Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/88—Lyases (4.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
  • C12P7/44—Polycarboxylic acids
  • C12P7/48—Tricarboxylic acids, e.g. citric acid
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P7/00—Preparation of oxygen-containing organic compounds
  • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
  • C12P7/6436—Fatty acid esters
  • C12P7/6445—Glycerides
  • C12P7/6463—Glycerides obtained from glyceride producing microorganisms, e.g. single cell oil
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y402/00—Carbon-oxygen lyases (4.2)
  • C12Y402/01—Hydro-lyases (4.2.1)
  • C12Y402/01079—2-Methylcitrate dehydratase (4.2.1.79)

Definitions

• the present invention relates to mutant yeasts having high production of lipids and citric acid.
• Some oleaginous microorganisms are capable of converting substrates, such as fats or glycerol, into lipids, especially triglycerides and fatty acids. These oleaginous microorganisms have the capacity to accumulate significant amounts of lipids, at least 20% of their dry matter.
• yeasts there are a few so-called unconventional oleaginous species, among which mention may be made of the genera Candida, Cryptococcus, Lipomyces, Rhodosporidium, Rhodotorula, Trichosporon or Yarrowia (see for reviews Beopoulos et al., 2009a, Papanikolaou et al. al, 201 la and 2011b).
• Yarrowia lipolytica is a hemiascomycete yeast. It is considered as a model of bioconversion for the production of proteins, enzymes and lipid derivatives (see for review Nicaud, 2012). It is naturally present in polluted environments of oil and especially in the heavy fractions, which testifies of its potential of degradation of the organic substrates. This yeast has already been successfully tested for its ability to degrade organic substrates such as naphthalene, dibenzofuran and trinitrotoluene (see for review: Thevenieau et al, 2009a and 2009b, Beopoulos et al., 2009b and 2009c).
• Y. lipolytica is one of the most studied oleaginous yeasts because of not only its ability to accumulate lipids up to more than 50% o of its dry matter according to a defined culture profile, but also its unique ability to accumulate linoleic acid at high levels (more than 50% of the fatty acids produced) as well as high value added lipids, such as stearic acid, palmitic acid and oleic acid, in proportions similar to those found in cocoa butter (Papanikolaou et al, 2001, Papanikolaou et al, 2010).
• Y. lipolytica can be efficiently cultured on a wide variety of hydrophobic compounds (free fatty acids, triacylglycerols, n-alkanes, etc.), thanks to the expression of multigene families encoding key enzymes involved in the decomposition of these compounds (for example, acyl-CoA oxidases, lipases).
• the uptake of these lipid substrates may result in a modification of the fatty acid composition of both the residual substrate and the accumulated fat, sometimes resulting in the synthesis of lipids with interesting properties (Papanikolaou et al, 2001; Beopoulos et al. , 2009a, Papanikolaou et al, 2010, 201 la and 2011b).
• lipids in Y. lipolytica is carried out either by the de novo biosynthesis of fatty acids via the production of fatty acid precursors such as acetyl-CoA and malonyl-CoA and their integration into the lipid biosynthesis pathway. (Kennedy's way), either by the ex novo accumulation, via the incorporation of the pre-existing fatty acids into the fermentation medium or deriving from the hydrolysis of the oils, fats, triglycerides and methyl esters of the culture medium and their accumulation inside the cell.
• the main pathways of de novo bio synthesis of lipids in Y. lipolytica and Saccharomyces cerevisiae S. cerevisiae; so-called non-oleaginous yeast
• ⁇ -oxidation is a pathway of fatty acid degradation that occurs mainly in peroxisomes (whose biogenesis is controlled by the PEX genes). This pathway allows the formation of acetyl-CoA from even-chain fatty acids and propionyl-CoA from odd-chain fatty acids.
• the ⁇ -oxidation comprises four successive reactions during which the carbon chain of the acyl-CoA is reduced by two carbon atoms. Once the reaction has been performed, the reduced acyl-CoA of two carbons can return to the spiral of ⁇ -oxidation (Lynen's helix) and undergo a further reduction of two carbons.
• decarboxylation cycles may be interrupted depending on the nature of Facyl-CoA, the availability of substrate, the presence of coenzyme A, acetyl-CoA or the NAD + / NADH ratio.
• TAG triacylglycerol fatty acids
• the active form of acyl-CoA formed is oxidized by a molecule of Flavin Adenine Dinucleotide (F AD) to form a trans-A 2 -enoyl-CoA molecule by means of an acyl-CoA oxidase (AOX).
• F AD Flavin Adenine Dinucleotide
• AOX acyl-CoA oxidase
• lipolytica has been widely described (Wang et al, 1999a, Lickova et al., 2004).
• acyl-CoA oxidases in Y. lipolytica, encoded by the POX1 to 6 genes, which have different substrate specificities (Wang et al, 1999a and 1999b, Luo et al, 2000 and 2002).
• the trans- ⁇ 2 - Enoyl-CoA is then hydrated with 2-enoyl-CoA hydratase.
• the formed 3-hydroxyacyl CoA molecule is oxidized by NAD + to form a 3-ketoacyl-CoA molecule.
• lipolytica generally a limitation in nitrogen or phosphate (Papanikolaou and Aggelis, 2009, Papanikolaou et al, 2011a ).
• SCO lipids
• nitrogen deficiency must be imposed only.
• C carbon
• N nitrogen
• lipolytica cell growth is carried out on substrates based on glycerol or sugar ("oses"), it is capable of either producing in large quantities only intra-cellular fats (Tsigie et al, 2011, Fontanille et al, 2012) to produce only citric acid without accumulating significant amounts of cellular lipids (Anastassiadis et al, 2002, Papanikolaou et al, 2002 and 2008, Tai and Stephanopoulos, 2013). It has been reported that according to the culture conditions, Y.
• lipolytica can simultaneously produce citric acid (-50 g / L) and lipids (-32% of its dry matter) (André et al, 2009), or sequentially produce cellular lipids and citric acid (Makri et al, 2010).
• the biosynthetic pathway involved in limiting nitrogen to the oleaginous yeast culture medium for the production of lipids is known (see review by Beopoulos et al, 2009a).
• the limitation of active nitrogen to deaminase which results in a decrease in the concentration of AMP (adenosine monophosphate) in the mitochondria.
• This decrease in AMP concentration inhibits the enzyme isocitrate dehydrogenase, which catalyzes the conversion of isocitrate to ⁇ -ketoglutarate ( ⁇ -KG).
• Aconitase catalyzes the isomerization of isocitrate to citrate in mitrochondria.
• the citrate then exits mitochondria and is converted to acetyl-CoA and oxaloacetate by ATP-citrate in the cytosol.
• Acetyl-CoA accumulated in large quantities in the cytosol allows the synthesis of fatty acid also in large quantities.
• Mutant Y. lipolytica strains capable of producing higher amounts of lipid or citric acid than wild-type strains were obtained.
• Rywiiiska et al. (2009) obtained mutant strains of Y. lipolytica acetate negative (ace " unable to grow on acetate as sole source of carbon and energy) able to bio-convert, in batch fermentation, glycerol (used as a substrate) citric acid more efficiently than the wild strain they derive from, Tai et al. (2012) obtained a genetically modified strain of Y.
• DGA1 diacylglycerol acyltransferase
• ACC1 acetyl-CoA carboxylase
• a genetically modified Yarrowia lipolytica yeast strain whose PHD1 gene (present on chromosome F, YALI0F02497g) coding for 2-methylcitrate dehydratase has been deleted, and grown on glycerol, not only exhibits slowed consumption of glycerol, but also increased production of lipids and citric acid, compared to the Yarrowia lipolytica W29 yeast strain of wild type from which it derives.
• 2-methylcitrate dehydratase (nomenclature EC 4.2.1.79) is a mitochondrial protein that catalyzes the conversion of 2-methylcitrate to 2-methyl-cis-aconitate in the 2-methylcitrate cycle of propionate metabolism (Uchiyama et al. , 1982).
• 2-methylcitrate dehydratase is a 520 amino acid protein encoded by the PHD1 gene (YALI0F02497g).
• the amino acid sequence of Y. lipolytica CLIB122 2-methyl citrate dehydratase is available under accession number G1: 50554999 (or GI: 49650778) in the GENBANK database, and represented by the sequence SEQ ID NO 1.
• the nucleotide sequence of the cDNA encoding this 2-methylcitrate dehydratase is available under access number GI: 50554998 in the GENBANK database.
• the inventors have determined that the amino acid sequence of Yarrowia lipolytica 2-methylcitrate dehydratase (SEQ ID NO: 1) has at least 55% identity and at least 70% similarity with the 2-methylcitrate dehydratases of hemiascomycetes.
• lactis available under access number KLLA0E14213p in the Genoîevures database 59% identity and 74% similarity to that of Remothecium gossypii available under accession number ERGO0G08404p in the Genoîevures database, 61% of identity and 72% similarity to that of Candida glabrata available under access number CAGL0L09108p in the Genoîevures database, 67% identity and 78% »similarity to that of Pichia sorbitophila available under accession number PISO0A12716p in the Genoîevures database, and 67% identity and 79% similarity to that of Pichia sorbitophila available under access number PISO0B12783p in the Genoîevures database.
• the inventors have also determined that the amino acid sequence of Yarrowia lipolytica 2-methylcitrate dehydratase (SEQ ID NO: 1) has at least 85% identity and at least 90% similarity with 2-methylcitrate dehydratases.
• Candida strains of the same clade as that of Y. lipolytica in particular 98.7% identity and 99.6% similarity with that of the CBS9722 strain of C gallium, 97.9% identity and 99, 4% similarity with that of C, yahushimensis strain CBS10253, 96.5% identity and 98.1% similarity with that of C. phangngensis strain CBS 10407, 95.6% identity and 98 , 5% similarity to that of C.
• the subject of the present invention is therefore a mutant yeast strain, characterized in that the expression or the activity of the endogenous 2-methylcitrate dehydratase (EC 4.2.1.79) of said strain is inhibited and that in addition the expression or the activity of acyl-coenzyme A oxidases (EC 6.2.1.3), the multifunctional protein of beta-oxidation (EC 4.2.1.74), 3-oxoacyl-coenzyme A thiolase (EC 2.3.1.16), one or more proteins encoded by a PEX gene involved in the metabolism of yeast peroxisomes (preferably peroxin 10), one or more triacylglycerol lipases (EC 3.1.1.3) and / or glycerol-3-phosphate dehydrogenase ( EC 1.1.99.5) endogenous of said strain is inhibited, and / or one or more endogenous gene genes (all genes) encoding a glycerol-3-phosphate dehydrogenase (NAD (+)) (EC 1.1.1
• the present invention includes all yeast strains and in particular yeast strains belonging to the genera Candida, Cryptococcus, Hansenula, Kluyveromyces, Lipomyces, Pichia, Rhodosporidium, Rhodotorula, Saccharomyces, Schizzosaccharomyces, Trichosporon or Yarrowia.
• said yeast strain is an oleaginous yeast strain.
• Oleaginous yeast strains are well known to those skilled in the art. They have the capacity to accumulate significant amounts of lipids, at least 20% of their dry matter (see Ratledge, 1994). They generally belong to the genus Candida, Cryptococcus, Lipomyces, Rhodosporidium (e.g., Rhodosporidium toruloides), Rhodotorula (e.g., Rhodotura glutinis), Trichosporon or Yarrowia.
• said mutant yeast strain is auxotrophic for leucine (Leu " ) and optionally for Porotidine-5'-phosphate decarboxylase (Ura " ),
• 2-methylcitrate dehydratase an enzyme (EC 4.2.1.79) which catalyzes the conversion of 2-methyl-citrate to 2-methyl-cis-aconitate and which has at least 55% identity, and in ascending order preferably at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, or 70% similarity, and in ascending order preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, 99% or 100% of similarity with the SEQ ID NO: 1 acid sequence, when the sequences are aligned along their entire length.
• said 2-methylcitrate dehydratase comprises a prpD region (corresponding to the domain PR 09425 in the CDD database; Marchler-Bauer et al., 201 1) having the consensus sequence SEQ ID NO: 8 (corresponding to amino acids 37 to 517 of the sequence SEQ ID NO: 1).
• the POX1, POX2, POX3, POX4, POX5 and POX6 genes encode 6 isoforms of acyl-coenzymeA oxidase (AOX, EC 6.2.1.3) involved, less partially, in the ⁇ -oxidation of fatty acids. Inhibition, partial or total, of the expression or the activity of these isoenzymes leads to the increase of the lipid accumulation due to the absence of consumption of synthesized lipids. More particularly, the coding sequence of the POX1 to POX6 genes and the peptide sequence of AOX1 to AOX6 of Y.
• AOX5 YALIOC23859g / YALIOC23859p
• POX6 I AOX6 YALI0E06567g / YALI0E06567p.
• the peptide sequences of Y. lipolytica acyl-CoA oxidases have 45% identity or 50% similarity with those of other yeasts. The degree of identity between the acyl-CoA oxidases varies from 55 to 70% (or 65 to 76% similarity) (International Application WO 2006/064131).
• a method of inhibiting endogenous AOX expression in a Y. lipolytica strain has been described in International Applications WO 2006/064131, WO 2010/004141 and WO 2012/001144.
• the multifunctional protein of beta-oxidation has three domains: two domains with 3-hydroxyacyl-CoA dehydrogenase activity (EC 4.2.1.74, domains A and B) and one domain with enoyl-CoA hydratase activity (EC 4.2.1.17, domain C),
• This enzyme is encoded by the gene MFE1 ("Multifunctional enzyme type 1") (Haddouche et al, 2011). More particularly, the coding sequence of the MFE1 gene and the peptide sequence of Y. lipolytica CLIB122 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase are available in Genolevures or GenBank databases under the access number or the name. next: YALI0E 15378g / YALI0E 15378p. A method of inhibiting the expression of said endogenous multifunctional protein in a Y. lipolytica strain has been described by Haddouche et al. (2011).
• 3-oxoacyl-coenzyme A thiolase (EC 2.3.1.16) is encoded by the gene POT1 ("Peroxisomal Oxoacyl Thiolase 1") (Berninger et al, 1993). More particularly, the coding sequence of the POT1 gene and the peptide sequence of the 3-oxoacyl-CoA thiolase of Y. lipolytica CLIB122 are available in the Genolevures or GenBank databases under the accession number or the following name: YALI018568g / YALI018568p . A method of inhibiting the expression of endogenous 3-oxoacyl-coenzyme A thiolase in a Y. lipolytica strain has been described by Berninger et al (1993).
• the PEX genes involved in the metabolism of peroxisomes in yeasts, in particular in Y. lipolytica are described in Table 1 below.
• the coding sequence PEX genes are available in Genolevures or GenBank databases. It has been described in International Application WO 2006/064131 and by Thevenieau et al. (2007) that when the peroxisome is not properly assembled or when it is not functional, the fatty acids are not properly degraded.
• the endogenous expression or activity of peroxin (encoded by the PEX10 gene) of said strain is inhibited.
• PEX23 PEX30 YLR324w YALI0D273O2g Integral peroxisomal peroxin membrane
• PEX32 YBR168w
• triacylglycerol lipases (EC 3.1.1.3) are encoded by TGL genes (Beopoulos et al, 2009 and 2012).
• the expression or the activity of the lipase triacylglycerol encoded by the TGL3 gene and / or the lipase triacylglycerol encoded by the TGL4 gene, preferably of the lipase triacylglycerol encoded by the TGL4 gene is inhibited.
• lipolytica CLIB122 are available in the Genolevures or GenBank databases under the accession number or the following name: YALIOD 17534g / YALIOD 17534p .
• the coding sequence of the TGL4 gene and the peptide sequence of the lipase triacylglycerol encoded by the TGL4 gene of Y. lipolytica CLIB122 are available in the Génolevures or GenBank databases under the accession number or the following name: YALIOF1001Og / YALI0F10010p.
• a method of inhibiting the expression of an endogenous triacylglycerol lipase in a strain of Y. lipolytica has been described in International Application WO 2012/001144 and by Dulermo et al. (2013).
• glycerol 3-phosphate dehydrogenase (EC 1.1.99.5) is encoded by the GUT2 gene (Beopoulos et al., 2008). More particularly, the GUT2 gene encodes the Gut2p isoform of glycerol-3-phosphate dehydrogenase, which catalyzes the glycerol-3-phosphate oxidation reaction to DHAP ("glycerol dehydratase-reactivation factor") (Beopoulos et al, 2008). ). The coding sequence of the GUT2 gene and the peptide sequence of the glycerol 3-phosphate dehydrogenase of Y.
• lipolytica CLIB122 are available in the Genolevures or GenBank databases under the accession number or the following name: YALI0B 13970g / YALI0B 13970p.
• a method of inhibiting the expression of said endogenous glycerol 3-phosphate dehydrogenase in a strain of Y. lipolytica has been described in International Applications WO 2010/004141 and WO 2012/001 144 and by Beopoulos et al (2008).
• glycerol-3-phosphate dehydrogenase (EC 1.1.1.18) is encoded by the GPD1 gene (Dulermo et al., 201 1). More particularly, the coding sequence of the GPD1 gene and the peptide sequence of the glycerol-3-phosphate dehydrogenase (NAD (+)) of Y. lipolytica CLIB122 are available in Génolevures or GenBank databases under the accession number or the following name: YALI0B02948g / YALI0B02948p. A method of overexpressing endogenous glycerol-3-phosphate dehydrogenase (NAD (+)) in a Y. lipolytica strain has been described in International Application WO 2012/001144.
• acetyl-CoA carboxylase (EC 6.4.1.2) is encoded by the ACC1 gene (Tai et al, 2012, Beopoulos et al, 2012). More particularly, the coding sequence of the ACC1 gene and the peptide sequence of acetyl-CoA carboxylase of Y. lipolytica CLIB122 are available in the Génolevures or GenBank databases under the accession number or the following name: YALI0C11407g / YALI0C11407p. A method of overexpressing endogenous acetyl-CoA carboxylase in a Y. lipolytica strain has been described by Thai et al (2012).
• acyl-CoA diacylglycerol acyltransferases
• DGAT EC 2.3.1.20
• DGA1 and DGA2 are coded by two genes: DGA1 and DGA2 (Beopoulos et al, 2009 and 2012, Tai et al, 2012, International Application WO 2012/001144).
• DGA1 and DGA2 are coded by two genes: DGA1 and DGA2 (Beopoulos et al, 2009 and 2012, Tai et al, 2012, International Application WO 2012/001144).
• the coding sequence of the gene DGA1 and the peptide sequence of acyl-CoA: diacylglycerol acyltransferases 1 of Y. lipolytica CLIB122 are available in the Genolevures or GenBank databases under the access number or the following name: YALI0E32769g / YALI0E32769p .
• the coding sequence of the DGA2 gene and the peptide sequence of the acyl-CoA: diacylglycerol acyltransferases 2 of Y. lipolytica CLIB122 are available in the Genolevures or GenBank databases under the accession number or the following name: YALI0D07986g / YALI0D07986p.
• an acyl-CoA: diacylglycerol acyl transferase has been described by ani et al (2013).
• a method of overexpressing one or both endogenous DGATs (DGAT1 and / or DGAT2) in a strain of Y. lipolytica has been described by Beopoulos et al (2012) and by Tai et al. (2012).
• the DGA2 gene is overexpressed in the strain according to the invention.
• citrate lyase In yeasts, citrate lyase (E.C. 2.3.3.8) consists of two subunits (A and B) encoded by two genes (ACL1 and ACL2, respectively) (Beopoulos et al, 2009). ATP citrate lyase from certain oleaginous yeasts has been characterized by Boulton et al (1981). More particularly, the coding sequence of the ACL1 and ACL2 genes and the peptide sequence of Y. lipolytica CLIB122 ⁇ citrateasease subunits A and B are available in Genolevures or GenBank databases under access numbers or names.
• ACL1 I subunit A YALI0E34793g / YALI0E347939p
• ACL2 I subunit B YALI0D24431g / YALI0D24431p.
• the malic enzyme (EC 1.1.1.40) is encoded by the MAE1 gene (Beopoulos et al, 2009a). More particularly, the coding sequence of the MAE1 gene and the Peptide sequence of the Y. lipolytica CLIB122 malic enzyme is available in Genolevures or GenBank databases under the accession number or the following name: YALI0E18634g / YALI0E18634p. A method of overexpressing the endogenous malic enzyme in a strain of Y. lipolytica has been described by Zhang et al. (2013).
• PDAT phospholipiddiacylglycerol acyltransferase
• LRO1 encoded by the LRO1 gene, is an enzyme capable of catalyzing the formation of triacylglycerol from 1, 2-i7z-diacylglycerol (Beopoulos et al, 2009 and 2012). More particularly, the coding sequence of the LRO1 gene and the peptide sequence of the phospholipid: diacylglycerol acyltransferase of Y. lipolytica CLIB122 are available in the Genolevures or GenBank databases under the accession number or the following name: YALI0E16797g / YALI0E16797p. A method of overexpressing endogenous phospholipid: diacylglycerol acyltransferase in a strain of Y. lipolytica has been described by Beopoulos et al. (2012).
• acetate-CoA ligase In yeasts, acetate-CoA ligase, acetyl-CoA synthetase (EC 6.2.1.1), acyl-CoA synthetase and coumarate-CoA ligases (EC 6.2.1.12) are proteins belonging to the Génolevure GL3C0072 family.
• Acetyl-CoA synthetase (EC 6.2.1.1) belongs to the Génolevure GL3C0072 family. It is encoded by the ACS2 gene. More particularly, the coding sequence of the ACS2 gene and the peptide sequence of Y. lipolytica CLIB122 acetyl-CoA synthetase are available in the Génolevures or GenBank databases under the accession number or the following name: YALI0F05962g / YALI0F05962p. The overexpression & ACS2 makes it possible to increase the acetyl-CoA pool. A method of overexpressing endogenous acetyl-CoA synthetase in a strain of Y. lipolytica has been described by Zhou et al (2012).
• Delta (9) -desaturase (EC 1.14.19.1) is encoded by the OLEl gene, (Thevenieau and Nicaud, 2013). More particularly, the coding sequence of the OLEl gene and the Peptide sequence of Del ta (9) -desaturas of Y. lipolytica CLIB122 are available in Genolevures or GenBank databases under the accession number or the following name: YALI0C05951g / YALI0C05951p. Overexpression of OLE / enriches the oil produced in C 18: 1 ( n- ).
• Delta (12) -desaturase (EC 1.14.19.6) is encoded by the FAD2 gene
• the coding sequence of the FAD2 gene and the peptide sequence of the Y. lipolytica delta (12) -desaturase CLIB122 are available in the Genolevures or GenBank databases under the access number or the following name: YALI0B10153g / YALI0B10153p .
• Overexpression of FAD2 enriches the oil produced in C18: 2 (n-6) .
• a method of overexpressing Mortierella alpina delta (12) -desaturase in a strain of Y. lipolytica has been reported by Chuang et al. (2009).
• Finvertase In yeasts, Finvertase (EC 3.2.1.26) is encoded by the SUC2 gene (Lazar et al, 2013). More particularly, the coding sequence of the SUC2 gene and the peptide sequence of S. cerevisiae Pinvertase are available in the Uniprot or GenBank databases under the accession number or the following name: P00724 / YIL162W. Overexpression of SUC2 allows the use of pure sucrose and molasses (Lazar et al, 2013). A method of overexpressing endogenous acetyl-CoA synthetase in a strain of S. cerevisiae has been described by Chen et al. (2010).
• An advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of the endogenous 2-methylcitrate dehydratase of said strain.
• the 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia is inhibited, and the ⁇ -xydation of the fatty acids of said strain is also inhibited.
• Inhibition of the ⁇ -oxidation of fatty acids of said strain can be achieved by inhibiting the expression or activity of all endogenous acyl-coenzyme oxidase isoforms of said strain (in particular the 6 acyl-isoforms of coenzymeA oxidase encoded by the POX1 to POX6 genes in the case of Yarrowia) and / or by inhibiting the expression or the activity of the multifunctional protein of the endogenous beta-oxidation of said strain (in particular the multifunctional protein of beta-oxidation).
• the inhibition of ⁇ -oxidation of the fatty acids of said strain is obtained by inhibiting the expression or the activity of all the endogenous acyl-coenzymeA oxidase isoforms of said strain (in particular the 6 isoforms of acyl-coenzymeA oxidase encoded by the genes POXÎ to POX6 in the case of Yarrowia) and / or by inhibiting the expression or the activity of the multifunctional protein of the endogenous beta-oxidation of said strain (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia).
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of the endogenous 2-methylhydrate dehydratase (in particular the 2-methyl citrate dehydratase encoded by the gene PHD1 in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of the endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited.
• Y. lipolytica strain JMY3433 described hereinafter.
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particularly the 2-methylcitrate dehydratase encoded by the gene PHD1 in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of the endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited, and the endogenous genes encoding an acyl-CoA; diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia) and a g
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particularly the 2-methylcitrate dehydratase encoded by the gene PHDÎ in the case of Yarrowia), of one or more endogenous triacylglycerol lipases (in particular lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited , and the endogenous genes encoding an acyl-CoA: diacylglycerol acyl transferase e (in particular the DGA2 gene in the case of Yarrowia), a g
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of the endogenous 2-methyl citrate dehydratase (in particular the 2-methyl citrate dehydratase encoded by the gene PHD1 in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation encoded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited, and the endogenous genes encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a glycerol-3
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particularly the 2-methylcitrate dehydratase encoded by the gene PHD1 in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of the endogenous beta-oxidation (in particular the multifunctional protein of the beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited, and the endogenous genes encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a g
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particularly the 2-methylcitrate dehydratase encoded by the gene PHD1 in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia), the multifunctional protein of the endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation encoded by the MFE1 gene in the case of Yarrowia) and one or more endogenous peroxins, such as peroxin 10 (in particular peroxin 10 encoded by the gene PEX10 in the case of Yarrowia) of said strain is inhibited, and endogenous genes encoding acyl-Co
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particularly the 2-methylcitrate dehydratase encoded by the gene PHDÎ in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of the endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited, and the endogenous genes encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a gly
• Another advantageous strain in the sense of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, preferably of Yarrowia lipolytica, in which the expression or the activity of the endogenous 2-methylcitrate dehydratase (in particular the 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia), of one or more endogenous triacylglycerol lipases (in particular the triacylglycerol lipase encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited, and the endogenous genes encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a gly
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particularly the 2-methylcitrate dehydratase encoded by the gene PHDÎ in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in particular the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of the endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited, and the endogenous genes encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a gly
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of endogenous 2-methylcitrate dehydratase (in particular the 2-methylcitrate dehydratase encoded by the gene PHDI in the case of Yarrowia), of one or more endogenous triacylglycerol lipases (in particular lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) of said strain is inhibited , and the endogenous genes encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a gly
• Another advantageous strain within the meaning of the present invention is a mutant strain of yeast, preferably a mutant strain of Yarrowia, more preferably of Yarrowia lipolytica, in which the expression or the activity of the endogenous 2-methylcitrate dehydratase of said strain is inhibited, expression of the endogenous TGL4 gene of said strain is inhibited and the endogenous GPD1 and ACC1 genes of said strain are overexpressed.
• Inhibition of the expression or activity of an enzyme defined in the present invention may be total or partial. It can be obtained in various ways by methods known in themselves to those skilled in the art.
• this inhibition can be obtained by mutagenesis of the gene encoding said enzyme.
• Mutagenesis of the gene coding for said enzyme may occur at the level of the coding sequence or sequences for regulating the expression of this gene, in particular at the level of the promoter, leading to an inhibition of the transcription or translation of the said enzyme.
• the mutation at the level of the coding sequence is carried out in the sequence coding for the prpD region of 2-methylcitrate dehydratase.
• Mutagenesis of the gene encoding said enzyme can be performed by genetic engineering. For example, it is possible to delete all or part of said gene and / or to insert an exogenous sequence. Methods for deleting or inserting a given genetic sequence into yeast, particularly Y, lipolytica, are well known to those skilled in the art (see review Madzak et al., 2004). By way of example, it is possible to use the method called POP ⁇ / POP OUT which has been used in yeasts, particularly in Y. lipolytica, for the deletion of the LEU2, URA3 and XPR2 genes (Barth et al. Gaillardin, 1996).
• a very advantageous method according to the present invention consists in replacing the coding sequence of the gene coding for the said enzyme with an expression cassette containing the sequence of a gene coding for a selection marker (eg, the URA3 gene [YALI0E26719g] coding for orotidine-5'-phosphate decarboxylase). It is also possible to introduce one or more point mutations in the gene coding for said enzyme, having the consequence of shifting the reading frame and / or of introducing a stop codon into the sequence and / or of inhibiting transcription or translation. of the gene encoding said enzyme.
• a selection marker eg, the URA3 gene [YALI0E26719g] coding for orotidine-5'-phosphate decarboxylase.
• Mutagenesis of the gene coding for said enzyme can also be carried out using physical agents (for example radiation) or chemical agents. This mutagenesis also makes it possible to introduce one or more point mutations in the gene encoding said enzyme.
• selection markers for the complementation of an auxotrophy also commonly referred to as auxotrophy markers, are well known to those skilled in the art.
• the selection marker URA3 is well known to those skilled in the art. More specifically, a yeast strain whose URA3 gene (sequence available in Genolevures databases under the name YALI0E26741g or UniProt under access number Q12724), coding for orotidine-5'-phosphate decarboxylase, is inactivated (for example by deletion), will not be able to grow on a medium not supplemented with uracil.
• the integration of the selection marker URA3 in this yeast strain will then restore the growth of this strain on a medium lacking uracil.
• the selection marker LEU2 described in particular in US Pat. No. 4,937,189 is also well known to those skilled in the art. More specifically, a yeast strain whose LEU2 gene (YALI0C00407g), encoding ⁇ -isopropylmate dehydrogenase e, is inactivated (for example by deletion), will not be able to grow on a medium not supplemented with leucine. As before, the integration of the selection marker LEU2 into this yeast strain will then restore the growth of this yeast. strain on a medium not supplemented with leucine.
• the ADE2 selection marker is also well known to those skilled in the field of yeast transformation.
• a yeast strain whose ADE2 gene (YALI0B23188g), coding for phosphoribosylaminoimidazole carboxylase, is inactivated (for example by deionization), will not be able to grow on a medium not supplemented with adenine.
• the integration of the selection marker ADE2 in this yeast strain will then restore the growth of this strain on a medium not supplemented with adenine.
• Y. lipolytica strains auxotrophic Leu "Ura” were described by Barth and Gaillardin, 1996.
• Y. lipolytica strain auxotrophic Leu "Ura” Ade “have been described in particular in application WO 2009/098263.
• the subject of the present invention is also a process for obtaining a mutant yeast strain according to the present invention from a parent yeast strain, comprising a step of mutagenesis of the gene coding for 2-methylcitrate dehydratase as defined. above in said parent yeast strain, and furthermore one or more mutagenesis steps in said parent yeast strain leading to the inhibition of one or more of the endogenous genes encoding acyl-coenzyme A oxidases (EC 6.2.1.3 ), the multi-functional protein of beta-oxidation (EC 4.2.1.74), 3-oxoacyl-coenzyme A thiolase (EC 2.3.1.16), the proteins encoded by the PEX genes involved in the metabolism of yeast peroxisomes (from preferably peroxin 10), lipases triacylglycerol (EC 3.1.1.3) and / or glycerol 3-phosphate dehydrogenase (EC 1.1.99.5) (in particular the genes POX1 to POX6, MFE1, POT1, PEX, PEX
• said method comprises:
• the inhibition of ⁇ -oxidation of the fatty acids of said strain can be carried out as described above; or
• mutagenesis steps leading to the inhibition of endogenous genes of said strain coding for 2-methylcitrate dehydratase (in particular 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia), one or more triacylglycerol lipases (in particularly the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia), the multifunctional protein of beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia) and one or more peroxins such as peroxin (in particular peroxin encoded by the PEX10 gene in the case of Yarrowia), and mutagenesis steps leading to overexpression of one or more of the endogenous genes of said acyl-encoding strain.
• 2-methylcitrate dehydratase in particular 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia
• CoA diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a glycerol-3-phosphate dehydrogenase (NAD (+)) (in particular the gene GPD1 in the case of Yarrowia) and ATP citrate lyase (in particular the ACL1 and ACL2 genes in the case of Yarrowia); or
• steps of mutagenesis leading to the inhibition of the endogenous genes of said strain coding for 2-methylcitrate dehydratase (in particular the 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia), one or more triacylglycerol lipases (in particular the triacylglycerol lipase encoded by the TGL4 gene in the case of Yarrowia) the multifunctional protein of beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia), and steps of mutagenesis leading to the overexpression of one or more of the endogenous genes of the said strain encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a glycerol-3-phosphate dehydrogenase (NAD (+) ) (in particular the GPD1 gene in the case
• mutagenesis steps leading to the inhibition of endogenous genes of said strain coding for 2-methylcitrate dehydratase (in particular 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia), one or more triacylglycerol lipases (in particular the triacylglycerol lipase encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia), and steps of mutagenesis leading to the overexpression of one or more of the endogenous genes of the said strain encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a glycerol-3-phosphate dehydrogenase (NAD (+) ) (in particular the GPD1 gene in the case of
• mutagenesis steps leading to the inhibition of the endogenous genes of said strain coding for 2-methylcitrate dehydratase (in particular the 2-methylcitrate dehydratase encoded by the PHD1 gene in the case of Yarrowia), one or more endogenous triacylglycerol lipases (in especially the lipase triacylglycerol encoded by the TGL4 gene in the case of Yarrowia) and the multifunctional protein of endogenous beta-oxidation (in particular the multifunctional protein of beta-oxidation coded by the MFE1 gene in the case of Yarrowia), and mutagenesis steps leading to the overexpression of one or more of the endogenous genes of the said strain encoding an acyl-CoA: diacylglycerol acyltransferase (in particular the DGA2 gene in the case of Yarrowia), a glycerol-3-phosphate dehydrogenase (NAD (+)) (NAD (+)) (
• Inhibition and / or overexpression of endogenous genes can be performed by genetic engineering.
• Said parent yeast strain may be a yeast strain of wild-type (e.g., strain Y. lipolytica W29) or mutant (e.g., strain Y. lipolytica Po d).
• the mutagenesis step comprises the deletion of the coding sequence of the gene coding for a given enzyme (eg, 2-methylcitrate dehydratase) and optionally the replacement of this coding sequence by a sequence exogenous, such as, for example, the sequence of a gene encoding a selectable marker (eg, the URA3 gene).
• a given enzyme eg, 2-methylcitrate dehydratase
• a sequence exogenous such as, for example, the sequence of a gene encoding a selectable marker (eg, the URA3 gene).
• the present invention also relates to a process for increasing the production of lipids and / or citric acid of a yeast strain, characterized in that the expression or the activity of the yeast strain is inhibited in said yeast strain.
• 2-methylcitrate dehydratase 2-methylcitrate dehydratase.
• the method for increasing the production of lipids further comprises the inhibition in said yeast strain of the expression of one or more of the endogenous genes encoding acyl-coenzyme A oxidases (EC 6.2.1.3 ), the multifunctional protein of beta-oxidation (EC 4.2.1.74), the 3-oxoacyl-co enzyme A thiolase (EC 2.3.1.16), the proteins encoded by the PEX genes involved in the metabolism of yeast peroxisomes, in particular peroxin 10, triacylglycerol lipases (EC 3.1.1.3) and / or glycerol 3-phosphate dehydrogenase (EC 1.1.99.5) (in particular the POX1 to POX6, MFE1, POT1, PEX, TGL3, TGL4 and GUT2 genes in the case of Yarrowia) and / or overexpression in said yeast strain of one or more of the endogenous genes encoding a glycerol-3-phosphate dehydrogenase (NAD (+)) (
• the present invention also relates to the use of a mutant yeast strain whose expression or the activity of endogenous 2-methylcitrate dehydratase (EC 4.2.1.79) of said strain is inhibited for the production of lipids and / or or citric acid.
• a mutant yeast strain according to the present invention as defined above is used for the production of lipids and / or citric acid.
• Lipid production may be favored over citric acid production when the mutant strain of yeast according to the present invention is grown by controlling the value of the ratio between the rate of carbon consumption and the rate of nitrogen consumption, as described in International Application WO 2010/076432. Lipid production can also be favored over citric acid production using a mutant strain according to the present invention overexpressing the genes encoding ATP citrate lyase, ACC (acetyl-coA carboxylase), DGA1 (diacylglycerol). acyltransferase 1) and / or DGA2 (diacylglycerol acyltransferase 2). Methods for promoting lipid accumulation are also described by Beopoulos et al. (2009).
• the present invention also relates to a method for producing lipids and / or citric acid, comprising a step of culturing a mutant strain of yeast whose expression or the activity of 2-methylcitrate dehydratase (EC 4.2 .1.79) endogenous of said strain is inhibited on a suitable medium.
• the process for producing lipids and / or citric acid comprising a step of culturing a mutant yeast strain according to the present invention as defined above on a suitable medium.
• the medium contains glucose and / or glycerol as a carbon source, preferably the medium contains as glycerol carbon source only.
• Glycerol can be crude or pure.
• said medium is not deficient in nitrogen.
• lipids can be favored over the production of citric acid as indicated above.
• Figure 1 Kinetics of ammonium ion (A) consumption, biomass production (B), glycerol consumption (C) and total citric acid (D) production during growth of strains of Yarrowia lipolytica W29 and JMY1203 grown on a medium containing glycerol (Glol) limited in nitrogen.
• Figure 2 Kinetics of total lipids in dry biomass (%, w / w) during growth of strains of Yarrowia lipolytica W29 (A) and JMY1203 (B) in a nitrogen-limited glycerol-based medium.
• Figure 3 Schematic representation of the construction of mutant strains according to the invention.
• FIG. 4 Visualization of lipid accumulation by BodiPy staining of lipid bodies produced by strains JMY3776 and JMY4209.
• Figure 5 followsed by different parameters (growth, glycerol consumption, production of citrate, mannitol and fatty acids) during the growth of strains JMY2900, JMY3776 and JMY4079 in Glol 6% and Glol9%.
• EXAMPLE PRODUCTION AND CHARACTERIZATION OF MUTANT STRAINS OF YARROWIA LIPOLYTICA YEAST IN WHICH AT LEAST
• the mutant strains of Y. lipolytica according to the present invention are derived from the auxotrophic strain of Y. lipolytica Pold (Leu " Ura " CLIB 139, genotype MatA Ura3-302, Leu2-270, xpr2-322), itself derived from the wild strain of Y. lipolytica W29 (genotype MatA; ATCC20460) by genetic modification.
• the Pold and W29 strains have been described by Barth and Gaillardin (1996). These two strains Pold and W29 show no differences in the production of lipids and citric acid.
• Yeast cells were cultured on YPD (Barth et al., 1996) or YNBCas (YNBD with 0.2% casamino acid) media for selection of transformants.
• the strain Escherichia coli Machl-Tl (Invitrogen) was used for the transformation and amplification of the recombinant plasmid DNA.
• Cells were cultured on LB medium (Sambrook et al., 1989). Kanamycin (40 g mL) was used for plasmid selection.
• the PHD1 gene (YALI0F02497) of the Y. lipolytica Pold strain was deleted by replacing the coding region of this gene with a cassette containing the URA3 gene as a selection marker, according to the gene disruption method ("gene disruption"). ) described by Fickers et al. (2003). More specifically, the promoter (P) and terminator (T) regions of the YAL10F02497 [Tl] gene were obtained by PC amplification of Y.
• YALI0F02497-P1 SEQ ID NO : 2
• YALIOF02497-P2 SEQ ID NO: 3
• YALI0F02497-T1 SEQ ID NO: 4
• YALI0F02497-T2 SEQ ID NO: 5
• Primers YALI0F02497-P2 and YALI0F02497-T1 were designed to introduce an Iscel restriction site at the 3 'end of the P fragment and at the 5' end of the T fragment.
• the corresponding P-Iscel and T-Iscel fragments were were grouped together and used as matrices for the amplification of the V-Iscel-cassette cassette with the pair of primers YALI0F02497-P1 / YALI0F02497-T2.
• the V-Iscel-cassette cassette was cloned into the plasmid pCR4®Blunt-TOPO (Invitrogen, Cergy-Pontoise, France), and transformed into the E. coli strain. coli Machl-Tl (Invitrogen).
• the resulting construct named pYALI0F02497-PT (JME739), was verified by restriction analysis with Iscel and sequenced.
• the loxR-t / 43-loxP fragment encoding the URA3 gene was excised from plasmid JMPÎ21 (Fickers et al., 2003) by Iscel restriction and cloned at the corresponding site in YALI0F02497-PT so as to insert the URA3 selection marker between the fragment P and T of the V-Iscel-cassette cassette at the Iscel site.
• the resulting construct, designated pYALI0F02497-PUT comprises the PUT cassette of the YALI0F02497 gene (cassette YALI0F02497-PUT).
• the deletion AYALI0F02497 :: URA3 was introduced into the Y. lipolytica Pold strain (JMY1 5), according to the method described by Fickers et al. (2003), resulting in the deleted strain JMY1203 (genotype MatA, Ura3-302, Leu2-270, xpr2-322, AYALI0F02497 :: URA3).
• the disabling cassette was amplified by PCR and used to transform the Y. lipolytica Pold strain.
• the Ura + transformants were selected on Yas BCas medium.
• the vectors JME1619 and JME2246 were constructed by cloning the coding sequences of the ACL1 and ACL2 genes between the BamH1 and Avril restriction sites of the m-62-pTEF-URA3ex vectors (Beopoulos et al., 2012) and JM-62-pTEF-LEU2ex. (Beopoulos et al, 2014) respectively.
• the coding sequences of the ACL1 and ACL2 genes were amplified using the following oligonucleotides:
• ACL1-S CGCGGATCCCACAATGTCTGCCAACGAGAACATCTCCCGATTCGAC (SEQ ID NO: 9), sense oligonucleotide, carrying the BamHI restriction site.
• ACL1-A CACCCTAGGTCTATGATCGAGTCTTGGCCTTGGAAACGTC (SEQ ID NO: 10), antisense oligonucleotide, carrying the restriction site Avril.
• the amplicon thus obtained was then digested with the enzymes BamHI and Vllll and cloned into the vector JMP62-pTEF-LEU2ex, generating the vector JME1619.
• ACL2 contains two BamHI restriction sites, the cloning of this sequence necessitated the use of different oligonucleotides in order to eliminate these restriction sites, without however modifying the sequence of the protein derived from this gene.
• ACL2-A CACGGATCCCACAATGTCAGCGAAATCCATTCACGAGGCCGAC (SEQ ID NO: 11), sense oligonucleotide, carrying the BamHI restriction site.
• ACL2-B ATGCCTAGGTTAAACTCCGAGAGGAGTGGAAGCCTCAGTAGAAG (SEQ ID NO: 12), antisense oligonucleotide, carrying the restriction site Avril.
• ACL2-C G AG AGG GCG ACTGG AT 7CTCTTCT ACC AC (SEQ ID NO: 13), sense oligonucleotide, carrying a mutation to remove a BamHl restriction site.
• ACL2-Dd GTGGTAGAAGAGAATC ⁇ AGTCGCCCTCTC (SEQ ID NO: 14), antisense oligonucleotide, carrying a mutation allowing the removal of a Bam restriction site.
• ACL2-E CTTCACCCAGGTTGGTCCACCTTCAAGGGC (SEQ ID NO: 15), sense oligonucleotide, carrying a mutation to remove a BamHI restriction site.
• ACL2-F GCCCTTGAAGGTGGAGCCAACCTGGGTGAAG (SEQ ID NO: 16), antisense oligonucleotide, carrying a mutation to remove a BamHl restriction site
• MAE 1 -sens CGCGGATC CAC AC AATGTT ACGAC (SEQ ID NO: 17), sense oligonucleotide, carrying the BamHI restriction site.
• ACL1-antisense GCGCCTAGGCTAGTCGTAATCCCG (SEQ ID NO: 18), antisense oligonucleotide, carrying the restriction site ⁇ vrll.
• BamCytoATG AACGCGGATCCCACAATGGCTTCAGGATCTTCAACG (SEQ ID NO:
• ACCavSph GTCCAAGCTCGGGAAGCTG (SEQ ID NO: 20)
• ACCrevIntron CCGTTGTT AGCG AT GGA C CTTGTTG AT ATGACCTC ATGACCTC (SEQ ID NO: 21)
• AvrRevACC AGCTATCGATAATCCTAGGTCACAACCCCTTGAGCAGCTC (SEQ ID NO:
• antisense oligonucleotide bearing Clal and Avril sites.
• the ACC1 gene being particularly long and containing an intron (containing a site
• Amplicon 1 BamCytoATG and ACCrevIntron (184 bp),
• Amplicon 5 BamCytoATG and AvrRevACC (7270 bp),
• Amplicons 1 and 2 were then fused with BamCytoATG and ACCavSph primers.
• Amplicons 1 + 2 and Pamplicon 5 were digested with BamHI + SphI.
• the amplicon 5 digested with BamHI + SphI makes it possible to obtain a fragment of 1876 bp, called the 5 'fragment.
• the fragments thus digested (1 + 2 and 5 ') were subsequently cloned by 3-way ligation between the BamHI and XbaI sites of the vector Bluescript (-) KS, generating the vector JME2412.
• Amplicons 3 and 4 were then fused with the ACCamXba and AvrRevACC primers.
• the 3 + 4 amplicon was then digested with XbaI and ClaI and cloned by 3-way ligation between the XbaI and ClaI sites of the Bluescript ( ⁇ ) KS vector, generating the JME2413 vector.
• JME2412 and JME2413 vectors were then digested with lai and ClaI to release the 1 + 2 + 5 'and 3 + 4 fragments with compatible ends. These two fragments thus digested were subsequently cloned by 3-way ligation between the BamHI and ClaI sites of the Buescript (-) KS vector, generating the JME2406 vector.
• the coding sequence of the ACC1 gene thus reconstructed has finally been digested by the enzymes Bam I + Avril, to be cloned between the BamHI + Avril sites of the vector JMP62 pTefLEU2ex, generating the vector JME2408.
• the strain JMY1203 was made protophobic by conversion of the leu2-270 locus to its wild version.
• the strain JMY3279 was obtained after excision of the selection marker URA3ex of strain JMY1203, according to the principle described by Fickers et al. (2003).
• This strain was then successively transformed with the inactivation cassettes of the genes MFE1 (JME1077) and TGL4 (JME1000), already described in Dulermo and Nicaud (201 1) and Dulermo et al. (2013), respectively.
• the URASex and LEU2ex markers of the strain JMY3396 thus obtained were then excised (Fickers et al., 2003), generating strain JMY3433.
• strain JMY3776 was obtained after excision of the selection markers URA3ex and LEU2ex (Fickers et al, 2003) and then successive transformation with the overexpression cassettes of the genes yICXi (JME1619) and ACL2 (JME2246).
• Wild strain Y. lipolytica W29 and genetically modified strains were used for fermentations.
• the culture medium used contained (in g / L): KH 2 PO 4 4.7; Na 2 HPO 4 2.5; MgSO 4 x7H 2 O 1.5; CaCl 2 x2H 2 0 0.1; FeCl 3 x 6H 2 0.15; ZnS0 4 x7H 2 0 0.02; MnSO 4 xH 2 O 0.06 (Papanikolaou et al, 2002). Ammonium sulfate and yeast extract were used as nitrogen sources at a concentration of 0.25 to 2.5 g, respectively.
• Crude glycerol (Hellenic industry of glycerin and fatty acids SA, purity about 70%, g / g, impurities composed of potassium and sodium salts 12%, w / w, non-glycerol organic material 1%, v 17%, g / g and methanol ⁇ 0.1%, g / g) was used as the sole source of carbon for different concentrations.
• the initial pH for all media is 6.0 ⁇ 0.1.
• analytical grade glucose AnaalaR, BDH, UK
• strains of Y. lipolytica JMY2900 (reference), JMY3776 (Aphdl Amfel Atgl4 + p TEF-D GA2-LEU2ex + pTEF ⁇ GPD1-URA3ex) and strain JMY4079 (Aphdl Amfel Atgl4 + pTEF-DGA2 + pTEF-GPD1 + pTEF-ACLFURA3ex + pTEF -LEU2ex) were evaluated for their ability to produce lipids in vials with baffles.
• the culture medium used contained: 60 g / L of pure glycerol (Glol medium 6%) or
• the biomass concentration (X, g / L) was determined by the dry weight (85 ⁇ 5 ° C / 24 h).
• glucose (Glc, in g / L) and organic acids were analyzed by HPLC as described by André et al (2009).
• the iso-citric acid concentration was determined by an enzymatic method, by measuring the NADP3 ⁇ 4 produced during the conversion of isocitric acid to ⁇ -ketoglutaric acid, catalyzed by iso-citrate dehydrogenase, as described by Papanikolaou et al. . (2002).
• the total amount of citric acid (citric and isocitric acid) produced was characterized as Cit (in g / L).
• the determination of ammonium ions was made using a selective ammonium electrode (Hach 95-12, Germany).
• Cellular total lipids (L, in g / L) were extracted from dry biomass with 2: 1 (v / v) chloroform / methanol and were gravimetrically determined. Cellular lipids were fractionated into their lipid fractions. Briefly, a known weight of extracted lipids (about 200 mg) was dissolved in chloroform (3 ml) and fractionated using a column (25 x 100 mm) of silicic acid, activated by heating at 110 ° overnight. C (Fakas et al, 2006).
• the total cellular lipids (L, in g L) were extracted from the milled dry biomass (20 to 30 mg) with a mixture of chloroform / methanol 2/1 (v / v), according to the protocol from Folch and Lee (1957) and were gravimetrically determined.
• Total cell lipids were converted to their fatty acid methyl esters (FAME) by the method of Browse (Browse et al., 1986).
• the FAMEs were analyzed in a gas chromatograph (GC-FID) (Varian, GC-430) according to Beopoulos et al. (2008). FAMEs were identified by comparison with stallions.
• strains W29 and JMY1203 consumed, with comparable levels, available extracellular nitrogen (initial NH4 + at 55 ⁇ 10 ppm, nitrogen depletion in 60 ⁇ 5 hours after inoculation).
• the strain W29 has a higher biomass production than the strain JMY1203 on the two substrates, between 10.7-12.5 g ⁇ L.
• biomass production reaches a maximum of 7 g / L in the presence of glycerol; on glucose, the biomass concentration decreases during culture to 1.8 g / L, suggesting cell lysis at the end of culture.
• citrate production increases after the exhaustion of the nitrogen of the medium, leading to its secretion.
• citrate production is superior on glucose, reaching g / g.
• Strain JM1203 has opposite characteristics on glucose; citrate production and conversion rates are from g / g, respectively, whereas on crude glycerol the Cit max was 2.04 times higher (31 g / L), corresponding to a 37.4% increase in the conversion rate reaching 0.78 g / g. These results indicate a difference in carbon flux according to growth on glucose or glycerol for the two strains, which have an opposite phenotype.
• strain JMY1203 produces less biomass compared to strain W29, it shows a 1.74-fold increase in lipids, reaching 10.1%, g / g, of dry weight (PS) on glucose and 1.49 times more lipids on glycerol, reaching 14.9%, g / g, PS.
• Glycerol is a better substrate for lipid accumulation for these two strains,
• strain W29 A rapid decrease in accumulated lipid is observed for strain W29 or the lipid content decreases from 5.8 to 2.4%, g / g, PS (58% decrease in lipid level) on glucose and from 10 to 1 , 6%, g / g, PS on glycerol.
• the amount of accumulated lipids decreases from 10.1 to 5.1%, g / g, PS (49.5% decrease) on glucose and from 14.9 to 10%, g / g, PS (32.9% decrease) on glycerol. It is then observed that the strain W29 remobilizes these lipid glucose reserves more rapidly than the strain JMY1203. On glycerol medium remobilization is similar for both strains.
• lipid accumulation clearly depends on the concentration of glycerol during the growth phase where nitrogen was not limiting, while lipid degradation during the nitrogen deficiency phase was not not affected by glycerol concentration (Figure 2B). Lipid accumulation reached 26.6%, g / g, PS for an initial concentration of glycerol (Glolo) of 90 g L, and 14.9% for a Glolo of 40 g / L.
• Citric acid is the main compound of total citrate produced, since the iso-citric acid dosage showed that the isocitric acid was about 5-8%, g / g, of the total citric acid produced regardless of the strain tested and the Glolo concentration of the medium. In the test with the Cit max amount reached, the amount of isocitric acid assayed was about 5%, g / g, of Cit.
• the exceptional Yat / Gioi value that has been obtained shows that the genetically modified strain JMY1203 can be used to promote the conversion of crude glycerol to citric acid.
• the fatty acid composition (AG) of the cellular lipids produced was studied at the end of the growth phases for the two strains cultivated on glucose and crude glycerol. It is shown in Tables 4 (strain W29) and 5 (strain JMY1203) hereinafter.
• Table 4 Fatty acid composition of the total cellular lipids produced by the strain Yarrowia lipolytica W29 during its growth in a limited nitrogen medium containing glucose (at 40 g / l) or glycerol (at 40, 60 or 90 g / L).
• the culture conditions are identical to those described for Tables 2 and 3.
• LE end of the exponential phase.
• ES beginning of the stationary phase.
• S stationary phase.
• composition of AG has been modified as a function of the Glolo concentration used and the fermentation time, and that differences have also been observed between growth on glucose and on glycerol.
• Some differences in AG profiles were observed between the two strains used, because the cultivation of strain W29 led to the synthesis of a microbial lipid less rich in oleic acid ( A9 C38: 1) and richer in linoleic acid. (A9 '12 C18: 2) for the JMY1203 strain.
• strain JMY1203 (Citric acid produced per unit of glycerol consumed) of the strain JMY1203 according to the present invention is higher than that of different strains of Y. lipolytica described in the prior art. iv) Growth of strains JMY2900, JMY3776 and JMY4209 in gfycerol 6% and 9% and consumption of glycerol over time
• the growth of the JMY3776 and JMY4079 strains is approximately 30% to 40% less than the growth of the JMY2900 reference strain.
• the final biomass after 96h of culture was 10.56 g / L and 12.36 g / L for JMY3776 and JMY4079, against 18.48 g / L for JMY2900.
• the analysis of the optical density curves during the growth of the different strains led to the same observation (Fig. 5 and Table 8).
• JMY2900 consumes glycerol more quickly than JMY3776 and JMY4079 ( Figure 5).
• Glycerol is completely exhausted from the medium at 48h in the case of the three strains cultured in 6% Glol medium, and 48 for JMY2900 and 72 hours for JMY3776 and JMY4079 in Glol 9% medium (FIG. 5).
• the growth continues more or less strongly depending on the strains after exhaustion of glycerol. It is quite possible that the metabolites secreted by the different strains, as explained below, in the culture medium, can be used to ensure the growth of the latter after exhaustion of glycerol (Figure 5).
• Table 8 Production of fatty acids, biomass, citric acid and mannitol by strains JMY2900, JMY3776 and JMY4079 after 96 hours of growth in Glol medium 6% and 9%.
• X dry biomass
• Lipids CA
• YCA / S OR YMnfs biomass yield / lipid / citric acid / mannitol based on the consumed substrate
• Yux or YCA / X OR Yu n v lipid / citric acid / mannitol yield relative to the biomass produced.
• JMY2900 appears to be more likely to produce mannitol, with a production of 1 1.4 g / L after 48 h growth in 6% Glol and 14.8 g / L after 48 h growth in 9% Glol ( Figure 5).
• the medium no longer containing glycerol
• strain JMY2900 re ⁇ consomme mannitol she secreted into the culture medium ( Figure 5), which allows undoubtedly to continue its growth after 48 h of culture.
• the levels of citric acid and mannitol are relatively comparable from one strain to another, except for mannitol which remains 3 times more concentrated (7.5 g / L vs. 2 to 2.8 g / L) in 9% Glol culture medium of JMY2900 compared to strains derived from the Aphdl mutant (Table 8 and Figure 5).
• Cl 8: 1 (n-9), C16: 0, C16: 1 (n-7), C18: 0 and C18: 2 (n-6) represent about 50%, 15 to 20%, 4 to 5%, 7 to 8% and 6.5% of the total fatty acids in Glol 6%. However in Glol 9%, the proportion of C18: 1 (n-9) decreases to 45% in favor of C16: 0, which represents 25% of fatty acids.
• Table 9 Fatty acid profile (in% of the total fatty acids) of strains JMY2900, JMY3776 and JMY4079 after 96 hours of growth in Glol medium 6% and Glol 9%.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Cell Biology (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Biomedical Technology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=48468565

Family Applications (1)

Country Status (4)

Families Citing this family (8)

Family Cites Families (7)

• 2013
  • 2013-03-04 FR FR1351893A patent/FR3002774A1/fr not_active Withdrawn
• 2014
  • 2014-02-28 EP EP14711850.9A patent/EP2964762A1/de not_active Withdrawn
  • 2014-02-28 US US14/773,242 patent/US20160145599A1/en not_active Abandoned
  • 2014-02-28 WO PCT/IB2014/059343 patent/WO2014136028A1/fr active Application Filing

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events