EP2582798A1 - Herstellung von biodiesel mittels hefe aus lignocellulose und glycerin - Google Patents

Herstellung von biodiesel mittels hefe aus lignocellulose und glycerin

Info

Publication number
EP2582798A1
EP2582798A1 EP11725783.2A EP11725783A EP2582798A1 EP 2582798 A1 EP2582798 A1 EP 2582798A1 EP 11725783 A EP11725783 A EP 11725783A EP 2582798 A1 EP2582798 A1 EP 2582798A1
Authority
EP
European Patent Office
Prior art keywords
seq
gene
fatty acids
yeast
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11725783.2A
Other languages
English (en)
French (fr)
Inventor
Ambareesh Govind Phadnavis
Peter Ruhdal Jensen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Danmarks Tekniskie Universitet
Original Assignee
Danmarks Tekniskie Universitet
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danmarks Tekniskie Universitet filed Critical Danmarks Tekniskie Universitet
Priority to EP11725783.2A priority Critical patent/EP2582798A1/de
Publication of EP2582798A1 publication Critical patent/EP2582798A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/18—Baker's yeast; Brewer's yeast
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/649—Biodiesel, i.e. fatty acid alkyl esters
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • Biodiesel refers to a fuel comprised of mono-alkyl esters of long chain fatty acids derived from vegetable oils or animal fats, designated B100, and meeting the requirements of ASTM D 6751 .
  • B100 mono-alkyl esters of long chain fatty acids derived from vegetable oils or animal fats
  • ASTM D 6751 the most common method of Biodiesel production is trans-esterification of edible and non-edible vegetable oils, or sometimes animal fats.
  • the trans-esterification reaction transforms triglycerides into fatty acid alkyl ester, in the presence of an alcohol, such as methanol or ethanol, and a catalyst, such as an alkali or acid, where glycerol is a by-product.
  • the genetically modified microorganism is characterised by comprising a transgene encoding a pyruvate formate lyase comprising PflA and PflB.
  • the genetically modified microorganism may be further characterised by additionally comprising a transgene encoding an acyl CoA-ACP thioesterase, wherein said thioesterase is selected from among: Soyabean (Glycine max Chlamydomonas reinhardtii (Protein ID - A8HY17); Arabidopsis thaliana (Protein ID - Q9SJE2); Ricinus communis (Protein ID - B9RAC3); Triticum aestivum; CtFatA from Brassica napus (Protein ID - Q43745); CtFatA from C. tinctorius (Protein ID - Q42715); GmFatAI from G.
  • Soyabean Glycine max Chlamydomonas reinhardtii (Protein ID - A8HY17); Arabidopsis thaliana (Protein ID - Q9SJE2); Ricinus communis (Prot
  • the genetically modified microorganism may be further characterised by additionally comprising enhanced expression of an acyl-coenzymeA:ethanol O-acyltransferase conferred by a recombinant endogenous acyl- coenzymeA:ethanol O-acyltransferase (EEB1 ) gene wherein said gene is operably linked to a heterologous promoter.
  • EEB1 endogenous acyl- coenzymeA:ethanol O-acyltransferase
  • the growth medium of the method comprises a carbon source is selected from at least one of glucose, glycerol, xylose, hydrolysed cellulose and hemicellulose, starch, sugar alcohol and xylan, Preferably the growth medium comprises or consists of the components set out below.
  • the present invention is also provides a growth medium adapted for use in the above described method, wherein the medium the composition comprises the following components,
  • Component Composition (grams/litre)
  • Figure 1a Saponifiable fatty acid content of two yeast strains (Y axis) as a function of fermentation growth temperature (X-axis). Note that the values of control reading are on X axis with Y co-ordinate as zero throughout the experiment.
  • Figure 1 b Saponifiable fatty acid content of two yeast strains (Y axis) as a function of glucose concentration (X-axis). The relationship is linear passing through origin, however, due to practical difficulties, the trend was
  • Figure 2 Gas Chromatogram of methyl esters of fatty acids secreted into the medium by yeast strain Saccharomyces cerevisiae (Wild type).
  • Figure 3 Lipid metabolic cycle in yeast, a) FAA2 is one of the enzymes in the repertoire of Saccharomyces cerevisiae which catalyzes the first step involved in catabolism of fatty acids; b) manipulation of the lipid metabolism in yeast.
  • Figure 5 SDS-gel with PCR amplification products of FAA2 from WT genome.
  • Lane 1 DNA size marker:100 - 10,000 nucleotide base pairs;
  • Lane 2 PCR product of WT yeast genomic DNA amplification using primer pair 3 (Table 4).
  • Figure 6a,b Detection of FAA2 (Aura3) deletion in gDNA from transformed yeast colonies.
  • Wells 3-9, 1 1 -17 contain genomic DNA from transformed yeast colonies, amplified with FAA2 primer set 3.
  • Wells 18, 20-27, 30-33 contain genomic DNA from transformed yeast colonies, amplified with URA3 primer set 2.
  • Wells 1 , 10, 19, 28, 29, 40 contain DNA size ladders.
  • Well number 2 and 39 contained WT-DNA amplified with primer set 3 and primer set 2 respectively.
  • Well 38 contain URA3 plasmid amplified with primer set 2, as positive control.
  • Figure 7 GC-MS graph of extracellular fatty acids secreted by from WT- strain (S. cerevisiae) grown on glucose medium.
  • Figure 8 GC-MS graph of intracellular fatty acids secreted by from WT-strain (S. cerevisiae) grown on glucose medium.
  • Figure 9 GC-MS graph of extracellular fatty acids by FAA2 (Aura3) deletion mutant of WT-strain (S. cerevisiae FAA2 Aura3) grown on glucose medium.
  • Figure 10 GC-MS graph of intracellular fatty acids by FAA2 (Aura3) deletion mutant of WT-strain (S. cerevisiae FAA2 Aura3) grown on glucose medium.
  • Figure 11 GC-MS graph of extracellular fatty acids secreted by from WT- strain (S. cerevisiae) grown on glycerol medium.
  • Figure 12 GC-MS graph of extracellular fatty acids by FAA2 (Aura3) deletion mutant of WT-strain (S. cerevisiae FAA2 Aura3) grown on glycerol medium.
  • Figure 13 GC-MS graph of extracellular fatty acids by Candida tropicalis grown on glucose medium (upper panel); fatty acid standards (lower panel).
  • Figure 14 GC-MS graph of extracellular fatty acids by Candida tropicalis grown on glycerol medium (upper panel); fatty acid standards (lower panel).
  • Figure 15 The homologous recombination of upstream and downstream sequences from the bipartite gene-targeting substrate to the chromosomal locus results in the exchange of ACC1 promoter to TEF1 promoter and the insertion of Kl URA3 flanked by direct repeats (DR). The Kl URA3 was later removed by plating the strains on medium containing 5-fluoroorotic acid (5- FOA).
  • 5- FOA 5-fluoroorotic acid
  • Figure 16 PCR detection of FAA2 (Aura3) deletion in gDNA from transformed SC-ACC1 yeast colonies.
  • Lane 1 -4 contain genomic DNA from transformed yeast colonies, amplified with FAA2 primer set 3 and URA3 primers respectively, and demonstrate presence of URA3 and absence of FAA2 in the gDNA in mutants in Lanes 1 , 2 and 4.
  • Lane 5 contains a DNA size ladder.
  • Figure 17 PCR detection of E.coli pyruvate formate lyase A gene (in lane 1 and 4) and Pyruvate Formate lyase B gene (in lane 2 and 3) amplified from E.coli genome, amplified with pfIA and pfIB specific primers. Lane M contains a DNA size ladder.
  • Figure 18 Gel Photograph showing plasmid (in lane 2 and 3) and ligated plasmid (in lane 1 and 4).
  • the lane 1 is PfIA gene in shuttle vector PCM182.
  • the lane 4 is PFLB gene in shuttle vector PCM183.
  • Lane M contains a DNA size ladder.
  • Figure 19 Comparative fatty acid yield of yeast strains of invention when grown on 20% glucose as carbon source.
  • Figure 20 Comparative fatty acid yield of yeast strains of invention when grown 5% pure glycerol as carbon source.
  • Figure 21 Comparative fatty acid yield of yeast strains of invention when grown on 5% crude glycerol as carbon source.
  • Figure 22 Comparative fatty acid yield of yeast strains of invention when grown on 15% xylose as carbon source
  • Figure 23 Comparative fatty acid yield of yeast strains of invention when grown on 10ml/L hydrolysed wheat kignocellulose as carbon source
  • FAA2 - gene encoding long chain fatty acyl-CoA synthetase (Faa2p; EC No: 6.2.1 .3) that accepts a wider range of acyl chain lengths than Faal p, preferring C9:0-C13:0; and is involved in the activation of endogenous pools of fatty acids;
  • the microorganism of the invention is a yeast or fungal species, since yeast and fungi can accumulate oils under some cultivation conditions, and some yeast and fungi species secrete fatty acids into the medium when grown on certain carbon sources. Accordingly, a yeast or fungal species of the invention is one that is able to secrete fatty acids extracellularly in the medium, and is capable of producing a large cell biomass combined with and a high extracellular lipid yield.
  • a preferred yeast or fungal species according to the invention is a yeast or fugal species capable of secreting fatty acids and esters thereof, said yeast or fungal species belonging to the genus Aspergillus (e.g. A.
  • Candida e.g. C. tropicalis; C. magnolia
  • Cryptococcus e.g. C. albidus
  • Debaryomyces e.g. D. hansenii
  • Fusarium e.g. F. oxysporum
  • Lindnera e.g. L. jadinii
  • Lipomyces e.g. L. lipofera or L. starkeyi
  • Monascus e.g. M. purpureus
  • Mucor e.g.; M. circinelloides, M. hiemalis; M. miehei; M. racemosus
  • Pachysolen e.g. P. tannophilus
  • Pichia e.g. P. P.
  • the micro-organism is a Saccharomyces, in particular S. cerevisiae.
  • the microorganism belongs to the yeast genus Candida, in particular the species Candida tropicalis, said yeast being characterised by the secretion of palmitic acid.
  • yeast genus Candida in particular the species Candida tropicalis, said yeast being characterised by the secretion of palmitic acid.
  • a genetically modified yeast or fungal species/strain of the invention is preferably derived from a microorganism selected from the group set out above under section I.
  • One or more gene controlling the metabolic pathways in the selected yeast or fungal species/strain is genetically modified to enable the selected species/strain to produce and secrete esters of fatty acids from various cheap carbon sources such as starch, glycerol and lignocellulose.
  • a yeast or fungal species/strain of the invention carries a deletion in the FAA2 gene (FAA2A strain) encoding the Faa2p, which catalyses the activation of medium-chain fatty acids, being the first committed step in beta-oxidation of these fatty acids. Deletion of FAA2 gene, in the yeast or fungal species, reduces the metabolic flux through fatty acid catabolism.
  • a FAA2A yeast or fungal species of the invention is characterised, not only by the synthesis of a surprisingly higher proportion of MCFAs than wild type yeast, but as further being capable of extracellular secretion of the MCFAs synthesized within the cell.
  • the deleted FAA2 gene is Gene ID: 856734 (SEQ ID No: 1 ) and encodes FAA2 (EC 6.2.1 .3) having protein ID: P39518 (SEQ ID No: 2).
  • 2.1 .2 Silencing endogenous fatty acyl CoA synthetase gene expression
  • expression of the one or more endogenous fatty acyl-CoA synthetase (FAA) genes in the yeast or fungal species of the invention is silenced or knocked-down by means of gene deletion or by means of promoter engineering.
  • FAA fatty acyl-CoA synthetase
  • promoters of each of the S. cerevisiae, FAA1 , FAA3, FAA4 may be substituted with promoters driving lower expression levels.
  • a corresponding strategy may be applied to silence or knock-down the expression of FAA genes in other yeast species.
  • the FAA gene to be silenced by gene deletion or knocked out by means of promoter engineering is one or more of the Faa1 gene (GenelD: 854495 (SEQ ID No: 3); encoding Protein ID - P30624: (SEQ ID No: 4)); the Faa3 gene (GenelD: 854808 (SEQ ID No: 5) encoding Protein ID - P39002 (SEQ ID No: 6)), and the Faa4 (GenelD: 855288 (SEQ ID No: 7) encoding Protein ID - P47912 (SEQ ID No: 8)) in Saccharomyces cerevisiae; the FAA gene (GenelD: 2541350 (SEQ ID No: 9) encoding Protein ID - Q9P7D7 (SEQ ID No: 10)) in Schizosaccharomyces Pombe; the FAA gene (GenelD: 3257561 (SEQ ID No: 1 1 ) encoding Protein ID
  • the enzymatic activity of the endogenous fatty acyl CoA synthetase (FAA), in the yeast or fungal species of the invention can be inhibited by means of inhibitors, for example with triacsin C (Pubchem. ID - CID: 9576787) or adenosine 5'-hexadecylphosphate.
  • Triacsin-C can be added to the growth medium to inhibit FAA activity and thereby increase the levels of secreted fatty acids in the medium. This approach is useful in those cases where the FAA gene in the respective yeast or fungal species cannot be genetically modified.
  • the gene encoding the fatty acid transporter, FATpl in the yeast or fungal species of the invention is disrupted or inhibited.
  • Lipid metabolism is compartmentalized in Saccharomyces cerevisiae, whereby the biosynthetic enzymes are located in the cytosol of the cell, whereas the catabolic enzymes are located in peroxisomes and mitochondria.
  • Fatty acid transporter FAT1
  • Fat1 is a medium chain fatty-acid-CoA activase itself.
  • a yeast or fungal strain of the invention is genetically modified by the transformation with and expression of a gene encoding Pyruvate-Formate lyase (pfl), which is an enzyme which converts pyruvic acid to acetyl-CoA and formic acid in the cytosol.
  • PFL function in yeast requires expression of both the structural gene encoding the PFL homodimer (pfIB) and its activating enzyme (pfIA), and single electron donor as co-factor.
  • Inactive PFL is converted into its active form under anaerobiosis by the stabilization of a glycyl radical in its active site, a process which is mediated by PfIA. S.
  • Yeasts and fungi are eukaryotic organisms, in which many cellular processes are compartmentalization, such that the bulk of lipid-biosynthesis is located in cytosol, while catabolism is located in mitochondria and peroxisomes.
  • Glycolysis which leads to production of pyruvate, is localised in the cytosol of yeast and fungi, while the conversion of pyruvate to acetyl CoA takes place in mitochondria catalysed by pyruvate dehydrogenase complex.
  • the concentration of acetyl-CoA is relatively lower in cytosol than in mitochondria.
  • the yeast or fungal strain of the invention that has been genetically modified to express pyruvate-Formate lyase (PFI A&B) (see point 2.2.1 above), will produce formate or formic acid in the cytosol.
  • the yeast and fungal genome comprises a gene encoding formate dehydrogenase, which degrades formate to carbon dioxide and water, with production of an NADH molecule.
  • formate dehydrogenase which degrades formate to carbon dioxide and water
  • NADH NADH
  • the fatty acid biosynthesis reaction consumes two NADPH, while growth on glycerol produces two NADH.
  • the concentration of malonyl CoA in the modified yeast strain may be increased by over-expressing the ACC1 gene encoding an acetyl CoA Carboxylase which converts acetyl CoA into Malonyl CoA.
  • enhanced expression/synthesis of acetyl CoA Carboxylase can be obtained by manipulating the expression levels of the native ACC encoding gene in its host cell, for example by substituting the native ACC gene promoter with an alternative promoter that directs higher expression levels of the cognate ACC gene.
  • Over-expression of the ACC1 gene in yeast can, for example, by achieved by replacing the endogenous promoter of the native ACC1 gene with the TEF1 promoter from Saccharomyces cerevisiae [SEQ ID NO: 1 13].
  • Suitable AAC1 genes to over-express include the ACC1 gene (GenelD: 855750 (SEQ ID No: 27) encoding Protein ID - Q00955 (SEQ ID No: 28)) in Saccharomyces cerevisiae; the ACC gene (GenelD: 2543344 (SEQ ID No: 29) encoding Protein ID - P78820 (SEQ ID No: 30)) in Schizosaccharomyces pombe; the ACC gene (GenelD: 8196923 (SEQ ID No: 31 ) encoding Protein ID - C4QXW1 (SEQ ID No: 32)) in Pichia pastoris; the ACC gene (GenelD: 8301221 (SEQ ID No: 33) encoding Protein ID - C5M4L7 (SEQ ID No: 34)) in Candida tropicalis; the ACC gene (GenelD: 2909424 (SEQ ID No: 35) encoding Protein ID - Q6CC
  • the fatty acids secreted by the yeast or fungal species/strain of the invention is preferably shorter than 16 carbons in length, preferably 14 or 12 carbons in length.
  • Fatty acid chain length is determined by the cytosolic enzyme, thioesterase (Acyl CoA-ACP Thioesterase), which cleaves the bond between growing fatty acid chain on the Fatty acid Synthase Complex (FAS) and releasing the fatty acid in the cytosol.
  • thioesterase Acyl CoA-ACP Thioesterase
  • Fatty acid chain thioesterase cleaves the thioester bond between Fatty acyl-CoA and Acyl-Carrier Protein (ACP) when the fatty acid chain reaches 16 Carbons in length.
  • the yeast or fungal strain of the invention is genetically modified by transformation with a Acyl CoA-ACP thioesterase gene derived from any on of the following: Soyabean (Glycine max) GenelD: 100170693; Chlamydomonas reinhardtii (GenelD: 5722109 (SEQ ID No: 52) encoding Protein ID - A8HY17 (SEQ ID No: 53)); Arabidopsis thaliana (GenelD: 837372 encoding Protein ID - Q9SJE2 (SEQ ID No: 54)); Ricinus communis (GenelD: 8269197 (SEQ ID No: 55) encoding Protein ID - B9RAC3 (SEQ ID No: 56)); Triticum aestivum (GenelD: 543005); CtFatA from Brassica napus (Genbank accession number: X73849 (SEQ ID No: 57) encoding Protein ID - Q4
  • tinctorius Genbank accession number: M96569 (SEQ ID No: 59) encoding Protein ID - Q42715 (SEQ ID No: 60)); GmFatAI from G. mangostana (Genbank accession number: U92876 (SEQ ID No: 61 ) encoding Protein ID - O04792 (SEQ ID No: 62)); CwFatBI from C. hookeriana (Genbank accession number: U17076 (SEQ ID No: 63) encoding Protein ID - Q39513 (SEQ ID No: 64)); CwFatBI from C.
  • Saccharomyces cerevisiae (GenelD: 856010 (SEQ ID No: 71 ) encoding Protein ID - Q02891 (SEQ ID No: 72)); Pichia Pastoris (GenelD: 8196549 (SEQ ID No: 69) encoding Protein ID - C4QX24 (SEQ ID No: 70)) in a yeast strain of the invention can be achieved by replacing the native promoter of these genes with a stronger promoter.
  • the release of free fatty acids in the cytosol and recycling of Coenzyme A is enhanced in a genetically modified yeast or fungal species of the invention by the heterogenous expression of the cytosolic mammalian Cytosolic Acyl CoA thioesterase (CTE).
  • CTE Cytosolic Acyl CoA thioesterase
  • a genetically modified yeast or fungal strain of the invention is transformed with a CTE gene derived from: Mus muscilis (GenelD: 26897 (SEQ ID No: 73) encoding Protein ID - 055137 (SEQ ID No: 74)); Arabidopsis thaliana (GenelD: 827955 (SEQ ID No: 75) encoding protein ID - Q5FYU1 (SEQ ID No: 76)); or Rattus norvegicus (GenelD: 170588 (SEQ ID No: 77) encoding Protein ID - Q6AZ44 (SEQ ID No: 78)).
  • a CTE gene derived from: Mus muscilis (GenelD: 26897 (SEQ ID No: 73) encoding Protein ID - 055137 (SEQ ID No: 74)); Arabidopsis thaliana (GenelD: 827955 (SEQ ID No: 75) encoding protein ID - Q
  • Free fatty acids may be converted to alkanes by treatment with a PD/C catalyst at 300°C and pressure 12 bars for 4 hours.
  • Free fatty acids may be converted to alkanes by decarboxylation with immobilized enzymes, which may be prepared from extracts of cells comprising suitable enzymes such as the insects: Apis mellifera, Musa domestica, Zootermopsis angusticollis, Triatoma infestans which contain native long-chain fatty acid-decarboxylase for decarboxylation of fatty acids longer than 20 carbon in chain-length. Further suitable enzymes may be obtained from extracts of the algae: Crocosphaera spp, Isochrysis, Prymnesium spp, Ectocarpus spp, Laminaria spp, Streblonema spp.
  • suitable enzymes such as the insects: Apis mellifera, Musa domestica, Zootermopsis angusticollis, Triatoma infestans which contain native long-chain fatty acid-decarboxylase for decarboxylation of fatty acids longer than 20 carbon in chain-length.
  • suitable enzymes may be obtained from extracts of the
  • the genetically modified yeast cells of the invention when grown on the modified growth medium of the invention are known to secrete fatty acids with chain- length longer than 20 carbon atoms.
  • LCFAs Long-Chain Fatty acids
  • the presence of Long-Chain Fatty acids (LCFAs) decreases the quality of the biodiesel by increasing its density and increasing the freezing point of the fuel-mixture, increasing their tendency to freeze in colder weathers.
  • the LCFAs are decarboxylated enzymatically by the means of LCFA decarboxylases present in the extracts of various insects like "honey bee" (Apis mellifera), Wood-termite (Cootermopsis angusticollis), Triatoma etc.
  • NCIM National centre for industrial microorganisms
  • the effect of growth temperature was analysed by adjusting the temperature of the growth medium to a temperature ranging from 15 to 45°C, as indicated in Figures 1 a. In all other tested fermentation conditions the growth medium in the bioreactor was maintained at a temperature of 30 °C.
  • the temperature Program Initial tempature 1 :100°C; hold 1 :2 min; rate 1 :10°C; temperature 2: 250°C; gold 2:25 min; Injection/Detector temperature: 250°C/250°C; carrier Flow: 30 ml/min; range: x10; attenuation: x1 ; 0
  • Table 2 Fatty acids content of the sample measured by GC, where the peaks in the chromatogram ( Figure 2), can be compared with the values in the table. The value corresponding to the peak signifies the presence of that particular chain length fatty acid (given in last column of the table)
  • fatty acid synthesis in micro-organisms adapts the membrane fatty acid profile (in particular its phospholipid content) in order to maintain its fluidity in response to changing growth temperature.
  • Higher temperatures stimulate synthesis of longer chain FAs with a higher boiling point, while lower temperatures stimulate synthesis of lower chain length FAs with lower density and boiling point.
  • the FAA2 gene was deleted Saccharomyces cerevisiae strain CEN-PK2 (MATa/MATa; ura3-52/ura3-52; trpl -289/trp1 -289; Ieu2-3,1 12/leu2-3,1 12; his3 D1/his3 D1 ; MAL2-8C/MAL2-8C; SUC2/SUC2) obtained from strain collection of CSM, and replaced with the 1 .1 kbp URA3 marker gene (derived from Kluyveromyces marxianus) conferring the capacity to synthesize uracil.
  • URA3 encodes orotidine 5-phosphate decarboxylase (ODCase), an enzyme involved in the synthesis of pyrimidine ribonucleotides.
  • Table 4 List of primers used for the purpose of gene deletion
  • Primer set 1 upstream: SEQ ID NO: 93; downstream: SEQ ID NO: 94,
  • Primer set 2 URA3 upstream flank fw: SEQ ID NO: 95; Rv: SEQ ID NO: 96, Primer set 3: FAA2 Fw: SEQ ID NO: 97; FAA2 Rv: SEQ ID NO: 98.
  • WT-strain genomic DNA was extracted and subjected to Fusion PCR where the URA 3 gene was inserted in place of the deleted FAA2 gene.
  • the yeast cells were transformed with URA3 according to protocol described by Gietz (Gietz, Jean et al. 1992). The transformed colonies were grown on SD-URA minimal medium plates. Colony PCR was conducted using Primer set 2, which clearly demonstrated the presence of the inserted URA3 gene and the loss of FAA2 gene in the mutant colonies. Stable mutant colonies were propagated on minimal media plates.
  • aternatve car on sources g ycero , xyose, geste ce u ose an em ce u oses, mannitol and other sugar-alcohols, xylan.
  • the fermentation conditions were multiphase comprising an initial 48 hours of aerobic growth, followed by 4 days of anaerobic conditions to facilitate the release of fatty acids into the medium.
  • the flasks were incubated in a water- bath at 30 ° C and shaken at a speed of 80 rpm for efficient mixing. After 6 days fermentation, the OD of the culture was measured and the cells were then removed from the liquid phase by centrifugation at 5000 rpm for 6 minutes.
  • the intra-cellular and extra-cellular fatty acids in the cells and the supernatant were extracted and quantified, according to Cocito and Delfini, 1994 supra. The only deviation from the protocol was that the extracellular fatty acids were extracted in the solvent diethyl ether instead of chloroform.
  • GC conditions for analysis of fatty acids employed a DBI capillary column, (30 m long and 0.25 mm i.d; film thickness 0.25 ⁇ ), with a temperature gradient of 40°C to 200°C at 6°C/min; 200°C for 15 minutes; 200°C to 260°C at 6°C/min; 260°C to 290°C at 2°C/min; an injector temperature of 280°C; detector temperature of 300°C; a split rate of 1 :20; using the carrier gas helium; and linear flow-rate of 1 .5ml/min; pressure 15.7 psig; and an injection volume of 1 -2 ⁇ .
  • the FAA2 gene was not detected in transformed colonies that were amplified with primer set 3 confirming the deletion of the FAA2 gene from the genome of the mutant yeast (wells 3-9, 11-17 in fig 6a, b).
  • the URA3 gene was clearly detected in several of the mutants colonies (wells 25, 26, 8, 30-33 in Fig 6a, b) amplified with primer set 2 thereby demonstrating the Aura3 deletion event.
  • the FAA2 deletion strain (FAA2Aura3) in Saccharomyces cerevisiae (AGPH-01) is deposited under the strain name CBS126804 with Centraalbureau voor Schimmelcultures, P.O Box 85167, 3508 AD Utrecht, NL on 26.04.2010 in conformity with rule 9.1 and 11.4(g) of the Budapest Treaty.
  • the FAA2A-stain and WT-strain were grown on Modified Wickerham's synthetic media with the specified carbon source, and fatty acids were extracted from the growth medium and cells respectively as set out under (2.0.0)
  • the Optical Density of the WT strain culture at the time of harvest was 11.
  • the yield of fatty acids at the end of organic extraction of the culture medium was 5 ml per 50 ml of sampled culture medium.
  • a crude sample of extracellularly secreted fatty acids, extracted from the culture medium, was separated by Gas-Chromatography and the components identified using Mass-Spectrometry (GC-MS).
  • the GC-MS graph in figure 7 shows various peaks having retention times (RT) corresponding to components (mostly fatty acids) of the test-sample. All peaks corresponding to more than 4% of the secreted lipids are listed in Table 6.
  • Table 6 Major extracellular fatty acids secreted by WT strain grown on 20% glucose.
  • the yield of pure fatty acids secreted by the WT-stain yeast was approximately 67 ml per liter of culture. 2.2.2. Intracellular fatty acid profile of WT strain grown on 20% glucose
  • the Optical Density of the WT strain culture at the time of harvest was 1 1 .
  • the yield of intracellular fatty acids extracted from cells from a 50 ml of sample was 0.5ml.
  • a sample of the extracted intracellular fatty acids was analysed by GC-MS.
  • the GC-MS graph in figure 8 shows various peaks having retention times (RT) corresponding to components (mostly fatty acids) of the test-sample. All peaks corresponding to more than 4% of the secreted lipids are listed in Table 7.
  • Table 7 Major intracellular fatty acids in WT strain grown on 20% glucose
  • the Optical Density of the culture at the time of harvest was 7.
  • the yield of saponifiable fatty acids at the end of organic extraction of the culture medium was 10 ml per 50 ml of sampled culture medium.
  • a sample of the extracted extracellular fatty acids was analysed by GC-MS
  • the GC-MS graph in figure 9 shows various peaks having retention times (RT) corresponding to components (mostly fatty acids) of the test-sample. All peaks corresponding to more than 4% of the secreted lipids are listed in Table 8.
  • Table 8 Major extracellular fatty acids secreted by FAA2A strain grown on 20% glucose
  • VLCFA Very Long Chain Fatty Acids
  • the Optical Density of the FAA2A strain culture at the time of harvest was 7.
  • the yield of intracellular fatty acids extracted from cells from a 50 ml of sample was 0.4ml.
  • a sample of the extracted intracellular fatty acids was analysed by GC-MS
  • the GC-MS graph in figure 10 shows various peaks having retention times (RT) corresponding to components (mostly fatty acids) of the test-sample. All peaks corresponding to more than 4% of the secreted lipids are listed in Table 9.
  • Table 9 Major intracellular fatty acids secreted by FAA2A strain grown on 20% glucose.
  • Table 10 Major extracellular fatty acids secreted by WT strain grown on 5% glycerol.
  • the yield of pure fatty acids secreted by the WT strain was approximately 60 ml per liter of culture. 2.2.6. Extracellular fatty acid profile of FAA2A ura3 strain grown on 5% glycerol
  • the yield of pure fatty acids (including siloxane) secreted by the FAA2A strain was approximately 32 ml per liter of culture (Table 12).
  • Table 12 Yields of secreted fatty acids by WT-strain and FAA2A strain
  • the FAA2A strain provides a 7%-8% increase in secreted pure fatty acids over the WT-strain, when grown on glucose as carbon source. When grown on glycerol, the yield of fatty acids decreases in both the FAA2A - and WT- stains, associated with a slower growth rate on this carbon source. The proportion of pure MCFAs secreted into the medium by the FAA2A strain was also increased by 16% over the WT-strain, if the VLCFA (tetratetracontane) produced by the WT-strain is excluded.
  • the major MCFAs secreted by the FAA2A strain were palmitic acid (C:16:0) and stearic acid (C18:0) and oleic acid (C:18:1 ).
  • the fatty acid-derivative of siloxane should be taken as the signal for the respective fatty acid in the original sample, due to a reaction between fatty acid esters in the sample with the stationary phase of the chromatography column.
  • VLCFAs are solid fats and essentially unsuitable as biodiesel.
  • the fatty acid elongase system (ELO1 , ELO2, ELO3) serves to elongate fatty acids of chain length 16 (MCFA) upward to 20-26 in Saccharomyces cerevisiae.
  • MCFA chain length 16
  • the high proportion of VLCFAs produced by the WT-strain suggests that the activity of the elongase system is elevated in presence of FAA2 gene. Deletion of FAA2 gene, surprisingly, stalls this loss of carbon into VLCFAs via the fatty acid elongase system.
  • the FAA2 deletion causes carbon flux to be channelled away from VLCFAs towards secretion of MCFAs, indicating a key role in determination of chain-length of fatty acid in yeast.
  • the maximum yield of fatty acids, directly suitable for biodiesel synthesis obtained from the FAA2A strain reached as high as 18- 20% from glucose.
  • the yield of fatty acids per mole of glycerol was comparable, but slightly higher than for glucose.
  • the growth conditions associated with anaerobic respiration lead to fatty acid secretion.
  • deletion of the FAA2 gene in yeast serves to inhibit MCFA catabolism and channels carbon flux into MCFAs, and enhances secretion of the fatty acids of this medium chain length (predominantly palmitic (C:16:0), stearic (C:18:0 ) and oleic (C:18:1 ) acids) providing a modified yeast stain of the invention adapted for biodiesel production.
  • Example 3 Use of Candida tropicalis for the production of fatty acids suitable for biodiesel
  • Candida tropicalis (DTU stain collection) was grown on Modified Wickerham's synthetic media with the specified carbon source, and fatty acids were extracted from the growth medium and cells respectively as set out under (2.0.0).
  • C. tropicalis grown on medium supplemented with either glucose or glycerol secretes the MCFA, palmitic acid, during the anaerobic fermentation phase.
  • the yield of secreted palmitic acid is high, corresponding to 120ml/ litre of growth medium.
  • C. tropicalis according to the present invention is a yeast stain that is particularly suited for biodiesel production.
  • Over-expression of the ACC1 gene in yeast is achieved by replacing the endogenous promoter of the native ACC1 gene with the TEF1 promoter from Saccharomyces cerevisiae [SEQ ID NO: 1 13], in order to obtain ACC1 over-expression in a genetically modified yeast.
  • a system for promoter replacement was based on a bipartite DNA molecule in which each of the two DNA fragments carries a target sequence, the sequence to be inserted, and a selectable marker gene, which is non-functional but homologous to some part of the same marker in the second fragment (Figure 15).
  • the first fragment contains the upstream sequence of ACC1 , direct repeat and the upstream 2/3 Kluyveromyces lactis (Kl) URA3.
  • the upstream which corresponded to the sequence in front of ACC1 promoter was amplified by primers ACC1 (SWA 3 and SWA4) using genomic DNA of wild type S. cerevisiae as a template.
  • Direct repeat with the upstream 2/3 Kl URA3 was amplified from pWJ1042 as template with primers SWA5 and 6 (Table 13).
  • Two PCR products were then fused together by primers SWA3 and 6.
  • To obtain the second fragment three PCR products were generated.
  • Direct repeat 2 SWA7 CTTGACGTTCGTTCGACTGATGAGC and Kl U RA3
  • the pfIB, pfIA, genes are amplified ( Figure 17) using their respective 5' and 3' forward and reverse primers (Table 14).
  • the genes are cloned by the "biobrick" assembly strategy of prefix and suffix insertions using the restriction enzymes EcoRI, Xbal, Spel, and Pstl.
  • the final constructs consist of pGal1 -gene-Adh1_Terminator and are transferred into yeast Tet-off based shuttle vector PCM 182 and PCM 183 ( Figure 18). The assembly is then ready to be transferred to any yeast system for fatty- acid production.
  • Primer PfIB forward - SEQ ID NO: 1 1 1 ; reverse - SEQ ID NO: 1 12.
  • Yeast strains were grown on the defined growth medium given in Table 5 (Modified Wickerham Synthetic Medium), where the selected sole carbon source was 20% Glucose.
  • the growth of the yeast strains, under fermentation growth conditions, and the subsequent extraction and analysis of extracellular lipids produced (fatty acid production) were as defined in Example 2.0.0.
  • the extracted fatty acids were concentrated to a volume 2 ml and was sent for GC-MS analysis.
  • the profile of fatty acids in the 2ml volume is set out in Table 15 and Figure 19.
  • the double mutants in strains 4, 5, 6 and 7, produce fatty acids comprising an increasing proportion of shorter chain-length fatty acids.
  • glycolytic pathway (glycerol » glyceraldehydes-3-phosphate) remains unused, thereby creating a NAD+ imbalance which hampers the growth of single mutants.
  • introduction of PFL system relieves the cellular system of this NADH imbalance and thus, we see better performance by double mutant strains with PFL system.
  • Yeast strains were grown on the defined growth medium given in Table 5 (Modified Wickerham Synthetic Medium), where the selected sole carbon source was 5% crude glycerol. The growth of the yeast strains, under fermentation growth conditions, and the subsequent extraction and analysis
  • Crude glycerol includes other components that may either promote or inhibit growth and fermentation of the yeast strains.
  • the single mutant strains 2 and 3 as well as the triple mutant 8 show the capacity to grow on crude glycerol and to produce more MCFAs than the WT strain.
  • Strain 10 is also surprisingly robust in its capacity to grow and ferment crude glycerol to fatty acids.
  • the importance of deletion of the FAA2 gene, and the activation of ACC1 gene for fatty acid production by fermentation on glycerol is also confirmed in the performance of strains 2, 3 and 8.
  • Yeast strains were grown on the defined growth medium given in Table 5 (Modified Wickerham Synthetic Medium), where the selected sole carbon source was on 15% xylose.
  • the growth of the yeast strains, under fermentation growth conditions, and the subsequent extraction and analysis of extracellular lipids produced (fatty acid production) were as defined in Example 2.0.0.
  • the extracted fatty acids were concentrated to a volume 2 ml and was sent for GC-MS analysis.
  • the profile of fatty acids in the 2ml volume is set out in Table 18 and Figure 22.
  • the strains 3, 4 5, and 8 were out-performed the WT in utilizing xylose, and producing fatty acids. Again the PFL system contributes to this 5 enhanced capacity to produce fatty acids in the single, double and triple mutant strains.
  • strain 8 The growth of the engineered yeast strains on digested lignocelluloses in the form of a wheat straw hydrolysate showed that the triple mutant strain (strain 8) produced more fatty acids than other engineered strains, while the single mutant FAA2 was also effective. Strain 8 however, has the additional advantage, compared to strain 2, in producing an even distribution of fatty acids of medium chain fatty acid range, important for biodiesel of the best quality. Furthermore, all of the fatty acids secreted by strain 8 are aliphatic, saturated fatty acids, while unsaturated fatty acids are distinctly present in the fatty acid profile of strain 2.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP11725783.2A 2010-06-18 2011-06-20 Herstellung von biodiesel mittels hefe aus lignocellulose und glycerin Withdrawn EP2582798A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP11725783.2A EP2582798A1 (de) 2010-06-18 2011-06-20 Herstellung von biodiesel mittels hefe aus lignocellulose und glycerin

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US35634410P 2010-06-18 2010-06-18
EP10169839 2010-07-16
PCT/EP2011/060237 WO2011157848A1 (en) 2010-06-18 2011-06-20 Production of biodiesel by yeast from lignocellulose and glycerol
EP11725783.2A EP2582798A1 (de) 2010-06-18 2011-06-20 Herstellung von biodiesel mittels hefe aus lignocellulose und glycerin

Publications (1)

Publication Number Publication Date
EP2582798A1 true EP2582798A1 (de) 2013-04-24

Family

ID=43067173

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11725783.2A Withdrawn EP2582798A1 (de) 2010-06-18 2011-06-20 Herstellung von biodiesel mittels hefe aus lignocellulose und glycerin

Country Status (6)

Country Link
EP (1) EP2582798A1 (de)
CN (1) CN103080305B (de)
AU (1) AU2011266953B2 (de)
BR (1) BR112012032279A2 (de)
CA (1) CA2802478A1 (de)
WO (1) WO2011157848A1 (de)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2601292T3 (en) 2010-08-06 2018-07-16 Biopetrolia Ab METHODS AND PRODUCTS FOR MANUFACTURING GROWERS
PT2753701T (pt) 2011-09-27 2018-08-10 Exxonmobil Res & Eng Co Acil-acp-sintases de éster ceroso
EP2820029A4 (de) * 2012-02-29 2015-12-23 Exxonmobil Res & Eng Co Vier-gene-signalweg für wachsestersynthese
US8962299B2 (en) 2012-02-29 2015-02-24 Exxonmobil Research And Engineering Company Four-gene pathway for wax ester synthesis
DE102012207921A1 (de) 2012-05-11 2013-11-14 Evonik Industries Ag Mehrstufiges Syntheseverfahren mit Synthesegas
WO2015013674A2 (en) * 2013-07-25 2015-01-29 The Regents Of The University Of California A yeast cell modified to overproduce fatty acid and fatty acid-derived compounds
SI3110930T1 (sl) 2014-02-28 2020-07-31 Delft Advanced Biofuels B.V. Postopek za ponovno pridobivanje lipidov ali ogljikovodikov
CN105543301B (zh) * 2016-01-08 2019-07-05 武汉科技大学 粗甘油与木质纤维素水解液共转化生产微生物油脂的方法
CN107384923B (zh) * 2017-08-01 2020-12-01 齐鲁工业大学 启动子pYLG及其在构建高产长链二元酸的热带假丝酵母中的应用

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001075136A1 (fr) * 2000-03-31 2001-10-11 Idemitsu Petrochemical Co., Ltd. Production de lipides et de micro-organismes secretant des lipides
WO2007136762A2 (en) * 2006-05-19 2007-11-29 Ls9, Inc. Production of fatty acids and derivatives thereof
CN101490241A (zh) * 2006-05-19 2009-07-22 Ls9公司 脂肪酸及其衍生物的制备
WO2008080124A2 (en) * 2006-12-21 2008-07-03 Gevo, Inc. Butanol production by metabolically engineered yeast
WO2008113041A2 (en) * 2007-03-14 2008-09-18 Ls9, Inc. Process for producing low molecular weight hydrocarbons from renewable resources
WO2008121701A1 (en) * 2007-03-30 2008-10-09 Cargill Inc. Metabolic engineering of yeasts for the production of 1-butanol
WO2009143495A2 (en) * 2008-05-22 2009-11-26 President And Fellows Of Harvard College Fast-growing yeast

Also Published As

Publication number Publication date
AU2011266953A1 (en) 2013-01-17
CN103080305A (zh) 2013-05-01
CA2802478A1 (en) 2011-12-22
CN103080305B (zh) 2014-12-24
AU2011266953A8 (en) 2013-02-21
WO2011157848A1 (en) 2011-12-22
AU2011266953B2 (en) 2014-09-18
BR112012032279A2 (pt) 2018-08-28

Similar Documents

Publication Publication Date Title
AU2011266953B2 (en) Production of Biodiesel by yeast from lignocellulose and glycerol
Tai et al. Engineering the push and pull of lipid biosynthesis in oleaginous yeast Yarrowia lipolytica for biofuel production
US9359581B2 (en) Biotransformation using genetically modified Candida
US9862977B2 (en) Engineered microbes and methods for microbial oil production
CA2901974C (en) Method for producing ethanol using recombinant yeast
CN107709540B (zh) 库德里阿兹威氏毕赤酵母ng7微生物及其用途
US9879248B2 (en) Engineered microbes and methods for microbial oil overproduction from cellulosic materials
US11142770B2 (en) Isolated oleaginous yeast
WO2011008231A2 (en) Biotransformation using genetically modified candida
US8999683B2 (en) Production of biodiesel by yeast from lignocellulose and glycerol
Qian et al. Valorization of crude glycerol into citric acid and malic acid by Yarrowia lipolytica
JP5817836B2 (ja) 組換え酵母を用いたエタノールの製造方法
CN113265343B (zh) 一种重组多形汉逊酵母的构建方法及其应用
WO2016162605A1 (en) Enhanced diacid production with genetically modified micro-organisms
CN118146967A (zh) 一种高效合成脂肪醇的菌株及其构建方法
CN102869768B (zh) 生产脂肪酸和脂肪酸衍生物的微生物工程
CN102869768A (zh) 生产脂肪酸和脂肪酸衍生物的微生物工程

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130116

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20140620

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20150904

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20160115