWALD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AGCT GmbH
Original Assignee
AGCT GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by AGCT GmbH filed Critical AGCT GmbH
Publication of EP3759246A1 publication Critical patent/EP3759246A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Definitions

  • the present invention relates to a method for the amplification of nucleic acids with improved specificity.
  • PCR nucleic acid chains plays a central role in biotechnology today.
  • Methods such as PCR have significantly advanced both the research landscape and industrial application fields such as diagnostics and the food industry.
  • technologies such as sequencing, real-time detection, microarray technology, microfluidic management etc.
  • Other amplification techniques such as isothermal amplification techniques have also been developed. Their use was designed especially for the area of POCT (point-of-care testing).
  • PCR plays the central role in determining the individual technological barriers to its application.
  • the PCR does not control the amplified sequence segments located between the primers.
  • the primer binding is in the focus of optimizations of PCR methods.
  • the initiation of the synthesis of major products and by-products e.g. by non-specific binding or extension of the primer.
  • the unspecifically extended primer is read off as a template, which usually leads to the formation of a complete primer binding site.
  • a transmission of erroneous sequence information from one synthesis cycle to the next occurs, which in sum leads not only to the initial formation, but above all to the exponential multiplication of by-products.
  • Such side reactions can lead to the exponential growth of fragments which interfere with the main reaction (amplification of a target sequence) or lead to interferences in subsequent steps of the analysis.
  • Such by-products typically include left and right primer sequences so that their amplification can occur in parallel with the main reaction. However, instead of a target sequence, such by-products include another nucleic acid target sequence.
  • primer sequences are typically optimized and those reaction conditions are chosen which support the specificity of primer linkages. However, if initiation of by-products has occurred, they can generally be duplicated in parallel with major products, since during the amplification process all newly formed strands are denatured regardless of their composition.
  • primer binding sites are regenerated, which is the prerequisite for a new synthesis round.
  • methods such as PCR or HDA or SDA agents are used which do not cause sequence-dependent strand separation (in the PCR, a temperature increase is used, in the HDA a helicase and ATP, and in the SDA a strand-displaced polymerase). Consequently, primer binding sites are generated in both major products and by-products for re-bonding and subsequent synthesis reaction. After a single initiation, both major products and by-products can be multiplied in parallel if primers used find corresponding primer binding sites.
  • amplification processes which have to proceed under reaction conditions that are in some cases difficult to control (eg point-of-care testing) or have a strong presence of side-reaction-promoting factors (eg amplification of sequence fragments with slight sequence deviations, such as mutations or SNV, in the presence of high levels of wild-type sequences
  • side-reaction-promoting factors eg amplification of sequence fragments with slight sequence deviations, such as mutations or SNV, in the presence of high levels of wild-type sequences
  • Such analyzes may be important, for example, in forensics, prenatal diagnostics or, for example, ctDNA detection in the context of Liquid-Biopsy analysis).
  • the specificity of the PCR amplification is achieved by optimizing the primer binding to the target sequences.
  • additional oligonucleotides can be used, which partially bind to the primer and thus can competitively participate in the primer binding to other nucleic acid chains.
  • Such probes typically bind to a sequence portion of the primer and release at the primer a single-stranded sequence portion with which the primer can bind to the target nucleic acid and initiate a synthesis reaction.
  • Primer matrices Mismatches can be competitively displaced by such oligonucleotides, which improves the specificity of the initiation.
  • Such additional oligonucleotides do not interact with the nucleic acid chain to be amplified in portions between the two primers. However, due to a molar excess of the primers, non-specific interactions of primers with templates may occur during amplification, resulting in the formation of a fully functional primer binding site as a result of the synthesis of a complementary strand of the by-product. The presence of such a complete primer binding site in the by-product results in a loss of the competitive effect of such additional oligonucleotides on primer binding. Control of the specificity of binding of a primer to the template by such oligonucleotides thus only initiates a side reaction unlikely, but can hardly influence its exponential amplification after formation of a byproduct.
  • oligonucleotide probes are used in the context of detection methods to improve the specificity of the analysis to a specific detection of certain sequences. These probes do not substantially affect exponential amplification. In general, probes require a sufficiently high concentration of nucleic acid chains and therefore exert their effect in the final stage of amplification when there is sufficient product (e.g., Taqman probes or light cycler probes).
  • an improvement in the specificity of the synthesis of an amplification process with reduced formation and co-amplification of by-products which differ from the target sequence can contribute, for example, to an improvement in diagnostic methods.
  • the object of the present invention is to provide a method with improved specificity of the synthesis of target nucleic acid chains in an exponential amplification.
  • Another object of the invention is to provide means for the implementation of an exponential amplification process with improved specificity of the synthesis.
  • a further object of the invention is to provide means and methods which can examine synthesized sequence segments between primers and influence the efficiency of an amplification reaction or the duration of an amplification reaction of sequences as a function of their agreement with a sequence specification.
  • a further object of the invention is to provide means and methods which make it possible to check the synthesized sequences in real time and to exercise control over the usability of the synthesized sequences in further amplification cycles (real time controlling / on-line quality control).
  • a further object of the invention is to provide means and methods which provide an exponential amplification method for the nucleic acid chain with a feedback function of checking contents of nucleic acid chains.
  • the feedback function of the check should be carried out parallel to the exponential amplification.
  • the individual amplification elements form a control loop.
  • the method according to the invention is intended to be able to synthesize or amplify nucleic acid chains having a defined sequence composition.
  • a method for amplification is provided.
  • the method for amplifying a nucleic acid chain or a nucleic acid chain to be amplified comprising a target sequence and / or its complementary sequence segments comprises the following steps (FIGS. 1 and 13):
  • a 5 ' overhang comprises (M2.1 .6), which is substantially non-interoperable for a polymerase
  • a second region (P1 .1 .2) (primer overhang) which adjoins or is connected to the 5 'end of the first region via a linker, the second region being defined by a first controller oligonucleotide (C1. 1) and remains substantially uncoated by a polymerase used for amplification under the chosen reaction conditions;
  • a second region (P2.1 .2) (overhang) which adjoins the 5 'end of the first region or is connected thereto via a linker, the second region being formed by a second controller oligonucleotide (C2.1) and remains substantially uncoated by a polymerase used for amplification under the chosen reaction conditions;
  • first primer extension product (P1 .1) by a template-dependent polymerase using the starting nucleic acid chain and / or the second primer extension product (P2.1-Ext) as template to give a first Primer extension product (P1 .1 -ext) which comprises, in addition to the first primer oligonucleotide, a region synthesized by the polymerase; the synthesized first primer extension product comprises the target sequence or its parts
  • C1 .1 .2 which is complementary to the first region of the second primer oligonucleotide (P1 .1 .1), and
  • C1 .1 .3 substantially complementary to at least a portion of the synthesized region of the first primer extension product (P1 .1 E4);
  • the first controller oligonucleotide does not serve as a template for a primer extension of the first primer oligonucleotide, and the first controller oligonucleotide to complementary sequence segments of the first primer extension product displacing complementary segments of the other strand (segments P2.1 E1 and P2. 1 E2) of the nucleic acid chain to be amplified;
  • C2.1 .1 which can bind to the second region of the second primer extension product (P2.1 E6) and / or to the starting nucleic acid chain (M 2.1 .6),
  • C2.1 .2 which is complementary to the first region of the second primer oligonucleotide (P2.1 .1), and
  • C2.1 .3 which is substantially complementary to at least part of the synthesized region of the second primer extension product (P2.1 E4);
  • the second controller oligonucleotide is not as a template for a
  • Primer extension of the second primer oligonucleotide, and the second Controller oligonucleotide binds to the primer extension product by displacing complementary segments of the other strand (P1 .1 E1 and P1 .1 E2) of the nucleic acid chain to be amplified;
  • the double strand comprising P1 .1 -Ext and P2.1-Ext can be separated from one another under reaction conditions with the participation of C1.1 and C2.1
  • synthesized primer extension products (P1 1 -Ext and P2.1 -Ext) can serve as matrices, and
  • the steps can be repeated until the desired amount of the nucleic acid to be amplified has been synthesized.
  • the steps of the primer extension are further modified and include displacement of the respective controller oligonucleotide from the binding with the respective primer extension product in cooperation with the primer extension product
  • the method is further modified and comprises: continuing the reaction under conditions permitting the repetition of steps.
  • the method is performed under conditions that do not permit separation of complementary strands of the nucleic acid to be amplified in the absence of a controller oligonucleotide.
  • Nucleic acid chain of a target sequence wherein the target sequence comprises the following sequence segments (in the 5 ' -3 ' direction): TS4.5, TS4.4, TS4.3, TS4.2, TS4.1 ( Figure 13).
  • the method comprises providing a starting nucleic acid chain (M2.1), wherein the 5 '-Überhang (M2.1 .6) is not complementary to the target sequence and can not be copied by the polymerase.
  • the method comprises providing a starting nucleic acid chain (M2.1), wherein the 5 '-Überhang (M2.1 .6) is not complementary to the target sequence by the polymerase and can not be copied and the first region second controller Oligonukleotides can bind.
  • M2.1 starting nucleic acid chain
  • the 5 '-Überhang (M2.1 .6) is not complementary to the target sequence by the polymerase and can not be copied and the first region second controller Oligonukleotides can bind.
  • the method comprises the provision of a starting nucleic acid chain (M2.1) which comprises the following sequence segments (in the 5 ' -3 ' direction):
  • M2.1 .5, M2.1 .4, M2.1 .3, M2.1 .2, M2.1 .1 comprise substantially complementary sequences to the target sequence.
  • the steps of binding the first controller and the second controller to the primer extension products occur simultaneously or parallel to each other.
  • the first controller oligonucleotide is not identical to the second controller oligonucleotide.
  • each primer extension product each comprises a segment which is not complementary to the respective controller.
  • each primer extension product each comprises a segment which is not complementary to the respective controller, with simultaneous binding of both controllers to complementary regions of the respective primer extension products, both primer extension products double stranded through their non-controller complementary segments can train.
  • each primer extension product each comprises a segment which is not complementary to the respective controller, and when simultaneously binding both of the controllers to complementary regions of the respective primer extension products, both primer extension products double stranded through their non-controller complementary segments and comprise these segments P1 .1 E3 and P2.1 E3.
  • the first primer extension product comprises a P1 .1 E3 segment.
  • the second primer extension product comprises a P2.1 E3 segment.
  • the P1 1 -ext can bind with its P1 .1 E3 segment to P2.1 E3 of the P2.1-Ext complementarily.
  • the first primer extension product comprises a P1 .1 E3 segment and the second primer extension product comprises a P2.1 E3 which has a length in the range from 0 to 100 nucleotides, in particular from 0 to 50 nucleotides,
  • nucleotides in particular from 0 to 30 nucleotides, in particular from 0 to 15 nucleotides.
  • the process is carried out at reaction conditions comprising temperatures between 25 ° C and about 80 ° C, in particular between 45 ° C and 75 ° C, in particular between 50 ° C and 70 ° C.
  • the P1 1 -text can be complementarily bound with its P1 .1 E3 segment to P2.1 E3 of the P2.1-Ext and form a double strand, the lengths of the segments P1 .1 E3 and P2.1 E3 thus are chosen that the double strand under
  • the process is carried out isothermally. In another embodiment, at least two different temperatures are used.
  • copying of the polynucleotide tail in the second primer region is effected by a polymerase stop region located between the first and second regions.
  • the third single-stranded region of the controller oligonucleotide is substantially complementary to the segment of the polymerase-synthesized extension product of the respective primer extension product which immediately adjoins the first primer region, wherein:
  • the third single-stranded region of the controller oligonucleotide is fully complementary to the 5 ' segment of the extension product of the respective primer extension product, the length of this complementary sequence segment comprising: at least 3 to 70 nucleotides, more preferably at least 5 to 50 Nucleotides, in particular from 5 to 40 nucleotides, more particularly from 5 to 30 nucleotides, in particular from 5 to 20 nucleotides.
  • the method is further modified and comprises: simultaneously amplifying the first and second primer extension products in an exponential reaction using the first and second primer oligonucleotide and the first controller oligonucleotide and the second controller oligonucleotide, wherein the formed primer extension products occur as templates for mutual synthesis.
  • the method comprises the provision of a starting nucleic acid chain (M2.1) (FIGS. 13 and 20) and the following steps:
  • a first region which can bind (essentially) sequence-specifically to the 3 'region of the complementary strand (TS4.1 and / or P1 .1 E1),
  • a second region (P2.1 .2) (overhang) which adjoins the 5 'end of the first region or is connected thereto via a linker, the second region being formed by a second controller oligonucleotide (C2.1) and remains substantially uncoated by a polymerase used for amplification under the chosen reaction conditions; Extension of the second primer oligonucleotide (P2.1) by a template-dependent polymerase using the target sequence as a template to give a starting nucleic acid sequence M2.1 ( Figure 13) which comprises a synthesized region in addition to the second primer oligonucleotide which comprises segments complementary to the target sequence;
  • the separation may be by either of the methods: thermal denaturation, alkali denaturation, enzymatic strand separation (e.g., helicase), degradation (e.g., RNase degradation).
  • thermal denaturation alkali denaturation
  • enzymatic strand separation e.g., helicase
  • degradation e.g., RNase degradation
  • substantially complementary in the sense of the invention means in particular that the mutually complementary regions of nucleic acid have not more than 5, 4, 3, 2, or 1 mismatches.
  • the above steps can be carried out in one approach or in separate approaches. If the operations are to be carried out in one batch, they may be treated under the same conditions, e.g. isothermal, or under different conditions, e.g. during thermocycling. In particular, primer oligonucleotides and controller oligonucleotide are present at the beginning of the reaction. However, sequential addition of individual reagents is also possible.
  • the third region of the first controller oligonucleotide is substantially complementary to the part of the synthesized region of the first primer extension product which directly adjoins the primer oligonucleotide part of the first primer extension product.
  • this improves the sequence-specific displacement of the nucleic acid to be amplified.
  • the part of the synthesized region that is substantially complementary to the third region of the first controller nucleotide has a length in the range from 5 nucleotides to 50 nucleotides.
  • the third region of the second controller oligonucleotide is substantially complementary to the part of the synthesized region of the second primer extension product that directly adjoins the primer oligonucleotide portion of the first primer extension product followed. In particular, this improves the sequence-specific displacement of the complementary strand or of the first primer extension product.
  • the part of the synthesized region which is substantially complementary to the third region of the second controller nucleotide has a length in the range from 3 nucleotides to 70 nucleotides, in particular 5 nucleotides to 50 nucleotides, in particular 5 nucleotides to 50 nucleotides, more particularly 5 nucleotides to 30 nucleotides, more particularly 5 nucleotides to 20 nucleotides.
  • the third single-stranded region of the first controller oligonucleotide is complete to the 5 ' segment of the first primer extension product
  • this complementary sequence section comprises the following ranges: from at least 3 to 70 nucleotides, in particular from at least 5 to 50 nucleotides, in particular from 5 to 40 nucleotides, from 5 to 30 nucleotides, or in particular from 5 to 20 nucleotides.
  • the third single-stranded region of the second controller oligonucleotide is fully complementary to the said 5 ' segment of the second primer extension product, the length of this complementary sequence segment comprising: at least 3 to 70 nucleotides, in particular at least 5 to 50 nucleotides, in particular from 5 to 40 nucleotides, more particularly from 5 to 30 nucleotides, or from 5 to 20 nucleotides.
  • the method further comprises the following step: hybridization of a probe to a region of the nucleic acid to be amplified, the complementary strand, the first primer extension product or the second primer extension product, wherein the range does not depend on the first controller oligonucleotide or the second controller oligonucleotide is bound or interacts.
  • the method further comprises the following step: hybridization of a blocking oligonucleotide to a region of the nucleic acid to be amplified, the complementary strand, the first primer extension product or the second primer extension product, the region not hybridization of the block oligonucleotide prevents amplification of the nucleic acid to be amplified, the complementary strand, the first primer extension product or the second primer extension product.
  • the method is carried out essentially isothermally.
  • substantially isothermal in the sense of the present description means in particular that the reaction temperature is changed by not more than 10 ° C within the process.
  • the nucleic acid to be amplified comprises a length in the range from 30 nucleotides to 200 nucleotides.
  • the first primer oligonucleotide has a length in the range from 15 nucleotides to 60 nucleotides.
  • the second primer oligonucleotide has a length in the range from 15 nucleotides to 60 nucleotides.
  • the first controller oligonucleotide has a length in the range from 20 nucleotides to 100 nucleotides.
  • the second controller oligonucleotide has a length in the range from 20 nucleotides to 100 nucleotides.
  • the region of the double strand comprising the first primer extension product and the nucleic acid to be amplified which is not bound by the first controller oligonucleotide or the second controller oligonucleotide, dissociated into the respective single strands under the selected reaction conditions ,
  • the region of the duplex comprising the second primer extension product and the complementary strand which is not from the first controller oligonucleotide or from the second
  • Controller oligonucleotide is bound under the chosen reaction conditions dissociated into the respective single strands.
  • the region of the duplex comprising the first primer extension product and the second primer extension product which is not bound by the first controller oligonucleotide or the second controller oligonucleotide dissociates into the respective single strands under the selected reaction conditions.
  • the selected reaction conditions comprise a reaction temperature in the range of 30 ° C to 75 ° C.
  • the first primer oligonucleotide has one or more modifications in the second region, in particular immediately following the first region of the first primer oligonucleotide, which stop the polymerase used at the second region. In particular, only the first region of the first primer oligonucleotide is thereby used as the template of a polymerase.
  • the second primer oligonucleotide has one or more modifications in the second region, in particular immediately following the first region of the second primer oligonucleotide, which stop the polymerase used at the second region. In particular, only the first region of the second primer oligonucleotide is thereby used as the template of a polymerase.
  • nucleotide modifications which, although they may form a complementary bond with the first region of the respective controller oligonucleotide, are not accepted by the polymerase as a template.
  • nucleotide modifications set nucleotide compounds with modified phosphate-sugar backbone moieties, for example, 2 '-0-alkyl-RNA modifications (eg 2' OMe), LNA modifications or morpholino modifications. In general prevents the presence of such modifications in one strand of a DNA-dependent polymerase upon reading such a strand. The number of such modifications may be different, usually several modifications (between 5 and 30) may be sufficient to one
  • Polymerase function so that certain segments of the structures used can not be copied by the polymerase and remain predominantly single-stranded.
  • the kit according to the invention comprises: a first primer oligonucleotide having the following ranges:
  • first primer oligonucleotide can be extended by a polymerase to a first primer extension product comprising a synthesized region in addition to the first primer oligonucleotide; a second primer oligonucleotide having the following ranges:
  • the second primer oligonucleotide can be extended by a polymerase to a second primer extension product comprising a synthesized region in addition to the second primer oligonucleotide;
  • a first controller oligonucleotide comprising the following ranges:
  • a second region which is substantially complementary to the first region of the second primer oligonucleotide
  • a second controller oligonucleotide comprising the following ranges:
  • a second region which is substantially complementary to the first region of the second primer oligonucleotide
  • the kit further comprises a
  • kits according to the above aspect for carrying out the method according to the first aspect or one of the associated embodiments or alternatives is provided. Further details and advantages of the invention will be explained in a non-restrictive manner by the following figures and a detailed description of selected embodiments.
  • Fig. 1 shows the sequence components of an embodiment of the invention
  • FIG. 2 shows A: the schematic structure of primer 1 .1, primer 2.1, controller 1 .1 and controller 2.1 and B: the interaction between primer 1 .1 and controller 1 .1 or primer 2.1 and controller 2.1.
  • Fig. 4 shows a schematic representation of the primer binding to the primer extension products
  • Fig. 5 shows a schematic representation of the controller binding to the primer extension products.
  • Fig. 6 shows a schematic representation of the interaction between the controllers (C1 .1 / C1 .2) and the primer extension products (P1 1-Ext./P2.1-Ext.).
  • Fig. 8 shows a schematic representation of the amplification starting from P1 1-Ext.
  • FIG. 9 shows a schematic representation of the preparation of a starting nucleic acid chain starting from P1 .1 and its use in amplification.
  • Fig. 10 shows a schematic representation of a longer double-stranded nucleic acid chain (A); hybridization of primer P.1.1 to the 3 ' end of one strand of the double-stranded nucleic acid chain (B); the extended primer P1 1 -Ext (C); and extension of primer P2.1 attached to P1 1 -ext. as template is hybridized (D).
  • Fig. 1 1 shows a schematic representation of a longer double-stranded nucleic acid chain (A); hybridization of primer P2.1 to the 3 ' end of one strand of the double-stranded nucleic acid chain (B); the extended primer P2.1 -Ext (C); and the extension of the primer P1 .1 attached to P2.1 -Ext. as template is hybridized.
  • Fig. 12 shows schematically the synthesis of P1 .1-Ext. under displacement of the controller C2.1.
  • Fig. 13 shows schematically the synthesis of P2.1-Ext. under displacement of the controller C1 .1.
  • Fig. 14 shows schematically the interaction of the controllers C1 .1 and C2.1 with the complex of P1 .1 -Ext. and P2.1 -Ext.
  • Fig. 15 shows schematically the interaction of the controllers C1 .1 and C2.1 with the complex of P1 .1 -Ext. and P2.1 -Ext.
  • 16 shows schematically the interaction of the controllers C1 .1 and C2.1 with the complex of P1 .1 -Ext. and P2.1 -Ext.
  • Figures 17-19 show schematically certain embodiments of topography of a nucleic acid chain to be amplified
  • Fig. 20 shows a schematic representation of the preparation of a starting nucleic acid chain starting from P2.1 and their use in the amplification.
  • Figs. 21-30 show results of amplification (examples)
  • the primer oligonucleotide comprises a first primer region and a second region.
  • two primer oligonucleotides are used, each for the initiation of the synthesis of a specific primer extension product.
  • the first and the second primer oligonucleotide differ from each other by the
  • the first primer region is capable of binding to a substantially complementary sequence within the nucleic acid or its equivalents to be amplified and initiating a primer extension reaction.
  • the second region comprises a polynucleotide tail which is capable of binding a controller oligonucleotide and thereby effecting spatial proximity between the controller oligonucleotide and the other portions of the corresponding primer extension product sufficient to induce strand displacement through the controller oligonucleotide.
  • the second region of the primer oligonucleotide further comprises at least one modification (a nucleotide modification or a non-nucleotide modification) which prevents the polymerase from copying the polynucleotide tail by inhibiting the continuation of the polymerase dependent synthesis.
  • This modification is located, for example, at the junction between the first and the second region of the primer oligonucleotide.
  • the first primer region of the primer oligonucleotide is thus replicable by a polymerase such that a complementary sequence to this region can be generated during synthesis of the second primer extension product from the polymerase.
  • the polynucleotide tail of the second region of the primer oligonucleotide is not copied by the polymerase.
  • this is achieved by the modification in the second region, which stops the polymerase from the polynucleotide tail.
  • this is accomplished by nucleotide modifications in the second region, where the entire polynucleotide tail consists essentially of such nucleotide modifications and thus is uncopatible to the polymerase.
  • each first primer oligonucleotide is specific for each nucleic acid to be amplified.
  • each first primer oligonucleotide is specific for at least two of the nucleic acids to be amplified, each comprising substantially different sequences.
  • the first primer oligonucleotide is labeled with a characteristic marker, e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.
  • a characteristic marker e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.
  • a characteristic marker e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment,
  • a primer extension product results from enzymatic (polymerase-dependent) extension of a primer oligonucleotide as a result of template-dependent synthesis catalyzed by a polymerase.
  • a primer extension product comprises the sequence of the primer oligonucleotide in its 5 ' segment and the sequence of the extension product (also called extension product) which has been synthesized by a polymerase in a template-dependent form.
  • the extension product synthesized by the polymerase is complementary to the template strand on which it was synthesized.
  • a specific primer extension product (eg in Fig. 1 P.1 .1 -Ext or P2.1 -Ext.) (Main product of the amplification, also called the nucleic acid chain to be amplified, also referred to as amplification fragment) comprises sequences of the to be amplified nucleic acid chain. It is a result of a specific synthesis or execution of an intended primer extension reaction in which the nucleic acid sequence to be specifically amplified serves as a template.
  • a non-specific primer extension product includes sequences that have resulted as a result of a nonspecific or improper primer extension reaction. These include, for example, primer extension products that have arisen as a result of a false initiation event (false priming) or as a result of other side reactions, including polymerase-dependent sequence changes such as base substitution, deletion, etc.
  • the level of sequence aberrations of nonspecific primer extension products generally exceeds the ability of controller oligonucleotides to successfully displace such double-stranded by-products from their templates so that the amplification of such by-products is slower or completely absent.
  • the degree of acceptance or the tolerance limit on deviations depends, for example, on the reaction temperature and the manner of the sequence deviation.
  • nonspecific primer extension products are primer dimers or sequence variants which do not correspond to the nucleic acid to be amplified, e.g. Sequences which do not comprise a target sequence.
  • the assessment of a sufficient specificity of the amplification is often related to the task. In many amplification methods, some degree of unspecificity of the amplification reaction can be tolerated as long as the desired result can be achieved.
  • the sequence of the synthesized primer extension products coincides completely with the expected sequence of a nucleic acid to be amplified.
  • deviations in the sequence obtained may be tolerated by the theoretically expected sequence.
  • the degree of agreement of the sequence obtained as a result of an amplification with the sequence of the theoretically expected nucleic acid to be amplified for example, between 90% and 100%, in particular, the match above 95%, in particular, the agreement is over 98% (measured by the proportion of synthesized bases).
  • the length of the extension product of a specific primer extension product may be between 10 and 300 nucleotides, in some embodiments between 10 and 180 nucleotides, in some embodiments between 20 and 120 nucleotides, or between 30 and 80 nucleotides.
  • the proportion of nucleic acid chains to be amplified in the overall result of the reaction is more than 1%, in particular more than 10%, in particular more than 30%, based on the total amount of newly synthesized strands.
  • the nucleic acid chain to be amplified represents a nucleic acid chain which is to be amplified sequence-specifically or at least predominantly sequence-specifically by means of the exponential amplification using primers and controller oligonucleotide by the polymerase.
  • the nucleic acid sequence to be amplified comprises the first specific and second specific primer extension products.
  • the nucleic acid chain to be amplified comprises a target sequence or is complementary thereto.
  • the length of the nucleic acid chain to be amplified may be between 20 and 300 nucleotides, in particular between 30 and 200 nucleotides, or between 40 and 150 nucleotides, or between 50 and 100 nucleotides.
  • the nucleic acid sequence to be amplified may comprise one or more target sequences or their equivalents.
  • a nucleic acid chain to be amplified may comprise sequences substantially complementary to a target sequence, which are propagated with similar efficiency as a target sequence in an amplification reaction and comprise the target sequence or its segments.
  • the nucleic acid to be amplified may include additional sequence segments, for example, primer sequences, sequences having primer binding sites, and / or sequence segments for binding detection probes, and / or sequence segments for sequence encoding strands by barcode sequences and / or sequence segments for binding to a solid phase.
  • the primer sequences or their sequence portions, as well as primer binding sites or their sequence portions may for example belong to sequence sections of a target sequence.
  • nucleic acid chain In order for the amplification to start, at the beginning of the reaction, a nucleic acid chain (starting nucleic acid chain) must be added to the reaction mixture, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain.
  • This start nucleic acid chain gives the arrangement of individual Sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.
  • This start-up nucleic acid chain comprises an uncopiable 5 ' region (overhang), which in one specific embodiment is identical to the second primer region of a primer.
  • Such a start nucleic acid chain (M1 .1 or M2.1) can be amplified, for example, by a primer extension reaction using a nucleic acid strand comprising a target sequence and one of the two amplification primers (of the first primer oligonucleotide, FIG. 9 and 10, or the second primer oligonucleotide, Figures 13 and 20) and a suitable polymerase and substrates (dNTP).
  • dNTP suitable polymerase and substrates
  • such a starting nucleic acid chain may be added as an initial template to initiate the reaction.
  • the respective primers bind to the corresponding binding sites in the starting nucleic acid chain and initiate the synthesis of specific primer extension products.
  • specific primer extension products accumulate exponentially in the course of amplification and increasingly assume the role of templates for the synthesis of complementary primer extension products in exponential amplification.
  • the nucleic acid chain to be amplified is thus formed.
  • the major product of the reaction (the nucleic acid to be amplified) may be predominantly single-stranded or predominantly a complementary duplex. This can be determined, for example, by the relative concentration of both primers and corresponding reaction conditions.
  • nucleic acid chain to be amplified include nucleic acids having substantially identical information content.
  • complementary strands of a nucleic acid to be amplified have identical information content and can be said to be equivalent.
  • a nucleic acid to be amplified comprises a target sequence.
  • the target sequence corresponds to the nucleic acid to be amplified.
  • a starting nucleic acid chain comprises a target sequence.
  • the target sequence corresponds to a starting nucleic acid chain.
  • the target sequence forms part of the sequence of the nucleic acid sequence to be amplified.
  • a target sequence may be from 3 ' side and / or flanked by 5 ' side of further sequences.
  • These further sequences may include, for example, binding sites for primers or their moieties, and / or comprising primer sequences or their moieties, and / or binding sites for detection probes, and / or adapter sequences for complementary binding to a solid phase (eg, Im Frame of microarrays, or bead-based analyzes) and / or include barcoding sequences for a digital signature of sequences.
  • the initial template which is supplied to an amplification reaction at the beginning, or which is added to the reaction mixture, corresponds to the sequence composition of the nucleic acid chain to be amplified.
  • a target sequence in one embodiment is a segment of a nucleic acid chain to be amplified which can serve as a characteristic sequence of the nucleic acid to be amplified. This target sequence can serve as a marker for the presence or absence of another nucleic acid.
  • This other nucleic acid thus serves as the source of the target sequence and can be for example a genomic DNA or RNA or parts of the genomic DNA or RNA (eg mRNA), or equivalents of the genomic DNA or RNA of an organism (eg cDNA, modified RNA such as rRNA, tRNA, microRNA, etc.), or defined changes in the genomic DNA or RNA of an organism, for example mutations (eg deletions, insertions, substitutions, additions, sequence amplification, eg repeat propagation in the context of microsatellite instability), splice variants, rearrangement variants (eg, T-Ze II receptor variants), etc.
  • mutations eg deletions, insertions, substitutions, additions, sequence amplification, eg repeat propagation in the context of microsatellite instability
  • splice variants eg, rearrangement variants (eg, T-Ze II receptor variants), etc.
  • the individual target sequences may represent a phenotypic trait, such as antibiotic resistance or prognostic information, and thus be of interest for diagnostic assays / assays.
  • a source / origin of a target sequence such a nucleic acid may comprise, for example, the target sequence as a sequence element of its strand.
  • a target sequence can thus serve as a characteristic marker for a particular sequence content of another nucleic acid.
  • the target sequence can be single-stranded or double-stranded. It may be substantially identical to the nucleic acid to be amplified or may be only part of the nucleic acid to be amplified.
  • Equivalents of the target sequence include nucleic acids with substantially identical information content.
  • complementary strands of a target sequence have identical informational content and can be said to be equivalent;
  • RNA and DNA variants of a sequence are also examples of equivalent informational content.
  • such a target sequence can be isolated from its original sequence environment and prepared for the amplification reaction.
  • Starting Nucleic Acid Chain Figures 9 and 10, 13 and 20
  • a nucleic acid chain For the amplification to start, a nucleic acid chain must be present in the reaction mixture at the beginning of the reaction, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain. This start nucleic acid chain predetermines the arrangement of individual sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.
  • Such a starting nucleic acid chain can be present in single-stranded or double-stranded form at the beginning of the reaction.
  • the complementary strands of the starting nucleic acid chain are separated, regardless of whether the nucleic acid was originally double- or single-stranded, the strands can serve as a template for the synthesis of specific complementary primer extension products.
  • the controller oligonucleotide (C1 .1 and C2.1) is a single-stranded nucleic acid chain which includes a sequence substantially complementary to a portion of a primer extension product which is specifically generated as part of the amplification of the nucleic acid to be amplified. This allows the controller oligonucleotide to bind substantially complementary to the first primer oligonucleotide and at least to the 5 ' segment of the specific extension product of the first primer oligonucleotide.
  • At least two controller oligonucleotides are used, each of which can sequence-specifically bind to its primer extension product.
  • the first controller oligonucleotide interacts specifically with the first primer oligonucleotide and with the first primer extension product.
  • the second controller oligonucleotide interacts specifically with the second primer oligonucleotide and with the second primer extension product.
  • controller oligonucleotide differs from each other, the basic structure of a controller oligonucleotide is the same for both controller oligonucleotides used. For simplicity of illustration, therefore, the first controller oligonucleotide will be explained. The structure of the second controller oligonucleotide can be adapted according to these specifications.
  • the first controller oligonucleotide may be substantially complementary to the first primer oligonucleotide and at least to the 5 ' segment of the specific extension product of the first primer oligonucleotide.
  • the controller oligonucleotide comprises in its inner sequence segment nucleotide modifications which prevent the polymerase from synthesizing a complementary strand using the controller oligonucleotide as template when the first primer oligonucleotide is complementarily bound to the controller oligonucleotide.
  • the controller oligonucleotide is further capable of completely or partially displacing the respective second specific primer extension product from binding with the first specific primer extension product under the chosen reaction conditions via strand displacement. In this case, the controller oligonucleotide with its complementary regions is attached to the first specific primer extension product.
  • the controller oligonucleotide Upon successful binding between the controller oligonucleotide and the first specific primer extension product, this results in the restoration of a single-stranded state of the 3 ' -terminal segment of the second specific primer extension product suitable for binding the first primer oligonucleotide, such that a new primer extension reaction can take place.
  • the controller oligonucleotide may be separated from binding with the first primer extension product by strand displacement, for example, by the polymerase and / or by the second primer oligonucleotide.
  • the present invention relates to a method for the exponential amplification of DNA, which includes a sequence control or sequence check during the amplification via partial segments of the fragment to be amplified by means of controller oligonucleotides.
  • a sequence control or sequence check during the amplification via partial segments of the fragment to be amplified by means of controller oligonucleotides.
  • the inventive method starts with the extension of two primers. Immediately after the synthesis, the amplification fragment is in double-stranded form. This duplex is stable under the reaction conditions and can not spontaneously dissociate or this spontaneous dissociation occurs very slowly.
  • primer-binding sequence segments are also present in double-stranded form and thus are not accessible to the binding of single-stranded primers.
  • amplification fragments with primer binding sites in double-stranded form can not occur as templates for specific sequence synthesis.
  • the double-stranded form represents an inert form of the amplification fragment.
  • the synthesized sequence fragments should serve as templates in subsequent synthesis cycles.
  • the synthesized amplification fragment from its double-stranded form must be at least partially converted to single-stranded form, wherein at least the primer binding sites must be in single-stranded form and thus be able to bind primers that can initiate synthesis.
  • a double-stranded opening occurs with the participation of two controller oligonucleotides which comprise complementary sequences to terminal regions of the fragment to be amplified.
  • the controller oligonucleotides are capable of binding with a sequence segment of the synthesized strand and forming a duplex.
  • primer binding sites are converted into single-stranded form and can thus bind new primers.
  • the prerequisite for the opening of the double strand of the fragment to be amplified is in particular a sequence match with the respective controller sequences.
  • a sequence check of segments of the synthesized fragment takes place before the synthesized fragment is converted from a double-stranded form into a single-stranded form. Sequence checking is performed beyond the primer length (about 5-50 nucleotides of the synthesized portion) and thus differs from conventional amplification methods, where only the primer sequence is responsible for sequence-specific binding.
  • a middle sequence segment (P1 .1 E3 and P2.1 E3 Figures 10 and 13) of the synthesized fragment is not checked by controllers in one embodiment. While both controller oligonucleotides have formed a double strand with synthesized strands, thus the middle sequence segment of the synthesized strand remains in double-stranded form.
  • the separation of this double-stranded segment can be favored, for example, by the choice of the temperature. Especially at very short lengths (less than 10 nucleotides) of this fragment, strand separation occurs rapidly under reaction conditions (e.g., 55 ° C or 65 ° C).
  • the interaction of the two controller oligonucleotides and the temperature-dependent separation of the middle segment results in a permanent separation of the synthesized double strand into a single-stranded form.
  • the respective controller oligonucleotides remain on complementary parts of the respective strand and thus form a double strand.
  • the controller strands are displaced by the polymerase during the synthesis of a complementary strand, so that a new synthesized strand can be formed.
  • the polymerases used are thus able to displace controller oligonucleotides from their binding with complementary segments of the fragment to be amplified.
  • amplification occurs as an exponential amplification in which newly synthesized products of both primers (primer extension products) occur as templates for further synthetic steps.
  • This primer sequences are at least partially copied, so that complementary primer binding sites arise, which are present immediately after their synthesis as sequence segments of a double strand.
  • the double-stranded opening of the main products of the amplification takes place inter alia by means of an oligonucleotide, termed controller oligonucleotide.
  • the controller oligonucleotide comprises sequence segments corresponding to the target sequence.
  • the strand separation according to the invention is achieved by the use of controller oligonucleotides with predefined sequences, which in particular separate by means of a sequence-dependent nucleic acid-mediated strand displacement a newly synthesized double strand consisting of two specific primer extension products.
  • the resulting single-stranded segments of primer extension products comprise the target sequence, as well as corresponding primer binding sites, which can serve as binding sites for further primer oligonucleotides, so that exponential amplification of nucleic acid chains to be amplified is achieved.
  • the primer extension reactions and strand displacement reactions take place simultaneously, in particular in the batch.
  • the amplification occurs in particular under reaction conditions which do not allow a spontaneous separation of both specific synthesized primer extension products.
  • a specific exponential amplification of a nucleic acid sequence comprising a target sequence comprises a repetition of synthesis steps and double strand opening steps (activation steps for primer binding sites) as a mandatory prerequisite for the amplification of the nucleic acid chain.
  • the opening of synthesized duplexes is implemented as a reaction step which is to be sequence-specifically influenced by the controller oligonucleotide. This opening can be complete, even to the dissociation of both complementary primer extension products, or even partial.
  • the controller oligonucleotide comprises sequence segments which can interact with the target sequence and further sequence segments which bring about this interaction or facilitate or favor it.
  • double-stranded portions of the synthesized primer extension products via sequence-specific strand displacement are converted into a single-stranded form.
  • This process is sequence-dependent: only when the sequence of the synthesized double strand has a certain degree of complementarity with the corresponding sequence of the controller oligonucleotide, there is sufficient double-stranded opening, so that the essential for the continuation of the synthesis sequence sections, such as primer - Binding sites are converted into single-stranded form, which corresponds to an "active state".
  • the controller oligonucleotide thus "specifically" activates the newly synthesized primer extension products comprising the target sequence for further synthetic steps.
  • sequence segments which do not comprise a target sequence are not converted to a single-stranded state and remain as a double strand, which corresponds to an "inactive" state.
  • the potential primer binding sites in such a duplex are disadvantaged or hindered from interacting with new primers, so that further synthetic steps on such "non-activated" strands generally do not occur.
  • This lack of or decreased activation (i.e., single stranded state) of synthesized nucleic acid strands following a synthesis step results in the successful conclusion that only a reduced amount of primers can successfully participate in a primer extension reaction in the subsequent synthesis step.
  • synthesis steps and activation steps are combined into an amplification process and carried out as long, or repeated as often, until the desired amount of the specific nucleic acid chain is provided.
  • reaction conditions e.g., temperature
  • the reaction conditions are designed such that spontaneous separation of complementary primer extension products in the absence of a controller oligonucleotide is unlikely or significantly slowed.
  • the controller oligonucleotide facilitates this double-stranded separation as a result of matching its sequence segments to given sequence segments of the primer extension products , This match is checked after each synthesis cycle by the controller oligonucleotide.
  • the exponential amplification results from successful repeats of synthesis events and sequence-specific strand displacements by the controller oligonucleotide, ie, "activations" (double-stranded openings / double-stranded separations / strand displacement events resulting in single-stranded form from corresponding primer binding sites) of newly synthesized primer extension products.
  • controller oligonucleotide and the reaction conditions result in the interaction of the controller oligonucleotide with non-specific primer extension products being different. Due to insufficient complementarity between controller oligonucleotide and a nonspecific primer extension product, there is not sufficient duplex separation / strand displacement from such nonspecific primer extension product from its template strand. The non-specific product thus remains predominantly in an "inactive", double-stranded state.
  • controller oligonucleotide thus allows a sequence-dependent review of the contents of primer extension products between individual synthesis steps during exponential amplification and to provide a selection of sequences for subsequent synthetic steps.
  • active single-stranded states of newly synthesized specific primer extension products may result as a result of successful interaction with a controller oligonucleotide
  • active double-stranded states of newly synthesized non-specific primer extension products as a result of deficient and / or insufficient and / or decreased and / or slowed interaction with a controller oligonucleotide.
  • An exponential amplification of target sequence-comprising nucleic acid chains is sequence-controlled (main reaction). This sequence control occurs after each synthesis step and includes sequence segments which are between primers and comprise a target sequence. The successful verification of the result of the synthesis after each synthesis step results in the separation of both specific primer extension products, which is the prerequisite for further specific synthesis steps.
  • sequence-dependent nucleic acid-mediated strand displacement for sequence-specific separation of the two primer extension products during the amplification reaction in the described method results in sufficient complementarity between newly synthesized extension fragments of the primer oligonucleotides with the sequence of a priming sequence set forth at the beginning of an amplification Controller oligonucleotide is a prerequisite for successful strand displacement and thus can affect the efficiency of strand separation of a double strand (consisting of the first and second primer extension products). Slight deviations slow the strand displacement and thus slow the strand separation. This can have a slowing down of the overall reaction.
  • the nucleic acid synthesis-inducing agent may be an enzyme-entrapping compound or a system that functions to effect the synthesis of the primer extension products.
  • Suitable enzymes for amplification for this purpose include e.g. DNA polymerases such as Bst polymerase and its modifications, Vent polymerase and other - particularly heat stable - DNA polymerases that allow the incorporation of the nucleotides in the correct manner, thereby forming the primer extension products that are complementary to each nucleic acid strand synthesized.
  • DNA polymerases such as Bst polymerase and its modifications, Vent polymerase and other - particularly heat stable - DNA polymerases that allow the incorporation of the nucleotides in the correct manner, thereby forming the primer extension products that are complementary to each nucleic acid strand synthesized.
  • the synthesis is initiated at the 3 'end of each primer and then proceeds in the 5' direction along the template strand until the synthesis is complete or interrupted.
  • template-dependent DNA polymerases that are capable of strand displacement are used in the first amplification.
  • these include, for example, the large fragment of Bst polymerase or its modifications (e.g., Bst 2.0 DNA polymerase), Klenow fragment, Vent exo minus polymerase, Deepvent exo minus DNA polymerase, large fragment of Bsu DNA polymerase, large fragment of Bsm DNA polymerase.
  • polymerases are used which have no 5 ' -3 ' -Exonuklease- activity, or have no 5 ' -3 ' -FFEN activity.
  • dNTPs deoxyribonucleoside triphosphates
  • dATP deoxyribonucleoside triphosphates
  • dCTP deoxyribonucleoside triphosphates
  • dGTP deoxyribonucleoside triphosphates
  • TTP dUTP, or dUTP / TTP mixture
  • these dNTP analogs comprise a characteristic label (eg, biotin or fluorescent dye) such that when incorporated into a nucleic acid strand, that label is also integrated into the nucleic acid strand.
  • this dNTP analogs include at least one modification in the sugar-phosphate moiety of the nucleotide, for example, alpha-phosphorothioate-2 '-Desoxyribonukleosid triphosphates (or other modifications which impart a nucleic acid strand a nuclease resistance), 2', 3 '-Dideoxy- ribonucleoside triphosphates, Azyklo nucleoside triphosphates (or other leading to the termination of a synthetic modifications).
  • alpha-phosphorothioate-2 '-Desoxyribonukleosid triphosphates or other modifications which impart a nucleic acid strand a nuclease resistance
  • 2', 3 '-Dideoxy- ribonucleoside triphosphates or other leading to the termination of a synthetic modifications.
  • these dNTP analogs comprise at least one modification of a nucleobase, eg iso-cytosines, iso-guanosines (or other modifications of the nucleobases of the extended genetic alphabet), 2-amino-adenosines, 2-thiouridines, inosines, 7 deazy-adenosines, 7-deaza-guanosines, 5-Me-cytosines, 5-propyl-uridines, 5-propyl-cytosines (or other modifications of nucleobases that can be incorporated into natural nucleobases by a polymerase and alter the strand Lead stability).
  • a nucleobase eg iso-cytosines, iso-guanosines (or other modifications of the nucleobases of the extended genetic alphabet), 2-amino-adenosines, 2-thiouridines, inosines, 7 deazy-adenosines, 7-deaza-guanosines, 5-Me-cytosines, 5-propy
  • a dNTP analog comprises both a modification of the nucleobase and a modification of the sugar-phosphate Share.
  • at least one further type of dNTP analogues is added to the synthesis mixture instead of at least one natural dNTP substrate.
  • a suitable agent leads to a complete or partial separation of a first double strand (consisting for example of A1 and B1 strand) and for the simultaneous / parallel formation of a new second double strand, wherein at least one of the strands ( A1 or B1) are involved in the formation of this new second strand.
  • the formation of a new second duplex may be accomplished using an already existing complementary strand which is generally in single-stranded form at the beginning of the reaction.
  • the means of strand displacement for example, a preformed single-stranded strand C1, which has a complementary sequence to the strand A1, acts on the first already formed double strand (A1 and B1) and enters into a complementary bond with the strand A1, whereby the strand B1 aus
  • the displacement of B1 is completed, the result of the C1 action is a new duplex (A1: C1) and a single strand B1.
  • the displacement of B1 is incomplete, it depends
  • a complex of partially double-stranded A1: B1 and A1: C1 may be present as an intermediate.
  • the formation of a new second duplex may occur under concurrent enzymatic synthesis of the complementary strand, with one strand of the first preformed duplex appearing as a template for synthesis by the polymerase.
  • the means of strand displacement acts on the first already preformed duplex (A1 and B1) and synthesizes a new strand D1 complementary to strand A1, wherein at the same time the strand B1 from the bond with the strand A1 is displaced.
  • nucleic acid mediated strand displacement is meant a sum / series of intermediate steps which can be in equilibrium with each other and, as a result, the temporary or permanent opening of a first preformed duplex (consisting of complementary strands A1 and B1) and forming a new one second duplex (consisting of complementary strands A1 and C1), where A1 and C1 are complementary to each other.
  • an essential structural prerequisite for the initiation of strand displacement is the creation of a spatial proximity between a duplex end (preformed first duplex of A1 and B1) and a single-stranded strand (C1) initiates strand displacement (where A1 and C1 can form a complementary strand).
  • Such spatial proximity can be brought about in particular by means of a single-stranded overhang (in the literature examples are known with short overhangs, referred to in English as "Toehold", see above), which binds the single-stranded strand (C1) temporarily or permanently complementary, and thus brings complementary Segqmente the strand C1 and A1 sufficiently close, so that a successful strand displacement of the strand B1 can be initiated.
  • the efficiency of initiation of nucleic acid-mediated strand displacement is generally greater the closer the complementary segments of strand A1 and C1 are positioned to each other.
  • nucleic acid-mediated strand displacement in internal segments Another essential structural prerequisite for efficiently continuing nucleic acid-mediated strand displacement in internal segments is high complementarity between strands (e.g., between A1 and C1) which must form a new duplex.
  • strands e.g., between A1 and C1
  • single nucleotide mutations in C1 can lead to the disruption of strand displacement (described, for example, for branch migration).
  • the present invention makes use of the ability of complementary nucleic acids to sequence-dependent nucleic acid-mediated strand displacement.
  • Reaction conditions include, but are not limited to, buffer conditions, temperature conditions, duration of reaction, and concentrations of respective reaction components.
  • the amount of specific produced nucleic acid to be amplified accumulates in an exponential manner.
  • the reaction comprising the synthesis of the extension products can be carried out for as long as necessary to produce the desired amount of the specific nucleic acid sequence.
  • the inventive method is carried out in particular continuously.
  • the amplification reaction proceeds at the same reaction temperature, the temperature in particular between 50 ° C and 70 ° C.
  • the reaction temperature can also be controlled variably, so that individual steps of the amplification run at respectively different temperatures.
  • reagents required for the exponential amplification are in particular already present at the beginning of a reaction in the same batch. In another embodiment, reagents may also be added at later stages of the process. In certain embodiments, no helicases or recombinases are used in the reaction mixture to separate the newly synthesized duplexes of the nucleic acid to be amplified.
  • the reaction mixture does not include biochemical energy-donating compounds such as ATP.
  • the amount of nucleic acid to be amplified at the beginning of the reaction can be between a few copies and several billion copies in one run.
  • the amount of nucleic acid chain to be amplified may be unknown.
  • the reaction may also contain other nucleic acids which are not to be amplified. These nucleic acids may be derived from natural DNA or RNA or their equivalents. In one embodiment, control sequences are in the same approach, which should also be amplified parallel to the nucleic acid to be amplified.
  • a molar excess of about 10 3 : 1 to about 10 15 : 1 (primer: template ratio) of the primers used and the controller oligonucleotide is added to the reaction mixture, which comprises template strands for the synthesis of the nucleic acid sequence to be amplified ,
  • the amount of target nucleic acids may not be known if the method of the invention is used in diagnostic applications, so that the relative amount of the primer and the controller oligonucleotide relative to the complementary strand can not be determined with certainty.
  • the amount of primer added will generally be present in molar excess relative to the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain nucleic acid strands. A large molar excess improves the efficiency of the process.
  • the concentrations of primer-1, primer-2 and controller oligonucleotides used are, for example, in the range between 0.01 pmol / l and 100 pmol / l, in particular between 0.1 pmol / l and 100 pmol / l, or between 0, 1 pmol / l and 50 pmol / l, in particular between 0.1 pmol / l and 20 pmol / l.
  • the high concentration of components can increase the rate of amplification.
  • the respective concentrations of individual components can be varied independently of one another in order to achieve the desired reaction result.
  • the concentration of polymerase ranges between 0.001 pmol / l and 50 pmol / l, in particular between 0.01 pmol / l and 20 pmol / l, in particular between 0.1 pmol / l and 10 pmol / l.
  • the concentration of individual dNTP substrates is in the range between 10 pmol / l and 10 mmol / l, in particular between 50 pmol / l and 2 mmol / l, in particular between 100 pmol / l and 1 mmol / l.
  • the concentration of dNTP can affect the concentration of divalent metal cations. If necessary, this will be adjusted accordingly.
  • divalent metal cations for example, Mg 2+ are used.
  • As a corresponding anion for example, CI, acetate, sulfate, glutamate, etc. can be used.
  • the concentration of divalent metal cations is adapted, for example, to the optimum range for each polymerase and comprises ranges between 0.1 mmol / l and 50 mmol / l, in particular between 0.5 mmol / l and 20 mmol / l, in particular between 1 mmol / l and 15 mmol / l.
  • the enzymatic synthesis is generally carried out in a buffered aqueous solution.
  • buffer solutions dissolved conventional buffer substances, such as Tris-HCl, Tris-acetate, potassium glutamate, HEPES buffer, and / or sodium glutamate can be used in conventional concentrations.
  • the pH of these solutions is usually between 7 and 9.5, in particular about 8 to 8.5.
  • the buffer conditions can be adapted, for example, according to the recommendation of the manufacturer of the polymerase used.
  • Tm depressants e.g., DMSO, betaines, TPAC
  • Tm depressors e.g., DMSO, betaines, TPAC
  • Tween 20 or Triton 100 can also be added in conventional amounts to the buffer.
  • EDTA or EGTA can be added to complex heavy metals in conventional amounts.
  • Polymerase stabilizing substances such as trehalose or PEG 6000 may also be added to the reaction mixture.
  • the reaction mixture contains no inhibitors of the strand displacement reaction and no inhibitors of polymerase-dependent primer extension.
  • the reaction mixture contains DNA-binding dyes, especially intercalating dyes, such as e.g. EvaGreen or SybrGreen.
  • intercalating dyes such as e.g. EvaGreen or SybrGreen.
  • Such dyes may possibly enable the detection of the formation of new nucleic acid chains.
  • the reaction mixture can furthermore contain proteins or other substances which, for example, originate from an original material and which in particular do not influence the amplification.
  • the temperature has a significant influence on the stability of the double strands.
  • no temperature conditions are used during the amplification reaction which essentially result in the separation of duplexes of the nucleic acid to be amplified in the absence of controller oligonucleotide. This is to ensure that the double-stranded separation of nucleic acid chains to be amplified is dependent on the presence of the controller oligonucleotide throughout the course of the amplification.
  • Tm measured melting temperature
  • the reaction temperature may be around the melting temperature (i.e., Tm plus / minus 3 ° to 5 ° C) of the nucleic acid to be amplified.
  • Tm melting temperature
  • the reaction temperature may be around the melting temperature (i.e., Tm plus / minus 3 ° to 5 ° C) of the nucleic acid to be amplified.
  • sequence differences between the controller oligonucleotide and the synthesized primer extension product can generally be well tolerated in a strand displacement reaction.
  • a high sequence specificity of the amplification of the method is achieved, in particular, when the newly synthesized strands of the nucleic acid to be amplified can not spontaneously dissociate into single strands under reaction conditions.
  • the sequence-specific strand displacement by the controller oligonucleotide plays a crucial role in sequence-specific strand separation and is significantly responsible for the sequence specificity of the amplification reaction. This can generally be achieved if the reaction temperature is well below the melting temperature of both strands of the nucleic acid to be amplified and no further components are used for strand separation, for example no helicases or recombinases.
  • the reaction temperature in a sequence-specific amplification in ranges between about (Tm minus 10 ° C) and about (Tm minus 50 ° C), in particular between about (Tm minus 15 ° C) and about (Tm minus 40 ° C), in particular between about (Tm minus 15 ° C) and about (Tm minus 30 ° C).
  • the maximum reaction temperature during the entire amplification reaction is not increased above the melting temperature of the nucleic acid chain to be amplified.
  • the reaction temperature can be increased at least once above the melting temperature of the nucleic acid chains to be amplified.
  • the increase in temperature can be carried out, for example, at the beginning of the amplification reaction and lead to the denaturation of double strands of a genomic DNA. It should be noted that during such a step, the dependence of the double strand separation on the effect of the controller oligonucleotide is canceled or at least significantly reduced.
  • the reaction temperatures of the individual steps of the amplification reaction can be in the range of about 15 ° C to about 85 ° C, in particular in the range of about 15 ° C to about 75 ° C, in particular in the range of about 25 ° C to about 70 ° C.
  • the reaction temperature can be optimally adjusted for each individual reaction step, so that such a temperature is brought about for each reaction step.
  • the amplification reaction thus comprises a repetitive change of temperatures, which are repeated cyclically.
  • reaction conditions are standardized for a plurality of reaction steps, so that the number of temperature steps is less than the number of reaction steps.
  • at least one of the steps of amplification occurs at a reaction temperature which differs from the reaction temperature of other steps of the amplification. The reaction is thus not isothermal, but the reaction temperature is changed cyclically.
  • the lower temperature range includes, for example, temperatures between 25 ° C and 60 ° C, in particular between 35 ° C and 60 ° C, in particular between 50 ° C and 60 ° C and the upper temperature range includes, for example, temperatures between 60 ° C and 75 ° C, especially between 60 ° C and 70 ° C.
  • the lower temperature range comprises, for example, temperatures between 15 ° C and 50 ° C, in particular between 25 ° C and 50 ° C, in particular between 30 ° C and 50 ° C and the upper temperature range includes, for example, temperatures between 50 ° C and 75 ° C, especially between 50 ° C and 65 ° C.
  • the lower temperature range for example, temperatures between 15 ° C and 40 ° C, in particular between 25 ° C and 40 ° C, in particular between 30 ° C and 40 ° C and the upper temperature range includes, for example, temperatures between 40 ° C and 75 ° C, especially between 40 ° C and 65 ° C.
  • the temperature can be kept constant in the respective range or can be changed as a temperature gradient (decreasing or rising).
  • Any induced temperature can be maintained for a period of time, resulting in an incubation step.
  • the reaction mixture may thus be incubated for a period of time during amplification at a selected temperature. This time may be different for the particular incubation step and may be responsive to the progress of the particular reaction at a given temperature (e.g., primer extension or strand displacement, etc.).
  • the time of an incubation step may comprise the following ranges: between 0.1 sec and 10,000 sec, in particular between 0.1 sec and 1000 sec, in particular between 1 sec and 300 sec, in particular between 1 sec and 100 sec.
  • a synthesis cycle may thus comprise at least one temperature change.
  • Such a temperature change can be performed routinely, for example, in a PCR device / thermocycler as a time program.
  • One embodiment relates to an amplification method in which at least one of the steps comprising the strand displacement and at least one of the steps comprising the primer extension reactions takes place simultaneously and in parallel and under the same reaction conditions.
  • a primer extension reaction of at least one primer oligonucleotide e.g., of the first primer oligonucleotide
  • the strand displacement with the aid of controller oligonucleotide and the one further primer extension reaction (for example, of the second primer oligonucleotide) take place, in particular, in the reaction step in the upper temperature range.
  • Another embodiment relates to an amplification method wherein at least one of the steps comprising strand displacement by the controller oligonucleotide and at least one of the steps comprising the primer extension reaction are performed at different temperatures.
  • primer extension reactions of at least one primer oligonucleotide eg, of the first primer oligonucleotide and / or of the second primer oligonucleotide
  • the strand displacement takes place with the assistance of controller oligonucleotide, in particular in the reaction step in the upper temperature range.
  • all steps of an amplification reaction proceed under the same reaction conditions.
  • the amplification process may be carried out under isothermal conditions, i. that no temperature changes are required to carry out the process.
  • the entire amplification reaction is carried out under constant temperature, i. the reaction is isothermal.
  • the time of such a reaction comprises, for example, the following ranges: between 100 sec and 30,000 sec, in particular between 100 sec and 10,000 sec, in particular between 100 sec and 1000 sec.
  • a synthesis cycle The sum of all process steps, which leads to a doubling of the amount of a nucleic acid chain to be amplified, can be referred to as a synthesis cycle.
  • Such a cycle can be correspondingly isothermal or else characterized by changes in the temperature in its course. The temperature changes can be repeated from cycle to cycle and made identical.
  • amplification methods in which the maximum achievable temperature essentially only permits a strand separation with the aid of controller oligonucleotide if more than 5 nucleotides of the third region of the controller oligonucleotide can form a complementary bond with the first primer extension product especially if more than 10, especially if more than 20 nucleotides of the controller oligonucleotide bind with the first primer extension product.
  • the longer the required binding between the controller oligonucleotide and the complementary strand of the first primer extension product, before the synthesized strands dissociate under reaction conditions the more specific is the amplification reaction.
  • the desired level of specificity can be determined.
  • a process step can be carried out at its constant temperature repetition over the entire duration of the process or at different temperatures.
  • Individual process steps can each be carried out in succession by adding individual components.
  • all reaction components necessary for the execution of an amplification are present at the beginning of an amplification in a reaction mixture.
  • the start of an amplification reaction can be carried out by adding a component, for example by adding a nucleic acid chain comprising a target sequence (for example a starting nucleic acid chain), or a polymerase or divalent metal ions, or else by inducing reaction conditions necessary for amplification, eg, adjusting a required reaction temperature for one or more process steps.
  • a component for example by adding a nucleic acid chain comprising a target sequence (for example a starting nucleic acid chain), or a polymerase or divalent metal ions, or else by inducing reaction conditions necessary for amplification, eg, adjusting a required reaction temperature for one or more process steps.
  • the amplification can be carried out until the desired amount of nucleic acid to be amplified is reached.
  • the amplification reaction is carried out for a time which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount.
  • the amplification reaction is carried out for a sufficient number of synthetic cycles (doubling times) which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount.
  • the reaction can be stopped by various interventions. For example, by changing the temperature (e.g., cooling or heating, for example, interfering with the function of the polymerase) or by adding a substance which stops a polymerase reaction, e.g. EDTA or formamide.
  • a temperature e.g., cooling or heating, for example, interfering with the function of the polymerase
  • a substance which stops a polymerase reaction e.g. EDTA or formamide.
  • the amplified nucleic acid chain can be used for further analysis.
  • synthesized nucleic acid chains can be analyzed by various detection methods. For example, fluorescence-labeled oligonucleotide probes can be used or sequencing methods (Sanger sequencing or Next-Generation sequencing), solid-phase analyzes such as microarray or bead-array analyzes, etc.
  • the synthesized nucleic acid chain can be used as a substrate / template in further primer extension reactions become.
  • the progress of the synthesis reaction is monitored during the reaction. This can be done, for example, by using intercalating dyes, e.g. Sybrgreen or Evagreen, or using labeled primers (e.g., Lux primer or Scorpion primer) or using fluorescently labeled oligonucleotide probes.
  • intercalating dyes e.g. Sybrgreen or Evagreen
  • labeled primers e.g., Lux primer or Scorpion primer
  • fluorescently labeled oligonucleotide probes e.g., fluorescently labeled oligonucleotide probes.
  • the detection of the change in fluorescence during amplification is implemented in a detection step of the method.
  • the temperature and the duration of this step can be adapted to the particular requirements of an oligonucleotide probe.
  • the temperatures of the detection step include, for example, ranges between 20 ° C and 75 ° C, in particular between 40 and 70 ° C, in particular between 55 and 70 ° C.
  • the reaction is illuminated with light of a wavelength which is capable of exciting a used detection system fluorophore (a donor or a fluorescent reporter).
  • the signal detection is usually parallel to the excitation, whereby the specific fluorescence signal is detected and its intensity is quantified.
  • a primer oligonucleotide which can specifically bind with the corresponding controller oligonucleotide is exemplified by the first primer oligonucleotide explained.
  • the structure of the second primer oligonucleotide follows the same rules.
  • the pair comprising the first primer oligonucleotide and the first controller oligonucleotide is also exemplarily used to explain interactions between these and other components.
  • the primer structure for the first and the second primer oligonucleotide is shown in detail using the example of the first primer oligonucleotide.
  • the construction of the second primer oligonucleotide is similar to the construction of the first; Depending on the embodiment, differences between the first and the second primer can be, for example, in concrete compositions of the sequences, used lengths of the respective regions, as well as nucleotide modifications.
  • the first primer oligonucleotide (primer-1) is a nucleic acid chain which includes at least the following ranges:
  • a first primer region in the 3 ' segment of the first primer oligonucleotide capable of substantially sequence-specific binding to a strand of nucleic acid chain to be amplified
  • a second region coupled directly or via a linker, to the 5 ' end of the first primer region of the first primer oligonucleotide which comprises a polynucleotide tail which is suitable for binding a controller oligonucleotide and promoting strand displacement by the controller.
  • Oligonucleotide is suitable, wherein the polynucleotide tail remains substantially single-stranded under reaction conditions, ie, does not form a stable hairpin structure or ds-structures, and in particular is not copied from the polymerase.
  • the total length of the first primer oligonucleotide is between 10 and 80, more preferably between 15 and 50, more preferably between 20 and 30 nucleotides or their equivalents (e.g., nucleotide modifications).
  • the structure of the first primer oligonucleotide is adapted to undergo reversible binding to the controller oligonucleotide under selected reaction conditions. Furthermore, the structure of the first primer oligonucleotide is adapted to its primer function. Furthermore, the structure is adapted so that a strand displacement can be performed by means of controller oligonucleotide. Overall, structures of the first and second regions are matched to each other so that exponential amplification can be performed.
  • the first and the second region of the primer are coupled in a conventional 5 ' -3 ' arrangement.
  • the coupling of both sections takes place via a 5 ' -5 ' bond, so that the second region has a reverse direction than the first region.
  • the coupling between the first and second regions is a 5 ' -3 ' phosphodiester coupling conventional for DNA. In another embodiment, it is a 5 ' - 5 '-Phosphodiester coupling. In a further embodiment, it is a 5 ' -3 ' phosphodiester coupling, wherein between adjacent terminal nucleotides or nucleotide modifications of the two regions at least one linker (eg a C3, C6, C12 or a HEG linker or an abasic modification ) is positioned.
  • linker eg a C3, C6, C12 or a HEG linker or an abasic modification
  • nucleotide modifications may be modified: nucleobase and backbone (sugar content and / or phosphate content). Furthermore, modifications may be used which lack or are modified at least one component of the standard nucleotide building blocks, e.g. PNA.
  • a second region of the first primer oligonucleotide includes additional sequences that do not bind to the controller oligonucleotide. These sequences can be used for other purposes, such as binding to the solid phase. These sequences are located in particular at the 5 ' end of the polynucleotide tail.
  • a first primer oligonucleotide may comprise a characteristic label.
  • a characteristic label are dyes (e.g., FAM, TAMRA, Cy3, Alexa 488, etc.) or biotin or other groups which can be specifically bound, e.g. Digoxigenin.
  • the sequence length is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides, the sequence being predominantly complementary to the 3 ' segment of a strand of the nucleic acid chain to be amplified.
  • this primer region must be able to specifically bind to the complementary 3 ' segment of a second primer extension product.
  • This first area should be copied in the reverse synthesis and also serves as a template for the 2nd strand.
  • the nucleotide building blocks are in particular linked to each other via conventional 5 'to 3' Phosphodie bond or Phosphothioester bond.
  • the first primer region includes in particular nucleotide monomers which do not or only insignificantly influence the function of the polymerase, for example include:
  • the 3 'OH end of this range in particular free of modifications and has a functional 3' -OH group, that can be recognized by the polymerase.
  • the first primer region serves as the initiator of the synthesis of the first primer extension product in the amplification.
  • the first comprises Area at least one phosphorothioate compound, so that no degradation of the 3 ' end of the primer can be done by the 3 ' exonuclease activity of polymerases.
  • sequence of the first region of the first primer oligonucleotide and the sequence of the second region of the controller oligonucleotide are in particular complementary to one another.
  • the first primer region or its 3 ' segment can bind to sequence segments of a target sequence.
  • the second region of the first primer oligonucleotide is a nucleic acid sequence comprising at least one polynucleotide tail, which in particular remains uncoupled from the polymerase during the synthesis reaction and which is capable of binding to the first region of the controller oligonucleotide.
  • the segment of the second region, which predominantly undergoes this binding with the controller oligonucleotide, may be referred to as the polynucleotide tail.
  • the second region of the first primer oligonucleotide must not only specifically bind the controller oligonucleotide under reaction conditions, but also participate in the process of strand displacement by means of controller oligonucleotide.
  • the structure of the second region must therefore be suitable for bringing about spatial proximity between the controller oligonucleotide and the corresponding duplex end (in particular, the 3 ' end of the second primer extension product).
  • the design of the structure of the second region of the first primer oligonucleotide is shown in more detail in several embodiments.
  • the arrangement of the oligonucleotide segments and the modifications used are taken into account, which lead to a stop in the polymerase-catalyzed synthesis.
  • the length of the second region is between 3 and 60, in particular between 5 and 40, in particular between 6 and 15 nucleotides or their equivalents.
  • the sequence of the second area may be chosen arbitrarily. In particular, it is not complementary with the nucleic acid to be amplified and / or with the second primer oligonucleotide and / or with the first region of the first primer oligonucleotide. Furthermore, it contains in particular no self-complementary segments, such as hairpins or Stemmloops.
  • the sequence of the second region is particularly matched to the sequence of the first region of the controller oligonucleotide, so that both sequences can bind under reaction conditions.
  • this bond is reversible under reaction conditions: there is thus a balance between bonded components and unbound components.
  • the sequence of the second region of the first primer oligonucleotide is chosen in particular such that the number of complementary bases which coincide with the first region of the Controller oligonucleotide, between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 is located.
  • the function of the second area consists inter alia of binding the controller oligonucleotide. In one embodiment, this binding is particularly specific, such that a second region of a first primer oligonucleotide can bind a specific controller oligonucleotide. In another embodiment, a second region may bind more than one controller oligonucleotide under reaction conditions.
  • the degree of complementarity between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%.
  • the respective complementary regions may be positioned immediately adjacent to each other or may comprise non-complementary sequence segments therebetween.
  • the second region of the first primer oligonucleotide may include at least one Tm modifying modification.
  • Tm enhancing modifications nucleotide modifications or non-nucleotide modifications
  • Tm-lowering modifications may also be used, such as inosine nucleotides.
  • linkers e.g., C3, C6, HEG linkers
  • the controller oligonucleotide For strand displacement, the controller oligonucleotide must be placed in close proximity to the double-stranded end of the nucleic acid to be amplified.
  • This double-stranded end consists of segments of the first primer region of the first primer extension product and a correspondingly complementary 3 ' segment of the second primer extension product.
  • the polynucleotide tail predominantly complements the controller oligonucleotide under reaction conditions, thereby causing a transient approach of the second region of the controller oligonucleotide and the first region of an extended primer extension product such that a complementary bond between these elements is initiated as part of a strand displacement process can.
  • binding of the controller oligonucleotide to the polynucleotide tail of the first primer oligonucleotide immediately results in such contact.
  • the polynucleotide tail and the first primer region of the first primer oligonucleotide must be coupled directly to each other. Thanks to such an arrangement, after a binding of a controller oligonucleotide in its first region, contact between complementary bases of the second region of the controller oligonucleotide and corresponding bases of the first primer region can occur directly, so that strand displacement can be initiated.
  • structures of the second region of the first primer oligonucleotide are located between structures of the polynucleotide tail and the first primer region. After binding of a controller oligonucleotide to the polynucleotide tail, it is thus not positioned directly at the first primer region, but at a certain distance from it.
  • the structures between the uncopiable polynucleotide tail and the copiable first primer region of the primer oligonucleotide can generate such a spacing.
  • This distance has a value which is between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm.
  • Such structures include, for example, linkers (e.g., C3 or C6 or HEG linkers) or segments that are not complementary to the controller oligonucleotide (e.g., in the form of non-complementary, non-copyable nucleotide modifications).
  • linkers e.g., C3 or C6 or HEG linkers
  • segments that are not complementary to the controller oligonucleotide e.g., in the form of non-complementary, non-copyable nucleotide modifications.
  • the length of these structures can generally be measured in chain atoms. This length is between 1 and 200 atoms, in particular between 1 and 50 chain atoms, in particular between 1 and 10 chain atoms.
  • the second region of the first primer oligonucleotide generally comprises sequence arrangements which cause the polymerase to stop in the synthesis of the second primer extension product after the polymerase releases the polymerase first primer area has been successfully copied. These structures are said to prevent copying of the polynucleotide tail of the second region. The polynucleotide tail thus remains uncoated, in particular, by the polymerase.
  • such structures are between the first primer region and the polynucleotide tail.
  • sequence of the polynucleotide tail may include nucleotide modifications that result in the termination of the polymerase.
  • a sequence segment of the second region of the first primer oligonucleotide may comprise both functions: it is both a polynucleotide tail and a polymerase-terminating sequence of nucleotide modifications.
  • oligonucleotide synthesis Several building blocks in oligonucleotide synthesis are known which prevent the polymerase from reading the template and lead to the termination of the polymerase synthesis.
  • non-copyable nucleotide modifications or non-nucleotide modifications are known.
  • There are also synthetic types / arrangements of nucleotide monomers within an oligonucleotide which result in the termination of the polymerase eg, 5 'to 5 ' or 3 'to 3 ' ).
  • Primer oligonucleotides with a non-copyable polynucleotide tail are also known in the art (eg Scorpion primer structures or primers for binding to the solid phase).
  • Both primer variants describe primer oligonucleotide structures which are able to initiate the synthesis of a strand on the one hand so that a primer extension reaction can take place.
  • the result is a first strand, which also integrates the primer structure with tail in the primer extension product.
  • the second strand is extended to the "blocking moiety / stop structure" of the primer structure.
  • Both described primer structures are designed in such a way that the 5 ' portion of the primer oligonucleotide remains single-stranded and is not copied by the polymerase.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail having a conventional 5 ' to 3 ' array in its entire length and including non-copyable nucleotide modifications.
  • non-copyable nucleotide modifications include, for example, 2 '-0-alkyl-RNA modifications, PNA, and morpholino. These modifications may be distributed differently in the second primer region.
  • the proportion of non-copyable nucleotide modifications may be between 20% and 100% in the polynucleotide tail, in particular more than 50% of the nucleotide building blocks.
  • these nucleotide modifications are in the 3 ' segment of the second region and thus adjacent to the first region of the first primer oligonucleotide.
  • sequence of non-copyable nucleotide modifications is at least partially complementary to the sequence in the template strand such that primer binding to the template occurs involving at least part of these nucleotide modifications.
  • sequence of non-copyable nucleotide modifications is non-complementary to the sequence in the template strand.
  • the non-copyable nucleotide modifications are in particular covalently coupled to one another and thus represent a sequence segment in the second region.
  • the length of this segment comprises between 1 and 40, in particular between 1 and 20 nucleotide modifications, in particular between 3 and 10 nucleotide modifications.
  • the second region of the first primer oligonucleotide comprising a polynucleotide tail, which 'has and non-copyable nucleotide modifications include (for example 2' in its entire length, a conventional arrangement of 5'-3 -0-alkyl Modifications) and at least one non-nucleotide linker (eg, C3, C6, HEG linker).
  • a non-nucleotide linker has the function of covalently linking adjacent nucleotides or nucleotide modifications while at the same time site-specifically disrupting the synthesis function of the polymerase.
  • non-nucleotide linker should not remove the structures of the polynucleotide tail and the first primer region too far apart. Rather, the polynucleotide tail should be in close proximity to the first primer region.
  • a non-nucleotide linker is taken to mean modifications which are no longer than 200 chain atoms in length, in particular not more than 50 chain atoms, in particular not more than 10 chain atoms. The minimum length of such a linker can be one atom.
  • An example of such non-nucleotide linkers are straight or branched alkyl linkers having an alkyl chain which includes at least one carbon atom, more preferably at least 2 to 30, especially 4 to 18.
  • Such linkers are in oligonucleotide chemistry well known (eg, C3, C6, or C12 linker) and can be introduced during solid phase synthesis of oligonucleotides between the sequence of the polynucleotide tail and the sequence of the first region of the first primer oligonucleotide.
  • Another example of such non-nucleotide linkers are linear or branched polyethylene glycol derivatives.
  • a well-known example in oligonucleotide chemistry is hexaethylene glycol (HEG).
  • HEG hexaethylene glycol
  • Another example of such non-nucleotide linkers are abasic modifications (eg THF modification, as analog of D-ribose).
  • modifications are integrated into a second region, they can effectively interfere with a polymerase in its copying function during its synthesis of the second primer extension product, leaving segments uncoined after such modification.
  • the number of such modifications in the second range can be between 1 and 100, in particular between 1 and 10, in particular between 1 and 3.
  • the position of such a non-nucleotide linker may be at the 3 ' end of the second region, thus representing the transition from the first region to the second region of the primer oligonucleotide.
  • the location of the non-nucleotide linker in the middle segment of the second region may also be used.
  • the 3 ' segment of the polynucleotide tail includes at least one, in particular several, for example between 2 and 20, in particular between 2 and 10 non-copyable nucleotide modifications. These non-copyable nucleotide modifications are in particular at the transition between the first and the second region of the primer oligonucleotide.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail having in its entire length an array of 5 'to 3 ' - and at least one nucleotide monomer in a "reverse" array of 3 ' - 5 ' - and which are positioned at the junction between the first and second regions of the first primer oligonucleotide.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail, such polynucleotide tail consisting entirely of nucleotides directly adjacent to the first region of the first primer oligonucleotide in reverse order such that the coupling of the first and the second area through 5 ' - 5 ' position.
  • the 3 ' -terminal nucleotide of the polynucleotide tail should be blocked at its 3 ' OH end to prevent side reactions.
  • a terminal nucleotide can be used which has no 3 ' -OH group, for example a dideoxy nucleotide.
  • the corresponding nucleotide arrangement is to be adapted in the controller oligonucleotide.
  • the first and the second portion of the controller oligonucleotide in 3 'to 3' arrangement have to be linked.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail having in its entire length a conventional 5 ' to 3 ' configuration and including at least one nucleotide modification which is not a complementary nucleobase for the polymerase if the synthesis is carried out using exclusively natural dNTP (dATP, dCTP, dGTP, dTTP or dUTP).
  • dNTP dATP, dCTP, dGTP, dTTP or dUTP
  • iso-dG or iso-dC nucleotide modifications can be integrated as single, but in particular more (at least 2 to 20) nucleotide modifications in the second region of the first primer oligonucleotide.
  • nucleobase modifications are various modifications of the extended genetic alphabet.
  • such nucleotide modifications do not support complementary base pairing with natural nucleotides such that a polymerase (at least theoretically) does not contain a nucleotide from the series (dATP, dCTP, dGTP, dTTP or dUTP). In reality, rudimentary incorporation may still occur, especially at higher concentrations of dNTP substrates and prolonged incubation times (eg, 60 minutes or longer).
  • nucleotide modifications should be positioned at adjacent sites.
  • the stop of polymerase synthesis is effected by the lack of suitable complementary substrates for these modifications.
  • Oligonucleotides with iso-dC or iso-dG can be synthesized by standard methods and are available from several commercial suppliers (eg Trilink Technologies, Eurogentec, Biomers GmbH).
  • the sequence of the first region of the controller oligonucleotide can also be adapted to the sequence of such a second primer region.
  • complementary nucleobases of the extended genetic alphabet can be integrated into the first region of the controller oligonucleotide accordingly during the chemical synthesis.
  • iso-dG may be integrated in the second region of the first primer nucleotide, its complementary nucleotide (iso-dC-5-Me) may be placed at the appropriate location in the first region of the controller oligonucleotide.
  • the termination of the synthesis of the polymerase in the second region can be achieved in various ways.
  • this blockade takes place in particular only when the polymerase has copied the first region of the first primer oligonucleotide.
  • the primer extension reaction remains in front of the polynucleotide tail. Because this polynucleotide tail remains single-stranded for interaction with the controller oligonucleotide and thus is available for binding, it supports the initiation of the strand displacement reaction by the controller oligonucleotide by encoding the corresponding complementary oligonucleotide controller oligonucleotide segments Immediate proximity of the appropriate duplex end brings. The distance between the complementary part of the controller oligonucleotide (second region) and the complementary part of the extended primer oligonucleotide (first region) is thereby reduced to a minimum. Such spatial proximity facilitates the initiation of strand displacement.
  • a complementary sequence of controller oligonucleotide is now in the immediate vicinity of the appropriate duplex end. This leads to competition for binding to the first region of the first primer oligonucleotide between the strand of the controller oligonucleotide and the primer complementary template strand.
  • the initiation of the nucleic acid-mediated strand displacement process occurs.
  • distances between the 5 ' segment of the first primer region of the first primer oligonucleotide, which binds to a complementary strand of the template and forms a complementary duplex, and a correspondingly complementary sequence segment in the controller oligonucleotide when bound to the Polynucleotide tail of the second region of the first primer oligonucleotide in the following ranges: between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm. In certain embodiments, this distance is less In other units, this distance corresponds to a distance of less than 200 atoms, in particular less than 50 atoms, in particular less than 10 atoms.
  • this distance is an atom. Distance information is for guidance only and illustrates that shorter distances between these structures offer significant benefits. The measurement of this distance is in many cases only possible by analyzing the exact structures of oligonucleotides and measuring sequence distances or linker lengths.
  • the first primer may also include additional sequence segments that are not required for interaction with the controller oligonucleotide or template strand. Such sequence segments may, for example, bind further oligonucleotides which are used as detection probes or immobilization partners when bound to the solid phase.
  • the first primer oligonucleotide can be used in several partial steps. First and foremost, it performs a primer function in the amplification.
  • the primer extension reaction is carried out using the second primer extension product as a template.
  • the first primer oligonucleotide may use the starting nucleic acid chain as a template at the beginning of the amplification reaction.
  • the first primer oligonucleotide can be used in the preparation / provision of a starting nucleic acid chain.
  • the first primer serves as the initiator of the synthesis of the first primer extension product using the second primer extension product as template.
  • the 3 ' segment of the first primer comprises a sequence which can bind predominantly complementary to the second primer extension product.
  • Enzymatic extension of the first primer oligonucleotide using the second primer extension product as template results in the formation of the first primer extension product.
  • Such a first primer extension product comprises the target sequence or its sequence parts.
  • the sequence of the copiable portion of the first primer oligonucleotide is recognized by the polymerase as a template and a corresponding complementary Sequence is synthesized to result in a corresponding primer binding site for the first primer oligonucleotide.
  • the synthesis of the first primer extension product occurs up to and including the 5 ' segment of the second primer oligonucleotide. Immediately after the synthesis of the first primer extension product, this product is bound to the second primer extension product and forms a double-stranded complex. The second primer extension product is displaced sequence-specifically from this complex by the controller oligonucleotide. The controller oligonucleotide binds to the first primer extension product. Again, following successful strand displacement by controller oligonucleotide, the second primer extension product may itself serve as a template for the synthesis of the first primer extension product. The now vacated 3 ' segment of the first primer extension product can bind another second primer oligonucleotide so that a new synthesis of the second primer extension product can be initiated.
  • the first primer oligonucleotide can serve as the initiator of the synthesis of the first primer extension product starting from the starting nucleic acid chain at the beginning of the amplification.
  • the sequence of the first primer is completely complementary to the corresponding sequence segment of a starting nucleic acid chain.
  • the sequence of the first primer oligonucleotide is only partially complementary to the corresponding sequence segment of a starting nucleic acid chain.
  • this divergent complementarity is not intended to prevent the first primer oligonucleotide from starting a predominantly sequence-specific primer extension reaction.
  • the respective differences in the complementarity of the first primer oligonucleotide to the respective position in the starting nucleic acid chain are in particular in the 5 ' segment of the first region of the first primer oligonucleotide, so that in the 3 ' segment predominantly complementary base pairing and initiation of the synthesis possible is.
  • the first 4-10 positions in the 3 ' segment should be fully complementary to the template (starting nucleic acid chain).
  • the remaining nucleotide positions may differ from a perfect complementarity.
  • the extent of perfect complementarity in the remaining 5 ' segment of the first region of the first primer oligonucleotide may thus range between 50% to 100%, in particular between 80% and 100%, of the base composition.
  • the first primer oligonucleotide may thus initiate synthesis of a starting nucleic acid chain.
  • copyable sequence segments of the first primer oligonucleotide are copied from the polymerase such that, in subsequent synthesis cycles, a fully complementary primer binding site within the second primer extension product for binding of the first primer oligonucleotide is formed and available in subsequent synthesis cycles.
  • the first primer oligonucleotide may be used in the preparation of a starting nucleic acid chain.
  • such a first primer oligonucleotide can bind to a nucleic acid (eg a single-stranded genomic DNA or RNA or its equivalents comprising a target sequence) predominantly / in particular sequence-specific and initiate a template-dependent primer extension reaction in the presence of a polymerase.
  • the binding position is chosen such that the primer extension product comprises a desired target sequence.
  • the extension of the first primer oligonucleotide results in a nucleic acid strand which has a sequence complementary to the template.
  • Such a strand can be detached from the template (eg by heat or alkali) and thus converted into a single-stranded form.
  • Such a single-stranded nucleic acid chain can serve as a starting nucleic acid chain at the beginning of the amplification.
  • Such a start nucleic acid chain comprises in its 5 ' segment the sequence portions of the first primer oligonucleotide, furthermore it comprises a target sequence or its equivalents and a primer binding site for the second primer oligonucleotide. Further steps are explained in the section "Starting nucleic acid chain".
  • the synthesis of the first primer extension product is a primer extension reaction and forms a partial step in the amplification.
  • the reaction conditions during this step are adjusted accordingly.
  • the reaction temperature and the reaction time are chosen so that the reaction can take place successfully.
  • the most advantageous temperature in this step depends on the polymerase used and on the binding strength of the respective first primer oligonucleotide to its primer binding site and includes, for example, ranges from 15 ° C to 75 ° C, especially from 20 to 65 ° C, in particular from 25 ° C to 65 ° C.
  • the concentration of the first primer oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.
  • all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of non-specific products / by-products.
  • stringent conditions include, for example, higher temperatures, for example above 50 ° C.
  • sequence-specific primer oligonucleotides are used in each case for the amplification of corresponding respective target sequences.
  • sequences of the first and second primer oligonucleotide and the controller oligonucleotide are so matched to each other that side reactions, eg primer-dimer formation, are minimized.
  • the sequence of the first and the second primer oligonucleotide are adapted to one another such that both primer oligonucleotides are unable to initiate an amplification reaction in the absence of a suitable template and / or a target sequence and / or a start sequence. Start nucleic acid chain or support.
  • the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide.
  • the primer sequences comprise extended self-complementary structures (self-complement).
  • the synthesis of the first and second primer extension products proceeds at the same temperature. In another embodiment, the synthesis of the first and second primer extension products proceeds at different temperatures. In another embodiment, the synthesis of the first primer extension product and the strand displacement by the controller oligonucleotide proceeds at the same temperature. In another embodiment, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide proceeds at different temperatures.
  • Primer oligonucleotides comprising additional sequence segments:
  • first primer and the second primer can be considered as so-called “base structure of the primer” or “minimal structure of the primer”.
  • Such basic structures of oligonucleotides with primer function comprise sequence segments which are essential for the execution of the amplification reaction.
  • Method are advantageous, for example, the first and second region of the first primer.
  • Such a basic structure of the primer can be extended by additional, additional sequence segments.
  • additional sequence segments include structures which, while not necessary for the performance of the amplification process, may nevertheless be useful for other tasks.
  • Such additional sequence segments may optionally be introduced into a primer and used for further functions or reactions. This allows the polymerase synthesized primer extension products (starting from, for example, the first and / or the second primer) to be linked to such sequences segments. This achieves integration of such additional sequence segments and primer extension products into a molecular structure. Such integration may be advantageous in certain embodiments.
  • a variety of applications for primer sequences with additional sequence segments are known to one skilled in the art.
  • additional sequence segments of the primer can be used, for example, as a means of imparting intermolecular or intramolecular bonding.
  • probes can be designed according to such a principle of intra-molecular binding, for example in the context of Scorpion primers.
  • sequence segments can further serve to bind additional oligonucleotides.
  • a sequence-specific intermolecular binding can be achieved using stringent conditions. Such interactions can be used, for example, for the binding of amplification products to a solid phase by complementary binding to immobilized oligonucleotides.
  • primer barcoding For example, for NGS library preparation (Stählberg et al Nucleic Acids Res. 2016 Jun 20; 44 (11): e105).
  • sequence analysis of primer extension products such a label can be used to assign sequences later.
  • Yet another example is the use of further sequence segments to introduce specific sequences with binding of certain proteins, e.g. Restriction endonucleases etc.
  • Yet another example is the use of further sequence segments to introduce spacer sequences which are not intended to bind a specific interaction partner, but serve primarily to increase the distance between adjacent sequences.
  • Such additional sequences may either be positioned on the copiable portion of the primer or added to the non-clippable portion of the primer.
  • an additional sequence segment is introduced into the copyable region of the primer, eg, at the 5 ' segment of the copiable portion of the second primer, so that, for example, in reading the primer sequence during a synthesis of a target sequence, additional sequence Segments are also read from the polymerase.
  • the length of such additional sequence segment includes ranges of 3 to 50 nucleotides.
  • the composition of these sequence segments in this embodiment allows the synthesis by a polymerase, this sequence segment thus serves as a template for polymerase-dependent synthesis.
  • natural nucleotides are used, eg dA, dG, dC, dT.
  • additional sequence segments may be positioned, for example, at the 5 ' terminus of the primer, which should not be copied in the synthesis of specific amplification fragments comprising a target sequence.
  • This can be achieved, for example, by positioning one or more modifications or chemical groups which prevents polymerase from the synthesis of a complementary strand (eg HEG, C3, a segment comprising 4 to 10 nucleotides with 2 ' om modifications, etc.).
  • modifications or chemical groups which prevents polymerase from the synthesis of a complementary strand (eg HEG, C3, a segment comprising 4 to 10 nucleotides with 2 ' om modifications, etc.).
  • modification may for example be positioned at the 5 'terminus of the copyable portion of the second primer and obstruct the continuation of the synthesis.
  • an HEG group may be introduced at the 5 ' end of the copatible segment of the second primer, followed by an additional sequence segment.
  • an additional sequence segment may be positioned at the 5 ' terminus of the second region of the first primer. Such localization of additional sequence segments prevents synthesis of a complementary strand during regular synthesis of specific amplification products comprising a target sequence.
  • the length of such additional sequence segment includes ranges of 3 to 50 nucleotides.
  • the base composition may comprise, for example, natural nucleobases (A, G, C, T, U, inosine) or modifications at different positions of nucleotides (eg at the bases such as 2-amino-adenine, iso-guanine, iso-cytosines, 5-propargyl uridines, 5-propargyl cytosines or on the sugar-phosphate backbone, such as LNA, 2 ' -Ome, 2 ' -halogen, etc.).
  • a first primer and additional sequence segments are combined to form an oligonucleotide.
  • a second primer and additional sequence segments are combined to form an oligonucleotide.
  • additional sequence segments are designed in an oligonucleotide such that they do not prevent amplification of target sequences. This is achieved, for example, by avoiding or reducing inhibiting interactions with the structures of the primers or controllers which are essential for the method.
  • additional structures may form double-stranded segments complementary to other primer regions under the selected reaction conditions. In particular, however, such double-stranded segments do not prevent specific amplification of a target sequence.
  • such additional sequence segments do not interact with the first or second primer region of the first primer.
  • such additional sequence segments do not interact with the controller oligonucleotide. In certain embodiments, such additional sequence segments do not interact with other primers in the reaction.
  • such additional sequence segments do not interact with P1 1-Ext or P2.1 -EX or other amplification fragments comprising a target sequence. In certain embodiments, such additional sequence segments do not form stable under reaction conditions Double-stranded portions with the first or second region of the first primer, which completely prevent the function of the first or the second region.
  • such additional sequence segments do not interact with the second primer. In particular, in certain embodiments, such additional sequence segments do not interact with the 3 ' segment of the second primer.
  • the first primer comprises at its 5 ' terminus of the second region an additional sequence segment of the first primer (variant sequence variant P1).
  • This segment optionally includes a sequence of 10-50 nucleotides which does not interfere with the amplification process of target sequences (eg, does not form secondary structures with primers).
  • this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copiable first region of the first primer.
  • the additional sequence variant P1 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.
  • the second primer comprises at its 5 ' terminus an additional sequence segment of the second primer (variant sequence variant P2).
  • This segment optionally includes a sequence of 10-50 nucleotides which does not interfere with the amplification process of target sequences (eg, does not form secondary structures with primers).
  • this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copyable region of the second primer.
  • the additional sequence variant P2 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.
  • oligonucleotides comprising a first primer and additional sequence variant P1 or oligonucleotides comprising a second primer and additional sequence variant P2 are less susceptible to side reactions than oligonucleotides comprising only a first primer, or oligonucleotides comprising only a second primer .
  • the generation and / or amplification of nonspecific primer-dimer structures may be delayed.
  • the formation of by-products comprising no target sequence can be reduced or retarded.
  • the premature consumption of primers can be reduced or delayed.
  • primer dimers comprising first primers (PD P1) or primer dimers comprising second primers (PD P2) are produced by secondary reactions and lead to premature consumption of primers in the reaction.
  • Use of primers having such additional structures is advantageous in certain embodiments if nonspecific reactions are observed in an amplification reaction.
  • Such side reactions may be favored by several factors, including but not limited to:
  • Multiplexing reactions e.g., amplification of more than 10 different target sequences in a reaction approach.
  • oligonucleotides comprising a first primer and additional sequence variant P1 or oligonucleotides comprising a second primer and additional sequence variant P2 represent a further possibility for delaying certain side reactions.
  • primer oligonucleotides with additional sequence segments are shown.
  • additional sequence segments are used which do not participate in the specific amplification of a target sequence and contribute to the delay of side reactions.
  • oligonucleotides comprising a first primer and additional sequence variant P1 and oligonucleotides comprising a second primer and additional sequence variant P2 are used.
  • an oligonucleotide in addition to a primer structure that is advantageous for the specific amplification of a target sequence (this structure may also be referred to as a "base structure” or “minimal structure”), also includes additional, additional sequence sequences. Segments may include (eg additional sequence variant P1 or additional sequence variant P2). Such additional sequence segments may provide a variety of different other beneficial properties.
  • a controller oligonucleotide comprises:
  • Extension product of the first primer extension product is substantially complementary
  • controller oligonucleotide does not serve as a template for primer extension of the first or second primer oligonucleotide.
  • the sequence of the third region of the controller oligonucleotide is adapted to the sequence of the nucleic acid to be amplified, since this is a template for the order of the nucleotides in the extension product of a first primer.
  • the sequence of the second region of the controller oligonucleotide is adapted to the sequence of the first primer region.
  • the structure of the first region of the controller oligonucleotide is adapted to the sequence of the second region of the first primer oligonucleotide, especially the nature of the polynucleotide tail.
  • a controller oligonucleotide may also include other sequence segments that do not belong to the first, second or third region.
  • these sequences can be attached as flanking sequences at the 3 ' and 5 ' ends.
  • these sequence segments do not interfere with the function of the controller oligonucleotide.
  • the structure of the controller oligonucleotide has in particular the following properties:
  • the individual areas are covalently bonded to each other.
  • the binding can be done for example via conventional 5 ' -3 ' bond.
  • a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.
  • a controller oligonucleotide may bind by its first region to the polynucleotide tail of the first primer oligonucleotide, which binding is mediated primarily by hybridization of complementary bases.
  • the length of this first region is 3 to 80 nucleotides, in particular 4 to 40 nucleotides, in particular 6 to 20 nucleotides.
  • the degree of sequence match between the sequence of the first region of the controller oligonucleotide and the sequence of the second region of the first primer oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%.
  • binding of the first region of the controller oligonucleotide should be specific to the second region of the first primer oligonucleotide under reaction conditions.
  • sequence of the first region of the controller oligonucleotide is chosen such that the number of complementary bases which coincide with the second region of the first Primer oligonucleotide can bind complementary, is between 1 and 40, in particular between 3 and 20, in particular between 6 and 15.
  • controller oligonucleotide since the controller oligonucleotide is not a template for the polymerase, it may include nucleotide modifications that do not support polymerase function, which may be both base modifications and / or sugar-phosphate backbone modifications.
  • the controller oligonucleotide may include, for example, in its first region, nucleotides and / or nucleotide modifications selected from the following list: DNA, RNA, LNA ("locked nucleic acids” analogues having 2 ' -4 ' bridge linkage in the sugar moiety), UNA ( "unlocked Nucleic acids” without binding between 2 '-3' -atoms of the sugar moiety), PNA ( "peptide nucleic acids” analogs), PTO (phosphorothioate), morpholino analogs, 2 '-0-alkyl-RNA modifications (such as 2 '-OMe, 2' -0 propargyl, 2 '-0- (2-methoxyethyl), 2'
  • nucleotides or Nucleotide modifications are linked together, for example, by conventional 5 ' -3 ' bonding or 5 ' -2 ' bonding.
  • a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.
  • the controller oligonucleotide may include nucleotides and / or nucleotide modifications in its first region, the nucleobases being selected from the following list: adenines and their analogs, guanines and its analogs, cytosines and its analogs, uracil and its analogs, thymines and its analogues, inosine or other universal bases (eg nitroindole), 2-amino-adenine and its analogues, iso-cytosines and its analogues, iso-guanines and its analogues.
  • nucleobases being selected from the following list: adenines and their analogs, guanines and its analogs, cytosines and its analogs, uracil and its analogs, thymines and its analogues, inosine or other universal bases (eg nitroindole), 2-amino-adenine and its analogues, iso-cytosines and
  • the controller oligonucleotide may include in its first region non-nucleotide compounds selected from the following list: Intercalating substances which may affect the binding strength between the controller oligonucleotide and the first primer oligonucleotide, e.g. MGB, naphthalene etc. The same elements can also be used in the second region of the first primer.
  • the controller oligonucleotide may include in its first region non-nucleotide compounds, e.g. Linkers such as C3, C6, HEG linkers which link individual segments of the first region together.
  • non-nucleotide compounds e.g. Linkers such as C3, C6, HEG linkers which link individual segments of the first region together.
  • the controller oligonucleotide may bind by means of its second region to the first primer region of the first primer oligonucleotide, the binding being mediated essentially by hybridization of complementary bases.
  • the length of the second region of the controller oligonucleotide is matched to the length of the first region of the first primer oligonucleotide and is consistent with this particular. It is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides.
  • the sequence of the second region of the controller oligonucleotide is in particular complementary to the first region of the first primer oligonucleotide. The measure of agreement in Complementarity is between 80% and 100%, especially between 95% and 100%, especially at 100%.
  • the second portion of the controller oligonucleotide specifically includes nucleotide modifications of one, which, however, the polymerase on the extension of the first primer oligonucleotide prevent the formation of complementary double strands do not block or substantially not prevent, for example, 2 '-0-alkyl RNA analogs (for example, 2 '-0-Me, 2' -0- (2-methoxyethyl), 2 '-0-propyl, 2' -0-propargyl nucleotide modifications), LNA, PNA or morpholino nucleotide modifications.
  • Individual nucleotide monomers are linked in particular via 5 ' -3 ' - binding, but also an alternative 5 ' -2 ' bond between nucleotide monomers can be used.
  • the sequence length and its nature of the first and the second region of the controller oligonucleotide are chosen in particular such that the binding of these regions to the first primer oligonucleotide is reversible under reaction conditions in at least one reaction step of the process. This means that the controller oligonucleotide and the first primer oligonucleotide can bind specifically to each other, but this bond should not lead to the formation of a permanently stable under reaction conditions complex of both elements.
  • an equilibrium between a bound complex form of controller oligonucleotide and the first primer oligonucleotide and a free form of individual components under reaction conditions should be sought or made possible at least in one reaction step. This ensures that at least a portion of the first primer oligonucleotides can be in free form under reaction conditions and can interact with the template to initiate a primer extension reaction. On the other hand, this ensures that corresponding sequence regions of the controller oligonucleotide are available for binding with an extended primer oligonucleotide.
  • the proportion of free, single-stranded and thus reactive components can be influenced: by lowering the temperature, first primer oligonucleotides bind to the controller oligonucleotides, so that both participants bind a complementary double-stranded complex.
  • concentration of single-stranded forms of individual components can be lowered.
  • An increase in temperature can lead to the dissociation of both components into single-stranded form.
  • the concentration of single-stranded forms in the reaction mixture can thus be influenced.
  • desired reaction conditions can be brought about during corresponding reaction steps.
  • desired reaction conditions can be brought about during corresponding reaction steps.
  • Controller oligonucleotide / first primer oligonucleotide portions of each free forms of individual components can be influenced.
  • the temperature used destabilizes complexes comprising controller oligonucleotide / first primer oligonucleotide, so that during this reaction step individual complex components are at least temporarily single-stranded and thus able to interact with other reactants.
  • a first sequence region of the controller oligonucleotide may be released from the double-stranded complex with a non-extended first primer, and thus may interact with the second sequence region of an extended first primer oligonucleotide, thereby initiating strand displacement.
  • release of a first, non-extended primer oligonucleotide from a complex comprising controller oligonucleotide / first primer oligonucleotide results in the first primer region becoming single-stranded and thus able to interact with the template such that primer extension by a polymerase can be initiated.
  • the temperature used does not have to correspond exactly to the melting temperature of the complex of controller oligonucleotide / first primer oligonucleotide. It is sufficient if a temperature in a reaction step is used approximately in the range of the melting temperature.
  • the temperature in one of the reaction steps comprises ranges of Tm +/- 10 ° C, in particular Tm +/- 5 ° C, in particular Tm +/- 3 ° C of the complex of controller oligonucleotide / first primer oligonucleotide.
  • Such a temperature can be set, for example, in the context of the reaction step, which comprises a sequence-specific strand displacement by the controller oligonucleotide.
  • reaction conditions are maintained over the entire duration of the amplification reaction in which there is equilibrium between a complex oligonucleotide-controller design and the first Primer oligonucleotide and a free form of individual components is possible.
  • the ratio between a complex form of controller oligonucleotide and the first primer oligonucleotide and free forms of individual components can be influenced both by reaction conditions (eg temperature and Mg 2+ concentration) and by structures and concentrations of individual components.
  • the sequence length and its nature of the first and second regions of the controller oligonucleotide are selected in one embodiment such that under given reaction conditions (eg in the reaction step of strand displacement by the controller oligonucleotide) the ratio between a proportion of a free controller oligonucleotide and a portion of a controller oligonucleotide complexed with a first primer oligonucleotide comprises the following ranges: from 1: 100 to 100: 1, more preferably from 1:30 to 30: 1, especially from 1: 10 to 10: 1.
  • the ratio between a proportion of a free first primer oligonucleotide and a proportion of a first primer oligonucleotide in complex with a controller oligonucleotide comprises ranges from 1: 100 to 100: 1, in particular from 1: 30 to 30: 1, in particular from 1 : 10 to 10: 1.
  • the concentration of the first primer oligonucleotide is higher than the concentration of the controller oligonucleotide.
  • the concentration of the first primer oligonucleotide is lower than the concentration of the controller oligonucleotide.
  • concentration of the controller oligonucleotide there is an excess of the controller oligonucleotide and the first primer oligonucleotide must be released for its effect of binding to the controller oligonucleotide by choosing an appropriate reaction temperature. In general, this is achieved by an increase in temperature, to sufficient concentrations of free forms of the first primer oligonucleotide.
  • the controller oligonucleotide may bind by means of its third region to at least one segment of the specifically synthesized extension product of the first primer oligonucleotide. In particular, binding occurs by hybridization of complementary bases between the controller oligonucleotide and the extension product synthesized by the polymerase.
  • the sequence of the third region should in particular have a high complementarity to the extension product. In one embodiment, the sequence of the third region is 100% complementary to the extension product.
  • the binding of the third region takes place in particular on the segment of the extension product which directly adjoins the first region of the first primer oligonucleotide.
  • the segment of the extension product lies in the 5 ' segment of the entire extension product of the first primer oligonucleotide.
  • the binding of the third region of the controller oligonucleotide does not occur over the entire length of the extension product of the first primer oligonucleotide.
  • a segment remains unbound at the 3 ' end of the extension product.
  • This 3 ' -terminal segment is necessary for the binding of the second primer oligonucleotide.
  • the length of the third region is adapted accordingly so that the third region binds to the 5 ' -terminal segment of the extension product on the one hand, while on the other hand does not bind the 3 ' -step segment of the extension product.
  • the total length of the third region of the controller oligonucleotide is from 2 to 100, in particular from 6 to 60, in particular from 10 to 40 nucleotides or their equivalents.
  • the controller oligonucleotide may enter into a complementary bond with the segment of the extension product over that length, thereby displacing this 5 ' segment of the extension product from binding with its complementary template strand.
  • the length of the 3 ' -terminal segment of the extension product which is not bound by the controller oligonucleotide comprises, for example, regions between 20 and 200 nucleotides, in particular between 20 and 100 nucleotides, in particular between 30 and 80, in particular between 30 and 60 nucleotides.
  • This 3 ' segment of the extension product is not displaced from the controller oligonucleotide from binding with the template strand. Even with the third region of the controller oligonucleotide fully bound to its complementary segment of the extension product, the first primer extension product may remain bound to the template strand via its 3 ' -terminal segment.
  • sequence length of this 3 ' segment is chosen such that the two primer extension products do not dissociate upon binding of only one controller. It therefore requires the simultaneous binding of both controllers to their corresponding primer extension products so that they can dissociate from each other.
  • the controller oligonucleotide as a whole has a suitable structure to perform its function: under appropriate reaction conditions, it is capable of sequence-specific displacement of the extended first primer oligonucleotide from binding with the template strand, thereby converting the template strand into a single-stranded form and Thus, for further binding with a new first primer oligonucleotide and their target sequence specific extension by the polymerase is available.
  • regions one, two and three of the controller oligonucleotide should be predominantly in single-stranded form under reaction conditions. Therefore, double-stranded self-complementary structures (e.g., hairpins) in these regions should be avoided as much as possible since they may degrade the functionality of the controller oligonucleotide.
  • double-stranded self-complementary structures e.g., hairpins
  • the controller oligonucleotide should not appear as a template in the method of the invention, therefore the first primer oligonucleotide, when attached to the controller oligonucleotide under reaction conditions, should not be extended by the polymerase. This is achieved in particular by the use of nucleotide modifications which prevent the polymerase from copying the strand. In particular, the 3 ' end of the first primer oligonucleotide does not remain elongated when the first primer oligonucleotide binds to the controller oligonucleotide under reaction conditions.
  • the degree of blockage / inhibition / slowing / aggravation of the reaction may be between complete expression of this property (e.g., 100% blockage under given reaction conditions) and a partial expression of this property (e.g., 30-90% blockade under given reaction conditions).
  • nucleotide modifications which individually or in a series coupled to each other (eg as a sequence fragment consisting of modified nucleotides) more than 70%, in particular more than 90%, in particular more than 95%, and especially 100% prevent the extension of a first primer can.
  • the nucleotide modifications may include base modifications and / or sugar-phosphate-residue modifications.
  • the sugar-phosphate modifications are advantageous because any complementary sequence of a controller oligonucleotide can be assembled by combining with conventional nucleobases.
  • the nucleotides with modifications in the sugar-phosphate residue, which can lead to hindrance or blockage of the synthesis of the polymerase include, for example: 2 '-0-alkyl modifications (eg, 2' -0-methyl, 2 '-0- (2-methoxyethyl), 2 '-0-propyl, 2' -0-propargyl nucleotide modifications), 2 '-amino-2' -Deoxy- nucleotide modifications, 2 'amino-alkyl-2' -Deoxy- Nucleotide modifications, PNA, morpholino modifications, etc.
  • 2 '-0-alkyl modifications eg, 2' -0-methyl, 2 '-0- (2-methoxyethyl), 2 '-0-propyl, 2' -0-propargyl nucleotide modifications
  • 2 '-amino-2' -Deoxy- nucleotide modifications e.g, 2'-alkyl modifications
  • the blockade can be accomplished by either a single nucleotide modification or only by coupling multiple nucleotide modifications in series (e.g., as a sequence fragment consisting of modified nucleotides). For example, at least 2, in particular at least 5, in particular at least 10, of such nucleotide modifications can be coupled side by side in the controller oligonucleotide.
  • a controller oligonucleotide may comprise a uniform type of nucleotide modifications or may comprise at least two different types of nucleotide modification.
  • the location of such nucleotide modifications in the controller oligonucleotide is intended to prevent the polymerase from extending the 3 ' end of a first primer oligonucleotide bound to the controller oligonucleotide.
  • nucleotide modifications are located in the second region of the controller oligonucleotide. In another embodiment, such nucleotide modifications are located in the third region of the controller oligonucleotide. In another embodiment, such nucleotide modifications are located in the second and third regions of the controller oligonucleotide.
  • the second region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%.
  • the third region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%, in particular at least 90%.
  • the entire third region comprises nucleotide modifications that prevent a polymerase from extending a primer bound to such a region using the controller oligonucleotide as a template.
  • the entire third and second region comprises such nucleotide modifications.
  • the entire first, second and third region comprises such nucleotide modifications.
  • the controller oligonucleotide may consist entirely of such nucleotide modifications.
  • Such modified controller oligonucleotides can be used, for example, in multiplex analyzes in which further primers are used. This is to prevent inadvertent primer extension reactions on one or more controller oligonucleotides.
  • sequence of nucleobases from these nucleotide modifications is adapted to the requirements of the sequence in each area.
  • the remaining portion may be natural nucleotides, or nucleotide modifications that do not or only marginally inhibit polymerase function, eg, DNA nucleotides, PTO nucleotides, LNA nucleotides, RNA nucleotides.
  • further modifications for example base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5 Propyl uridine or non-nucleotide modifications such as dyes, or MGB modifications, etc.
  • base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5 Propyl uridine or
  • a segment of the controller oligonucleotide having nucleotide modifications which prevent the 3 ' extension of a first primer oligonucleotide bound to the controller oligonucleotide by the polymerase is termed a "second blocking moiety".
  • the length of this segment may include between 1 to 50 nucleotide modifications, more particularly between 4 and 30.
  • this segment may be located in the controller oligonucleotide such that the 3 ' end of the bound first primer oligonucleotide is in that segment.
  • this segment can span regions two and three.
  • a controller oligonucleotide in its third region comprises at least one component of the detection system (eg fluorescence reporter or fluorescence quencher or a donor fluorophore). The position of this component in one embodiment lies at the 5 ' end of the controller oligonucleotide. In another embodiment, this component is in the inner sequence segment of the third region.
  • the distance up to the 5 ' end of the controller oligonucleotide may be between 2 to 50 nucleotides, in particular between 2 and 20, in particular between 2 and 10 nucleotides.
  • the controller oligonucleotide may comprise, in addition to regions one, two and three, further sequence segments which, for example, flank the abovementioned regions in the 5 ' segment or 3 ' segment of the controller oligonucleotide.
  • sequence elements can be used, for example, for other functions, such as, for example, interaction with probes, binding to solid phase, etc. In particular, such regions do not disturb the function of regions one to three.
  • the length of these flanking sequences may be, for example, between 1 to 50 nucleotides.
  • a controller oligonucleotide may comprise at least one element for immobilization on a solid phase, eg a biotin residue.
  • a controller oligonucleotide may include at least one element for detection, eg, a fluorescent dye.
  • the strand displacement of the template strands is influenced by newly synthesized strands.
  • the strand displacement and / or separation is either slowed down quantitatively or completely eliminated. It is thus not at all or less often the transfer of primer binding sites in the single-stranded state. Thus, there are no or fewer primer binding sites available for a new interaction with primers.
  • the system will consist of both primer Extension products rarely put into an active state or an active state is not reached.
  • the efficiency of the double-stranded opening of the newly synthesized primer extension products after each individual synthesis step affects the potentially achievable yields in subsequent cycles: the fewer free / single-stranded primer binding sites of a nucleic acid chain to be amplified at the beginning of a synthesis step The lower the number of newly synthesized strands of the nucleic acid chain to be amplified in this step. In other words, the yield of a synthesis cycle is proportional to the amount of primer binding sites available for interaction with corresponding complementary primers. Overall, this can be realized a control circuit.
  • This control circuit corresponds to a real-time / on-line control of synthesized fragments: the sequence control takes place in the reaction mixture while the amplification takes place.
  • This sequence control follows a predetermined pattern and the oligonucleotide system (by strand-opening action of the controller oligonucleotide) can decide between "correct” and "incorrect” states without external interference. In the correct state, the synthesis of sequences is continued; in the incorrect state, the synthesis is either slowed down or completely prevented. The resulting differences in yields of "correct” and "incorrect” sequences after each step affect the entire amplification comprising a variety of such steps.
  • the displacement of the second primer extension product from binding with the first primer extension product by means of sequence-dependent strand displacement by the controller oligonucleotide forms a partial step in the amplification.
  • the reaction conditions during this step are adjusted accordingly.
  • the reaction temperature and the reaction time are chosen so that the reaction can take place successfully.
  • the strand displacement by the controller oligonucleotide proceeds until the separation / dissociation of the second primer extension product from the bond with the first primer extension product.
  • Such dissociation of the 3 ' segment of the first primer extension product from complementary portions of the second primer extension product may occur spontaneously as part of a temperature-dependent / temperature-related separation of both primer extension products.
  • Such dissociation has a favorable effect on the kinetics of the amplification reaction and can be influenced by the choice of the reaction conditions, for example by means of temperature conditions. The temperature conditions are therefore chosen such that successful strand displacement by complementary binding of the controller oligonucleotide favors dissociation of the second primer extension product from the 3 ' segment of the first primer extension product.
  • the length of the controller and the length of the primer extension products are chosen such that binding of a single controller oligonucleotide is insufficient to separate both primer extension products.
  • the strand displacement by the controller oligonucleotide proceeds until the detachment / dissociation of a 3 ' segment of the second primer extension product (P2.1-Ext) from the complementary binding with the first primer extension product (P1 .1-Ext ), this 3 ' segment of the second primer extension product (P2.1-Ext) comprising at least one complementary region to the first primer and a complementary segment to the first primer extension product (P1 .1 -Ext), which were formed only in the enzymatic synthesis is.
  • a new primer extension product (P1 .2) can be attached to a single stranded sequence segment of the complexed (P2.1-Ext ) under reaction conditions and thus initiate a synthesis of a new first primer extension product (P1 .2-Ext) by a polymerase.
  • this reaction proceeds at a reduced rate, since the 3 ' segment of the P2.1 -Ext is not permanently single-stranded, but in competitive behavior with the controller oligonucleotide and thus alternately single-stranded and double-stranded states by binding to the P1 1 -Ext has ,
  • Such dissociation has a favorable effect on the kinetics of the amplification reaction and may be influenced by the choice of reaction conditions, e.g. by means of temperature conditions.
  • the involvement of the polymerase-mediated synthesis-dependent strand displacement in the dissociation of P1 .1-Ext and P2.1 -xt has a favorable effect on strand separation.
  • the temperature in this step includes, for example, ranges from 15 ° C to 75 ° C, especially from 30 ° C to 70 ° C, especially from 50 ° C to 70 ° C.
  • the controller oligonucleotide Given the length of the first region of the controller oligonucleotide and the second region of the first primer oligonucleotide (including, for example, ranges of from 3 to 25 nucleotide monomers, especially from 5 to 15 nucleotide monomers), a strand displacement reaction can generally be successfully initiated. With complete complementarity of the controller oligonucleotide to corresponding portions of the first primer extension product, the controller oligonucleotide can bind to the first primer extension product except for the 3 ' segment of the first primer extension product and displace the second primer extension product. The second primer extension product thus remains in association with the 3 ' segment of the first primer extension product. This strength of this compound can be influenced by temperature. Upon reaching a critical temperature, this compound can decay and dissociate both primer extension products. The shorter the sequence of the 3 ' segment, the more unstable this compound and the lower the temperature which causes spontaneous dissociation.
  • a spontaneous dissociation can be achieved for example in the temperature range, which is approximately at the melting temperature.
  • the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 3 ° C) of the complex comprising the 3 ' segment of the first primer extension product that is not bound by the controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.
  • the temperature of the steps of strand displacement by the controller oligonucleotide is at about the melting temperature (Tm +/- 5 ° C) of the complex comprising the 3 ' segment of the first primer extension product that is not bound by the controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.
  • the temperature of the steps of strand displacement by the controller oligonucleotide is above the melting temperature of the complex comprising the 3 ' segment of the first primer extension product that is not bound by the controller oligonucleotide and the second primer oligonucleotide second primer extension product.
  • a temperature includes temperature ranges from about Tm + 5 ° C to Tm + 20 ° C, better from Tm + 5 ° C to Tm + 10 ° C.
  • a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide and which comprises sequence lengths of 9 to about 18 nucleotides.
  • spontaneous dissociation can usually be achieved already at temperature ranges between 40 ° C and 65 ° C. Higher temperatures also lead to dissociation.
  • a first primer extension product comprises a 3 ' segment that is not bound by the controller oligonucleotide and that has sequence lengths of 15 to about 25 nucleotides.
  • spontaneous dissociation can usually be achieved already at temperature ranges between 50 ° C and 70 ° C. Higher temperatures also lead to dissociation.
  • a first primer extension product comprises a 3 ' segment that is not bound by the controller oligonucleotide and that has sequence lengths of from 20 to about 40 nucleotides.
  • a spontaneous dissociation usually already at temperature ranges between 50 ° C and 75 ° C can be achieved. Higher temperatures also lead to dissociation.
  • composition of the 3 ' segment of the first primer extension product and optionally an introduction of melting temperature-influencing oligonucleotide modifications (eg MGB) or reaction conditions (eg TPAC, betaine) can influence the choice of temperature.
  • An appropriate adaptation can therefore be made.
  • all steps of the amplification proceed under stringent conditions which prevent the formation of nonspecific products / by-products or slow it down.
  • stringent conditions include, for example, higher temperatures, for example above 50 ° C.
  • the single steps of strand displacement by controller oligonucleotides are at the same temperature as the synthesis of the first and second primer extension products. In another embodiment, the single steps of strand displacement by controller oligonucleotides are at a temperature that differs from the temperature of the particular synthesis of the first and second primer extension products. In another embodiment, the synthesis of the first primer extension product and the strand displacement by the controller oligonucleotide proceeds at the same temperature. In another embodiment, synthesis of the second primer extension product and strand displacement by the controller oligonucleotide proceeds at the same temperature.
  • the concentration of the controller oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.
  • the preparation of the starting nucleic acid was carried out by primer extension starting from double-stranded nucleic acid chains comprising the target sequences. Primers were used which were also used in the later amplification as the first and second primer.
  • double-stranded nucleic acid chains comprising target sequences and corresponding complementary strands
  • Both strands can serve as templates for primer extension.
  • the double-stranded matrices were converted into single-stranded form by initial denaturation under reaction conditions.
  • primers which were also used in the later amplification
  • primers were hybridized to their complementary sequence segments and extended by Taq polymerase. These steps were repeated once (denaturation and primer extension).
  • the reaction mixtures thus obtained comprised both primer extension products (the first and the second primer extension products) which were used as starting nucleic acid chains in the amplification method (Example 2).
  • the resulting products also included the first and second regions of the respective primer.
  • the primer extension reaction starting from double-stranded nucleic acid chains was carried out as follows:
  • the first and second primers were each used in concentrations of 1 pmol / l.
  • DNA templates were used in about 0.05 to 0.5 nmol / l.
  • 1 x isothermal buffer (New England Biolabs, catalog # B0537S, in simple concentration, the buffer contains: 20 mM Tris-HCl, 10 mM (NH 4 ) 2 SO 4 , 50 mM KCl, 2 mM MgSO 4 , 0.1% Tween® 20; pH 8.8 @ 25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each;
  • the preparation of the starting nucleic acid chains was carried out with Taq polymerase (NEB).
  • the Taq polymerase was in the reaction mixture in a simple concentration (about 100-fold dilution of the stock solution).
  • the thermal reaction conditions were as follows:
  • the first primer oligonucleotide P1 F5-50-AE2051
  • the underlining sequence portion corresponds to the first region of a primer and may sequence-specifically hybridize to a template and be extended by the polymerase.
  • numbered positions represent modified nucleotide analogues as building blocks of the chain:
  • This primer oligonucleotide comprises the first region (positions 1 - 12 from the 3 ' end), the second region (C3 linker, as well as positions 13 - 24 from the 3 ' end), and a segment with an additional sequence variant P1 (positions 25 - 57 from the 3 ' end).
  • the first region and the second region are necessary for the execution of a specific amplification and can be described as "basic Structure of the first primer "or" minimal structure of the first primer "are summarized.
  • the additional sequence variant P1 represents an example of additional sequence segments which can be integrated on the first primer oligonucleotide. Positions 1-12 serve as template in the synthesis of the second primer extension product. C3 modification and the second region prevent synthesis from continuing at positions 25-57 during synthesis of the second primer extension product.
  • the second primer oligonucleotide P1F5G2-1001-103_2xlnv
  • the underlining sequence portion corresponds to the first region of a primer and may sequence-specifically hybridize to a template and be extended by the polymerase.
  • Both primers comprised the following composition:
  • numbered positions represent modified nucleotide analogues as building blocks of the chain:
  • nucleotides and modifications are linked together with phosphodiester bonds.
  • Double-stranded templates were used which included subsequent target sequences.
  • the double-stranded templates were prepared by conventional PCR.
  • the Tm of double strands was about 79 to 81 ° C (measured at the end of the PCR reaction).
  • AAGGAATACAGGTATTTTGAA 3 (SEC ID NO 01 1)
  • Product: M2HAF5-2xC-GC-Gap 20_THR (starting nucleic acid chain Ml.1)
  • the resulting products of the primer extension reaction correspond to the starting nucleic acid chains (M1.1 and M2.1) and comprise either the target sequence or its complementary sequence, as well as primer binding sites to which primers can bind in the amplification. These products were used as a mixture of both primer extension products in the amplification (Example 2).
  • Example 2 Exponential Multiplication of Amplification Fragments Starting from Start Nucleic Acid Chains
  • the amplification was carried out using two sequence-specific controller oligonucleotides, two sequence-specific primers and two auxiliary oligonucleotides (block oligonucleotides).
  • the first primer oligonucleotide P1 F5-50-AE2051
  • the underlining sequence portion corresponds to the first region of a primer and may sequence-specifically hybridize to a template and be extended by the polymerase.
  • the second primer oligonucleotide P1F5G2-1001-103_2xlnv
  • the underlining sequence portion corresponds to the first region of a primer and can sequence-specifically hybridize to a template and be extended by the polymerase.
  • Both primers comprised the following composition:
  • the first block oligonucleotide BP1 F5-25001 -402
  • X 3 'phosphate group for blocking a possible extension by polymerase.
  • the first controller oligonucleotide CF 5-1001-11-6-S
  • the second controller oligonucleotide CF-1001 -L-103_2xlnv-GC-S
  • M2HAF5-2xC-Ex-Gap 30_THL
  • M2HAF5-2xC-Ex-Gap 30_THR
  • M2HAF5-2xC-Ex-Gap 20_THL
  • M2HAF5-2xC-Ex-Gap 20_THR
  • M2HAF5-2xC-Ex Gap 0_THL
  • the first controller oligonucleotide CF 5-1001-11-6
  • the second controller oligonucleotide CF5G2-1001-401_2xlnvEx
  • X 3 'phosphate group for blocking a possible extension by polymerase.
  • the first and second primers were each used in concentrations of 0.5 pmol / l.
  • the first and second block oligonucleotides were each used in concentrations of 5 pmol / l.
  • the first and second controller oligonucleotides were each used in concentrations of 2 pmol / l.
  • Mixtures with DNA matrices (starting nucleic acid chains M1 .1 and M2.1) from Example 1 (Mixtures 1 to 6) were each used individually diluted 6-fold and / or 6000-fold.
  • 1 x isothermal buffer (New England Biolabs, catalog # B0537S, in simple concentration, the buffer contains: 20 mM Tris-HCl, 10 mM (NH 4 ) 2 SO 4 , 50 mM KCl, 2 mM MgSO 4 , 0.1% Tween® 20; pH 8.8 @ 25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each;
  • the amplification was carried out using BST 2.0 polymerase (stock solution: Bst 2.0 warm start 120,000 units / ml, NEB) according to the manufacturer.
  • BST polymerase was present in the reaction mixture at 1200-fold dilution of the polymerase stock solution.
  • the thermal reaction conditions were as follows:
  • Amplification products used the following techniques:
  • Fig. 21 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction. On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • Arrow 1 belongs to the 6-fold and (arrow 2) to the 6000-fold diluted starting material from Example 1.
  • Arrow 3 shows the course of a negative control, here H20 instead of the
  • Fig. 21 (B) shows the melting curves belonging to the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed. The peaks indicated by arrow 4 belong to the 6-fold and 6000-fold diluted
  • Fig. 22 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted.
  • the increase in the fluorescence signal indicates that amplification products have formed.
  • arrow 1 belongs to the 6-fold and arrow 2 to 6000-fold diluted starting material from Example 1.
  • Arrow 3 shows the course of a negative control, here H20 instead of the
  • Fig. 22 (B) shows the melting curves associated with the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed. The peaks indicated by arrow 4 belong to the 6-fold and 6000-fold diluted
  • Fig. 23 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction. On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • Arrow 1 belongs to the 6000-fold diluted starting material from Example 1.
  • Arrow 2 shows the Course of a negative control, here H20 was used instead of the starting material from Example 1.
  • Fig. 23 (B) shows the melting curves associated with the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed. The peaks indicated by arrow 3 belong to the 6000-fold diluted starting material from example 1. The curves marked with arrow 4 have no product peak and belong to the negative control.
  • Fig. 24 (A) shows a typical course of the EvaGreen fluorescence signal over time
  • Amplification reaction On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • Arrow 1 belongs to the 6000-fold diluted starting material from Example 1.
  • Arrow 2 shows the course of a negative control, here H20 was used instead of the starting material from Example 1.
  • Fig. 24 (B) shows the melting curves associated with the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed. The peaks indicated by arrow 3 belong to the 6000-fold diluted starting material from example 1. The curves marked with arrow 4 have no product peak and belong to the negative control.
  • Fig. 25 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction. On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • Arrow 1 belongs to the 6000-fold diluted starting material from Example 1.
  • Arrow 2 shows the course of a negative control, here H20 was used instead of the starting material from Example 1.
  • Fig. 25 (B) shows the melting curves associated with the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed.
  • auxiliary oligonucleotides (block oligonucleotides):
  • an advantageous embodiment of the reaction conditions was selected in which on the one hand the primer concentration was lower than the concentration of controller oligonucleotide and on the other hand cyclic temperature changes (between 50 ° C and 65 ° C) were used.
  • primer oligonucleotides form an interaction pair with the corresponding controller oligonucleotides (e.g., first primer oligonucleotide and first controller oligonucleotide).
  • this interaction pair had a melting temperature of about 63 ° C. (measured at about 1 pmol / l concentration of both components under buffer conditions of the amplification).
  • the first region of the primer oligonucleotide formed with a complementary sequence portion of a template a complex having a melting temperature of about 50 ° C eg first region of the first primer and the second primer extension product (P2.1-Ext) measured at approx 1 pmol / L concentration of both components under buffer conditions of amplification.
  • primer-controller combinations may be used in which the concentration of primer is higher than the concentration of controller (e.g., primers 2-5 pmol / L and controller 1 pmol / L).
  • concentration of primer is higher than the concentration of controller (e.g., primers 2-5 pmol / L and controller 1 pmol / L).
  • controller e.g., primers 2-5 pmol / L and controller 1 pmol / L.
  • a mixture of a primer and a corresponding controller was used in which the concentration of primer was lower than the concentration of the controller oligonucleotide (eg primer 0.5 pmol / l and controller 2 pmol / l).
  • the controller oligonucleotide was in excess.
  • sending the reaction temperature to 50 ° C resulted in rapid binding of the primer oligonucleotides to the controller oligonucleotides. This reduced the yield in the primer extension step at 50 ° C and lowered the rate of amplification.
  • block oligonucleotides In order to maintain a sufficient primer concentration even at low temperatures and thus to increase yields in the primer extension step, so-called block oligonucleotides were used. Such block oligonucleotides competed with the primer oligonucleotide for binding to the controller oligonucleotide, but were themselves unable to be extended by a polymerase.
  • block oligonucleotides By using block oligonucleotides, it was possible to use concentration combinations of primer oligonucleotide and oligonucleotide for certain ("in certain" ⁇ - is quite inaccurate we should formulate here more precisely, for example, in very low primer concentrations) concentration ranges and to combine with cyclic temperature changes. This resulted in an increase in the reaction rate.
  • the structure of block oligonucleotides is substantially similar to the structure of primer oligonucleotides, with the following differences:
  • Block oligonucleotides are not extended by polymerase. This can, for example, by blocking the 3 'end can be achieved by a modification (for example 3' phosphate, 3 'C3, dideoxy-nucleotide), and / or by introduction of terminal mismatches in the 3' - end of the block oligonucleotide.
  • a modification for example 3' phosphate, 3 'C3, dideoxy-nucleotide
  • Block oligonucleotides may differ in their sequence composition from their corresponding primers.
  • the number of sequence deviations can be between 1 nucleotide to 20 nucleotides.
  • block oligonucleotides In the design of block oligonucleotides, it is advantageous to maintain the Tm of block oligonucleotides on controller oligonucleotides in the similar range as the Tm of primer oligonucleotides and controller oligonucleotides. As a result, block oligonucleotides and primer oligonucleotides compete for binding to controller oligonucleotides to a similar extent (e.g., primer-controller complex Tm plus / minus 3 ° C). By using higher concentrations of block oligonucleotides as primer oligonucleotides, the binding ratio can be favorably influenced.
  • Fig. 1 shows schematically the sequence components of an embodiment of the invention.
  • the primers 1 .1 and primer 2.1 can be predominantly complementarily bound with their respective first regions (in 3 ' segments) to the respective primer binding sites in amplification products and extended by the polymerase, the primer extension products P1 1-Ext and P2 .1 text are formed.
  • the polynucleotide tail (primer overhang) of the second region of each primer does not bind to any resulting during amplification
  • Amplification fragments 1 .1 and is not copied by the polymerase.
  • the strand separation according to a respective polymerase-dependent synthesis process takes place with the assistance of controller 1 .1 and controller 2.1, which can bind to the respective complementary segments of P1 1-Ext or P2.1-Ext.
  • Amplification products provide the result
  • the amplification product 1 .1 comprises P1 1-Ext and P2.1-Ext.
  • C1 .1 can bind complementary to the complementary segment of P1 .1-Ext.
  • C2.1 can bind to the complementary segment of P2.1-Ext.
  • the middle segment 3 is not bound by any controller complementary.
  • the first primer extension product (P1 .1-Ext) comprises the following segments (in the 5 ' -3 ' direction): P1.1 E6, P1.1 E5, P1.1 E4, P1.1 E3, P1.1 E2 , P1 .1 E1. Segments P1 .1 E6 and P1 .1 E5 are formed by the first primer oligonucleotide, segments P1 .1 E4 to P1 .1 E1 are synthesized during polymerase amplification.
  • the second primer extension product (P2.1-Ext) comprises the following segments (in the 5 ' -3 ' direction): P2.1 E6, P2.1 E5, P2.1 E4, P2.1 E3, P2.1 E2 , P2.1 E1. Segments P2.1 E6 and P2.1 E5 are formed by the second primer oligonucleotide, segments P1 .1 E4 to P1 .1 E1 are synthesized during amplification by the polymerase.
  • Fig. 2 shows schematically the topography of components of an embodiment of the invention.
  • the first primer oligonucleotide (P1 .1) comprises a first region (P1 .1 .1) and a second region (P1 .1 .2).
  • the first region can bind to the respective complementary position in primer extension products and can be extended by the polymerase depending on the template. In a reverse synthesis, the first region is copied from the polymerase.
  • the second region (polynucleotide tail) is not copied by the polymerase.
  • This range may for example include nucleotide modifications which prevent a polymerase from this area as a template to be used (for example, this area consists of 2 '-0-alkyl modifications of nucleotides).
  • a linker may be attached between the first region and the second region, which also prevents the polymerase from using the second region as a template.
  • the expected position of the polymerase stop in the synthesis of the strand complementary to the first region is referred to herein as stop-1 .1.
  • the polynucleotide tail is not copied by the polymerase and thereby remains single-stranded. It can serve to initiate the binding of controller 1 .1 to the P1 1 -xt.
  • the first primer P1 .1 can bind to the controller C1 .1, forming a complex P1 .1 / C1 .1 complex.
  • the second primer oligonucleotide (P2.1) comprises a first region (P2.1 .1) and a second region (P2.1 .2).
  • the first region can bind to the respective complementary position in primer extension products and can be extended by the polymerase depending on the template. In a reverse synthesis, the first region is copied from the polymerase.
  • the second region (polynucleotide tail) is not copied by the polymerase.
  • This range may for example include nucleotide modifications which prevent a polymerase from this area as a template to be used (for example, this area consists of 2 '-0-alkyl modifications of nucleotides).
  • a linker may be attached between the first region and the second region, which also prevents the polymerase from using the second region as a template.
  • the expected position of the polymerase stop in the synthesis of the strand complementary to the first region is referred to herein as stop-2.1.
  • the polynucleotide tail is not copied by the polymerase and remains single-stranded. It can serve to initiate the binding of controller 2.1 to the P2.1 text.
  • the first primer P2.1 can bind to the controller C2.1, forming a complex, the P2.1 / C2.1 complex.
  • segment P1 .1 does not bind to controller C2.1 and P2.1 does not bind to C1 .1.
  • Segment P1 .1 .1 of the first primer is identical to the segment P1 .1 E5 of the first primer extension product.
  • Segment P1 .1 .2 of the first primer is identical to segment P1 .1 E6 of the first primer extension product.
  • Segment P2.1 .1 of the second primer is identical to segment P2.1 E5 of the second primer extension product.
  • Segment P2.1 .2 of the second primer is identical to segment P2.1 E6 of the second primer extension product.
  • Fig. 3 shows schematically the topography of components of an embodiment of the invention.
  • the first controller oligonucleotide (C1 .1) comprises a first region (C1 .1 .1), a second region (C1 .1 .2) and a third region (C1 .1 .3).
  • the region C1 .1 .1 can bind mainly complementary to the P1 .1 .2.
  • the region C1 .1 .2 can bind to the P1 .1 .1 complementarily.
  • Region C1 .1 .3 can be complementary to that synthesized by the polymerase
  • Extension segment of the first primer complementary bind (P1 .1 E4).
  • the controller oligonucleotide (C1 .1) includes modifications that prevent a polymerase from using the first primer bound to the controller oligonucleotide as a template.
  • the controller oligonucleotide comprises nucleotide modifications that prevent a polymerase from extending the primer using the controller as a template.
  • the first primer P1 .1 can bind to the controller C1 .1, forming a complex, the P1 .1 / C1 1 complex.
  • the second controller oligonucleotide (C2.1) comprises a first region (C2.1 .1), a second region (C2.1 .2) and a third region (C2.1 .3).
  • the area C2.1 .1 can bind to the P2.1 .2 mainly complementary.
  • the area C2.1 .2 can bind to the P2.1 .1 complementarily.
  • Region C2.1 .3 can be complementary to that synthesized by the polymerase
  • the controller oligonucleotide (C2.1) includes modifications that prevent a polymerase from using the second primer bound to the controller oligonucleotide as a template.
  • the controller oligonucleotide comprises nucleotide modifications that prevent a polymerase from extending the primer using the controller as a template.
  • the controller oligonucleotide includes C2.1 .2 and C2.1.3 several 2 '-0-alkyl modifications of nucleotides.
  • the second primer P21 .1 can bind to the controller C2.1, forming a complex, the P2.1 / C2.1 complex.
  • primer 1 .1 and controller 1 .1 form the primer controller system 1 .1, and primer 2.1 and controller 2.1 the primer controller system 2.1.
  • FIG. 4 A schematically shows the topography of the first synthesized primer extension product (also called primer extension product, P1 .1-Ext).
  • the P1 .1 portion of primer extension product P1 .1 comprises the first primer region and the second primer region (with stop 1 .1 modification and polynucleotide tail 1 .1.).
  • Polymerase synthesized moieties lie during a template-dependent synthesis in the 3 ' direction of the primer moiety. These portions or segments serve as templates for the polymerase during the further synthetic steps and as primer binding site for primer 2.1 (PBS P2.1).
  • the stop-1 .1 element of primer P1 .1 prevents copying of the respective oligonucleotide tail.
  • the stated array of segments indicates for individual primer extension products which segments are represented by the primer and which are synthesized by the polymerase.
  • Fig. 4B shows schematically the topography of the second synthesized primer extension product (also called primer extension product, P2.1-Ext).
  • the primer extension product 2.1 (P2.1-Ext) comprises the P2.1 portion with the first primer region and the second primer region (with stop-2.1 modification and the polynucleotide tail 2.1.).
  • the synthesized by the polymerase shares are during a template-dependent synthesis in the 3 'direction of the primer portions. These portions also serve as templates for the polymerase during the further synthesis steps and as primer binding site for the primer 1 .1 (PBS P1 .1).
  • the stop 2.1 element of P2.1 also prevents copying of the respective oligonucleotide tail.
  • the stated array of segments shows for individual primer extension products which segments are represented by the primer and which are synthesized by the polymerase.
  • Fig. 5 schematically illustrates the controller binding and the primer binding to the
  • controller C1 .1 binds to the primer extension product P1 1-Ext. forming a double strand in the 5 'segment of the P1 .1 -Ext.
  • the controller C2.1 binds to the primer extension product P2.1-Ext. forming a double strand in the 5 'segment of P2.1-Ext.
  • the middle segment of each primer extension product does not interact with the controllers.
  • primer P1 .1 binds to the primer extension product P2.1 -Ext (which comprises a primer binding site for P1 .1 in the 3 ' segment) to form a double strand in the 3-segment of the P2.1-Ext.
  • primer P2.1 binds to the primer extension product P1 1 -Ext (which comprises a primer binding site for P2.1 in the 3 ' segment) to form a double strand in the 3-segment of the P2.1-Ext.
  • Fig. 6 schematically illustrates the interaction between the controllers (C1 .1 and C2.1) and the primer extension products (P1 .1-ext. And P2.1-ext.).
  • the double-stranded Complex comprising P1 1 -ext and P2.1 -ext shown immediately after a primer extension reaction by a polymerase. Both primer extension products form a complementary double strand.
  • the potential interaction positions for the two controllers (C1 .1 and C2.1) and the double-stranded complex comprising P1 1-Ext and P2.1-Ext are shown schematically.
  • C1 .1 has a double strand formed with parts of P1 1-Ext and C2.1 a double strand with parts of P2.1 -Ext, so that P1 1 -Ext and P2.1 -Ext remain bound together by the middle segment 3.
  • the sequence sections of the central region 3 are bonded to each other in the form of a complementary double strand.
  • a dissociation or separation of P1 1 -Ext and P2.1 -Ext from one another after a separation of the two strands in the middle segment 3 is shown. This results in the new complexes: P1 1 -Ext / C1 .1 and P2.1 -Ext / C2.1. Both complexes each comprise a primer binding site for primers which is in single-stranded form.
  • Fig. 7 shows schematically an amplification by the simultaneous synthesis of the first and second primer extension products (P1 .1 -Ext and P2.1-Ext).
  • P1 .1 -Ext serves as template for the polymerase-dependent synthesis of P2 .1 -xt, using the second primer P2.1 to initiate synthesis by the polymerase.
  • P2.1 -EX serves as a template for the polymerase-dependent synthesis of P1 1 -ext, using the first primer P1 .1 to initiate synthesis by the polymerase.
  • the respective separation of P1 .1-Ext and P2.1-Ext after the respective synthesis phase takes place with the assistance of both controller oligonucleotides (C1.1) and (C2.1).
  • the result is an exponential amplification of both primer extension products P1 .1 -Ext and P2.1 -Ext.
  • FIG. 7A illustrates an interaction between the controllers C1 .1 and C2.1 and the double-stranded complex comprising P1 .1 -Ext and P2.1 -Ext (A1) and a dissociation or separation of P1 .1 -Ext and P2 .1-Ext each other after a separation of the two strands in the middle segment 3.
  • Both complexes each comprise a primer binding site for primers which is in single-stranded form.
  • B) and C the use of the complexes P1 .1 -Ext / C1 .1 (FIG.
  • P2.1-Ext / C2.1 (FIG. 7C) as templates for the synthesis is shown in each case.
  • These include primer binding to respective PBS (1), polymerase binding to the primer / PBS complex (2), synthesis of the complementary strand by primer extension to the respective template (3), synthesis in the single-stranded one Field, and the completion of the synthesis of the complementary strand by the primer extension at the respective template with simultaneous displacement of the respective controller oligonucleotide (4), the strand displacement is mediated by the polymerase.
  • FIGS. 8-12 schematically show the amplification starting from M1 .1.
  • a synthesis can be performed using a starting nucleic acid chain (M1 .1) (FIG. 8A), a polymerase, dNTPs and corresponding P1 .1 / C1 .1 and P2.1 / C2.1 (FIG. 8B) such that an exponential Propagation of P1 1 -Ext and P2.1 -Ext (C) results.
  • M1 .1 starting nucleic acid chain
  • dNTPs corresponding P1 .1 / C1 .1 and P2.1 / C2.1
  • the starting nucleic acid chain (M 1 .1) (FIG. 8A) is provided at the beginning of the amplification and comprises the following segments (in the 5 ' -3 ' order): M1 .1 .6, M1 .1 .5, M1. 1 .4, M1 .1 .3, M1 .1 .2, M1 .1 .1, these segments being substantially identical to desired corresponding segments of P1 .1-Ext (in the 5 ' -3 ' order): P1 .1 E6, P1 .1 E5, P1 .1 E4, P1 .1 E3, P1 .1 E2, P1 .1 E1 (FIG. 8D).
  • nucleic acid chain M1 .1 is known to a person skilled in the art. This can be established by means of a primer extension reaction using P1 .1 and a nucleic acid strand comprising a target sequence (here called target sequence 1) (FIG. 9). In this case, a P1 .1 is hybridized to a 3 ' segment of a target sequence complementarily (FIG. 9B) so that a primer extension reaction can take place.
  • such a primer can be extended using a target sequence-comprising nucleic acid strand such that the target sequence 1 serves as a template and is copied during the process and a start-up nucleic acid sequence M1 .1 is synthesized (FIG 9C).
  • a separation (FIG. 9D) of the synthesized M1 .1 from the nucleic acid strand (comprising the target sequence) the starting nucleic acid chain M1 .1 is converted into single-stranded form.
  • Such a starting nucleic acid chain can be used for the amplification of P1 1-Ext and P2.1-Ext ( Figure 9E).
  • nucleic acid strand comprising a target sequence for a primer extension reaction is known to a person skilled in the art.
  • a primer extension reaction can be carried out once to provide a starting nucleic acid chain, or the process can also be repeated cyclically, ie several times, it being possible to provide a copy of M1 .1 using P1 .1.
  • the separation of M1 .1 from the target sequence-comprising nucleic acid strand and conversion into a single-stranded state are also known to a person skilled in the art: this can be done, for example, by temperature, which leads to the separation of strands formed. In general, a temperature can between 85 ° C and 105 ° C.
  • polymerase-dependent strand displacement can be used to detach M1.1 from the target sequence-comprising strand.
  • a so-called bumper primer is used, which is hybridized in the 3 ' direction of the target sequence comprising nucleic acid strand, so that during this synthesis M1 .1 will be displaced by polymerase.
  • alkaline strand separation is possible using, for example, 0.1 mole of NaOH.
  • the use of a first primer in the preparation of M1 .1 is important: it introduces a region in the 5 ' region of the starting nucleic acid chain which can not be copied by the polymerase. This is the second primer region of the first primer.
  • segment M1 .1 .6 corresponds to segment P1 .1 .2
  • segment M1 .1 .5 corresponds to segment P1 .1 .1.
  • Segments M1 .1 .4 to M1 .1 .1 are specified by the composition of the target sequence when the M1 .1 is created.
  • Fig. 10 summarizes schematically together thereby serve which segments of the target sequence as a template and used in the preparation of M1 .1:
  • the target sequence 1 comprises here the following segments (5 '- 3' arrangement): .5 TS1, TS1 .4 , TS1 .3, TS1 .2, TS1 .1.
  • Segment TS1 .1 can bind predominantly complementary to the first region of the first primer (P1 .1 .1), so that the polymerase can copy the target sequence starting from the 3 ' end of the hybridized primer, M1 .1 being generated.
  • P1 .1 .1 The choice of such a target sequence is known to a person skilled in the art.
  • a genomic DNA or RNA may comprise such a target sequence, or artificially produced sequences may include such a target sequence.
  • Fig. 10 summarizes which sequence segments of a target sequence (Fig.
  • the amplification starts from M1 .1, whereby a hybridization of the P2.1 to the essentially complementary primer binding site of the M1 .1 (segment M1 .1 .1) first carries out a primer extension reaction (using a polymerase and dNTPs) in which M1.1 occurs as a template. Due to the nature of the M1 .1 provided, polymerase synthesis is stopped at the Stop-1 .1 position of the M1 .1. The product synthesized by the primer extension reaction corresponds to the P2.1 text. (Fig. 1 1 B).
  • FIG. 12 shows that nucleic acid chains which do not have exact complementarity to P2.1.1 or which differ in the length of the 3 ' segment can also be used as the starting nucleic acid chain (M 1 .1; M1 .2 M1.13). It is crucial that P2.1 can bind specifically to segment M1 .1 .1 and can be extended by the polymerase, thus resulting in P2.1 -Ext (FIG. 11B).
  • FIG. 13 summarizes that M2.1 can also be used analogously as a starting nucleic acid chain.
  • Figures 14-15 show schematically the primer extension with simultaneous displacement of the respective controller from its binding with the primer extension product.
  • Figure 16 illustrates the interaction of C1 .1 and C2.1 with the complex of P1 .1-Ext and P2.1-Ext.
  • controllers There is initial binding of controllers via respective polynucleotide tails ( Figure 16B), resulting in sequence identity between synthesized strands and controller strands leading to double-stranded formation (C1.1 / P11-Ext and C2.1 / P2. 1 -xt).
  • P1 .1-Ext and P2. 1 -xt in the middle region (3) initially remain bound in a complementary manner (FIG. 16 C). Under appropriate reaction conditions, this complex can dissociate into single strands in the middle region, which leads to the separation of P1 .1-Ext and P2.1-Ext (FIG. 16 D).
  • This central region can be between 0 and 60 nucleotides, in particular between 1 and 40 nucleotides, in particular between 5 and 30 nucleotides.
  • This middle region is not bound by any of the two controllers in certain embodiments of the invention.
  • This middle region 3 corresponds to segments P1 .1 E3 and P2.1 E3.
  • the corresponding segment in the target sequence 1 is TS 1 .3; in M1 .1 it is M1 .1 .3.
  • reaction conditions which do not allow spontaneous separation of double strands comprising P1.1-Ext and P2.1-Ext in the absence of at least one controller.
  • FIGS. 17-19 schematically show various embodiments of topographies of individual target sequences and corresponding strands of starting nucleic acid chains derived therefrom and resulting primer extension products (P1 .1-Ext and P2.1-Ext).
  • Fig. 20 shows schematically the preparation of the starting nucleic acid sequence M2.1 using target sequence 4.
  • Example 3 Preparation of a starting nucleic acid chain by means of a PCR starting from
  • the starting nucleic acid chains obtained comprised a target sequence or a sequence complementary to the target sequence, as well as a segment M1.1.6 or M2.1.6 (overhang comprising modified nucleotides shown in FIG. 9 AD and FIG. 20 AD)
  • T2C-300-3001 (SEQ ID NO 27):
  • T2C-300-3002 (SEQ ID NO 28):
  • the underlining sequence portion corresponds to the first region of a primer and can sequence-specifically hybridize to a template and be extended by the polymerase.
  • A 2 'deoxy-adenosine
  • C 2' deoxy-cytosine
  • G 2 '-deoxy-guanosine
  • T 2' deoxy-thymidine (thymidine)
  • the underlining sequence portion corresponds to the first region of a primer and can sequence-specifically hybridize to a template and be extended by the polymerase.
  • Taq polymerase (used at a 1: 100 dilution starting from stock solution) 1 x isothermal buffer (New England Biolabs, catalog # B0537S; in simple concentration, the buffer contains: 20 mM Tris-HCl; 10 mM (NhU ⁇ SCU; 50 mM KCl; 2 mM MgSCU; 0.1% Tween® 20; pH 8.8 @ 25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each;
  • the PCR reaction was carried out for 25 cycles. One cycle included 54 ° C for 1 min and 65 ° C for 1 min. A final extension was carried out at 68 ° C for 10 minutes. For products of the reaction starting from the template T2C-300-3001, a Tm of about 80 ° C was measured. For the products of the reaction starting from the template T2C-300-3002 a Tm of about 81 ° C was measured.
  • A 2 'deoxy-adenosine
  • C 2' deoxy-cytosine
  • G 2 '-deoxy-guanosine
  • T 2' deoxy-thymidine (thymidine)
  • the region (M 1 .1 .6) rCUCU GAUGCUCU1 of the respective start nucleic acid chain M 1 .1 and the region enclosed in parentheses (M 2.1 .6) rCUCU GAUGCUUC1 of the respective start nucleic acid chain M 2.1 comprise modifications (2 '.
  • the resulting products of the PCR correspond to the starting nucleic acid chains (M1 .1 and M2.1) and comprise either the target sequence or its complementary sequence, corresponding overhangs (M 1 .1 .6 or M 2.1 .6) and primer binding sites which primers can bind in the amplification. These products were used as a mixture of both primer extension products in the amplification (Example 4).
  • the amplification was performed using two sequence-specific controller oligonucleotides and two sequence-specific primers.
  • the first variant (primer mix 1) comprised primers with a so-called “base structure” ("minimal structure”), which comprised a first region and a second region. No additional sequence segments were used.
  • Primer Mix 2 comprised primers with a structure that used additional sequence segments in addition to a first and a second primer region.
  • Both primer mixes were used with the same controller oligonucleotides.
  • the first primer oligonucleotide P1F5G2-1001-103 TMR
  • the second primer oligonucleotide P1F5-001-1016
  • the first primer oligonucleotide binds to M2.1
  • the second primer oligonucleotide binds to M1 .1.
  • the first primer comprised a 5'-TMR modification.
  • the first primer oligonucleotide P1F5G2-1001-103
  • the second primer oligonucleotide P1 F5-50-AE2051
  • A 2 'deoxy-adenosine
  • C 2' deoxy-cytosine
  • G 2 '-deoxy-guanosine
  • T 2' deoxy-thymidine (thymidine)
  • the underlining sequence portion corresponds to the first region of a primer and can sequence-specifically hybridize to a template and be extended by the polymerase.
  • the bracketed range rCUCU GAUGCUCU1 of the first primer oligonucleotide and the bracketed area rCUCU GAUGCUUC1 of the second oligonucleotide primer included modifications (2 '-0-methyl nucleotides: 2' -0-Me A (2 '-0-methyl - Adenosine), 2 '-0-Me G (2' -0-methyl-guanosine), 2 '-0-Me C (2' -0-methyl-cytosine), 2 '-0- Me U (2' 1-C3 linkers These sequence segments correspond to the second region of a primer oligonucleotide.
  • primer oligonucleotides comprise the first region (positions 1 - 12 from the 3 ' end), the second region (C3 linker, as well as positions 13 - 24 from the 3 ' end), and one segment each with an additional sequence variant P1 (FIG. Positions 25 - 54 from the 3 ' end).
  • the first region and the second region are necessary for performing a specific amplification and may be summarized as "base structure of the first primer” or "minimal structure of the first primer”.
  • the additional sequence variant P1 provides an example of additional Sequence segments which can be integrated on the first primer oligonucleotide.
  • a C3 modification and the second region prevent synthesis from continuing at positions 25-54 during synthesis of the second primer extension product.
  • controller oligonucleotides were used:
  • the first controller oligonucleotide C2xCF-P1 -103-101
  • the second controller oligonucleotide CF5-1001-11-6
  • A 2 'deoxy-adenosine
  • C 2' deoxy-cytosine
  • G 2 '-deoxy-guanosine
  • T 2' deoxy-thymidine (thymidine)
  • bracketed range rUAUUAGCCCAGAGGCGAUGUCUCUCAUGAU ACA GGUAUUl of the first controller and the oligonucleotide in brackets JA GGACUACUUC UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUACAG1 of the second controller included oligonucleotide modifications (2 '-0-methyl nucleotides: 2' -0- Me A ( 2 '-0-methyl-adenosine), 2' -0-Me G (2 '-0-methyl-guanosine), 2' -0-Me C (2 '-0- methyl-cytosine), 2' -0 -Me U (2 '-0-methyl-uridine).
  • X 3' phosphate group.
  • auxiliary oligonucleotides e.g., block oligonucleotides
  • the first and second primers were each used in concentrations of 4 pmol / l.
  • the first and second controller oligonucleotides were each used in concentrations of 2 pmol / l.
  • Mixtures with DNA templates (starting nucleic acid chains M1.1 and M2.1) from Example 3 (Mixtures 7 and 8) were each individually diluted 100 times (1: 600 v: v), 1000 times (1: 6000 v: v) and 60000 times (1: 10000 v: v) diluted.
  • a primer mix 1 with both controller oligonucleotides was used.
  • a primer mix 2 with both controller oligonucleotides was used.
  • concentrations of M1.1 and M1.2, as well as concentration of BST polymerase are indicated (see figure description).
  • 1x isothermal buffer (New England Biolabs, catalog # B0537S; in simple concentration, the buffer contains: 20mM Tris-HCl; 10mM (NH 4 ) 2S0 4 ; 50mM KCl; 2mM MgS0 4 ; 0.1% Tween® 20; pH 8.8@25°C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each; EvaGreen dye (Jena Biosciences) in 1:50 dilution.
  • Amplification was carried out using BST 2.0 polymerase (stock solution: Bst 2.0 warm start 120,000 units / ml, NEB) according to the manufacturer's instructions.
  • the BST polymerase was present in the reaction mixture in 120-fold (1: 120) and 1200-fold (1: 1200) dilution of the polymerase stock solution. See caption of figures).
  • the thermal reaction conditions were as follows:
  • the amplification was carried out using starting nucleic acid chains M1 .1 and M 2.1, prepared in Example 3.
  • the amplification proceeded both in mixtures with a primer mix 1 and with a primer mix 2.
  • the reaction kinetics (observed by the time of the signal - increase) of the amplification was observed. It was shown that the time of the visible signal increase depends on the input amount of the starting nucleic acid chains (FIGS. 26-29) and also on the amount of polymerase used in the reaction mixture (1: 120 or 1: 1200) (FIG. 30).
  • the melting temperature of amplification products obtained was above 80 ° C. Double-stranded products with such melting points are sufficiently stable under reaction conditions used in the absence of controller oligonucleotides. Only the presence of controller oligonucleotides leads to a separation of synthesized strands, so that an amplification can take place.
  • the primers used in primer mix 1 each comprise a first (P1 .1.1 and P2.1 .1) and a respective second range (P1 .1 .2 and P2.1 .2).
  • the controllers used each comprised a corresponding first (C1 .1 .1 and C 2.1.1), a second (C1 .1 .2 and C 2.1.2) and a third (C1.1.3 and C 2.1 .3) range. This shows that oligonucleotides having such structures were sufficient to carry out the process.
  • primers used in primer mix 2 comprised, in addition to a first and a second region, additional sequence segments which were located at the 5 ' primer term. These structures do not participate in the amplification, but do not interfere with such amplification either. This shows that additional sequences can be introduced at the primer.
  • FIGS. 26-29 show the influence of the starting nucleic acid chain used on the course of the reaction.
  • Fig. 26 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • the mixtures contained 600-fold (arrow), 6000-fold (arrow 2) and 60,000-fold (arrow 3) diluted mixtures from example 3 with mixture 7 (M 1.1 -T2C-300- 3001 and M 2.1 -T2C- 300-3001).
  • Arrow 4 shows the course of a negative control, here was used in the PCR for the generation of fragments instead of template H2O. No amplification products were produced in the negative control.
  • the amplification approach was performed with primer mix 2 and corresponding controller oligonucleotides.
  • the BST polymerase was used in 1-to-120-fold dilution of the stock solution.
  • Fig. 26 (B) shows the melting curves associated with the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed. In this case, the peaks marked with 1 -3 are among the mixtures at the start of the reaction mixture 7 (M 1.1 -T2C-300-3001 and M 2.1 -T2C-300-3001) in 600-fold, 6000-fold and 60000-fold dilution contained. The 4 marked curves show no product peak and belong to the negative control.
  • Fig. 27 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • the mixtures contained 600-fold (arrow), 6000-fold (arrow 2) and 60000-fold (arrow 3) diluted mixtures of Example 3 with mixture 8 (M 1.1 -T2C-300- 3002 and M 2.1 -T2C-300-3002).
  • Arrow 4 shows the course of a negative control, here was in the PCR used to generate fragments instead of template H2O. No amplification products were produced in the negative control.
  • the amplification approach was performed with primer mix 2 and corresponding controller oligonucleotides.
  • the BST polymerase was used in 1-to-120-fold dilution of the stock solution.
  • Fig. 27 (B) shows the melting curves belonging to the batches.
  • the derivative of the fluorescence signal and on the X-axis the temperature is plotted.
  • the peaks marked with 1 -3 are among the mixtures which at the start of the reaction mixture 8 (M 1.1 -T2C-300-3002 and M 2.1 -T2C-300-3002) in 600-fold, 6000-fold and 60000-fold dilution contained.
  • the 4 marked curves show no product peak and belong to the negative control.
  • Fig. 28 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • the mixtures contained 600 times (PfeiM), 6000 times (arrow 2) and 60,000 times (arrow 3) diluted mixtures from example 3 with mixture 7 (M 1.1 -T2C-300- 3001 and M 2.1 -T2C- 300-3001).
  • Arrow 4 shows the course of a negative control, here was used in the PCR for the generation of fragments instead of template H2O. No amplification products were produced in the negative control.
  • the amplification approach was performed with primer mix 1 and corresponding controller oligonucleotides.
  • the BST polymerase was used in 1-to-120-fold dilution of the stock solution
  • Fig. 28 (B) shows the melting curves belonging to the batches. On the Y-axis derivative of the fluorescence signal and on the X-axis temperature is plotted. There is a peak that indicates that a single amplification product has formed. In this case, the peaks marked with 1 -3 are among the mixtures at the start of the reaction mixture 7 (M 1.1 -T2C-300-3001 and M 2.1 -T2C-300-3001) in 600-fold, 6000-fold and 60000-fold dilution contained. The 4 marked curves show no product peak and belong to the negative control.
  • Fig. 29 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted.
  • the increase in the fluorescence signal indicates that amplification products have formed.
  • the reactions contained 600 times (PfeiM) at the start of the reaction, 6000 times (Pfeil 2) and 60000-fold (arrow 3) diluted mixtures of Example 3 with mixture 8 (M 1.1 -T2C-300- 3002 and M 2.1 -T2C-300-3002).
  • Arrow 4 shows the course of a negative control, here was used in the PCR for generating fragments in place of template HO. No amplification products were produced in the negative control.
  • the amplification approach was performed with primer mix 1 and corresponding controller oligonucleotides.
  • the BST polymerase was used in 1-to-120-fold dilution of the stock solution.
  • Fig. 29 (B) shows the melting curves associated with the batches.
  • the derivative of the fluorescence signal and on the X-axis the temperature is plotted.
  • the peaks marked with 1 -3 are among the mixtures which at the start of the reaction mixture 8 (M 1.1 -T2C-300-3002 and M 2.1 -T2C-300-3002) in 600-fold, 6000-fold and 60000-fold dilution contained.
  • the 4 marked curves show no product peak and belong to the negative control.
  • Fig. 30 shows the influence of the amount of polymerase used on the course of the reaction.
  • Fig. 30 (A) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • the mixtures contained 600 times (PfeiM) diluted mixtures from Example 3 with mixture 8 (M 1.1 -T2C-300-3002 and M 2.1 -T2C-300-3002).
  • Arrow 2 shows the course of a negative control, here was used in the PCR for generating fragments instead of template H O. No amplification products were produced in the negative control.
  • the amplification approach was performed with primer mix 2 and corresponding controller oligonucleotides.
  • the BST polymerase was used at 1 to 1200-fold dilution of the stock solution.
  • Fig. 30 (B) shows a typical course of the EvaGreen fluorescence signal in the course of the amplification reaction.
  • On the Y-axis is the change of the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. The increase in the fluorescence signal indicates that amplification products have formed.
  • the mixtures contained 600 times (PfeiM) diluted mixtures from Example 3 with mixture 8 (M 1.1 -T2C-300-3002 and M 2.1 -T2C-300-3002).
  • Arrow 2 shows the course of a negative control, here was used in the PCR for generating fragments instead of template H O. No amplification products were produced in the negative control.
  • the amplification approach was performed with primer mix 2 and corresponding controller oligonucleotides.
  • the BST polymerase was used at 1 to 120-fold dilution of the stock solution.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé d'amplification d'un acide nucléique par polymérase d'acide nucléique par l'intermédiaire de deux amorces, lesquelles présentent chacune un segment de séquence qui se lie à la séquence cible et un segment de séquence qui ne se lie pas à ladite séquence cible, le second ne pouvant servir de matrice pour la polymérase, et deux oligonucléotides régulateurs, lesquels sont chacun complémentaires des amorces et d'une partie du segment de séquence synthétisé par elles et interviennent lors du détachement du brin synthétisé de la matrice. Les régulateurs comprennent également des motifs nucléotides modifiés de manière à ne pas pouvoir servir de matrice pour l'activité de la première polymérase d'acide nucléique dépendant de la matrice.
EP19710329.4A 2018-02-28 2019-02-28 Procédé d'amplification d'un acide nucléique à spécificité améliorée Withdrawn EP3759246A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP18159155 2018-02-28
PCT/EP2019/055060 WO2019166586A1 (fr) 2018-02-28 2019-02-28 Procédé d'amplification d'un acide nucléique à spécificité améliorée

Publications (1)

Publication Number Publication Date
EP3759246A1 true EP3759246A1 (fr) 2021-01-06

Family

ID=61526595

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19710329.4A Withdrawn EP3759246A1 (fr) 2018-02-28 2019-02-28 Procédé d'amplification d'un acide nucléique à spécificité améliorée

Country Status (3)

Country Link
US (1) US20210071244A1 (fr)
EP (1) EP3759246A1 (fr)
WO (1) WO2019166586A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112708662B (zh) * 2020-12-28 2021-08-31 阅尔基因技术（苏州）有限公司 抑制生物dna样本中非目标区域的核苷酸组合物及其应用

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040091923A1 (en) * 1993-07-23 2004-05-13 Bio-Rad Laboratories, Inc. Linked linear amplification of nucleic acids
US5882857A (en) * 1995-06-07 1999-03-16 Behringwerke Ag Internal positive controls for nucleic acid amplification
WO2002018616A1 (fr) * 2000-09-01 2002-03-07 Hitachi Chemical Co., Ltd. Ajustement du rendement d'amplification d'une matrice d'acide nucleique par pcr attenuee a l'aide d'oligonucleotides matrices-genocopies
ES2460896T3 (es) * 2007-10-04 2014-05-14 Commonwealth Scientific And Industrial Research Organisation Amplificación de ácido nucleico
AU2011319755B2 (en) * 2010-10-27 2017-02-23 President And Fellows Of Harvard College Compositions of toehold primer duplexes and methods of use
CA2971006C (fr) * 2014-12-15 2024-05-21 Cepheid Amplification d'acides nucleiques superieure a 2 sur une base exponentielle

Also Published As

Publication number Publication date
US20210071244A1 (en) 2021-03-11
WO2019166586A1 (fr) 2019-09-06

Similar Documents

Publication Publication Date Title
EP3504338B1 (fr) Procede d'amplification d'acides nucleiques et utilisation d'un kit d'execution
DE60116651T2 (de) Methode zur amplifizierung und möglicher charakterisierung von nukleinsäuren
DE60009323T2 (de) Methoden und zusammensetzungen zur linearen isothermalen amplifikation von polynukleotidsequenzen
DE69119083T2 (de) Direkte klonierung von pcr amplifizierten nukleinsäuren
DE69829328T2 (de) Strangverdrängungsamplifikation von RNA
JP2703183B2 (ja) 複数標的の同時増幅
JP3867926B2 (ja) 核酸の増幅法
DE60023480T2 (de) Amplifikation und sequenzierung von primer-paaren und deren verwendung
WO2019162529A1 (fr) Procédé pour réaction d'allongement d'amorce avec une meilleure spécificité
EP3759246A1 (fr) Procédé d'amplification d'un acide nucléique à spécificité améliorée
WO2019162487A1 (fr) Procédé d'amplification sélective d'acides nucléiques et kit pour mettre en oeuvre ce procédé
EP3530755B1 (fr) Procédé d'affichage du progrès de l'amplification d'acides nucléiques et kit de mise en uvre dudit procédé
EP2002015B1 (fr) Mélange d'enzymes à inhibition réversible
DE102018001586A1 (de) Verfahren zur Detektion der Amplifikation einer Nukleinsäure mit verbesserter Spezifität
DE102018001639A1 (de) Verfahren zur Primer-Verlängerungsreaktion mit verbesserter Spezifität
EP3759248A1 (fr) Procédé pour l'amplification d'un acide nucléique avec spécificité améliorée
US20190284596A1 (en) Stoichiometric nucleic acid purification using randomer capture probe libraries
DE102005048503B4 (de) Verfahren zur Steuerung der abschnittsweisen enzymatischen Nukleinsäurevervielfältigung über inkomplette Komplementärstränge
EP3530753A1 (fr) Procédé de réaction d'extension des amorces à spécificité améliorée
DE102004001582A1 (de) Verfahren zur Herstellung von DNS-Sonden für DNS-Abschnitte mit repetitiven Sequenzen

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20200916

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20230901