EP2283142A1 - Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite - Google Patents

Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite

Info

Publication number
EP2283142A1
EP2283142A1 EP09738158A EP09738158A EP2283142A1 EP 2283142 A1 EP2283142 A1 EP 2283142A1 EP 09738158 A EP09738158 A EP 09738158A EP 09738158 A EP09738158 A EP 09738158A EP 2283142 A1 EP2283142 A1 EP 2283142A1
Authority
EP
European Patent Office
Prior art keywords
lysine
microorganism
icd
isocitrate dehydrogenase
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09738158A
Other languages
German (de)
English (en)
Inventor
Andrea Herold
Hartwig Schröder
Weol Kyu Jeong
Corinna Klopprogge
Oskar Zelder
Stefan Haefner
Ulrike Richter
Judith Becker
Christoph Wittmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Priority to EP09738158A priority Critical patent/EP2283142A1/fr
Publication of EP2283142A1 publication Critical patent/EP2283142A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/02—Amides, e.g. chloramphenicol or polyamides; Imides or polyimides; Urethanes, i.e. compounds comprising N-C=O structural element or polyurethanes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/12—Methionine; Cysteine; Cystine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/20—Aspartic acid; Asparagine

Definitions

  • the present invention is directed to a method utilizing a microorganism with reduced isocitrate dehydrogenase activity for the production of fine chemicals.
  • Said fine chemicals may be amino acids, monomers for polymer synthesis, sugars, lipids, oils, fatty acids or vitamins, and are preferably amino acids of the aspartate family, especially methionine or lysine, or derivatives of said amino acids, especially cadaverine.
  • the present invention relates to a recombinant microorganism having a reduced isocitrate dehydrogenase activity in comparison to the initial microorganism and the use of such microorganism in producing fine chemicals such as aspartate family amino acids and their derivatives.
  • Fine chemicals which includes e.g. organic acids such as lactic acid, organic amines such as diaminopentane (cadaverine), proteogenic or non-proteogenic amino acids, carbohydrates, aromatic compounds, heteroaromatic compounds such as dipicolinate, vitamins and cofactors, saturated and unsaturated fatty acids, are typically used and needed in the pharmaceutical, agriculture, cosmetic as well as food and feed industry, but also as monomers for polymer synthesis. They are generally produced by chemical processes, but a growing number of fine chemicals is produced by fermentation processes as well.
  • organic acids such as lactic acid, organic amines such as diaminopentane (cadaverine), proteogenic or non-proteogenic amino acids, carbohydrates, aromatic compounds, heteroaromatic compounds such as dipicolinate, vitamins and cofactors, saturated and unsaturated fatty acids
  • amino acid methionine As regards for example the amino acid methionine, currently worldwide annual production amounts to about 500,000 tons.
  • the standard industrial production process is not by fermentation but a multi-step chemical process.
  • Methionine is the first limiting amino acid in livestock of poultry feed and due to this mainly applied as a feed supplement.
  • Various attempts have been published in the prior art to produce methionine by fermentation e.g. using microorganisms such as E. coli.
  • Other amino acids such as glutamate, lysine, and threonine, are produced by e.g. fermentation methods. For these purposes, certain microorganisms such as C. glutamicum have been proven to be particularly suited.
  • the production of amino acids by fermentation has the particular advantage that only L-amino acids are produced and that environmentally problematic chemicals such as solvents as they are typically used in chemical synthesis are avoided.
  • fine chemicals like dipicolinate, cadaverine or ⁇ -lysine
  • said compounds are used in diverse fields and generally produced by non- fermentative methods.
  • Dipicolinic acid also known as pyridine-2,6-dicarboxylic acid or DPA
  • DPA dipicolinic acid
  • monomer in the synthesis of polyester or polyamide type of copolymers
  • precursor for pyridine synthesis stabilizing agent for peroxides and peracids, for example t-butyl peroxide, dimethyl- cyclohexanon peroxide, peroxyacetic acid and peroxy-monosulphuric acid, ingredient for polishing solution of metal surfaces, stabilizing agent for organic materials susceptible to be deteriorated due to the presence of traces of metal ions (sequestrating effect), stabilizing agent for epoxy resins, and stabilizing agent for photographic solutions or emulsions (preventing the precipitation of calcium salts).
  • stabilizing agent for peroxides and peracids for example t-butyl peroxide, dimethyl- cyclohexanon peroxide, peroxyacetic acid and peroxy-monosulphuric acid
  • DPA is bio synthesized in endospores of bacteria.
  • An enzyme catalyzing the biosynthesis of DPA from dihydrodipicolinate is dipicolinate synthetase. Said enzyme has been isolated from Bacillus subtilis and further characterized. It is encoded by the spoVF operon (BG10781, BG10782).
  • L- ⁇ -lysine was identified in several strongly basic peptide antibiotics produced by Streptomyces. Antibiotics that yield L- ⁇ -lysine upon hydrolysis include viomycin, streptolin A, streptothricin, roseothricin and geomycin (Stadtman, Adv. Enzymol. Relat. Areas Molec. Biol. 38:413 (1973)).
  • ⁇ -Lysine is also a constituent of antibiotics produced by the fungi Nocardia, such as mycomycin, and ⁇ -lysine may be used to prepare other biologically active compounds.
  • the chemical synthesis of ⁇ -lysine is time consuming, requires expensive starting materials, and generally results in a racemic mixture.
  • 1,5-Diaminopentane is a relatively expensive specialty chemical which is currently produced by a chemical process (decarboxylation) of L-lysine. Diaminopentane produced by fermentation is not yet available on the market.
  • Corynebacterium glutamicum C glutamicum
  • Escherichia coli E. coli
  • Saccharomyces cerevisiae S. cerevisiae
  • Schizosaccharomyces pombe S. pombe
  • Pichia pastoris P. pastoris
  • Aspergillus niger Bacillus subtilis
  • Ashbya gossypii or Gluconobacter oxydans Especially Corynebacterium glutamicum is known for its ability to produce amino acids in large quantities, e.g., L-glutamate and L-lysine (Kinoshita, S. (1985) Glutamic acid bacteria; p. 115-142 in: A.L. Demain and N. A. Solomon (ed.), Biology of industrial microorganisms, Bejamin/Cummings Publishing Co., London).
  • desired amino acid is known to be non-desirable as it channels a lot of metabolic energy into formation of undesired by-products it may be contemplated to down- regulate expression of the respective enzymatic activity in order to favour only such metabolic reactions that ultimately lead to the formation of the amino acid in question.
  • Isocitrate dehydrogenase (ICD, sometimes also called IDH, EC 1.1.1.42, SEQ ID NO:3) is an enzyme which participates in the citric acid cycle (TCA) of, e.g., C. glutamicum. It catalyzes the third step of the cycle: the oxidative decarboxylation of isocitrate, producing alpha-ketoglutarate and CO 2 .
  • TCA citric acid cycle
  • the gene encoding ICD in C. glutamicum was identified, cloned and characterized by Eikmanns et al. (Eikmanns, B. et al, J. Bacteriol. (1995) 177:774-782). Inactivation of the chromosomal icd gene encoding ICD by knockout in C. glutamicum leads to glutamate auxotrophy (Eikmanns, B. et al., J. Bacteriol. (1995)
  • the present invention relates to a method for the production of fine chemicals using cells with a reduced activity of isocitrate dehydrogenase.
  • the downregulation of said enzyme was heretoforth unknown to lead to improved yields of certain biochemical products, especially of products downstream of aspartate.
  • the fine chemicals produced by the method according to present invention are preferably synthesized via intermediates of the bio synthetic pathways leading from aspartate to methionine and/or lysine.
  • the fine chemicals are preferably naturally occurring amino acids such as lysine, threonine, isoleucine or methionine, or nitrogen containing derivatives thereof, such as ⁇ -lysine, dipicolinate and 1,5- diaminopentane .
  • the cells used in the production method may be prokaryotes, lower eukaryotes, isolated plant cells, yeast cells, isolated insect cells or isolated mammalian cells, in particular cells in cell culture systems. In the context of present invention, the term "microorganism" is used for said kinds of cells.
  • a preferred kind of microorganism wherein the ICD activity is reduced for performing the present invention is a Corynebacterium wherein the ICD expression is reduced and particularly preferably a C. glutamicum wherein the ICD expression is reduced.
  • a recombinant microorganism which has a reduced ICD activity, and preferably comprises a modified nucleotide sequence leading to said reduced expression of ICD in the host cell also forms part of the invention.
  • a microorganism may be C. glutamicum.
  • the present invention also relates to the use of the aforementioned recombinant microorganism for producing fine chemicals, especially via intermediates of the biosynthetic pathways leading from aspartate to methionine and/or lysine. It may be particularly used for production of naturally occurring amino acids such as lysine, threonine, isoleucine or methionine. It may also be particularly used for production of nitrogen containing fine chemicals such as ⁇ -lysine, dipicolinate and 1,5- diaminopentane .
  • the following embodiments of the invention are provided: (1) a method for the production of fine chemicals, utilizing a microorganism with a partially or completely reduced isocitrate dehydrogenase (ICD) activity in comparison to a corresponding initial microorganism; (2) a recombinant microorganism with a partially or completely reduced isocitrate dehydrogenase (ICD) activity in comparison to a corresponding initial microorganism, with the proviso that the reduction of ICD expression is not due to the expression of a modified ICD encoding nucleotide sequence ⁇ icd sequence) instead of the native icd sequence of the microorganism wherein said modified icd encoding sequence is derived from the non- modified icd sequence such that at least one codon of the non-modified nucleotide sequence is replaced in the modified icd sequence by a less frequently used codon according to the codon usage of the host cell;
  • Fig. 1 Fermentative preparation of beta- lysine, dipicolinate and 1,5-diaminopentane in enzymatic reactions diverging from lysine biosynthesis.
  • the indicated enzymes are generally heterologous to the microorganism used in the fermentation.
  • IDH isocitrate dehydrogenase
  • ICD isocitrate dehydrogenase
  • ICD isocitrate dehydrogenase
  • a microorganism can include more than one microorganism, namely two, three, four, five etc. microorganisms of a kind.
  • a compound or amino acid mentioned in the context of present invention may have any stereochemistry, including a mixture of different steroisomers.
  • the amino acids, their precursors and derivatives have L- configuration. Specifically preferred configurations are indicated where appropriate.
  • the acids obtained by the method according to present invention may be in the form of a free acid, a partial or complete salt of said acid or in the form of mixtures of the acid and its salt.
  • the amines obtained by the method according to present invention may be in the form of a free amine, a partial or complete salt of said amine or in the form of mixtures of the amine and its salt.
  • the term "host cell” for the purposes of the present invention refers to any isolated cell that is commonly used for expression of nucleotide sequences for production of e.g. polypeptides or fine chemicals.
  • the term "host cell” relates to prokaryotes, lower eukaryotes, plant cells, yeast cells, insect cells or mammalian cell culture systems.
  • microorganism relates to prokaryotes, lower eukaryotes, isolated plant cells, yeast cells, isolated insect cells or isolated mammalian cells, in particular cells in cell culture systems.
  • the microorganisms suitable for performing the present invention comprise yeasts such as S. pombe or S. cerevisiae and Pichia pastoris.
  • Mammalian cell culture systems may be selected from the group comprising e.g.
  • a microorganism is preferably a prokaryote or a yeast cell.
  • Preferred microorganisms in the context of present invention are indicated below in the "detailed description" section. Particularly preferred are Corynebacteria.
  • Wild-type microorganism is, unless indicated otherwise, the common naturally occurring form of the indicated microorganism. Generally, a wild-type microorganism is a non- recombinant microorganism.
  • “Initial” is a synonym to "starting".
  • An “initial” nucleotide sequence or enzyme activity is the starting point for its modification, e.g. by mutation or addition of inhibitors.
  • Any “initial” sequence, enzyme or microorganism lacks a distinctive feature which its "final” or “modified” counterpart possesses and which is indicated in the specific context (e.g. a reduced ICD activity).
  • the term “initial” in the context of present invention encompasses the meaning of the term “native”, and in a preferred aspect is a synonym for "native". Any wild-type or mutant (non-recombinant or recombinant mutant) microorganism may be further modified by non-recombinant (e.g.
  • the initial, non-modified microoorganism is designated as "initial microorganism” or "initial (microorganism) strain". Any reduction of ICD activity in a microorganism in comparison to the initial strain with a given ICD expression level is determined by comparison of ICD activity in both microorganisms under comparable conditions.
  • microorganisms in accordance with the invention are obtained by introducing genetic alterations in an intial microorganism which does not carry said genetic alteration.
  • a "derivative" of a microorganism strain is a strain that is derived from its parent strain by e.g. classical mutagenesis and selection or by directed mutagenesis.
  • the strain C. glutamicum ATCC 130321ysC ftr (WO 2005/059093) is a lysine production strain derived from ATCC13032, as well as LUl 1424.
  • nucleic acid sequence or “nucleic acid sequence” for the purposes of the present invention relates to any nucleic acid molecule that encodes for polypeptides such as peptides, proteins etc. These nucleic acid molecules may be made of DNA, RNA or analogues thereof. However, nucleic acid molecules made of DNA are preferred.
  • Recombinant in the context of present invention means “being prepared by or the result of genetic engineering".
  • a “recombinant microorganism” comprises at least one "recombinant nucleic acid” or “recombinant protein”.
  • a recombinant microorganism preferably comprises an expression vector or cloning vector, or it has been genetically engineered to contain the cloned nucleic acid sequence(s) in the endogenous genome of the host cell.
  • Heterologous is any nucleic acid or polypeptide/protein introduced into a cell or organism by genetic engineering with respect to said cell or organism, and irrespectively of its organism of origin.
  • a DNA isolated from a microorganism and introduced into another microorganism of the same species is a heterologous DNA with respect to the latter, genetically modified microorganism in the context of present invention, even though the term “homologous” is sometimes used in the art for this kind of genetically engineered modifications.
  • the term “heterologous” is preferably addressing a non-homologous nucleic acid or polypeptide/protein in the context of present invention.
  • Heterologous protein/nucleic acid is synonymous to "recombinant protein/nucleic acid”.
  • express refers to expression of a gene product (e.g., a biosynthetic enzyme of a gene of a pathway) in a host organism.
  • the expression can be done by genetic alteration of the microorganism that is used as a starting organism.
  • a microorganism can be genetically altered (e.g., genetically engineered) to express a gene product at an increased level relative to that produced by the starting microorganism or in a comparable microorganism which has not been altered.
  • Genetic alteration includes, but is not limited to, altering or modifying regulatory sequences or sites associated with expression of a particular gene (e.g.
  • modifying the chromosomal location of a particular gene altering nucleic acid sequences adjacent to a particular gene such as a ribosome binding site or transcription terminator, increasing the copy number of a particular gene, modifying proteins (e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like) involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventional means of deregulating expression of a particular gene using routine in the art (including but not limited to use of antisense nucleic acid molecules, for example, to block expression of repressor proteins).
  • modifying proteins e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like
  • a “conservative amino acid exchange” means that one or more amino acids in an initial amino acid sequence are substituted by amino acids with similar chemical properties, e.g. VaI by Ala.
  • the ratio of substituted amino acids in comparison to the initial polypeptide sequence is preferably from 0 to 30% of the total amino acids of the initial amino acid sequence, more preferably from 0 to 15%, most preferably from O to 5%.
  • Conservative amino acid exchanges are preferably between the members of one of the following amino acid groups: acidic amino acids (aspartic and glutamic acid); - basic amino acids (lysine, arginine, histidine); hydrophobic amino acids (leucine, iso leucine, methionine, valine, alanine); hydrophilic amino acids (serine, glycine, alanine, threonine); amino acids having aliphatic side chains (glycine, alanine, valine, leucine, iso leucine); - amino acids having aliphatic-hydroxyl side chains (serine, threonine); amino acids having amide-containing side chains (asparagine, glutamine); amino acids having aromatic side chains (phenylalanine, tyrosine, tryptophan); amino acids having basic side chains (lysine, arginine, histidine); - amino acids having sulfur-containing side chains (cysteine, methionine). Specifically preferred conservative
  • isolated means "separate or purified from its organism of origin”. More specifically, an isolated cell of a multicellular organism is separate or has been purified from its organism of origin. This encompasses biochemically purified and recombinantly produced cells.
  • a "precursor" or “biochemical precursor” of an amino acid is a compound preceding ("upstream") the amino acid in the biochemical pathway leading to the formation of said amino acid in the microorganism of present invention, especially a compound formed in the last few steps of said biochemical pathway.
  • a "precursor" of lysine, methionine, threonine or iso leucine, i.e. of any amino acid of the aspartate family besides aspartate is any intermediate formed during biochemical conversion of aspartate to the respective amino acid in a wild-type organism in vivo.
  • the term “derivative” (with the exception of its use in the context “derivative of a microorganism”, see above) means any chemical compound derivable from (i) the amino acids of the aspartate family or (ii) their biochemical precursors in the biochemical pathways downstream of aspartate by enzymatic or non-enzymatic conversions, enzymatic conversions being preferred.
  • the conversion results in at least one of the following: (i) the removal of one or two carboxyl groups; (ii) the removal of one amino group; (iii) the shift of one amino group; and/or (iv) a dehydrogenation.
  • an “intermediate” or “intermediate product” is understood as a compound which is transiently or continuously formed during a chemical or biochemical process, in a not necessarily analytically directly detectable concentration.
  • Said intermediate may be removed from said biochemical process by a second, chemical or biochemical reaction, in particular by a subsequent enzymatic conversion as defined below in the detailed description section.
  • Said subsequent enzymatic conversion preferably takes place in the microorganism with a partially or completely reduced ICD activity according to present invention.
  • the microorganism comprises at least one heterologous enzyme catalyzing a reaction step in the subsequent conversion of the endogenous intermediate to the final product of the method.
  • the "aspartate family" of amino acids encompasses aspartate, asparagin, lysine, methionine, threonine and iso leucine, particularly the L-enantiomers of said amino acids. In a narrower sense, it encompasses lysine, methionine, threonine and iso leucine.
  • Carbon yield is the carbon amount found (of the product) per carbon amount consumed (of the carbon source used in the fermentation, usually a sugar), i.e. the carbon ratio of product to source.
  • ICD activity in the context of present invention means any enzymatic activity of ICD, especially any catalytic effect exerted by ICD. Specifically, the conversion of isocitrate into alpha-ketoglutarate is meant by "ICD activity”. ICD activity may be expressed as units per milligram of enzyme (specific activity) or as molecules of substrate transformed per minute per molecule of enzyme.
  • the present invention pertains to the biochemical transformation of amino acids and their precursors into fine chemicals by a microorganism with reduced ICD activity.
  • ICD The activity of ICD provides some of the NADPH/NADH necessary for the amino acid production in a cell. Thus, it did not seem obvious previous to the conception of present invention to reduce ICD activity in a cell in order to amplify its amino acid production, especially the production of amino acids of the aspartate family and their precursors.
  • the derivatives are synthesized by endogenous or heterologous enzymes, preferably by heterologous enzymes, particularly by the heterologous enyzmes as outlined in Fig. 1, by converting an amino acid of the aspartate family or one of its native precursors.
  • amino acids methionine and lysine and the derivatives cadaverine (1,5-diaminopentane), ⁇ -lysine and dipicolinate are of considerable interest as fine chemicals, especially the amino acids methionine and lysine and the derivatives cadaverine (1,5-diaminopentane), ⁇ -lysine and dipicolinate.
  • amino acids methionine and lysine and the derivatives cadaverine (1,5-diaminopentane), ⁇ -lysine and dipicolinate may be used as follows:
  • 1,5-diaminopentane polyamide monomer, polyurethane monomer, piperidine precursor beta-lysine: caprolactam precursor, polyamide monomer dipicolinate: polyester monomer, polyamide monomer, stabilizing agent.
  • the production method according to embodiment (1) is a fermentative method.
  • other methods of biotechno logical production of chemical compounds are also considered, including in vivo production in plants and non-human animals.
  • the method for the fermentative production of fine chemicals according to embodiment (1) may comprise the cultivation of at least one - preferably recombinant - microorganism having a reduced ICD activity such that the carbon flux through the glyoxylate shunt is increased.
  • the microorganism used in the production method is a recombinant microorganism.
  • the organism of choice is preferably a recombinant organism.
  • the isocitrate dehydrogenase activity in the microorganism used for the embodiment is partially or completely reduced.
  • a microorganism having a reduced ICD activity according to present invention has lost its initial ICD activity partially or completely when compared with an initial microorganism of the same species and genetical background.
  • the extent of reduction of activity is determined in comparison to the level of activity of the endogenous ICD activity in an initial microorganism under comparable conditions.
  • ICD activity An incomplete loss of ICD activity is preferred, as this keeps up the TCA and allows the microorganism to further produce glutamate and other bio molecules synthesized from alpha-ketoglutarate.
  • the cultivation media for the microorganism especially the media used in the production according to embodiment (1) may be supplemented by one or more essential compounds lacking in the microorganism due to the suppression of ICD activity.
  • glutamate may be supplemented to the media as it is an inexpensive, easiliy accessable compound.
  • the ICD activity reduction may be a reduction in activity of all, several or only one of the different kinds of ICD.
  • a specific reduction of less than all kinds of ICD is preferred for the reasons indicated above in context with the incomplete loss of ICD.
  • the reduction of ICD activity necessary for present invention may be either an endogenous trait of the microorganism used in the method according to embodiment (1), e.g. a trait due to spontaneous mutations, or due to any method known in the art for suppressing or inhibiting an enzymatic activity in part or completely, especially an enzymatic activity in vivo.
  • the reduction of enzymatic activity may occur at any stage of enzyme synthesis and enzyme reactions, at the genetic, transcription, translation or reaction level.
  • the decrease of ICD activity is preferably the result of genetic engineering.
  • any method known in the art may be applied.
  • a multitude of technologies such as gene knockout approaches, antisense technology, RNAi technology etc. are available.
  • the ICD activity is reduced due to partial or complete reduction of ICD expression.
  • “Reducing the expression of at least one ICD in a microorganism” refers to any reduction of expression in a microorganism in comparison to an initial microorganism with a given ICD expression level. This, of course, assumes that the comparison is made for comparable host cell types, comparable genetic background situations etc.. Preferably, the reduction of expression is achieved as listed above or described in the following.
  • the microorganism has lost its initial ICD activity due to a decrease in ICD expression, preferably a decrease by at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%, with the extent of reduction of expression being determined in comparison to the level of expression of the polypeptide in an initial microorganism.
  • the extent of reduction of expression is determined in comparison to the level of expression of the endogenous ICD that is expressed from the initial icd nucleotide sequence in an intial microorganism under comparable conditions.
  • the reduction of ICD expression may concern one, several or all icd genes.
  • a specific reduction of expression of less than all icd genes is preferred for the reasons indicated above in context with the incomplete loss of ICD.
  • "reduction of expression” means the situation that if one replaces an endogenous nucleotide sequence coding for a polypeptide with a modified nucleotide sequence that encodes for a polypeptide of substantially the same amino acid sequence and/or function, a reduced amount of the encoded polypeptide will be expressed within the modified cells.
  • a specific aspect of this downregulation mode is the knock-out of the icd gene (compare example 4). It may be achieved by any known knock-out protocol suitable for the microorganism in question. Particularly preferred methods for knock-out and for production of fine chemicals using the resulting knock-out mutants are described in example 4.
  • the knock-out of the icd may lead to complete or near-complete loss of ICD activity.
  • a supplementation of the culturing media with deficient ICD-dependent products like glutamate may be necessary for knock-out mutants.
  • reduction of expression means the down-regulation of expression by antisense technology or RNA interference (where applicable, e.g. in eucaryotic cell cultures) to interfere with gene expression. These techniques may affect icd mRNA levels and/or icd translational efficiency.
  • "reduction of expression” means the deletion or disruption of the icd gene combined with the introduction of a "weak” icd gene, i.e. a gene encoding an ICD whose enzymatic activity is lower than the initial ICD activity, or by integration of the icd site at a weakly expressed site resulting in less ICD activity inside the cell.
  • a "weak” icd gene i.e. a gene encoding an ICD whose enzymatic activity is lower than the initial ICD activity, or by integration of the icd site at a weakly expressed site resulting in less ICD activity inside the cell.
  • This may be done by integrating the icd gene at a chromosomal locus from which genes are less well transcribed, or by introducing a mutant or heterologous icd gene with lower specific activity or which is less efficiently transcribed, less efficiently translated or less stable in the cell.
  • the introduction of this mutant icd gene can be performed by using a replicating plasmi
  • ICD activity is the result of lowering the mRNA levels by lowering transcripton from the chromosomally encoded icd gene, preferably by mutation of the initial promoter or replacement of the initial ICD promoter by a weakened version of said promoter or by a weaker heterologous promoter. Particularly preferred methods for performing this aspect and for production of fine chemicals using the resulting mutants are described in example 6.
  • "reduction of expression” means that the reduced ICD activity is the result of RBS mutation leading to a decreased binding of ribosomes to the translation initiation site and thus to a decreased translation of icd mRNA.
  • the mutation can either be a simple nucleotide change and/or also affect the spacing of the RBS in relation to the start codon.
  • a mutant library containing a set of mutated RBSs may be generated.
  • a suitable RBS may be selected, e.g. by selecting for lower ICD activity.
  • the initial RBS may then be replaced by the selected RBS. Particularly preferred methods for performing this aspect and for production of fine chemicals using the resulting mutants are described in example 6.
  • "reduction of expression” is achieved by lowering mRNA levels by decreasing the stability of the mRNA, e.g. by changing the secondary structure.
  • icd regulators e.g. transcriptional regulators.
  • a specific method for dowregulating ICD expression in yet a further preferred aspect is the codon usage method described in PCT/EP2007/061151, which is hereby incorporated by reference inasfar as application of the codon usage method for downregulating ICD activity in microorganisms, especially in Corynebacterium and E. coli is concerned.
  • PCT/EP2007/061151 describes a method of reducing the amount of at least one polypeptide in a host cell, comprising the step of expressing in said host cell a modified nucleotide sequence instead of a non-modified nucleotide sequence encoding for a polypeptide of substantially the same amino acid sequence and/or function wherein said modified nucleotide sequence is derived from the non- modified nucleotide sequence such that at least one codon of the non-modified nucleotide sequence is replaced in the modified nucleotide sequence by a less frequently used codon according to the codon usage of the host cell.
  • modified nucleotide sequences that are to be expressed in Corynebacterium and particularly preferably in C. glutamicum for reducing the amount of the ICD, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, preferably at least 1%, at least 2%, at least 4%, at least 6%, at least 8%, at least 10%, more preferably at least 20%, at least 40%, at least 60%, at least 80%, even more preferably at least 90% or least 95% and most preferably all of the codons of the non-modified nucleotide sequences may be replaced in the modified nucleotide sequence by less frequently used codons for the respective amino acid.
  • the afore-mentioned number of codons to be replaced refers to frequent, very frequent, extremely frequent or the most frequent codons.
  • the above number of codons are replaced by the least frequently used codons.
  • the reference codon usage be based on the codon usage of the Corynebacterium and preferably C. glutamicum and preferably on the codon usage of abundant proteins of Corynebacterium and preferably C. glutamicum. See also PCT/EP2007/061151 for detailed explanation.
  • a particularly preferred aspect of the invention relates to a method wherein the decrease of the expression of isocitrate dehydrogenase in a microorganism is achieved by adapting the codon usage as described in PCT/EP2007/061151.
  • the microorganism can be a Corynebacterium, with C. glutamicum being preferred.
  • These methods may be used to improve synthesis of amino acids and particularly of methionine and/or lysine as well as of derivatives thereof and derivatives of the precursors of said amino acids, such as 1,5-diaminopentane, ⁇ -lysine and dipicolinate.
  • microorganisms with a reduced ICD activity due to application of the codon usage method described in PCT/EP2007/061151 are in one preferred aspect of present invention the microorganisms of choice for performing the method according to embodiment (1).
  • Microorganisms with a reduced ICD activity due to replacement of their start codon, e.g. of ATG, are particularly preferred, especially a microorganism wherein the start codon ATG has been replaced by GTG.
  • PCT/EP2007/061151 does especially describe the reduction of ICD in C.
  • microorganisms with a reduced ICD activity due to application of the codon usage method described in PCT/EP2007/061151 are excluded from being the microorganisms of choice in the method according to embodiment (1).
  • the method of embodiment (1) is an embodiment of present invention with the proviso that the reduction of ICD expression is not due to the expression of a modified ICD encoding nucleotide sequence (icd sequence) instead of the native icd sequence of the microorganism wherein said modified icd encoding sequence is derived from the non-modified icd sequence such that at least one codon of the non- modified nucleotide sequence is replaced in the modified icd sequence by a less frequently used codon according to the codon usage of the host cell.
  • icd sequence a modified ICD encoding nucleotide sequence
  • the method of embodiment (1) is an embodiment of present invention with the proviso that the reduction of ICD expression is not due to modified codon usage as described in PCT/EP2007/061151 and that no microorganism described in PCT/EP2007/061151 is used.
  • the method of embodiment (1) is an embodiment of present invention with the proviso that, when the fine chemicals are selected from the group consisting of lysine, threonine and methionine, the reduction of ICD expression is not due to the expression of a modified ICD encoding nucleotide sequence (icd sequence) instead of the native icd sequence of the microorganism wherein said modified icd encoding sequence is derived from the non-modified icd sequence such that at least one codon of the non-modified nucleotide sequence is replaced in the modified icd sequence by a less frequently used codon according to the codon usage of the microorganism.
  • icd sequence a modified ICD encoding nucleotide sequence
  • Said provisos do not apply to production of fine chemicals with a microorganism whose ICD expression is reduced due to modified codon usage as described in PCT/EP2007/061151 and which in addition comprises a heterologous enzyme catalyzing the conversion of an endogenous biosynthetic intermediate or final product of the microorganism into a non-native target compound of the fine chemical synthesis (see below).
  • said heterologous enzyme is selected from the group consisting of enzymes catalyzing one or more steps in the synthesis or biosynthesis of fine chemicals, particularly of fine chemicals derivable from lysine or its biochemical precursors downstream of aspartate via enzymatic conversion.
  • it is an enzyme catalyzing a decarboxylation, a deamination, a transamination, the shift of an amino group along an organic molecule, an oxidation and/or cyclisation reaction. Even more preferably, it is selected from the group consisting of dipicolinate synthase, lysine decarboxylase and lysine 2,3- aminomutase. Particularly preferred is a microorganism comprising a heterologous dipicolinate synthase, lysine decarboxylase or lysine 2,3-aminomutase. In other words, in this particularly preferred embodiment, the microorganism may have reduced ICD activity due to modified codon usage as described in
  • PCT/EP2007/061151 may even be a microorganism described in PCT/EP2007/061151, but additionally comprises a heterologous dipicolinate synthase, lysine decarboxylase or lysine 2,3-aminomutase.
  • the preparation of fine chemicals according to embodiment (1) of present invention may be performed with a microorganism whose ICD acitivity is reduced due to codon usage as described in PCT/EP2007/061151 if the fine chemical is none of the fine chemicals listed in PCT/EP2007/061151. Therefore, as the biochemical precursors of amino acids in the biochemical pathways downstream of aspartate (e.g.
  • precursors of the amino acids lysine, methionine, threonine and isoleucine, like 2,3-dihydrodipicolinate, diaminopimelate, homoserine, homocysteine and 2,3- dihydroxy-3-methylvalerate), and native or non-native derivatives of said amino acids or biochemical precursors are not listed as products of the microorganisms described in PCT/EP2007/061151, a compound selected from said group of precursors and derivatives is the preferred product of the method according to embodiment (1).
  • a derivate preferably a non-native derivate, of said amino acids or precursors, particularly of lysine or one of its native precursors downstream of aspartate (e.g. 2,3-dihydrodipicolinate).
  • the ICD activity is reduced due to partial or complete inhibition of the enzyme.
  • the inhibition may be the result of binding of any known reversible or irreversible ICD inhibitor to ICD.
  • ICD inhibitors are known in the art, e.g. oxaloacetate, 2-oxoglutarate and citrate which are known as weak inhibitors of ICD in C. glutamicum, or oxaloacetate plus glyoxylate, which are known as strong inhibitors (Eikmanns et al (1995) loc. cit.).
  • Said inhibitor may either be added to the fermentation medium, or its synthesis inside the cell may be induced by an external stimulus.
  • the reduced ICD activity is the result of genetically engineering a host cell (preferably a microorganism, especially a Corynebacterium), but not the result of reduced ICD expression.
  • deleting the initial copy of an icd gene and replacing it with a mutant version encoding an ICD that shows decreased ICD activity or with a heterologous icd gene encoding an ICD having less ICD activity than the initial ICD leads to a decrease in ICD activity of the microorganism of present invention.
  • Particularly preferred methods for performing this aspect and for production of fine chemicals using the resulting mutants are described in example 5.
  • a combination of two or more of the aforementioned features leading to ICD activity reduction is realized in the microorganism according present invention.
  • a preferred method in accordance with embodiment (1) of the present invention comprises the step of reducing the ICD acitivity in a microorganism, preferably in Corynebacteria and more preferably in C. glutamicum, wherein the above principles are used.
  • the increase in biosysnthesis of members of the aspartate family and of their precursors formed by biotransformation of aspartate in a microorganism with reduced ICD activity may be due to an increased carbon flux through PPP and glyoxylate shunt as a result of ICD inhibition.
  • the former leads to provision of sufficient reduction equivalents, i.e. NAD(P)H, for amino acid production, the latter provides the necessary carbon precursors for biosynthesis of amino acids of the aspartate family.
  • the pentose phosphate pathway is increased in comparison to a wild-type microorganism.
  • the carbon flux through the glyoxylate shunt is increased. Any of said increases may be the result of the ICD activity reduction, the result of genetically engineering the microorganism, a native trait of the microorganism, or a combination of any of these factors.
  • the increased carbon flux through the glyoxylate shunt is preferably the result of the ICD activity reduction and/or of genetically engineering the microorganism.
  • the increased carbon flux through PPP is preferably the result of genetically engineering the microorganism, more preferably the result of an active upregulation of the PPP enzyme expression level, e.g. by using a strong promoter like Psod (WO 2005/059144).
  • the present invention pertains to microorganisms and to the use of microorganisms in fine chemical production.
  • use of other organisms besides microorganisms in the production method according to embodiment (1) and instead of the microorganism according to embodiment (2) is also contemplated.
  • the term "organism" for the purposes of the present invention refers to any non-human organism that is commonly used for expression of nucleotide sequences for production of fine chemicals, in particular microorganisms as defined above, plants including algae and mosses, yeasts, and non-human animals.
  • Organisms besides microorganisms which are particularly suitable for fine chemical production are plants and plant parts.
  • Such plants may be monocots or dicots such as monocotyledonous or dicotyledonous crop plants, food plants or forage plants.
  • monocotyledonous plants are plants belonging to the genera of avena (oats), triticum (wheat), secale (rye), hordeum (barley), oryza (rice), panicum, pennisetum, setaria, sorghum (millet), zea (maize) and the like.
  • Dicotyledonous crop plants comprise inter alia cotton, leguminoses like pulse and in particular alfalfa, soybean, rapeseed, tomato, sugar beet, potato, ornamental plants as well as trees.
  • Further crop plants can comprise fruits (in particular apples, pears, cherries, grapes, citrus, pineapple and bananas), oil palms, tea bushes, cacao trees and coffee trees, tobacco, sisal as well as, concerning medicinal plants, rauwolfia and digitalis.
  • Particularly preferred are the grains wheat, rye, oats, barley, rice, maize and millet, sugar beet, rapeseed, soy, tomato, potato and tobacco.
  • Further crop plants can be taken from US 6,137,030.
  • a non- fermentative production method may be applied.
  • any microorganism as defined above may be used.
  • the microorganism is a prokaryote.
  • Particularly preferred for performing the present invention are microorganisms being selected from the genus of Corynebacterium and Brevibacterium, preferably Corynebacterium, with a particular focus on Corynebacterium glutamicum, the genus of Escherichia with a particular focus on Escherichia coli, the genus of Bacillus, particularly Bacillus subtilis, the genus of Streptomyces and the genus of Aspergillus.
  • a preferred embodiment of the invention relates to the use of microorganisms which are selected from coryneform bacteria such as bacteria of the genus Corynebacterium. Particularly preferred are the species Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium callunae, Corynebacterium ammoniagenes, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium effiziens.
  • Other preferred embodiments of the invention relate to the use of Brevibacteria and particularly the species Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divarecatum.
  • the microorganism may be selected from the group consisting of Corynebacterium glutamicum ATCC 13032, C. acetoglutamicum ATCC 15806, C acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERMBP- 1539, Corynebacterium melassecola ATCC17965, Corynebacterium effiziens DSM 44547, Corynebacterium effiziens DSM 44549, Brevibacterium flavum ATCC14067, Brevibacterium lactoformentum ATCC13869, Brevibacterium divarecatum ATCC 14020, Corynebacterium glutamicum KFCC 10065 and Corynebacterium glutamicum ATCC21608 as well as strains that are derived thereof by e.g. classical mutagenesis and selection or by directed mutagenesis.
  • C. glutamicum may be selected from the group consisting of ATCC13058, ATCC13059, ATCC13060, ATCC21492, ATCC21513, ATCC21526, ATCC21543, ATCC13287, ATCC21851, ATCC21253, ATCC21514, ATCC21516, ATCC21299, ATCC21300, ATCC39684, ATCC21488, ATCC21649, ATCC21650, ATCC19223, ATCC13869, ATCC21157, ATCC21158, ATCC21159, ATCC21355, ATCC31808, ATCC21674, ATCC21562, ATCC21563, ATCC21564, ATCC21565, ATCC21566, ATCC21567, ATCC21568, ATCC21569, ATCC21570, ATCC21571, ATCC21572, ATCC21573, ATCC21579, ATCC19049, ATCC19050, ATCC19051, ATCC19052, ATCC19053, ATCC19054, ATCC
  • the abbreviation KFCC stands for Korean Federation of Culture Collection
  • ATCC stands for American-Type Strain Culture Collection
  • DSM stands for Deutsche Sammlung von Mikroorganismen und Zellkulturen.
  • the abbreviation NRRL stands for ARS cultures collection Northern Regional Research Laboratory, Peorea, IL, USA.
  • Corynebacterium glutamicum that are already capable of producing fine chemicals such as L-lysine, L-methionine, L-isoleucine and/or L-threonine are particularly preferred for performing present invention.
  • Such a strain is e.g. Corynebacterium glutamicum ATCC 13032, and especially derivatives thereof.
  • Corynebacterium glutamicum strains that are already capable of producing fine chemicals such as L-lysine, L-methionine and/or L-threonine. Therefore strains derived from Corynebacterium glutamicum having a feedback-resistant aspartokinase and derivatives thereof are particularly preferred. This preference encompasses strains derived from Corynebacterium glutamicum ATCC 13032 having a feedback-resistant aspartokinase, and particularly concerns the strains LUl 1424, ATCC130321ysC ftr and ATCC13286.
  • C glutamicum LUl 1424, ATCC130321ysC ftr , ATCC13032 or ATCC13286 and derivatives thereof having a feedback-resistant aspartokinase are specifically preferred microorganisms in the context of present invention. Most preferred are LUl 1424, ATCC130321ysC fcr or ATCC 13286 and derivatives thereof, LUl 1424 being especially preferred.
  • C glutamicum strains for replacing the endogenous copy of icd.
  • a C glutamicum lysine production strain such as for example ATCC13032 lysC ftr , LUl 1424 or other derivatives of ATCC13032 or ATCC13286.
  • ATCC 13032 lysC ftr may be produced starting from ATCC 13032.
  • an allelic exchange of the lysC wild type gene is performed in C glutamicum ATCC 13032.
  • a nucleotide exchange is introduced into the lysC gene such that the resulting protein carries an iso leucine at position 311 instead of threonine.
  • the detailed construction of this strain is described in patent application WO 2005/059093.
  • the accession no. of the lysC gene is P26512.
  • LUl 1424 may be produced as described in example 1. It is a derivative of ATCC13032 lysC ftr .
  • the ICD activity in LUl 1424 is preferably reduced by replacement of ATG as start codon of the isocitrate dehydrogenase encoding nucleotide sequence, preferably by replacement of ATG with GTG.
  • the strain described in example 1 wherein the icd start codon was changed is especially preferred in the context of present invention (i.e. the strain ICD ATG — > GTG).
  • any ATCC 13032 derivative having one or more of the modifications listed in example 1 for LUl 1424 and having a reduced ICD activity is also considered to be a preferred strain for performing the present invention.
  • microorganisms listed above will display a partially or completely reduced ICD activity.
  • Preferred microorganisms in the context of present invention are recombinant microorganisms whose reduced ICD activity is the result of genetic engineering, e.g. the strain ICD ATG — > GTG described in example 1.
  • Embodiment (1) of present invention concerns the use of an aforementioned microorganism having a reduced ICD activity to produce fine chemicals.
  • fine chemicals is well known to the person skilled in the art and designates compounds which can be used in different parts of the pharmaceutical industry, agricultural industry as well as in the cosmetics, food and feed industry.
  • fine chemicals does also include monomers for polymer synthesis.
  • Fine chemicals can be final products or intermediates which are needed for further synthesis steps.
  • fine chemicals is synonymous to "a fine chemical", i.e. to just one kind of compound.
  • the production of a fine chemical, i.e. just one kind of target compound, by the method and microorganism of present invention is preferred.
  • Fine chemicals are defined as all organic molecules which contain at least two carbon atoms and additionally at least one heteroatom which is not a carbon or hydrogen atom.
  • fine chemicals relates to organic molecules that comprise at least two carbon atoms and additionally at least one functional group, such as an hydroxy-, amino-, thiol-, carbonyl-, carboxy-, methoxy-, ether-, ester-, amido-, phosphoester-, thioether- or thioester-group.
  • Fine chemicals thus preferably comprise organic acids such as lactic acid, succinic acid, tartaric acid, itaconic acid etc. Fine chemicals further comprise amino acids, purine and pyrimidine bases, nucleotides, lipids, saturated and unsaturated fatty acids such as arachidonic acid, alcohols, e.g. diols such as propandiol and butandiol, carbohydrates such as hyaluronic acid and trehalose, aromatic compounds such as vanillin, vitamins and cofactors etc. Trehalose and the fine chemicals described in the following sections are preferred.
  • a particularly preferred group of fine chemicals for the purposes of the present invention are biosynthetic products being selected from the group consisting of organic acids, amino acids, organic amines, and heteroaromatic compounds comprising one or two nitrogens in the aromatic ring.
  • fine chemicals in the context of present invention pertains to molecules comprising at least three aromatic or aliphatic carbon atoms and additionally at least one carboxy- or amino-group, even more preferably one or two carboxy- and/or amino groups.
  • the fine chemicals produced by the method and/or microorganism of present invention are compounds having formula I or II or salts thereof:
  • Rl is -COOH or H, and R2 and R3 are independently of each other NH 2 or H; and wherein the following combinations are preferred:
  • the method according to embodiment (1) is particularly suitable for producing a compound selected from the group consisiting of (i) the amino acids of the aspartate family, especially lysine, (ii) their biochemical precursors in the biochemical pathways downstream of aspartate, and
  • non-native derivatives especially non-native enzymatic derivatives, and of amino acids is preferred.
  • production of a non-native derivative of lysine or of a non-native derivative of one of its precursors, i.e. of an intermediate in the bioconversion of aspartate into lysine is preferred.
  • Specifically preferred final products of the method according to present invention are selected from the group consisting of lysine, methionine, threonine, iso leucine, 1,5- diaminopentane, ⁇ -lysine and dipicolinate. More preferably, the final products are selected from the derivatives (iii) comprised in the group of preferred final products, i.e. from the group consisting of 1,5-diaminopentane, ⁇ -lysine and dipicolinate. The production of 1,5-diaminopentane (cadverine) is most preferred.
  • a compound selected from the group consisting of the amino acids of the aspartate family and their biochemical precursors is produced as intermediate or final product.
  • an amino acid selected from the group consisting of aspartate, lysine, methionine, iso leucine and threonine is the final product of the method according to embodiment (1), wherein lysine, methionine, isoleucine and threonine, and especially lysine are preferred as final products.
  • the L-enantiomers are especially preferred.
  • a biochemical precursor of an amino acid selected from the group consisting of lysine, methionine, isoleucine and threonine, which lies downstream of aspartate in the biosynthesis of the respective amino acid is the final product of the method according to embodiment (1).
  • said amino acid or amino acid precursor is an intermediate product and is subsequently converted enzymatically or nonenzymatically into an derivative thereof, preferably into an organic amine, organic acid, or amino acid, in the method according to embodiment (1).
  • the final product is a non-native derivative of said intermediate product.
  • a particularly preferred intermediate product which is subsequently converted is lysine or one of its biochemical precursors downstream of aspartate. Of said precursors, dihydrodipicolinate is especially preferred.
  • the term "derivative” means any chemical compound derivable from (i) the amino acids of the aspartate family or (ii) their biochemical precursors in the biochemical pathways downstream of aspartate by enzymatic or non-enzymatic conversions, enzymatic conversions being preferred.
  • the conversion results in at least one of the following:
  • said subsequent conversion is preferably an enzymatic conversion or does at least comprise one enzymatic step.
  • the enzyme catalyzing said conversion may be endogenous or heterologous to the microorganism with reduced ICD activity. It is preferably heterologous.
  • the subsequent conversion preferably happens in the reaction mixture comprising the microorganism as defined in embodiment (1). It may be catalyzed by an isolated enzyme added to the reaction mixture, by a second microorganism besides the microorganism with reduced ICD activity, or by the microorganism with reduced ICD activity itself. It preferably is catalyzed by the microorganism with reduced ICD activity itself.
  • a preferred aspect of the method according to embodiment (1) therefore comprises the subsequent enzymatic conversion as defined above taking place in the microorganism with a partially or completely reduced ICD activity.
  • the microorganism preferably comprises at least one heterologous enzyme catalyzing a reaction step in the subsequent conversion of the endogenous intermediate to the final product of the method.
  • Said heterologous enzyme in the microorganism with reduced ICD activity may be any enzyme which is able to convert an endogenous biosynthetic intermediate or final product of the microorganism into the target compound of the fine chemical synthesis.
  • it is selected from the group consisting of enzymes catalyzing one or more steps in the synthesis or biosynthesis of fine chemicals, particularly of fine chemicals derivable from lysine or its biochemical precursors downstream of aspartate via enzymatic conversion. More preferably, it is an enzyme catalyzing a decarboxylation, a deamination, a transamination, the shift of an amino group along an organic molecule, an oxidation and/or cyclisation reaction. Even more preferably, it is selected from the group consisting of dipicolinate synthase, lysine decarboxylase and lysine 2,3-aminomutase. Particularly preferred is a microorganism comprising a heterologous dipicolinate synthase, lysine decarboxylase or lysine 2,3-aminomutase.
  • the microorganism comprises at least one heterologous enzyme as defined in the previous section.
  • a microorganism optimized for the preparation of one of the products selected from the group consisting of dipicolinate, 1,5-diaminopentane and ⁇ -lysine as follows: dipicolinate: microorganism with heterologous dipicolinate synthase; 1,5-diaminopentane: microorganism with heterologous lysine decarboxylase; ⁇ -lysine: microorganism with heterologous lysine 2,3-aminomutase.
  • a microorganism may be used which does not only possess reduced ICD activity, but is also specifically adapted for production of the desired final product. This adaptation may be due to a repression or reduction of enzyme activities known to be responsible for the synthesis of unwanted by-products/side products. Lowering the amount or activity of an enzyme that forms part of a biosynthetic pathway may allow increasing synthesis of the aforementioned fine chemicals by e.g. shutting off production of by-products and by channelling metabolic flux into a preferred direction.
  • this adaptation may be due to an increased activity of enzymes or metabolic pathways known to enhance fine chemical production.
  • said adaption of the microorganism encompasses an increase of activity and/or expression of an enzyme which catalyzes one or more than one of the conversion steps leading up to the desired final product, in particular of an enzyme catalyzing a conversion step downstream of aspartate, more particularly of an enzyme catalysing a conversion step in the conversion of aspartate to lysine or a heterologous enzyme catalyzing the conversion of an endogenous biosynthetic intermediate or final product of the microorganism into a non-native target compound of the fine chemical synthesis.
  • said adaptation is due to genetic engineering leading to the presence of at least one heterologous enzyme in the microorganism which enhances the production of the target fine chemical or is even essential for said production as the wild-type microorganism is unable to synthesize the target compound.
  • a particularly preferred microorganism for performing said method has not only a reduced ICD activity, but in addition comprises a lysine decarboxylase.
  • Said decarboxylase is preferably a heterologous (recombinant) lysine decarboxylase.
  • the microorganism has the ability to produce lysine and to convert it into cadaverine.
  • the lysine decarboxylase is a heterologous lysine decarboxylase as described in WO 2007/113127.
  • Lysine decarboxylase (EC 4.1.1.18) catalyzes the decarboxylation of L-lysine into cadaverine.
  • the enzymes from E. coli having lysine decarboxylase activity are the cadA (SEQ ID NO: 10) gene product (SEQ ID NO: 11; Kyoto Encyclopedia of Genes and Genomes, Entry b4131) and the ldcC (SEQ ID NO: 12) gene product (SEQ ID NO: 13; Kyoto Encyclopedia of Genes and Genomes, Entry JW0181).
  • DNA molecules encoding the E. coli lysine decarboxylase can be obtained by screening cDNA or genomic libraries with polynucleotide probes having nucleotide sequences reverse-translated from the amino acid sequence of SEQ ID NO:11 or 13.
  • the E. coli lysine decarboxylase genes can be obtained by synthesizing DNA molecules using mutually priming long oligonucleotides or PCR. See, for example, Ausubel et al, (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, pages 8.2.8 to 8.2.13 (1990), Wosnick et al., Gene 60:115 (1987); Ausubel et al. (eds.), SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 3rd Edition, pages 8-8 to 8-9, John Wiley & Sons, Inc. (1995); and the further citations provided in WO 2007/113127 in connection with DNA synthesis, which are hereby incorporated by reference.
  • Variants of E. coli lysine decarboxylase that contain conservative amino acid changes as defined above in comparison to the parent enzyme may also be used. See also WO 2007/113127.
  • Conservative amino acid changes in the E. coli lysine decarboxylase can be introduced by substituting nucleotides for the nucleotides recited in SEQ ID NO: 10 or 12.
  • Such "conservative amino acid" variants can be obtained, for example, by oligonucleotide-directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like. Ausubel et al., supra, at pages 8.0.3-8.5.9; Ausubel et al. (eds.), SHORT PROTOCOLS IN MOLECULAR
  • lysine decarboxylases in the context of present invention are the lysine decarboxylase from E.
  • coli and homologues thereof which have up to 80%, preferably 90% and most preferred 95% or 98% sequence identity (based on amino acid sequence) with the corresponding "original" gene product and have still the biological activity of lysine decarboxylase.
  • These homologous genes can be easily constructed by introducing nucleotide substitutions, deletions or insertions by methods known in the art.
  • the lysine decarboxylase of E. coli (SEQ ID NO: 11 and NO: 13) may also be retranslated into DNA by applying the codon usage of Corynebacterium glutamicum.
  • These lysine decarboxylase polynucleotide sequences are useful for expression of lysine decarboxylase in a microorganism of the genus Corynebacterium, especially C. glutamicum.
  • An even more particularly preferred microorganism for the production of 1,5- diaminopentane has not only a reduced ICD activity and comprises a lysine decarboxylase, but does also comprise at least one additional up- or downregulated gene encoding an enzyme playing a key role in the biosynthesis of lysine as described in WO 2007/113127.
  • the microorganisms specifically described in WO 2007/113127 and additionally possessing the reduced ICD activity necessary for performing the present invention are most preferred for production of cadaverine.
  • the gene diamine acetyltransferase is downregulated, i.e. the gene is either inactivated completely or the gene activity is reduced.
  • the sequence of diamine acetyltransferase is described in WO 2007/113127.
  • a particularly preferred microorganism for performing said method has not only a reduced ICD activity, but in addition comprises a lysine-2,3- aminomutase.
  • Said aminomutase is preferably a heterologous (recombinant) lysine- 2,3-aminomutase.
  • the microorganism has the ability to produce lysine and to convert it into ⁇ -lysine. More preferably, the lysine-2,3-aminomutase is a heterologous lysine-2,3- aminomutase as described in WO 2007/101867.
  • Lysine 2,3-aminomutase catalyzes the reversible isomerization of L-lysine into ⁇ -lysine.
  • the enzyme isolated from Clostridium subterminale strain SB4 is a hexameric protein of apparently identical subunits, which has a molecular weight of 285,000, as determined from diffusion and sedimentation coefficients (Chirpich et al, J. Biol. Chem. 245:1778 (1970); Aberhart et al., J. Am. Chem. Soc. 105:5461 (1983); Chang et al., Biochemistry 35:11081 (1996)).
  • the clostridial enzyme contains iron-sulfur clusters, cobalt and zinc, and pyridoxal 5'-phosphate, and it is activated by S-adenosylmethionine. Unlike typical adenosylcobalamin-dependent aminomutases, the clostridial enzyme does not contain or require any species of vitamin B 12 coenzyme.
  • the nucleotide and predicted amino acid sequences of clostridial lysine 2,3-aminomutase are disclosed in US 6,248,874 Bl.
  • DNA molecules encoding the clostridial lysine 2,3-aminomutase can be obtained by screening cDNA or genomic libraries with polynucleotide probes having nucleotide sequences reverse-translated from the amino acid sequence of SEQ ID NO: 16 or with polynucleotide probes having nucleotide sequences based upon SEQ ID NO: 14.
  • a suitable library can be prepared by obtaining genomic DNA from Clostridium subterminale strain SB4 (ATCC No. 29748) and constructing a library according to standard methods. See, for example, Ausubel et al. (eds.), SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 3rd Edition, pages 2-1 to 2-13 and 5-1 to 5-6 (John Wiley & Sons, Inc. 1995).
  • the lysine 2,3-aminomutase genes can be obtained by synthesizing DNA molecules using mutually priming long oligonucleotides or PCR.
  • oligonucleotides or PCR See, for example, Ausubel et al., (eds.), CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, pages 8.2.8 to 8.2.13 (1990), Wosnick et al., Gene 60:115 (1987); Ausubel et al. (eds.), SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 3rd Edition, pages 8-8 to 8-9, John Wiley & Sons, Inc. (1995); and the further citations provided in WO 2007/113127 and WO 2007/101867 in connection with DNA synthesis, which are hereby incorporated by reference.
  • Variants of lysine 2,3-aminomutase that contain conservative amino acid changes as def ⁇ end above in comparison to the parent enzyme may also be used. See also WO 2007/101867.
  • Conservative amino acid changes in the lysine 2,3-aminomutase can be introduced by substituting nucleotides for the nucleotides recited in SEQ ID NO: 14.
  • Such "conservative amino acid” variants can be obtained, for example, by oligonucleotide- directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like. Ausubel et al., supra, at pages 8.0.3-8.5.9; Ausubel et al. (eds.), SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 3rd Edition, pages 8-10 to 8-22 (John Wiley & Sons, Inc. 1995).
  • Lysine-2,3-aminomutases from other sources than from Clostridium subterminale, e.g. from Bacillus subtilis or from Escherichia coli have been disclosed in US 6,248,874 Bl. The parts of this US patent dealing with the isolation, SEQ ID NOs and expression of lysine-2,3-aminomutases are herewith incorporated by reference expressly.
  • Preferred lysine-2,3-aminomutases for use in present invention are the lysine-2,3- aminomutase from Clostridium subterminale, Bacillus subtilis and Escherichia coli and their homologues having up to 80%, preferably 90%, most preferred 95% and 98% sequence identity (based on amino acid sequence) with the corresponding native amino acid sequence and have still the biological activity of lysine 2,3- aminomutase.
  • These homologues can be easily be constructed by introducing nucleotide substitutions, deletions or insertions by methods known in the art.
  • lysine-2,3-aminomutase is the lysine-2,3-aminomutase from Clostridium subterminale (SEQ ID NO:2 of US 6,248,874 Bl) which is retranslated into DNA by applying the codon usage of Corynebacterium glutamicum (SEQ ID NO: 15).
  • This lysine-2,3-aminomutase polynucleotide sequence is useful for expression of lysine 2,3-aminomutase in a microorganism of the genus Corynebacterium, especially C. glutamicum.
  • An even more particularly preferred microorganism for the production of ⁇ -lysine has not only a reduced ICD activity and comprises a lysine-2,3-aminomutase, but does also comprise at least one additional up- or downregulated gene encoding an enzyme playing a key role in the lysine biosynthesis as described in WO 2007/101867.
  • the microorganisms specifically described in WO 2007/101867 and additionally possessing the reduced ICD activity necessary for performing the present invention are most preferred for production of ⁇ -lysine.
  • a particularly preferred microorganism for performing said method has not only a reduced ICD activity, but in addition comprises a dipicolinate synthetase.
  • Said dipicolinate synthetase is preferably a heterologous (recombinant) dipicolinate synthetase.
  • the microorganism has the ability to produce 2,3- dihydropicolinate and to convert it into dipicolinate.
  • the dipicolinate synthetase is a heterologous dipicolinate synthetase as described in EP 08151031.5.
  • the fermentative production of DPA following the method according to embodiment (1) of present application comprises the cultivation of at least one recombinant microorganism with reduced ICD activity, having the ability to produce lysine via the diaminopimelate (DAP) pathway with dihydrodipicolinate, in particular L-2,3- dihydrodipicolinate, as intermediary product, and additionally having the ability to express heterologous dipicolinate synthetase, so that dihydrodipicolinate, in particular L-2,3-dihydrodipicolinate is converted into DPA.
  • DAP diaminopimelate
  • said parent microorganism is a lysine producing bacterium, preferably a coryneform bacterium.
  • said parent microorganism is a bacterium of the genus Corynebacterium, as for example Corynebacterium glutamicum.
  • Said heterologous dipicolinate synthetase is of prokaryotic or eukaryotic origin.
  • said heterologous dipicolinate synthetase may originate from a bacterium of the genus Bacillus, in particular from Bacillus subtilis.
  • Said Bacillus enzyme is composed of alpha and beta subunits as described in EP 08151031.5.
  • the heterologous dipicolinate synthetase comprises at least one alpha subunit having an amino acid sequence according to SEQ ID NO:2 of EP 08151031.5 or a sequence having at least 80% identity thereto, as for example at least 85, 90, 92, 95, 96, 97, 98 or 99% sequence identity; and at least one beta subunit having an amino acid sequence according to SEQ ID NO: 3 of EP 08151031.5 or a sequence having at least 80% identity thereto, as for example at least 85, 90, 92, 95, 96, 97, 98 or 99% sequence identity.
  • the enzyme having dipicolinate synthetase activity may be encoded by a nucleic acid sequence, which is adapted to the codon usage of said parent microorganism having the ability to produce lysine.
  • the enzyme having dipicolinate synthetase activity may be encoded by a nucleic acid sequence comprising a) the spoVF gene sequence according to SEQ ID NO: 17 (SEQ ID NO: 1 of EP 08151031.5), or b) a synthetic spoVF gene sequence comprising a coding sequence essentially from residue 193 to residue 1691 according to SEQ ID NO:4 of EP 08151031.5; or c) any nucleotide sequence encoding a dipicolinate synthetase or its alpha and/or beta subunits as defined above.
  • DNA molecules encoding the dipicolinate synthetase can be obtained by screening cDNA or genomic libraries with polynucleotide probes having nucleotide sequences reverse-translated from the amino acid sequence of SEQ ID NO: 19 or 20 or with polynucleotide probes having nucleotide sequences based upon SEQ ID NO: 17.
  • the dipicolinate synthetase genes can be obtained by synthesizing DNA molecules using mutually priming long oligonucleotides or PCR.
  • Variants of dipicolinate synthetase that contain conservative amino acid changes as defined above in comparison to the parent enzyme may also be used. See also EP 08151031.5.
  • Conservative amino acid changes in the dipicolinate synthetase can be introduced by substituting nucleotides for the nucleotides recited in SEQ ID NO: 17.
  • Such "conservative amino acid" variants can be obtained, for example, by oligonucleotide- directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like. Ausubel et al., supra, at pages 8.0.3-8.5.9; Ausubel et al.
  • dipicolinate synthetase is the dipicolinate synthetase from B. subtilis which is retranslated into DNA by applying the codon usage of Corynebacterium glutamicum (SEQ ID NO: 18). This dipicolinate synthetase polynucleotide sequence is useful for expression of dipicolinate synthetase in a microorganism of the genus Corynebacterium, especially C. glutamicum.
  • An even more particularly preferred microorganism for the production of dipicolinate has not only a reduced ICD activity and comprises a dipicolinate synthetase, but does also comprise at least one additional up- or downregulated gene encoding an enzyme playing a key role in the lysine biosynthesis as described in EP 08151031.5.
  • a microorganism wherein one or more of the enzymes downstream of dihydrodipicolinate are downregulated, especially the enzyme converting dihydrodipicolinate itself, is preferred, as in these microorganisms the carbon loss into the native lysine biosynthesis starting fron dihydrodipicolinate is reduced, thus enhancing the carbon yield of dipicolinate.
  • the microorganisms specifically described in EP 08151031.5 and additionally possessing the reduced ICD activity necessary for performing the present invention are most preferred for production of dipicolinate.
  • the dipicolinate as produced according to the present invention may be used as monomer in the synthesis of polyester or polyamide type of copolymers; precursor for pyridine synthesis; stabilizing agent for peroxides and peracids, as for example t- butyl peroxide, dimethyl-cyclohexanon peroxide, peroxyacetic acid and peroxy- monosulphuric acid; ingredient for polishing solution of metal surfaces; stabilizing agent for organic materials susceptible to be deteriorated due to the presence of traces of metal ions (sequestrating effect); stabilizing agent for epoxy resins; and stabilizing agent for photographic solutions or emulsions (in particular, by preventing the precipitation of calcium salts).
  • the 1,5-diaminopentane as produced according to the present invention may be used as monomer in the synthesis of polyamide or polyurethane; or as precursor for piperidine synthesis.
  • Beta-lysine as produced according to the present invention may be used for the synthesis of caprolactame or as monomer in the synthesis of polyamide.
  • one or more than one further enzyme activity besides the ICD activity in endogenous bio synthetic pathways of the miccroorganism is modified, leading to an increase of carbon yield for the target compound.
  • one or more than one of the enzymes catalyzing the biochemical transformation of aspartate to lysine, methionine or iso leucine is up- or downregulated.
  • the activity of a Corynebacterium enzyme and particularly of a C. glutamicum enzyme is up- or downregulated.
  • said modification is achieved by modification of the nucleotide sequences encoding said enzymes.
  • said modified enzymes and/or nucleotide sequences may be selected from the group consisting of sequences encoding the following gene products which are either preferably up-regulated or preferably down-regulated.
  • the gene products which are preferably upregulated i.e.
  • aspartate kinase aspartate-semialdehyde-dehydrogenase, dihydrodipicolinate- synthetase, dihydridipicolinate-reductase ⁇ iaminopimelate-dehydrogenase, diaminopimelate-decarboxylase, lysine-exporter, pyruvate carboxylase, phosphoenolpyruvate (PEP) carboxylase, glucose-6-phosphate-deydrogenase, 6- phospho-gluconolactonase, 6-phosphogluconate-dehydrogenase, ribose-5-phosphat- isomerase, ribose-phosphate epimerase, transketolase, transaldolase, glucosephosphate-isomerase, transcriptional regulators LuxR, transcriptional regulators LysRl, transcriptional regulators LysR2, malate
  • aspartate kinase aspartate- semialdehyde-dehydrogenase, dihydrodipico linate-synthetase, dihydrodipico linate- reductase, diaminopimelate-dehydrogenase, diaminopimelate-decarboxylase, lysine- exporter, pyruvate carboxylase, phosphoenolpyruvate (PEP) carboxylase glucose-6- phosphate-deydrogenase, 6-phospho-gluconolactonase, 6-phosphogluconate- dehydrogenase, ribose-5-phosphat-isomerase, ribose-phosphate epimerase, transketolase, transaldolase, isocitrate lyase, malate synthase, tetrahydropicolinat- succinylase, succinyl-aminoketopimelate
  • the gene products which are preferably downregulated (i.e. their activity should be decreased in comparison to the wild-type microorganism) in this first preferred aspect are selected from the following group: phosphoenolpyruvate-carboxykinase, pyruvate-oxidase, homoserine-kinase, homoserine-dehydrogenase, threonine-exporter, threonine-efflux, asparaginase, aspartate-decarboxylase, threonine-synthase, citrate synthase, aconitase, isocitrate- dehydrogenase, alpha-ketoglutarate dehydrogenase, succinyl-CoA-synthase, succinat-dehydrogenase, fumarase, malate-quinone oxidoreductase, malate dehydrogenase, pyruvate kinase,
  • cytochrom aa3 oxidase dctA (C4-dicarboxylat transport protein), dctQ sodit (C4-dicarboxylat transport protein), dead (DNA/RNA helicase), def (peptide deformylase), dep33 (multi drug resistance protein B), dep34 (efflux protein), fda (fructose bisphosphate ldolase), gorA (glutathion reductase), gpi/pgi (glucose-6-P-isomerase), hisC2 (histidinol phosphate aminotransferase), horn
  • transcriptional regulator cgll (transcriptional regulator), hspR (transcriptional regulator), cgl2 (transcriptional regulator), cebR (transcriptional regulator), cgl3 (transcriptional regulator), gatR (transcriptional regulator), glcR (transcriptional regulator), tcmR (transcriptional regulator), smtB2 (transcriptional regulator), dtxR (transcriptional regulator), degA (transcriptional regulator), galR (transcriptional regulator), tipA2 (transcriptional regulator), mall (transcriptional regulator), cgl4 (transcriptional regulator), arsR (transcriptional regulator), merR (transcriptional regulator), hrcA (transcriptional regulator), glpR2 (transcriptional regulator), lexA (transcriptional regulator), ccpA3 (transcriptional regulator), degA2 (transcriptional regulator), methylmalonyl-CoA-mutase.
  • phosphoenolpyruvate- carboxykinase pyruvate-oxidase, homoserine-kinase, homoserine-dehydrogenase, succinyl-CoA-synthase, malate-quinone oxidoreductase and methylmalonyl-CoA- mutase.
  • the gene diamine acetyltransferase is preferentially downregulated, i.e. the gene is either inactivated completely or the gene activity is reduced.
  • the sequence of diamine acetyltransferase is described in WO 2007/113127.
  • modified enzymes and/or nucleotide sequences which are preferably down- regulated may be selected from the group consisting of sequences encoding homoserine-kinase, threonine-dehydratase, threonine-synthase, meso-diaminopimelat D-dehydrogenase, phosphoenolpyruvate-carboxykinase, pyruvat-oxidase, dihydrodipicolinate-synthase, dihydrodipicolinate-reductase, and diaminopicolinate- decarboxylase.
  • said enzymes are downregulated.
  • the following are preferred for down-regulation: homoserine-kinase, phosphoenolpyruvate- carboxykinase and dihydrodipicolinate-synthase.
  • the gene products which are preferably upregulated in this second preferred aspect are selected from the following group: cystathionin synthase, cystathionin lyase, homoserine-0-acetyltransferase, O-acetylhomoserine-sulfhydrylase, homoserine- dehydrogenase, aspartate-kinase, aspartate-semialdehyde-dehydrogenase, glycerinaldehyde-3-phosphate-dehydrogenase, 3-phosphoglycerate-kinase, pyruvate- carboxylase, triosephosphate-isomerase, transaldolase, transketolase, glucose-6- phosphate-dehydrogenase, biotine-ligase, protein OpcA, 1-phosphofructo-kinase, 6- phosphofructo-kinase, fructose- 1 ,6-bisphosphatase, 6-phosphogluconate- dehydr
  • the modified enzymes and/or nucleotide sequences which are preferably down-regulated may be selected from the group consisting of sequences encoding homoserine O- acetyltransferase, serine-hydroxymethyltransferase, O-acetylhomoserine- sulfhydrylase, meso-diaminopimelate D-dehydrogenase, phosphoenolpyruvate- carboxykinase, pyruvate-oxidase, dihydrodipicolinate-synthase, dihydrodipicolinate- reductase, asparaginase, aspartate-decarboxylase, lysin-exporter, acetolactate- syntha
  • B12-dependent methionine-synthase coenzym B12-independent methione-synthase, dihydroxy acid dehydratase and diaminopicolinate-decarboxylase.
  • said enzymes are downregulated.
  • the gene products which are preferably upregulated in this third preferred aspect are selected from the following group: threonine-dehydratase, threonine synthase, homoserine-dehydrogenase, aspartate-kinase, aspartate-semialdehyde- dehydrogenase, glycerinaldehyde-3-phosphate-dehydrogenase, 3-phosphoglycerate- kinase, pyruvate-carboxylase, triosephosphate-isomerase, transaldolase, transketolase, glucose-6-phosphate-dehydrogenase, biotine-ligase, protein OpcA, 1-phosphofructo-kinase, 6-phosphofructo-kinase, fructose- 1,6-bisphosphatase, 6- phosphogluconate-dehydrogenase, phosphoglycerate-mutase, pyruvat-kinase, aspartate-transamin
  • Embodiment (1) may further include a step of recovering the target compound (fine chemical).
  • the term “recovering” includes extracting, harvesting, isolating or purifying the compound from culture media. Recovering the compound can be performed according to any conventional isolation or purification methodology known in the art including, but not limited to, treatment with a conventional resin
  • the target compound can be recovered from culture media by first removing the microorganisms. The remaining broth is then passed through or over a cation exchange resin to remove unwanted cations and then through or over an anion exchange resin to remove unwanted inorganic anions and organic acids.
  • a conventional adsorbent e.g., activated charcoal, silicic acid, silica gel, cellulose, alumina, etc.
  • alteration of pH e.g., activated charcoal, silicic acid, silica gel, cellulose, alumina, etc.
  • solvent extraction e.g., with a conventional solvent such as an alcohol, ethyl acetate, hexane and the like
  • distillation dialysis, filtration, concentration, crystallization, recrystallization, pH adjustment, lyophilization and the like.
  • the target compound can be recovered from culture media by first removing the microorganisms. The remaining broth is then passed through or over a cation exchange resin to remove unwanted cations and then
  • Embodiment (2) of present invention pertains to a recombinant microorganism.
  • Said microorganism may be any of the microorganims listed in detail above, with the same preferences as indicated in said section.
  • it is C. glutamicum, and preferably is a C. glutamicum ATCC 13032 derivative with a feedback-resistant aspartokinase, particularly is ATCC 130321ysC ftr or ATCC 13286, or a derivative of said strains like LUl 1424 (see example 1).
  • LUl 1424 is especially preferred.
  • microorganism according to embodiment (2) may possess any of the features described above for a microorganism used in the production method according to embodiment (1), as long as it fulfills the criteria of the proviso included into embodiment (2) in order to exclude certain microorganisms already disclosed in PCT/EP2007/061151.
  • a microorganism with a reduced ICD activity due to application of the codon usage method described in PCT/EP2007/061151 is excluded from being the microorganism according to embodiment (2) when said microorganism is disclosed in PCT/EP2007/061151.
  • This proviso does not exclude microorganisms wherein reduction of ICD expression is not due to the expression of a modified ICD encoding nucleotide sequence (icd sequence) instead of the native icd sequence of the microorganism wherein said modified icd encoding sequence is derived from the non-modified icd sequence such that at least one codon of the non- modified nucleotide sequence is replaced in the modified icd sequence by a less frequently used codon according to the codon usage of the host cell.
  • This proviso does further not exclude a microorganism whose ICD expression is reduced due to modified codon usage as described in PCT/EP2007/061151 and which in addition comprises a heterologous enzyme catalyzing the conversion of an endogenous biosynthetic intermediate or final product of the microorganism into a non-native target compound of the fine chemical synthesis (see above).
  • said heterologous enzyme is selected from the group consisting of enzymes catalyzing one or more steps in the synthesis or biosynthesis of fine chemicals, particularly of fine chemicals derivable from lysine or its biochemical precursors downstream of aspartate via enzymatic conversion.
  • it is an enzyme catalyzing a decarboxylation, a deamination, a transamination, the shift of an amino group along an organic molecule, an oxidation and/or cyclisation reaction. Even more preferably, it is selected from the group consisting of dipicolinate synthase, lysine decarboxylase and lysine 2,3-aminomutase. Particularly preferred is a microorganism comprising a heterologous dipicolinate synthase, lysine decarboxylase or lysine 2,3-aminomutase.
  • the microorganism may have reduced ICD activity due to modified codon usage as described in PCT/EP2007/061151 and may even be a microorganism described in PCT/EP2007/061151, but additionally comprises a heterologous dipicolinate synthase, lysine decarboxylase or lysine 2,3-aminomutase.
  • Said microorganism according to embodiment (2) is particulary suitable for performing the method according to embodiment (1). It preferably comprises a vector and/or nucleotide sequence which leads to a lower ICD expression in
  • said lower ICD expression is due to replacement of ATG as start codon of the isocitrate dehydrogenase encoding nucleotide sequence, preferably to replacement of ATG with GTG.
  • An especially preferred microorganism according to embodiment (2) is LUl 1424 whose partially or completely reduced isocitrate dehydrogenase activity is due to replacement of ATG as start codon of the isocitrate dehydrogenase encoding nucleotide sequence, preferably to replacement of ATG with GTG.
  • the recombinant microorganism of embodiment (2) additionally comprises a heterologous enzyme which is able to convert an amino acid of the aspartate family or one of its biochemical precursors into further fine chemicals as described above in detail in the context of embodiment (1).
  • Said enzyme preferably is able to convert lysine or one of its biochemical precursors downstream of aspartate into further fine chemicals.
  • the heterologous enzyme is preferably selected from the group consisting of lysine decarboxylase, lysine-2,3-aminomutase and dipicolinate synthetase.
  • the use (3) of the microorganism (2) encompasses the use in a method as described for embodiment (1).
  • the present invention provides a method for the production of products made from the fine chemicals prepared by the method according to embodiment (1).
  • dipicolinate is an intermediate product and which comprises a step wherein the intermediate product is prepared by the method as defined above for embodiment (1) is a preferred aspect of embodiment (4).
  • the method is a process for the production of a polyamide (e.g. nylon ® ) and comprises the production of cadaverine according to embodiment (1) and the reaction of said cadaverine with a dicarboxylic acid.
  • the cadaverine is reacted in a known manner with di-, tri- or polycarboxylic acids to get polyamides.
  • the cadaverine is reacted with dicarboxylic acids containing 4 to 10 carbons such as succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, and so forth.
  • the dicarboxylic acid is preferably a free acid.
  • the method is a process for the production of ⁇ -amino- ⁇ -caprolactam, ⁇ -caprolactam, or ⁇ -aminocaproic acid and comprises the production of ⁇ -lysine according to embodiment (1).
  • the present invention provides a process for the production of ⁇ -amino- ⁇ -caprolactam comprising as one step the method according to embodiment (1) for the production of ⁇ -lysine.
  • ⁇ -Lysine subsequently undergoes an intramolecular cyclization resulting in ⁇ -amino- ⁇ -caprolactam.
  • This cyclization reaction can be performed either directly before the isolation and/or purification of the ⁇ -lysine or using the isolated ⁇ -lysine.
  • the present invention provides a process for the production of ⁇ -capro lactam comprising as one step the method according to embodiment (1) for the production of ⁇ -lysine.
  • ⁇ - lysine further undergoes an intramolecular cyclization resulting in ⁇ -amino- ⁇ - caprolactam, which can be deaminated selectively in order to get ⁇ -caprolactam. This deamination process is known in the art.
  • the present invention provides a process for the production of an aminocaproic acid comprising as one step the method according to embodiment (1) for the production of ⁇ -lysine and subsequent removal of the ⁇ -amino function of ⁇ -lysine by deamination.
  • the resulting ⁇ - aminocaproic acid can be transformed either to ⁇ -caprolactam or directly - without cyclization to the lactam - to a polyamide by known polymerization techniques, ⁇ - Capro lactam is a very important monomer for the production of polyamides, especially PA6.
  • the method is a process for the production of a polyester or polyamide (e.g. nylon ® ) copolymer and comprises the production of dipicolinate according to embodiment (1), the isolation of said dipicolinate, and the subsequent polymerization of said dipicolinate with at least one further polyvalent comonomer selected from polyols and polyamines.
  • the dipicolinate is reacted in a known manner with di-, tri- or polyamines to obtain polyamides, or with di-, tri- or polyols to obtain polyesters.
  • the dipicolinate is reacted with a polyamine or polyol containing 4 to 10 carbon atoms.
  • a person skilled in the art is familiar with how to replace e.g. a gene or endogenous nucleotide sequence that encodes for a certain polypeptide with a modified nucleotide sequence.
  • This may e.g. be achieved by introduction of a suitable construct (plasmid without origin of replication, linear DNA fragment without origin of replication) by electroporation, chemical transformation, conjugation or other suitable transformation methods.
  • a suitable construct plasmid without origin of replication, linear DNA fragment without origin of replication
  • electroporation chemical transformation, conjugation or other suitable transformation methods.
  • homologous recombination using selectable markers which ensure that only such cells are identified that carry the modified nucleotide sequence instead of the endogenous naturally occurring sequence.
  • Other methods include gene disruption of the endogenous chromosomal locus and expression of the modified sequences from e.g. plasmids.
  • Yet other methods include e.g. transposition. Further information as to vectors and host cells that may be used will be given below.
  • the person skilled in the art is familiar with designing constructs such as vectors for driving expression of a polypeptide in microorganisms such as E. coli and C. glutamicum.
  • the person skilled in the art is also well acquainted with culture conditions of microorganisms such as C. glutamicum and E. coli as well as with procedures for harvesting and purifying fine chemicals such as amino acids and particularly lysine, methionine and threonine from the aforementioned microorganisms.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • vector refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector Another type of vector, wherein additional DNA segments can be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e. g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operative Iy linked.
  • expression vectors Such vectors are referred to herein as "expression vectors”.
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector.
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e. g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • a recombinant expression vector suitable for preparation of the recombinant microorganism of the invention may comprise a heterologous nucleic acid as defined above in a form suitable for expression of the respective nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed.
  • operably linked is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory sequence is intended to include promoters, repressor binding sites, activator binding sites, enhancers and other expression control elements (e.g., terminators, polyadenylation signals, or other elements of mRNA secondary structure). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells.
  • Preferred regulatory sequences are, for example, promoters such as cos-, tac-, trp-, tet-, trp-, tet-, lpp-, lac-, lpp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, arny, SP02, e-Pp- ore PL, SOD, EFTu, EFTs, GroEL, MetZ (last five from C. glutamicum), which are used preferably in bacteria.
  • Additional regulatory sequences are, for example, promoters from yeasts and fungi, such as ADCl, MFa, AC, P-60, CYCl, GAPDH, TEF, rp28, ADH, promoters from plants such as CaMV/35S, SSU, OCS, Iib4, usp, STLSl, B33, nos or ubiquitin- or phaseolin-promoters. It is also possible to use artificial promoters. It will be appreciated by one of ordinary skill in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.
  • the expression vectors can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides.
  • Any vector that is suitable to drive expression of a modified nucleotide sequence in a host cell may be used for decreasing the amount of ICD in these host cells.
  • Such vector may e.g. be a plasmid vector which is autonomously replicable in coryneform bacteria.
  • examples are pZl (Menkel et al. (1989), Applied and Environmental Microbiology 64:549-554), pEKExl (Eikmanns et al. (1991), Gene 102:93-98), pHS2-l (Sonnen et al. (1991), Gene 107:69-74).
  • vectors are based on the cryptic plasmids pHM1519, pBLl oder pGAl.
  • Other suitable vectors are pClik5MCS (WO 2005/059093), or vectors based on pCG4 (US-A 4,489,160) or pNG2 (Serwold-Davis et al. (1990), FEMS Microbiology Letters 66:119-124) or pAGl (US-A 5,158,891). Examples for other suitable vectors can be found in the Handbook of Corynebacterium, Chapter 23 (edited by Eggeling and Bott, ISBN 0- 8493-1821-1, 2005).
  • Recombinant expression vectors can be designed for expression of specific nucleotide sequences in prokaryotic or eukaryotic cells.
  • the nucleotide sequences can be expressed in bacterial cells such as C. glutamicum and E. coli, insect cells (using baculovirus expression vectors), yeast and other fungal cells (see Romanos, M. A. et al. (1992), Yeast 8:423-488; van den Hondel, C. A. M.J. J. et al. (1991) in: More Gene Manipulations in Fungi, J. W. Bennet & L. L. Lasure, eds., p. 396-428, Academic Press: San Diego; and van den Hondel, C. A.
  • Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein but also to the C-terminus or fused within suitable regions in the proteins.
  • Such fusion vectors typically serve four purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification; and 4) to provide a "tag" for later detection of the protein.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D. B. and Johnson, K. S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S- transferase (GST), maltose E binding protein, or protein A, respectively.
  • Suitable inducible non- fusion E. coli expression vectors include pTrc
  • Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
  • Target gene expression from the pET Hd vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7gnl).
  • This viral polymerase is supplied by host strains BL21 (DE3) or HMS 174 (DE3) from a resident X prophage harboring a T7gnl gene under the transcriptional control of the lacUV 5 promoter.
  • appropriate vectors may be selected.
  • the plasmids pIJlOl, pIJ364, pIJ702 and pIJ361 are known to be useful in transforming Streptomyces, while plasmids pUBl 10, pC194 or pBD214 are suited for transformation of Bacillus species.
  • plasmids pUBl 10, pC194 or pBD214 are suited for transformation of Bacillus species.
  • plasmids of use in the transfer of genetic information into Corynebacterium include pHM1519, pBLl, pSA77 or pAJ667 (Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York ISBN 0 444 904018).
  • C. glutamicum and E. coli shuttle vectors are e.g. pClik5aMCS (WO 2005/059093; or can be found in Eikmanns et al. ((1991) Gene 102:93-8).
  • E. coli - C. glutamicum shuttle vectors (table 23.1), a list of E. coli - C. glutamicum shuttle expression vectors (table 23.2), a list of vectors which can be used for the integration of DNA into the C. glutamicum chromosome (table 23.3), a list of expression vectors for integration into the C. glutamicum chromosome (table 23.4.), as well as a list of vectors for site-specific integration into the C. glutamicum chromosome (table 23.6).
  • the expression vector is a yeast expression vector.
  • yeast expression vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari, et al., (1987) Embo J. 6:229-234), 2i, pAG-1, Yep6, Yepl3, P EMBLYe23, pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al, (1987) Gene 54:113-123), and pYES2 (Invitrogen Corporation, San Diego, CA).
  • Vectors and methods for the construction of vectors appropriate for use in other fungi, such as the filamentous fungi include those detailed in: van den Hondel, C. A. M. J. J. & Punt, P. J. (1991) in: Applied Molecular Genetics of Fungi, J. F. Peberdy et al., eds., p. 1- 28, Cambridge University Press: Cambridge, and Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York (ISBN 0 444 904018).
  • an operative link is understood to be the sequential arrangement of promoter (including the ribosomal binding site (RBS)), coding sequence, terminator and, optionally, further regulatory elements in such a way that each of the regulatory elements can fulfill its function, according to its determination, when expressing the coding sequence.
  • promoter including the ribosomal binding site (RBS)
  • coding sequence including the ribosomal binding site (RBS)
  • terminator including the ribosomal binding site (RBS)
  • RBS ribosomal binding site
  • heterologous nucleotide sequences may be expressed in unicellular plant cells (such as algae) or in plant cells from higher plants (e. g., the spermatophytes, such as crop plants).
  • plant expression vectors include those detailed in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) Plant MoI. Biol. 20:1195-1197; and Bevan, M. W. (1984) Nucl. Acid. Res. 12:8711-8721, and include pLGV23, pGHlac+, pBIN19, pAK2004, and pDH51 (Pouwels et al., eds. (1985) Cloning Vectors. Elsevier: New York ISBN 0 444 904018).
  • a recombinant expression vector is capable of directing expression of a nucleic acid preferentially in a particular cell type, e.g. in plant cells (e. g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art.
  • Another aspect of the invention pertains to organisms or host cells into which a recombinant expression vector or nucleic acid has been introduced.
  • the resulting cell or organism is a recombinant cell or organism, respectively. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell when the progeny is comprising the recombinant nucleic acid. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein, inasfar as the progeny still expresses or is able to express the recombinant protein.
  • Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and “transfection”, “conjugation” and “transduction” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e. g., linear DNA or RNA (e.
  • a linearized vector or a gene construct alone without a vector or nucleic acid in the form of a vector (e.g., a plasmid, phage, phasmid, phagemid, transposon or other DNA)) into a host cell, including calcium phosphate or calcium chloride co -precipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, conjugation chemical-mediated transfer, or electroporation.
  • Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning : A Laboratory Manual. 3rd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2003), and other laboratory manuals.
  • a gene that encodes a selectable marker is generally introduced into the host cells along with the gene of interest.
  • selectable markers include those which confer resistance to drugs, such as G418, hygromycin, kanamycine, tetracycline, ampicillin and methotrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding the above-mentioned modified nucleotide sequences or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e. g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
  • plasmids without an origin of replication and two different marker genes e.g. pClik int sacB
  • pClik int sacB When plasmids without an origin of replication and two different marker genes are used (e.g. pClik int sacB), it is also possible to generate marker-free strains which have part of the insert inserted into the genome. This is achieved by two consecutive events of homologous recombination (see also Becker et al., APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 71 (12), p. 8587-8596; Eggeling and Bott (eds) Handbook of Corynebacterium (Taylor and Francis Group, 2005)).
  • the sequence of plasmid pClik int sacB can be found in WO 2005/059093 as SEQ ID NO:24; therein, the plasmid is called pCIS.
  • recombinant microorganisms can be produced which contain selected systems which allow for regulated expression of the introduced gene. For example, inclusion of a nucleotide sequence on a vector placing it under control of the lac operon permits expression of the gene only in the presence of IPTG.
  • Such regulatory systems are well known in the art.
  • the method comprises culturing the microorganism in a suitable medium for fine chemical production. In another embodiment, the method further comprises isolating the fine chemical from the medium or the host cell.
  • the person skilled in the art is familiar with the cultivation of common microorganisms such as C. glutamicum and E. coli. Thus, a general teaching will be given below as to the cultivation of E. coli and C. glutamicum. Additional information may be retrieved from standard textbooks for cultivation of E. coli and C. glutamicum.
  • E. coli strains are routinely grown in MB and LB broth, respectively (Follettie et al. (1993) J. Bacteriol. 175:4096-4103).
  • Minimal media for E. coli is M9 and modified MCGC (Yoshihama et al. (1985) J. Bacteriol. 162:591-597), respectively.
  • Glucose may be added at a final concentration of 1%.
  • Antibiotics may be added in the following amounts (micrograms per millilitre): ampicillin, 50; kanamycin, 25; nalidixic acid, 25.
  • Amino acids, vitamins, and other supplements may be added in the following amounts: methionine, 9.3 mM; arginine, 9.3 mM; histidine, 9.3 mM; thiamine, 0.05 mM.
  • E. coli cells are routinely grown at 37°C, respectively.
  • Corynebacteria are typically cultured in synthetic or natural growth media.
  • a number of different growth media for Corynebacteria are both well-known and readily available (Liebl et al. (1989) Appl. Microbiol. Biotechnol., 32:205-210; von der Osten et al. (1998) Biotechnology Letters, 11 :11-16; Patent DE 4,120,867; Liebl (1992) "The Genus Corynebacterium", in: The Procaryotes,
  • These media consist of one or more carbon sources, nitrogen sources, inorganic salts, vitamins and trace elements.
  • Preferred carbon sources are sugars, such as mono-, di-, or polysaccharides. For example, glucose, fructose, mannose, galactose, ribose, sorbose, lactose, maltose, sucrose, glycerol, raff ⁇ nose, starch or cellulose serve as very good carbon sources. It is also possible to supply sugar to the media via complex compounds such as molasses or other by-products from sugar refinement. It can also be advantageous to supply mixtures of different carbon sources.
  • Other possible carbon sources are alcohols and organic acids, such as methanol, ethanol, acetic acid or lactic acid.
  • Nitrogen sources are usually organic or inorganic nitrogen compounds, or materials which contain these compounds.
  • Exemplary nitrogen sources include ammonia gas or ammonia salts, such as NH 4 C 1 or (NH 4 ) 2 SO 4 , NH 4 OH, nitrates, urea, amino acids or complex nitrogen sources like corn steep liquor, soy bean flour, soy bean protein, yeast extract, meat extract and others.
  • the overproduction of methionine is possible using different sulfur sources.
  • Sulfates, thiosulfates, sulfites and also more reduced sulfur sources like H 2 S and sulfides and derivatives can be used.
  • organic sulfur sources like methyl mercaptan, thioglycolates, thiocyanates, and thiourea, sulfur containing amino acids like cysteine and other sulfur containing compounds can be used to achieve efficient methionine production.
  • Formate may also be possible as a supplement as are other Cl sources such as methanol or formaldehyde.
  • Inorganic salt compounds which may be included in the media include the chloride-, phosphorous- or sulfate-salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron.
  • Chelating compounds can be added to the medium to keep the metal ions in solution.
  • Particularly useful chelating compounds include dihydroxyphenols, like catechol or protocatechuate, or organic acids, such as citric acid. It is typical for the media to also contain other growth factors, such as vitamins or growth promoters, examples of which include biotin, riboflavin, thiamine, folic acid, nicotinic acid, pantothenate and pyridoxine.
  • the exact composition of the media compounds depends strongly on the immediate experiment and is individually decided for each specific case. Information about media optimization is available in the textbook "Applied Microbiol. Physiology, A Practical Approach” (Eds. P. M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). It is also possible to select growth media from commercial suppliers, like standard 1 (Merck) or BHI (grain heart infusion, DIFCO) or others.
  • All medium components should be sterilized, either by heat (20 min at 1.5 bar and 121 0 C) or by sterile filtration.
  • the components can either be sterilized together or, if necessary, separately.
  • All media components may be present at the beginning of growth, or they can optionally be added continuously or batchwise. Culture conditions are defined separately for each experiment.
  • the temperature depends on the microorganism used and usually should be in a range between 15°C and 45°C.
  • the temperature can be kept constant or can be altered during the experiment.
  • the pH of the medium may be in the range of 5 to 8.5, preferably around 7.0, and can be maintained by the addition of buffers to the media.
  • An exemplary buffer for this purpose is a potassium phosphate buffer.
  • Synthetic buffers such as MOPS, HEPES, ACES and others can alternatively or simultaneously be used. It is also possible to maintain a constant culture pH through the addition of NaOH or NH 4 OH during growth. If complex medium components such as yeast extract are utilized, the necessity for additional buffers may be reduced, due to the fact that many complex compounds have high buffer capacities.
  • the pH can also be controlled using gaseous ammonia.
  • the incubation time is usually in a range from several hours to several days. This time is selected in order to permit the maximal amount of product to accumulate in the broth.
  • the disclosed growth experiments can be carried out in a variety of vessels, such as microtiter plates, glass tubes, glass flasks or glass or metal fermentors of different sizes.
  • the microorganisms should be cultured in microtiter plates, glass tubes or shake flasks, either with or without baffles. Preferably 100 ml shake flasks are used, filled withl ⁇ % (by volume) of the required growth medium.
  • the flasks should be shaken on a rotary shaker (amplitude 25 mm) using a speed-range of 100-300 rpm. Evaporation losses can be diminished by the maintenance of a humid atmosphere; alternatively, a mathematical correction for evaporation losses should be performed.
  • an unmodified control clone e.g. the parent strain
  • a control clone containing the basic plasmid without any insert should also be tested.
  • the medium is inoculated to an OD600 of 0.5-1.5 using cells grown on agar plates, such as CM plates (lOg/1 glucose, 2,5g/l NaCl, 2g/l urea, lOg/1 polypeptone, 5g/l yeast extract, 5g/l meat extract, 22g/l NaCl, 2g/l urea, lOg/1 polypeptone, 5g/l yeast extract, 5g/l meat extract, 22g/l agar, pH 6.8 with 2M NaOH) that had been incubated at 30 0 C.
  • Inoculation of the media is accomplished by either introduction of a saline suspension of C. glutamicum cells from CM plates or addition of a liquid preculture of this bacterium.
  • Quantification of amino acids and their intermediates may be performed by any textbook method known to a person skilled in the art.
  • said quantification is exemplified by the quantification of methionine. Further exemplifications of quantification are presented in the Examples section. The latter are preferred in the context of present invention.
  • the following gradient is applied: Start 0% B; 39 min 39% B; 70 min 64% B; 100% B for 3.5 min; 2 min 0% B for equilibration.
  • Derivatization at room temperature is automated as described below. Initially 0.5 ⁇ l of 0.5% 2-MCE in bicine (0.5M, pH 8.5) are mixed with 0.5 ⁇ l cell extract.
  • Detection is performed by a fluorescence detector (340 nm excitation, emission 450 nm, Agilent, Waldbronn, Germany).
  • ⁇ -amino butyric acid (ABA) is used as internal standard.
  • Campbell in refers to a transformant of an original host cell in which an entire circular double stranded DNA molecule (for example a plasmid being based on pClik int sacB) has integrated into a chromosome by a single homologous recombination event (a cross-in event), which effectively results in the insertion of a linearized version of said circular DNA molecule into a first DNA sequence of the chromosome that is homologous to a first DNA sequence of the said circular DNA molecule.
  • a cross-ination event a single homologous recombination event
  • “Campbelled in” refers to the linearized DNA sequence that has been integrated into the chromosome of a “Campbell in” transformant.
  • a “Campbell in” contains a duplication of the first homologous DNA sequence, each copy of which includes and surrounds a copy of the homologous recombination crossover point. The name comes from Professor Alan Campbell, who first proposed this kind of recombination.
  • “Campbell out,” as used herein, refers to a cell descending from a “Campbell in” transformant, in which a second homologous recombination event (a cross out event) has occurred between a second DNA sequence that is contained on the linearized inserted DNA of the "Campbelled in” DNA, and a second DNA sequence of chromosomal origin, which is homologous to the second DNA sequence of said linearized insert, the second recombination event resulting in the deletion
  • the "Campbell out" cell contains one or more intentional changes in the chromosome (for example, a single base substitution, multiple base substitutions, insertion of a heterologous gene or DNA sequence, insertion of an additional copy or copies of a homologous gene or a modified homologous gene, or insertion of a DNA sequence comprising more than one of these aforementioned examples listed above).
  • a "Campbell out” cell or strain is usually, but not necessarily, obtained by a counter- selection against a gene that is contained in a portion (the portion that is desired to be jettisoned) of the "Campbelled in” DNA sequence, for example the Bacillus subtilis sacB gene, which is lethal when expressed in a cell that is grown in the presence of about 5% to 10% sucrose.
  • a desired "Campbell out” cell can be obtained or identified by screening for the desired cell, using any screenable phenotype, such as, but not limited to, colony morphology, colony color, presence or absence of antibiotic resistance, presence or absence of a given DNA sequence by polymerase chain reaction, presence or absence of an auxotrophy, presence or absence of an enzyme, colony nucleic acid hybridization, antibody screening, etc.
  • the term "Campbell in” and “Campbell out” can also be used as verbs in various tenses to refer to the method or process described above.
  • the homologous recombination events that lead to a "Campbell in” or “Campbell out” can occur over a range of DNA bases within the homologous DNA sequence, and since the homologous sequences will be identical to each other for at least part of this range, it is not usually possible to specify exactly where the crossover event occurred. In other words, it is not possible to specify precisely which sequence was originally from the inserted DNA, and which was originally from the chromosomal DNA.
  • the first homologous DNA sequence and the second homologous DNA sequence are usually separated by a region of partial non-homo logy, and it is this region of non-homo logy that remains deposited in a chromosome of the "Campbell out" cell.
  • typical first and second homologous DNA sequences are at least about 200 base pairs in length, and can be up to several thousand base pairs in length, however, the procedure can be made to work with shorter or longer sequences.
  • a length for the first and second homologous sequences can range from about 500 to 2000 bases, and the obtaining of a "Campbell out" from a "Campbell in” is facilitated by arranging the first and second homologous sequences to be approximately the same length, preferably with a difference of less than 200 base pairs and most preferably with the shorter of the two being at least 70% of the length of the longer in base pairs.
  • the "Campbell In and -Out-method" is described in WO 2007/012078 and Eggeling and Bott (eds) Handbook of Corynebacterium (Taylor and Francis Group, 2005), Chapter 23.
  • PCT/EP2007/061151 inasfar as they pertain to ICD reduction via codon usage and to its effects on production of methionine are herewith incorporated by reference.
  • Example 1 Reducing expression of isocitrate dehydrogenase (icd) and its effect on lysine and trehalose production
  • ICD ATG-GTG The sequence of ICD ATG-GTG is depicted in figure 2 a) of PCT/EP2007/061151.
  • a plasmid was constructed which allows the marker-free manipulation by 2 consecutive homologous recombination events.
  • SacB-gene which can be used as a positive selection marker as cells which carry this gene cannot grow on sucrose containing medium
  • This plasmid allows the integration of sequences at the genomic locus of C. glutamicum.
  • the insert was amplified by PCR using genomic DNA of ATCC 13032 as a template.
  • the modification of the coding region was achieved by fusion PCR using the following oligonucleotides.
  • the table shows the primers used as well as the template DNA:
  • the product of the fusion PCR was purified, digested with Xhol and MIuI, purified again and ligated into pClik int sacB which had been linearized with the same restriction enzymes. The integrity of the insert was confirmed by sequencing.
  • the coding sequence of the optimised sequence ICD ATG — > GTG is shown in Figure 2 of PCT/EP2007/061151 (SEQ ID NO:2 of PCT/EP2007/061151; SEQ ID NO:4 of present sequence listing).
  • the resulting plasmid is called pClik int sacB ICD ATG - GTG.
  • strains with modified ICD expression levels The plasmid pClik int sacB ICD ATG - GTG was then used to replace the native coding region of the icd gene by the coding region with the modified start codon.
  • the strain used was LUl 1424.
  • PCT/EP2007/061151 and OLD 450 (CGAGTAGGTCGCGAGCAG) (SEQ ID No. 13 of PCT/EP2007/061151).
  • the positive clones give a band ofca. 600 bp.
  • C. glutamicum strains for replacing the endogenous copy of icd.
  • a C. glutamicum lysine production strain such as for example LUl 1424 or other derivatives of ATCC13032, ATCC120321ysC ftr or ATCC13286.
  • LUl 1424 is especially preferred.
  • LUl 1424 had been constructed by several consecutive steps of genetic engineering starting from ATCC 13032.
  • LUl 1424 contains the following modifications:
  • accession no. of the lysC gene is P26512.
  • pepCK • a disrupted pepCK gene (encoding phosphoenolcarboxykinase).
  • accession no. ofpepCK is ABl 15091.
  • argSlysA operon encoding arginyl-tRNA synthetase and diaminopimelate decarboxylase.
  • accession no. of the argS lysA operon is X54740.
  • a mutant horn gene (encoding homoserine dehydrogenase) resulting in a protein which carries an alanine instead of a valine at amino acid position 59.
  • the accession no. of horn is Y00546.
  • an enhanced and mutated pycA gene (encoding pyruvate carboxylase) which is controlled by the expression unit Psod and which contains a point mutation resulting in a protein which carries a serine instead of a proline at amino acid position 458.
  • the accession no. of pycA is AF038548.
  • accession no. of zwf is BA000036.3, nt. 1667860-1669404.
  • the expression unit Psod (promoter including ribosomal binding site) is described in WO 2005/059144.
  • the Psod sequence is (5' to 3'): tagctgccaattattccgggcttgtgacccgctacccgataaataggtcggctgaaaatttcgttgcaatatcaacaaaa ggcctatcattgggaggtgtcgcaccaagtacttttgcgaagcgccatctgacggattttcaaaagatgtatatgctcggtg cggaaacctacgaaaggatttttaccc
  • the above modifications were all introduced using a similar strategy as for the manipulation of the icd gene (i.e. by the "Campbell in/Campbell out” method described above).
  • the plasmids used for the manipulations were all based on pClik int sacB (see above) or pK19mobsacB (SEQ ID NO:21).
  • the lysine production strain LUl 1424 in which ICD activity was lowered by changing the icd start codon from ATG to GTG was called ICD ATG-GTG (synonym ICD ATG ⁇ GTG).
  • the effects of the manipulation of the icd gene were confirmed in two independent test series.
  • the ICD activity and the lysine production were determined.
  • the second test series did additionally contain determination of trehalose production.
  • ICD enzyme activity of strain ICD ATG-GTG as compared to the initial strain LUl 1424.
  • cell free extracts were prepared from overnight cultures. Cells were grown in complex medium containing 37 g/L BHI (BactoTM Brain Heart Infusion) inoculated with single cells from agar plates. Cells were harvested by centrifugation (13.000 x g, 5 min, Centrifuge 5415 R, Eppendorf, Hamburg, Germany), washed with reaction buffer (100 mM Tris-HCl, pH 7.8) and cells were disrupted with glasbeads in a ribolyser (Schwingm ⁇ hle, Retsch, Haan, Germany).
  • the generated strain was compared to the parent strain.
  • Conditions for growth of the strains were as follows: Media: First pre-cultures were grown in complex medium containing 5 g L "1 glucose, 5 g L "1 yeast extract, 1O g L “1 tryptone and 5 g L “1 NaCl. Agar plates were prepared by adding 18 g L "1 agar. Second pre-cultivations and main cultivations were performed in minimal medium containing 55 mM glucose.
  • the minimal medium additionally contained per liter: 0.055 g CaCl 2 • 2H 2 O, 0.2 g MgSO 4 -7H 2 O, 1 g NaCl, 25 g K 2 HPO 4 , 7,7 g KH 2 PO 4 , 15 g (NH 4 ) 2 SO 4 , 0.5 mg biotin, 1 mg Ca- panthothenic acid, 1 mg thiamine • HCl, 20 mg FeSO 4 , 30 mg 3,4-dihydroxybenzoic acid and lO ml of a 100 x trace element solution.
  • the trace element solution contained per liter: 200 mg FeCl 3 OH 2 O, 200 mg MnSO 4 B 2 O, 50 mg ZnSO 4 7 H 2 O, 20 mg CuCl 2 ' 2 H 2 O, 20 mg NaB 4 O 7 IO H 2 O and 10 mg (NH 4 ) 6 Mo 7 O 24 ' 4 H 2 O and was adjusted to pH 1.
  • Cultivation Single colonies from agar plates were used to inoculate the first pre- culture which incubated for 8 h in 50 rnL complex medium in 500 mL baffled flasks.
  • cells were harvested by centrifugation (8,800 x g, 2 min, 4°C), washed with sterile 0.9% NaCl, and used as inoculum for the second pre-culture (25 ml minimal medium in 250 ml baffled flasks).
  • Main cultures were performed in 50 ml medium in 500 ml baffled flasks and inoculated with exponentially growing cells from the second pre-culture. All cultivation experiments were carried out at 30 0 C and 230 rpm on a rotary shaker (shaking diameter 5 cm, Multitron, Infors AG, Bottmingen, Switzerland). The pH was in a range of 7.1 ⁇ 0.2 over the cultivation time.
  • strains with lowered ICD activity have a higher lysine yield (more than 1.3 fold higher than in initial strain).
  • Medium composition Complex medium, used for agar plates and first pre-cultures, contained 10 g L “1 peptone, 5 g L “1 beef extract, 5 g L “1 yeast extract, 2.5 g L “1 NaCl, 1O g L “1 glucose and 2 g L “1 urea with or without 18 g L “1 agar, respectively.
  • Second pre-culture and main culture were performed in minimal medium containing: (A) 500 mL salt solution (1 g NaCl, 55 mg MgCl 2 7H 2 O and 200 mg CaCl), (B) 100 mL substrate solution (100 g L "1 glucose or fructose, respectively), (C) 100 mL buffer solution (2 M potassium phosphate, pH 7.8), (D) 100 mL solution B (150 g L “1 (NFL) 2 SO 4 , pH 7.0), (E) 20 mL vitamin solution (25 mg L "1 biotin, 50 mg L "1 thiamine ⁇ Cl and 50 mg L “1 panthothenic acid), (F) 10 mL FeSO4-solution (2 g L "1 FeSO 4 , pH 1.0), (G) 10 ml 100 x trace elements (Vallino, J.
  • A 500 mL salt solution (1 g NaCl, 55 mg MgCl 2 7H 2 O and 200 mg CaCl
  • B 100 mL substrate
  • Cultivation and growth conditions Cells from glycerol stocks (10% glycerol, 50 mg L "1 lactose) stored at - 80 0 C were spread on agar plates and incubated for 48 h at 30 0 C. First pre-cultures were grown in 25 ml complex medium (250 ml baffled shake flasks) for 10 h at 30 0 C and 230 rpm on a rotary shaker (Multitron, Infors AG, Bottmingen, Switzerland).
  • the protocol for quantification of amino acids included pre-column derivatisation with o-phthaldehyde (OPA) and separation on a Cl 8 column (Gemini5u, Phenomenex, Aillesburg, Germany) as described (Kr ⁇ mer, J. O. et al., Anal Biochem 340:171-3 (2005)). To reduce measurement time the gradient profile was changed and eluent B was added with 4% min 1 . Cell concentration was determined in a photometer (Libra SI l, Biochrome, Cambridge, UK) at 660 nm or gravimetrically as cell dry mass (CDM) (CP225D, Sartorius, G ⁇ ttingen, Germany).
  • OPA o-phthaldehyde
  • Cells were grown as described above with a main culture volume of 50 ml (500 ml baffled shake flasks). Cells were harvested in the exponential growth phase by centrifugation (5 min, 9800 x g, 4°C, Biofuge stratos, Heraeus, Hanau, Germany), washed with disruption buffer (100 mM TrisHCl, pH 7.8) and subsequently resuspended in 10 ml of the same buffer. Cell suspension was aliquoted in 750 ⁇ l amounts in 2 ml Eppendorf tubes containing glass beads. Disruption was performed in a ribolyzer (MM301, Retsch, Haan, Germany) at 30 Hz (2 x 5 min; 5 minutes break in between).
  • disruption buffer 100 mM TrisHCl, pH 7.8
  • Disruption was performed in a ribolyzer (MM301, Retsch, Haan, Germany) at 30 Hz (2 x 5 min; 5 minutes break in between).
  • Crude cell extracts were obtained by centrifugation for 10 minutes at 13000 x g (Centrifuge 5415R, Eppendorf, Hamburg, Germany) and used for determination of enzyme activity and protein content. The latter was quantified by the method of Bradford (Anal Biochem 72:248-54 (1976)) with a reagent solution from BioRad (Quick Start Bradford Dye, BioRad, Hercules, USA).
  • Isocitrate dehydrogenase activity Analysis of in vitro activity of ICD was based on the protocol of Chen et al. (Chen, R., and H. Yang, Arch Biochem Biophys 383:238-45 (2000)). The reaction was carried out in a volume of 1 ml at pH 7.8 and 30 0 C in 1.5-ml polystyrene cuvettes. The assay mixture contained 100 mM Tris/HCl (pH 7.8), 10 mM MgCl 2 , 1 mM isocitrate, 0.5 mM NADP and 25 ⁇ l of crude cell extract.
  • the production characteristics of lysine producing C. glutamicum LUl 1424 and ICD ATG — > GTG on glucose are provided in table 6.
  • the yields given in table 6 are biomass yield (Y ⁇ /s), lysine yield (YLys/s), and trehalose yield (Yiws), all per consumed glucose (S), and represent mean values from three parallel cultivation experiments and corresponding deviations.
  • the yields were determined as slope of the linear best fit when plotting product formation and substrate consumption.
  • Example 2 Strain construction for methionine production and effect on methionine productivity
  • the strain was grown as described in WO 2007/020295. After 48h incubation at 30 0 C the samples were analyzed for sugar consumption. It was found that the strains had used up all added sugar, meaning that all strains had used the same amount of carbon source. Synthesized methionine was determined by HPLC as described above and in WO 2007/020295.
  • Example 3 Use of strains with reduced ICD epression level in diaminopentane production
  • the plasmid pClik int sacB ICD ATG ⁇ GTG (see example 1.1, synonyms: pClik int sacB ICD (ATG-GTG), pClik int sacB ICD ATG - GTG, vector insert see SEQ ID NO:5) is used for construction of diaminopentane producing strains with modified ICD expression level in comparison to the host strain.
  • the parent strain used is a 1,5-diaminopentane (1,5-DAP) producer derived from C. glutamicum wild type strain ATCC 13032 by incorporation of a point mutation T31 II into the aspartokinase gene (NCgI 0247) and subsequent amplification of the gene dosage by addition of a strong promoter Psod, duplication of the diaminopimelate dehydrogenase gene (NCgI 2528), disruption of the phosphoenolpyruvate carboxykinase gene (NGgI 2765) and chromosomal integration of the E. coli lysine decarboxylase gene (Kyoto Encyclopedia of Genes and Genomes, Entry JWO 181).
  • SEQ ID NOs: 21 to 24 The sequences of the plasmids used for establishing the 1,5-DAP producer parent strain are shown in SEQ ID NOs: 21 to 24.
  • SEQ ID NO:21 may be used for deletion of the pepCK gene (delta pepCK).
  • SEQ ID NO:22 may be used for duplication of the ddh gene (2 x ddh).
  • SEQ ID NO:23 may be used for the amplification of ask gene dosage by integration of Psod promoter upstream of the ask gene (Psodk ask).
  • SEQ ID NO:21 may be used for deletion of the pepCK gene (delta pepCK).
  • SEQ ID NO:22 may be used for duplication of the ddh gene (2 x ddh).
  • SEQ ID NO:23 may be used for the amplification of ask gene dosage by integration of Psod promoter upstream of the ask gene (Psodk ask).
  • NO:24 may be used for the construction of the diaminopentane production strain by intengration of E. coli ldcC in the bioD region of a C glutamicum lysine producer. Then, pClick int sacB ICD ATG -> GTG or any other plasmid whose integration would lead to a decrease in ICD activity in the host cell may be introduced into the parent strain by the methods described under "Construction of strains with modified ICD expression levels " in example 1 for a lysine producer.
  • the optimized strains are compared to 1,5 -DAP productivity of the parent strain as described under "Determination of ICD activity" in example 1 for a lysine producer.
  • CM-plates (10% sucrose, 10 g/1 glucose, 2,5 g/1 NaCl, 2 g/1 urea, 10 g/1 Bacto Pepton, 10 g/1 yeast extract, 22 g/1 agar) for 2 days at 30 0 C. Subsequently cells are scraped from the plates and re-suspended in saline.
  • the concentration of 1,5-DAP that is segregated into the medium is determined. This is done using HPLC on an Agilent 1100 Series LC system HPLC. A precolumn derivatisation with ortho-phthalaldehyde allows to quantify the formed 1,5-DAP. The separation of the mixture can be done on a Gemini C 18 column (Phenomenex). EluentA is 40 mM NaH 2 PO 4 -H 2 O, pH7.8 and eluent B Acetonitril:Methanol:H 2 O 45:45:10. Detection is done by a fluorescence detector. As strains with lowered ICD activity have higher lysine productivity, it seems reasonable that strains with lowered ICD activity will have higher 1,5-DAP productivities.
  • a deletion cassette containing ⁇ 300 - 600 consecutive nucleotides upstream of the icd coding sequence directly fused to 300 - 600 consecutive nucleotides downstream of the icd coding region is inserted into pClik int sacB.
  • the resulting plasmid is called pClik int sacB delta icd (SEQ ID NO:8).
  • the plasmid is then transformed into C. glutamicum by standard methods, e.g. electroporation. Methods for transformation are found in e.g. Thierbach et al. (Applied Microbiology and Biotechnology 29:356-362 (1988)), Dunican und Shivnan (Biotechnology 7:1067-1070 (1989)), Tauch et al. (FEMS Microbiological Letters 123,343-347 (1994)), and DE 10046870.
  • Suitable primers are (5' to 3'):
  • a strain in which the complete coding region of ICD was removed should result in a PCR product of about 440 base pairs (more precisely: 442 bp), while the parent strain with the wild type icd gene should show a band of about 2660 base pairs.
  • Successful deletion can furthermore be confirmed by Southern blotting or measuring ICD activity.
  • delta icd The resulting strain which contains a complete deletion of the icd coding region is called delta icd. As this strain will lack ICD activity and therefore be unable to synthesise glutamate, it is useful to let this strain grow on rich medium or supply glutamate if grown on minimal medium.
  • lysine, methionine, beta- lysine, diaminopentane, dipicolinate can be monitored as descibed above and in WO 2007/101867, WO 2007/113127.
  • the same culture medium and conditions as for lysine production as described in WO 2005/059139 can be employed.
  • the strains are precultured on CM agar overnight at 30 0 C. Cultured cells are harvested in a microtube containing 1.5 ml of 0.9% NaCl and cell density is determined by the absorbance at 610 nm following vortex.
  • suspended cells are inoculated to reach 1.5 of initial OD into 10 ml of the production medium (called medium I in WO 2005/059139) contained in an autoclaved 100 ml of Erlenmeyer flask having 0.5 g of CaCO3.
  • Main culture is performed on a rotary shaker (Infors AJl 18, Bottmingen, Switzerland) with 200 rpm for 48-78 hours at
  • Example 5 Replacement of the native icd coding region with a variant with lower specific activity
  • the icd coding sequence is cloned into a replicating plasmid which contains all regulatory sequences, such as promoter, RBS and a terminator sequence functioning in the host cell, which may be C. glutamicum.
  • a shuttle plasmid is used which can replicate in E. coli and in C. glutamicum.
  • An example for such a shuttle vector is pClik5aMCS (WO 2005/059093). More suitable shuttle vectors can be found in Eikmanns et al. ⁇ Gene (1991) 102:93-8) or in the "Handbook of Corynebacterium" (edited by Eggeling and Bott, ISBN 0-8493-1821-1, 2005).
  • E. coli - C. glutamicum shuttle vectors table 23.1
  • E. coli - C. glutamicum shuttle expression vectors table 23.2
  • the latter are preferred as they already contain suitable promoters driving the expression of the cloned gene.
  • Standard methods of molecular biology such as cloning including the amplicifation by PCR, digestion with restriction enzymes, ligation, transformation are known to the expert and can be found in standard protocol books such as Ausubel et al. (eds) Current protocols in molecular biology. (John Wiley & Sons, Inc. 2007), Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. (1989), and Ausubel et al. (eds.), SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 3rd Edition (John Wiley & Sons, Inc. 1995).
  • a set of mutant variants of the icd coding sequence is generated by site-directed mutagenenis. Methods for mutagenesis can be found in Glick and Pasternak MOLECULAR BIOTECHNOLOGY. PRINCIPLES AND APPLICATIONS OF RECOMBINANT DNA; 2 nd edition (American Sicienty for Microbiology, 1998), Chapter 8: Directed Mutagenensis and Protein Engineering, and Ausubel et al. (eds) Current protocols in molecular biology. (John Wiley & Sons, Inc. 2007). Chapter 8.
  • the resulting set of plasmids encoding a library of icd variants is usually generated in E. coli.
  • the library may be transformed into C. glutamicum by standard methods, such as electroporation. Methods for transformation are found in e.g. Thierbach et al. (Applied Microbiology and Biotechnology 29:356-362 (1988)), Dunican und Shivnan (Biotechnology 7:1067-1070 (1989)), Tauch et al. (FEMS Microbiological Letters 123:343-347 (1994)) or Eggeling and Bott (eds) Handbook of Corynebacterium” (Taylor and Francis Group, 2005) ISBN 0-8493-1821-1. The resulting clones should then be tested on ICD activity. The method to measure ICD enzyme activity from crude cell extract is described in example 1.
  • the wild type icd gene cloned in the same plasmid as the icd variant library is determined in parallel.
  • ICD variants with lower activity compared to the wild type icd gene can be selected.
  • the mutants resulting in lower ICD activity can either have lower specific activity (e.g. each protein molecule is less active), be transcribed or translated less efficiently, or be less stable.
  • the variant icd coding sequence is inserted into the delta icd strain.
  • the mutant icd sequence is cloned into a suitable integration plasmid, e.g. pClik int sacB (see above) flanked by the same ⁇ 300-600 upstream and downstream nucleotides used for the deletion construct in example 4.
  • a suitable integration plasmid e.g. pClik int sacB (see above) flanked by the same ⁇ 300-600 upstream and downstream nucleotides used for the deletion construct in example 4.
  • plasmid containing mutant icd is transformed into C. glutamicum, clones which have - after two consecutive steps of homologous recombination - inserted the mutant icd coding region into the icd locus can be identified by a similar strategy as above. PCR primers specific for the mutant ICD coding region may be used to distinguish between the delta icd strain and the positive clone.
  • icd (mut) Clones which have successfully replaced the wild type icd coding region by the mutant icd coding region will be called "icd (mut)" in the following.
  • strain "icd (mut)" should be compared to the activity of the parent strain containing the wild type icd gene. The method for this is described in example 1.
  • mutant icd may be done in strains producing different chemicals by fermentation.
  • Suitable strains include C. glutamicum engineered to produce the following chemicals (refererences for strains which can be used as production strains in brackets):
  • Lysine e.g. LUl 1424, ATCC 13032 lysC(fbr); ATCC13287, 21300, 21513 described in e.g. Eggeling and Bott (eds) Handbook of Corynebacterium” (Taylor and Francis Group, 2005) Chapter 20
  • lysine, methionine and diaminopentane production is described in the other examples.
  • the same culture medium and conditions as for lysine production can be employed as described in WO 2005/059139.
  • the strains are precultured on CM agar overnight at 30 0 C. Cultured cells are harvested in a microtube containing 1.5 ml of 0.9% NaCl and cell density is determined by the absorbance at 610 nm following vortex.
  • suspended cells are inoculated to reach 1.5 of initial OD into 10 ml of the production medium (called medium I in WO 2005/059139) contained in an autoclaved 100 ml of Erlenmeyer flask having 0.5 g of CaCO 3 .
  • Main culture is performed on a rotary shaker (Infers AJl 18, Bottmingen, Switzerland) with 200 rpm for 48-78 hours at 30 0 C.
  • 0.1 ml of culture broth is mixed with 0.9 ml of 1 N HCl to eliminate CaCO 3 , and the absorbance at 610 nm is measured following appropriate dilution.
  • the concentration of the product and residual sugar including glucose, fructose and sucrose are measured by HPLC method (Agilent 1100 Series LC system).
  • Example 6 Lowering icd transcription/translation by changing the upstream sequence a) Identification of a suitable upstream sequence (promoter plus RBS) First, an upstream sequence which is weaker than the native icd promoter has to be identified. The new upstream sequence can be derived from Corynebacterium or from other organisms. Several promoters (incl RBS) which function in bacteria, more specifically in coryneform bacteria, have been identified.
  • upstream regions which are weaker than the native icd promoter may be used for the replacement of the icd promoter.
  • the strength of upstream regions can be measured using a reporter system, such as described in Patek et al (1996) Promoters from corynebacterium glutamicum: cloning, molecular analysis and search for a consensus motif. Microbiology 142:1297-1309.
  • the 83 nt upstream sequence of the icd start codon is used, as in this regions there is no coding region of other genes.
  • the sequence of the upstream region is shown below (bold letters).
  • the resulting strain will have lowered ICD activity.
  • the effect on the productivity can be analyzed as described in Example 5.
  • ICD gene including 500 nt up- and downstream region (SEQ ID NO:2) Presumed promoter region (Upstream region): bold letters bold, not underlined: (partial) 3' coding region of the gene located upstream of icd bold, underlined: 83 nt without any coding region

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un procédé employant un micro-organisme présentant une activité isocitrate déshydrogénase réduite pour la production de produits chimiques fins. Lesdits produits chimiques fins peuvent être des acides aminés, des monomères pour la synthèse de polymères, des sucres, des lipides, des huiles, des acides gras ou des vitamines et sont de préférence des acides aminés de la famille des aspartates, en particulier, la méthionine et la lysine, ou des dérivés de ces acides aminés, en particulier la cadavérine. En outre, la présente invention concerne un micro-organisme recombinant présentant une activité isocitrate déshydrogénase réduite par rapport à celle du micro-organisme initial et l'utilisation de ce micro-organisme dans la production de produits chimiques fins, comme des acides aminés de la famille des aspartates et leurs dérivés.
EP09738158A 2008-04-30 2009-04-28 Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite Withdrawn EP2283142A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP09738158A EP2283142A1 (fr) 2008-04-30 2009-04-28 Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP08155436 2008-04-30
EP09153149 2009-02-18
EP09738158A EP2283142A1 (fr) 2008-04-30 2009-04-28 Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite
PCT/EP2009/055146 WO2009133114A1 (fr) 2008-04-30 2009-04-28 Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite

Publications (1)

Publication Number Publication Date
EP2283142A1 true EP2283142A1 (fr) 2011-02-16

Family

ID=40852147

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09738158A Withdrawn EP2283142A1 (fr) 2008-04-30 2009-04-28 Procédé de production de produits chimiques fins employant des micro-organismes présentant une activité isocitrate déshydrogénase réduite

Country Status (6)

Country Link
EP (1) EP2283142A1 (fr)
JP (1) JP5395893B2 (fr)
KR (2) KR20130038944A (fr)
CN (1) CN102124119A (fr)
BR (1) BRPI0911770A2 (fr)
WO (1) WO2009133114A1 (fr)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8404465B2 (en) 2009-03-11 2013-03-26 Celexion, Llc Biological synthesis of 6-aminocaproic acid from carbohydrate feedstocks
KR101512432B1 (ko) * 2010-06-15 2015-04-16 백광산업 주식회사 미생물을 이용한 아스파테이트 계열 아미노산의 생산방법
IN2014MN01298A (fr) 2011-12-21 2015-07-03 Cj Cheiljedang Corp
WO2014028026A1 (fr) * 2012-08-17 2014-02-20 Celexion, Llc Synthèse biologique d'hexanes et de pentanes difonctionnels à partir de charges de glucides
CN104845923B (zh) 2014-02-14 2018-03-23 中国科学院微生物研究所 生产l‑组氨酸的方法及其专用重组菌
CN105441473A (zh) * 2014-08-18 2016-03-30 中粮营养健康研究院有限公司 一种谷氨酸生产菌株及其制备方法
CN105441496A (zh) * 2015-12-22 2016-03-30 天津科技大学 一种提高微生物利用糖类发酵生产尸胺的方法
CN107796770A (zh) * 2017-10-09 2018-03-13 苏州科铭生物技术有限公司 一种异柠檬酸裂解酶活性测定试剂盒及其方法
CN108085287B (zh) * 2017-12-14 2021-08-24 江南大学 一种重组谷氨酸棒状杆菌、其制备方法及其应用
WO2020036181A1 (fr) * 2018-08-13 2020-02-20 Ｓｐｉｂｅｒ株式会社 Procédé pour d'isolement ou d'identification d'une cellule, et masse cellulaire
KR20220007769A (ko) 2020-07-09 2022-01-19 삼성디스플레이 주식회사 표시 장치
US20230313244A1 (en) * 2020-09-03 2023-10-05 Daesang Corporation Corynebacterium glutamicum mutant strain having enhanced l-lysine productivity and method of producing l-lysine using the same
CN113913483B (zh) * 2021-11-23 2023-06-23 常州大学 一种海藻糖和葡萄糖酸联产的方法
CN116426512B (zh) * 2022-08-11 2023-09-26 海南师范大学 一种耐盐（NaCl）异柠檬酸酶基因及应用
CN118460587B (zh) * 2024-07-15 2024-09-10 南京工业大学 过表达关键基因或/和关键酶基因在提高维生素k2产量中的应用及方法

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7244610B2 (en) * 2003-11-14 2007-07-17 Rice University Aerobic succinate production in bacteria
WO2006031424A2 (fr) * 2004-08-27 2006-03-23 Rice University Souche e. coli mutante avec production accrue d'acide succinique
WO2007140816A1 (fr) * 2006-06-09 2007-12-13 Metabolic Explorer Production d'acide glycolique par fermentation à partir de ressources renouvelables
EP2082045B1 (fr) * 2006-10-24 2015-03-18 Basf Se Procédé permettant de réduire l'expression génique par une utilisation de codons modifiée

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2009133114A1 *

Also Published As

Publication number Publication date
JP2011518571A (ja) 2011-06-30
KR20130038944A (ko) 2013-04-18
BRPI0911770A2 (pt) 2015-08-04
JP5395893B2 (ja) 2014-01-22
KR101498753B1 (ko) 2015-03-09
WO2009133114A1 (fr) 2009-11-05
CN102124119A (zh) 2011-07-13
KR20110015422A (ko) 2011-02-15

Similar Documents

Publication Publication Date Title
JP5395893B2 (ja) 低下したイソクエン酸デヒドロゲナーゼ活性を有する微生物を使用するファインケミカルの製造方法
US8951759B2 (en) Process for the fermentative preparation of L-ornithine
RU2535973C2 (ru) Способ продуцирования аминокислот семейства аспартата с использованием микроорганизмов
EP2082045B1 (fr) Procédé permettant de réduire l'expression génique par une utilisation de codons modifiée
JP4648947B2 (ja) 硫黄含有化合物を生産するための微生物
EP2082044B1 (fr) Procédé permettant d'augmenter l'expression génique par une utilisation de codons modifiées
US8148117B2 (en) Microorganism and process for the preparation of L-methionine
EP2431476B1 (fr) Bactéries coryneformes dotées d'une activité de division de la glycine
US8252555B2 (en) Nucleic acid encoding a cobalamin-dependent methionine synthase polypeptide
US8163532B2 (en) Microorganisms with a reactivation system for cob(I)alamin-dependent methionine synthase
US20100047881A1 (en) Microorganisms with Deregulated Vitamin B12 System
WO2007020295A2 (fr) Micro-organismes a rendement ameliore destines a la synthese de la methionine
WO2007135188A2 (fr) Procédé de synthèse de la l-méthionine
EP2121735A1 (fr) Procédé de production de méthionine dans des corynebactéries par la surexpression d'enzymes de la voie pentose phosphate
US20110207183A1 (en) Production Process for Fine Chemicals Using Microorganisms with Reduced Isocitrate Dehydrogenase Activity
US20110117614A1 (en) Production Process for Methionine Using Microorganisms with Reduced Isocitrate Dehydrogenase Activity
EP4317426A1 (fr) Nouvelle voie de synthèse de la glycine

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20101130

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA RS

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20111128

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140819