Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K8/00—Cosmetics or similar toiletry preparations
  • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
  • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
  • A61K8/60—Sugars; Derivatives thereof
  • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K8/00—Cosmetics or similar toiletry preparations
  • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
  • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
  • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
  • A61Q5/00—Preparations for care of the hair
  • A61Q5/06—Preparations for styling the hair, e.g. by temporary shaping or colouring
  • A61Q5/065—Preparations for temporary colouring the hair, e.g. direct dyes
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
  • A61Q5/00—Preparations for care of the hair
  • A61Q5/10—Preparations for permanently dyeing the hair
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
  • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
  • A61K2800/94—Involves covalent bonding to the substrate

Definitions

• the invention relates to keratin-binding effector molecules containing reactive dyes and keratin-binding polypeptides, and to their use in hair dye preparations and the hair dye preparations themselves.
• Another object of the present invention is a method for dyeing hair.
• Hair coloring compositions are classified into three classes depending on their color fastness: temporary hair dyes that are only 1-2 shampoos, semi-permanent hair dyes that need to be renewed after 8-10 washes, and permanent hair dyes that are not - wash out.
• Temporary and semipermanent hair dyes are referred to as non-oxidative.
• the dyes attach to the keratin of the hair or penetrate into the hair fiber.
• With permanent hair dyes by far the most widely used hair dyes, the colors of colorless precursors are formed directly on and in the hair by chemical reaction in the presence of hydrogen peroxide, which acts as the oxidant. The hair is completely dyed through, the color is not washable.
• These hair dyes are referred to as oxidative hair dyes.
• the permanent hair coloring is very resistant to shampooing, exposure to light and other hair treatment methods. It is the most widely used and has a market share of approx. 80% among hair dye products. It only needs, due to the hair growth, about every month to be renewed.
• the dyes are formed directly on and in the hair, by chemical reactions to which the undyed intermediates or precursors are subjected. It run from oxidation reactions and coupling processes or condensations, which are caused by hydrogen peroxide in the presence of ammonia or monoethanolamine.
• the use of hydrogen peroxide as an oxidizing agent is necessary because it not only initiates dye formation, but also destroys the melanin pigments of the hair and thus causes bleaching, which is why this dyeing process is also referred to as lightening dyeing.
• hair dyes are usually in the form of aqueous solutions, preferably thickened solutions or emulsions and contain, in addition to dyes, for example, fatty alcohols and / or other oil components, emulsifiers and surfactants, and optionally alcohols.
• Oxidizing hair dyes usually consist of two components, namely
• Typical administration forms for such permanent or oxidation hair dyes are cream hair colors and hair coloring gels.
• hair dyes contain two components: an oxidizing agent and a color cream.
• the aromatic amines found in hair dyes have been particularly criticized in the recent past. During staining, they should be absorbed into the body via the head and broken down in the liver. In the bladder, the degradation products are then partially converted to carcinogenic substances.
• active compound compounds which have a keratin-binding property and are also suitable for the production of cosmetic agents and / or hair colorants.
• suitable compounds which can be coupled via a covalent bond to a polypeptide having keratin-binding properties.
• these objects could be achieved as described below by the coupling of chemical dyes to keratin-binding polypeptides.
• the invention relates to keratin-binding effector molecules comprising (a) at least one reactive dye (i) and (b) at least one keratin-binding polypeptide (ii).
• said keratin-binding effector molecules contain at least one keratin-binding polypeptide (ii) which has a binding affinity to human skin, hair or nail keratin.
• the keratin-binding polypeptide (ii) mentioned under (b) comprises
• polypeptide which is at least 40% identical to at least one of the sequences according to SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 100, 102, 104, 106,
• the keratin-binding polypeptide (ii) used according to the invention is encoded by a nucleic acid molecule comprising at least one nucleic acid molecule selected from the group consisting of:
• nucleic acid molecule which encodes a polypeptide comprising those shown in SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 , 36, 38, 40,
• nucleic acid molecule which has at least one polynucleotide of the sequence shown in SEQ ID No .: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 145, 149, 152, 159, 161, 163, 165, 167 or 169;
• nucleic acid molecule which comprises a polypeptide according to the sequences SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 , 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86 , 88, 90, 92, 94, 96, 98 100, 102, 104, 106, 108, 110, 112, 114, 16, 18, 120, 122, 124, 126, 128, 130, 132 , 134, 136, 138, 140, 146, 150, 153, 156,
• nucleic acid molecule having a nucleic acid sequence corresponding to at least one of the sequences according to SEQ ID No .: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57,
• nucleic acid molecule encoding a polypeptide which is derived from a monoclonal antibody directed against a polypeptide which is expressed by the
• nucleic acid molecule encoding a keratin-binding protein that hybridizes under stringent conditions with a nucleic acid molecule according to (a) to (c);
• nucleic acid molecule coding for a keratin-binding protein which consists of a DNA library using a nucleic acid molecule according to (a) to (c) or its partial fragments of at least 15 nt (nucleotides), preferably 20 nt, 30 nt, 50 nt , 100 nt, 200 nt or 500 nt as a probe under stringent
• Hybridization conditions can be isolated, and h) Nucleic acid molecule, which by back translation of one of the in the sequences SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 , 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 , 86, 88, 90, 92, 94, 96, 98 100, 102, 104, 106, 108, 1 10, 1 12, 1 14, 1 16, 1 18, 120, 122, 124, 126, 128, 130 , 132, 134, 136, 138,
• 140, 146, 150, 153, 156, 157, 158, 160, 162, 164, 166, 168 or 170 can be generated.
• said keratin-binding effector molecules contain at least one reactive dye (ii) which has at least one reactive anchor selected from the group consisting of
• the bond to the dye molecule (F) means
• V is fluorine or chlorine
• Ui, U2 are independently fluorine, chlorine or hydrogen
• Q 1, Q 2 independently of one another chlorine, fluorine, cyanamido, hydroxy, (C 1 -Ce) alkoxy, phenoxy, sulfophenoxy, mercapto, (C 1 -C 6) -alkylmercapto, pyridino, carboxypyridino, carbamoylpyridino, or a group of the general Mean formula (6) or (7)
• R 24 , R 25 and R 26 are (C 1 -C 4 ) -alkyl or (C 1 -C 4 ) -hydroxyalkyl;
• B- is the equivalent of an anion such as hydrogen sulfate, sulfate, fluoride, chloride, bromide, dihydrogen phosphate, hydrogen phosphate, phosphate, hydroxide or acetate;
• the keratin-binding effector molecule contains a reactive dye containing a reactive anchor according to formula 1, wherein at least one of the radicals present there is a group SO3H.
• keratin-binding effector molecules containing dyes selected from the group of phthalocyanine-series dyes, anthraquinone dyes, azo dyes, formazan dyes, dioxazine dyes, actidine dyes, xanthene dyes, polymethine dyes , Stilbene dyes, sulfur dyes, triarylmethane dyes, benzopyran dyes, dibenzanthrone dyes and the metal complexes of these dyes.
• keratin-binding effector molecules comprising at least one reactive dye which comprises a reactive anchor selected from the following residues (1-1) to (1-43).
• a preferred subject of the present invention are also keratin-binding effector molecules in which the reactive dye (i) is indirectly coupled via a linker molecule to the keratin-binding polypeptide (ii).
• the dye or the reactive dye is coupled to the keratin-binding polypeptide via a linker molecule (iii) according to formula 9 or 10.
• n is an integer between 0 and 40.
• Another object of the present invention is the use of the keratin-binding effector molecules described above in skin, hair dyes or decorative cosmetics.
• the present invention furthermore relates to skin, nail and / or hair dyes, preferably hair dyes, containing at least one of the keratin-binding effector molecules according to the invention described above.
• a further subject of this invention is a process for dyeing hair, skin or nails with keratin-binding effector molecules comprising (a) at least one keratin-binding polypeptide (ii) and (b) a dye or reactive dye (i).
• the keratin-binding effector molecules according to the invention as defined above are used.
• the keratin-binding effector molecule by treatment with (i) a keratin-binding polypeptide, or (ii) a keratin-containing solution in a displacing reaction is displaced from the hair, skin or nail keratin or the keratin-binding effector molecule is removed by a solution with a high detergent content (eg SDS) of the skin, hair or nails.
• a high detergent content eg SDS
• amino functions in the context of the description "amino function-carrying effector molecule”, means amino groups which make it possible to covalently link the molecules carrying said amino functions via an amide bond with other molecules.
• amino functions are also those which can be converted chemically into amino functions, the effector molecules according to the invention having at least one amino function, but also effector molecules having two, three or more amino functions and / or secondary amino groups can be used become.
• antibodies are proteins which humans and the kite-bearing vertebrates produce to repel antigens (infectious agents or body-foreign biological material) They are a central component of the immune system of higher eukaryotes and are produced by a class of white blood cells, the B Cells are secreted, occurring in the blood and extracellular fluid of the tissues.
• Decorative cosmetics means cosmetic aids which are not primarily used for care purposes but for beautifying or improving the appearance of the skin, hair and / or fingernails. These aids are known to the person skilled in the art and include, for example, kohl pencils, mascara, eye shadows , tinted topicals, powders, masking sticks, blushes, lipsticks, lip pencils, make-up, nail varnish, glamor gel, etc. In particular, for the purposes of the present invention, agents are suitable for dyeing skin, nails and / or hair.
• “Hair dyes” are agents or preparations (i) dyeing of hair. "Hair dyes” in the sense of the present invention are distinguished into direct colors and true hair colors. For direct colors, one or more washes are sufficient to remove the color (tints). The dye is only superficially attached to the hair substance, there is no chemical reaction. For the hair itself, the process is harmless.
• Hair dyes contain in a cosmetically acceptable medium suitable auxiliaries and additives which are familiar to the person skilled in the art and handbooks of cosmetics, for example Schrader, bases and formulations of the Kosmetika, Weghig Verlag, Heidelberg, 1989, ISBN 3-7775-1491-1, or Limbach, cosmetics: development, production and application of cosmetics, 2nd extended edition, 1995, Georg Thieme Verlag, ISBN 3 13 712602 9, can be removed.
• Effective molecule in the sense of the present invention means molecules which have a certain predictable effect, preferably a color-altering and / or nourishing effect or a cosmetically decorative effect on skin, hair or nails for example, shown in Tables 3, 5 and 6.
• Keratin in the sense of the present invention means intermediary filaments constructed from rope-shaped protein complexes. Intermediate filaments are composed of many similar proteins (monomers), which assemble in parallel to a tubular structure. Intermediate filaments are connected to larger bundles (tonofibrils). Intermediate filaments together with the microtubules and actin filaments form the cytoskeleton of the cell. There are five types of intermediate filaments: acidic and basic keratins, desmines, neurofilaments and lamins. Especially preferred for the purposes of the present invention are the acidic and basic keratins occurring in the epithelia (single or multi-layer cell layers which cover all outer body surfaces of the multicellular animal organisms).
• Keratin-binding polypeptide means a polypeptide or protein that has the property of binding to keratin
• keratin-binding polypeptides are also intermediate filament-associated proteins
• These keratin-binding polypeptides have a binding affinity to keratin or to keratin-based macrostructures such as protofibrils
• keratin-binding polypeptides are to be understood as meaning those polypeptides which have a binding affinity for skin, hair and / or fingernails of mammals.
• Keratin-binding polypeptides are also polypeptides having a biological function associated with the binding of keratin, keratin fibers, skin or hair within a mammalian organism, keratin-binding polypeptides also means those for the actual binding to the keratin, the keratin fibers, skin, hair Binding of the keratin-binding polypeptide (ii) to keratin can be tested under the conditions described in Examples 8, 9 and 10. Keratin-binding polypeptides are those polypeptides that are approximately 10% in the above-mentioned quantitative keratin binding tests.
• Coupling in connection with the binding of a linker molecule to an effector molecule or keratin-binding protein, means a covalent linkage of the said molecules.
• Cosmetically acceptable medium is to be understood broadly and means substances which are suitable for the preparation of cosmetic or dermocosmetic preparations and mixtures thereof, preferably protein-compatible media.
• Cosmeticsmetically-compatible substances do not cause irritation or damage on contact with human or animal dermal tissue or hair and are incompatible with other substances, and have low allergenic potential and are approved by the state regulatory authorities for use in cosmetic preparations These substances are familiar to the person skilled in the art and may, for example, be manuals for cosmetics, for example Schrader, bases and formulations of cosmetics, Weghig Verlag, Heidelberg, 1989, ISBN 3-7785-1491-1, are taken.
• Nucleic acid or nucleic acid molecule means deoxyribonucleotides, ribonucleotides or polymers or hybrids thereof, in single- or double-stranded form, in sense or antisense orientation.
• the term nucleic acid or nucleic acid molecule can be used to describe a gene, DNA, cDNA, mRNA, oligonucleotide or polynucleotide.
• Nucleic acid sequence means a sequential and interlinked sequence of deoxyribonucleotides or ribonucleotides of a nucleic acid molecule as defined above, as determined using available DNA / RNA sequencing techniques, and in the form of a list of abbreviations, letters or words representing nucleotides, can be displayed or displayed.
• Polypeptide in the sense of the present invention means a macromolecule composed of amino acid molecules, in which the amino acids are linked to one another in a linear sequence via peptide bonds
• a polypeptide can be composed of a few amino acids (about 10 to 100), but also comprises proteins. Proteins are generally composed of at least 100 amino acids, but may also comprise several thousand amino acids
• polypeptides comprise at least 20, 30, 40 or 50, more preferably at least 60, 70, 80 or 90, most preferably at least 100, 125, 150, 175 or 200, most preferably at least over 200 amino acids, wherein the upper limit may be several thousand amino acids.
• “Homology” or “identity” between two nucleic acid sequences is understood to mean the identity of the nucleic acid sequence over the respective entire sequence length, which is determined by comparison with the aid of the program algorithm GAP (Wisconsin Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA; Altschul et al. (1997) Nucleic Acids Res. 25: 3389ff), using the following parameters:
• Gap Weight 50 Length Weight: 3
• GAP WorldNetwork Organization
• Gap Weight 8 Length Weight: 2
• a sequence having a polypeptide-based homology of at least 80% with the sequence SEQ ID NO: 2 is understood as meaning a homology of, in a comparison with the sequence SEQ ID NO: 2 according to the above program algorithm with the above parameter set at least 80%.
• Hybridization conditions is to be understood broadly and, depending on the application, means stringent as well as less stringent hybridization conditions Such hybridization conditions are described inter alia in Sambrook J, Fritsch EF, Maniatis T et al., In Molecular Cloning (A Laboratory Manual), 2nd edition CoId, Spring Harbor Laboratory Press, 1989, pp. 9.31-9.57) or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6 The skilled artisan would select hybridization conditions that would allow him allow to distinguish specific from non-specific hybridizations.
• the conditions of low-stringency conditions (approximately 2X SSC at 5O 0 C.) and preferably at high stringency (approximately 0.2X SSC at 5O 0 C at 65 0 C) (2 O x SSC. 0.3M sodium citrate, 3M NaCl, pH 7.0) in addition, the temperature during the washing step from low stringency Conditions at room temperature, about 22 0 C, to more stringent conditions, about 65 0 C, raised. Both parameters, salt concentration and temperature, can be varied simultaneously or individually, keeping the other parameter constant.
• denaturing agents such as formamide or SDS may also be used. In the presence of 50% formamide, hybridization is preferably carried out at 42 ° C.
• Hybridization conditions may for example be selected from the following conditions: a) 4X SSC at 65 ° C, b) 6X SSC at 45 ° C, c) 6X SSC, 100 ⁇ g / ml denatured, fragmented fish sperm DNA at 68 ° C, d) 6X SSC, 0.5% SDS, 100 ⁇ g / ml denatured salmon sperm DNA at 68 ° C, e) 6X SSC, 0.5% SDS, 100 ⁇ g / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C.
• Wash steps can be selected for example from the following conditions: a) 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS at 50 0 C. b) 0.1X SSC at 65 ° C. c) 0.1X SSC, 0.5% SDS at 68 ° C. d) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C. e) 0.2X SSC, 0.1% SDS at 42 ° C. f) 2X SSC at 65 ° C (weak stringent condition).
• the stringent hybridization conditions are chosen as follows:
• a hybridization buffer which contains formamide, NaCl and PEG 6000.
• the presence of formamide in the hybridization buffer destabilizes double-stranded nucleic acid molecules, allowing the hybridization temperature to be lowered to 42 ° C without thereby lowering the stringency.
• the use of salt in the hybridization buffer increases the renaturation rate of a duplex or the hybridization efficiency.
• PEG increases the viscosity of the solution, which has a negative influence on renaturation rates, the presence of the polymer in the solution increases the concentration of the probe in the remaining medium, which increases the rate of hybridization.
• the composition of the buffer is as follows:
• Hybridization buffer The hybridizations are carried out at 42 ° C overnight. The filters are washed 3x 2xSSC + 0.1% SDS the next morning for approx. 10 min each. washed.
• "Hydroxy function” in the context of the description "hydroxy function-carrying effector molecule”, means free OH groups or hydroxyl groups, which make it possible to covalently link these OH-group-carrying molecules via an esterification reaction with other molecules.
• Haldroxy functions within the meaning of the present invention are also those which can be converted chemically into OH functions (for example derivatives such as methoxy, ethoxy), the effector molecules according to the invention having at least one hydroxyl group, but also effector molecules having two, three or more hydroxy functions are used.
• Coupling functionalities are functional groups of a linker molecule which can covalently bind with functional groups of the effector molecule or the keratin-binding protein, by way of example but not limited to: hydroxyl groups, carboxyl groups, thio groups and amino groups. "Coupling functionalities” or “coupling functionality” and " Anchor Groups "or” Anchor Group “are used synonymously.
• Reactive dye in the sense of the present invention means dyes containing at least one reactive anchor which can be coupled via a covalent bond to a keratin-binding polypeptide.
• Reactive anchor in the context of the present invention means chemically functional groups or radicals by means of which a covalent bond between a carbon or phosphorus atom of the reactive dye molecule and an oxygen, nitrogen or sulfur atom of a hydroxy, amino or thiol group of another molecule is realized.
• Residues which are cleaved under alkaline conditions, ie at pH values of 7 or above, preferably 7.5 or above, with elimination and formation of a vinylsulfone group.
• groups are halogen, for example chlorine, bromine or iodine, furthermore -O-SO 3 H, -S-SO 3 H, dialkylamino, quaternary ammonium radicals such as tri-C 1 -C 4 -alkylammonium, benzyldiCi-C 4 - Alkylammonium or N-bonded pyridinium, and radicals of the formulas R 3 S (O) 2 -, R 4 S (O) 2 -O-, R 5 C (O) -O-.
• R 3 , R 4 and R 5 are independently alkyl, haloalkyl or optionally substituted phenyl, wherein R 5 may also be hydrogen.
• Q is a group -O- (CO) CH 3 and especially -O-SO 3 H.
• Reversible coloring in the sense of the present invention means a change in the color of skin, hair or nail keratin achieved by use of the method according to the invention, which can be reversed.
• "Back translation” in the sense of the present invention means the translation of a protein sequence into a nucleic acid sequence coding for this protein .Therefore, the back translation is a process of decoding an amino acid sequence into the nucleic acid sequence corresponding thereto.
• codons most commonly used for a particular species for a particular species can be determined Protein back translation can be performed using computer algorithms known to those skilled in the art and specifically designed for this purpose (Andres Moreira and Alejandro Maass TIP: protein back translation aided by genetic algorithms, Bioinformatics, Volume 20, Number 13 pp. 2148-2149 (2004); G Pesole, M. Attimonelli, and S. Liuni thod based on codon usage strategy. Nucleic Acids Res. 1988 March 1 1; 16 (5 Pt A): 1715-1728.).
• the present invention relates to keratin-binding effector molecules comprising (a) at least one reactive dye (i) and (b) at least one keratin-binding polypeptide (ii).
• the said keratin-binding effector molecules contain at least one keratin-binding polypeptide (ii) which has a binding affinity to human skin, hair or nail keratin.
• Keratin-binding polypeptide domains suitable according to the invention are e.g. present in the polypeptide sequences of desmoplakins, Plakophilinen, Plakoglobinen, Plectinen, Periplakinen, Envoplakinen, Trichohyalinen, Epiplakinen or Haarfolikelproteinen.
• the keratin-binding polypeptide (ii) mentioned under (b) comprises
• polypeptide which is at least 40% identical to at least one of the sequences according to SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 100, 102, 104, 106,
• said keratin-binding effector molecules contain at least one keratin-binding polypeptide (ii) which is encoded by a nucleic acid molecule comprising at least one nucleic acid molecule selected from the group consisting of:
• nucleic acid molecule encoding a polypeptide comprising those shown in SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 , 36, 38, 40,
• nucleic acid molecule which has at least one polynucleotide of the sequence shown in SEQ ID No .: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81 , 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131 , 133, 135, 137, 139,
• nucleic acid molecule which comprises a polypeptide according to the sequences SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 , 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84,
• nucleic acid molecule having a nucleic acid sequence corresponding to at least one of the sequences according to SEQ ID No .: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 145, 149, 152, 159, 161, 163, 165, 167 or
• nucleic acid molecule derived therefrom by substitution, deletion or insertion which codes for a polypeptide which is at least 40% identical to at least one of the sequences according to SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84,
• nucleic acid molecule encoding a keratin-binding protein that hybridizes under stringent conditions with a nucleic acid molecule according to (a) to (c);
• nucleic acid molecule encoding a keratin-binding protein from a DNA library using a nucleic acid molecule according to (a) to (c) or their partial fragments of at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt can be isolated as a probe under stringent hybridization conditions, and
• Nucleic acid molecule which by back translation of one of the in the sequences SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 , 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72,
• said keratin-binding effector molecules contain desmoplakins or their partial fragments according to the sequences SEQ ID No .: 2, 42, 44, 46, 48, 146, 150, 153, 156, 157, 158, 160, 162, 164 or 166, and / or Plakophillins or their partial sequences according to the sequences SEQ ID No .: 18, 20, 26, 28, 32, 34, 36, 168, 170 and / or Plakoglobine or their partial sequences according to the sequences having the
• Preferred keratin-binding domains are those shown in the sequences SEQ ID NOs: 4, 6, 8, 10, 12, 14, 146, 150, 153, 156, 157, 158, 160, 162, 164, 166, 168 or 170 Desmoplakin polypeptides, as well as their functional equivalents.
• the keratin-binding polypeptides depicted in the sequences SEQ ID No .: 156, 157, 158, 160, 162, 164, 168 and / or 170 are used in the method according to the invention.
• the keratin-binding protein shown in the sequence SEQ ID No .: 168 is used.
• this protein can be used both with and without the histidine anchor present in SEQ ID No .: 168.
• the histidine anchor (or a purification / Detektiossystem to be used analogously) may also be C-terminal.
• a histidine anchor (or a purification / detection system to be used analogously) is not necessary.
• the use of said proteins without additional amino acid sequences is preferred
• keratin-binding polypeptides are, in the context of the present invention, different polypeptides which furthermore possess the desired biological activity, such as keratin binding, for example, “functional equivalents” of keratin-binding polypeptides
• Polypeptides those polypeptides which, under otherwise comparable conditions, in the quantitative keratin binding tests described in the examples are about 10%, 20%, 30%, 40% or 50%, preferably 60%, 70%, 80% or 90%, more preferably 100%, 125%, 150%, most preferably 200%, 300% or 400%, most preferably 500%, 600%, 700% or 1000% or more of the keratin binding capacity of SEQ ID NO: 2 , 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52 , 54, 56, 58, 60, 62, 64, 66, 68, 70, 72,
• “functional equivalents” are in particular also understood to mean muteins which, in at least one sequence position of the abovementioned amino acid sequences, have a different amino acid than the one specifically mentioned but nevertheless possess one of the abovementioned biological activities.
• “Functional equivalents” thus include those represented by a Mutations obtainable muteins, said changes can occur in any sequence position, as long as they lead to a mutein with the property profile according to the invention.
• “Mutation” in the sense of the present invention means the alteration of the nucleic acid sequence of a gene variant in a plasmid or in the genome of an organism Mutations can arise, for example as a consequence of errors in the replication or caused by mutagens Organisms are very low, but a variety of biological, chemical or physical mutagens are known to those skilled in the art.
• Mutations include substitutions, insertions, deletions of one or more nucleic acid residues. Substitutions are understood as meaning the exchange of individual nucleic acid bases, a distinction being made between transitions (substitution of a purine for a purine base or a pyrimidine for a pyrimidine base) and transversions (substitution of a purine for a pyrimidine base (or vice versa).
• addition or insertion is meant the incorporation of additional Nuklein Text- reresten in the DNA, which can lead to shifts of the reading frame.
• frame shifts distinguish between “in frame” insertions / additions and “out of frame” insertions.
• in-frame insertions / additions the reading frame is retained and a polypeptide increased by the number of amino acids encoded by the inserted nucleic acids is formed.
• out of frame insertions / additions the original reading frame is lost and the formation of a complete and functional polypeptide is no longer possible.
• Deletions describe the loss of one or more base pairs, which also result in "in frame” or “out of frame” shifts of the reading frame and the consequent consequences on the formation of an intact protein.
• mutagenic agents useful for generating random or targeted mutations and the applicable methods and techniques are known to those skilled in the art.
• Such methods and mutagens are e.g. described by A.M. van Harten [1998], "Mutation breeding: theory and practical applications", Cambridge University Press, Cambridge, UK], E Friedberg, G Walker, W Siede [(1995), “DNA Repair and Mutagenesis", Blackwell Publishing], or K. Sankaranarayanan, JM Gentile, LR Ferguson [(2000) “Protocols in Mutagenesis", Elsevier Health Sciences].
• the mutagens listed below are illustrative but not limiting. Chemical mutagens can be subdivided according to their mechanism of action. Thus there are base analogues (eg 5-bromouracil, 2-amino purine), monofunctional and bifunctional alkylating agents (eg monofunctional such as ethyl methyl sulfonate, dimethyl sulfate or bifunctional such as dichloroethyl sulfite, mitomycin, nitrosoguanidines - dialkylnitrosamines, N-nitrosoguanidine derivatives) or intercalating substances (eg acridines, ethidium bromide).
• base analogues eg 5-bromouracil, 2-amino purine
• monofunctional alkylating agents eg monofunctional such as ethyl methyl sulfonate, dimethyl sulfate or bifunctional such as dichloroethyl sulfite, mitomycin, nitro
• those polypeptides may also be present in the keratin-binding effector molecules according to the invention which are obtained as a result of a mutation of a polypeptide according to the invention, e.g. according to SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 100, 102, 104, 106, 108, 1 10, 1 12, 1 14, 1 16, 1 18, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 146 , 150, 153, 156, 157, 158, 160, 162, 164, 166, 168 and / or 170.
• SEQ ID NO: 2 the naturally occurring serine at position 2849 can be exchanged, for example, for glycine, in order to avoid phosphorylation at this position (Fontao L, Favre B, Riou S, Geerts D, Jaunin F, Saurat JH , Green KJ, Sonnenberg A, Borradori L., Interaction of the bullous pemphigoid antigen 1 (BP230) and desmoplakin with intermediate filaments is mediated by distinct sequences within their COOH terminus., Mol Biol Cell. 2003 May; 14 (5): 1978-92. Epub 2003 Jan 26).
• Precursors are natural or synthetic precursors of the polypeptides with or without desired biological activity.
• Salts are understood as meaning both salts of carboxyl groups and acid addition salts of amino groups of the protein molecules of the invention.
• Salts of carboxyl groups can be prepared in a manner known per se and include inorganic salts such as, for example, sodium, calcium, ammonium, egg salts and salts with organic bases, such as, for example, amines, such as triethylamine, arginine, lysine, piperidine, etc.
• Acid addition salts for example salts with mineral acids, such as hydrochloric acid or sulfuric acid, and salts with organic acids, such as acetic acid and Oxalic acid are also the subject of the invention.
• “functional equivalents” also encompass polypeptides that are accessible from other organisms, as well as naturally occurring variants (alleles) thereof. For example, regions of homologous sequence regions or conserved regions can be determined by sequence comparisons. Using these sequences, DNA databases (e.g., genomic or cDNA databases) can be screened for equivalent enzymes using comparative bioinformatics programs. Suitable computer programs and publicly accessible databases are well known to those skilled in the art. These alignments of known protein sequences can be carried out, for example, with a computer program such as Vector NTI 8 (version of September 25, 2002) from InforMax Inc.
• Fusion equivalents are also fusion proteins comprising one of the above-mentioned polypeptide sequences or functional equivalents derived therefrom and at least one other functionally distinct heterologous sequence in functional N- or C-terminal linkage (ie, without mutual substantial functional impairment of the fusion protein moieties)
• heterologous sequences are, for example, signal peptides or enzymes.
• Homologs to the specifically disclosed proteins according to the invention include at least 40%, 45% or 50%, preferably at least 55%, 60%, 65% or 70%, particularly preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93% or 94%, most preferably at least 95% or 96% homology to any of the specifically disclosed amino acid sequences calculated using the computer programs and computer algorithms disclosed in the Definitions.
• “functional equivalents” include proteins of the type described above in deglycosylated or glycosylated form as well as modified forms obtainable by altering the glycosylation pattern.
• “functional equivalents” include proteins of the type indicated above in dephosphorylated or phosphorylated form as well as modified forms obtainable by altering the phosphorylation pattern.
• Homologs of the polypeptides of the invention may be prepared by screening combinatorial libraries of mutants, such as e.g. Shortening mutants, to be identified.
• a library of protein variants can be generated by combinatorial mutagenesis at the nucleic acid level, e.g. by enzymatic ligation of a mixture of synthetic oligonucleotides.
• methods that can be used to prepare libraries of potential homologs from a degenerate oligonucleotide sequence. The chemical synthesis of a degenerate gene sequence can be performed in a DNA synthesizer, and the synthetic gene can then be ligated into a suitable expression vector.
• degenerate gene set allows for the provision of all sequences in a mixture that encode the desired set of potential protein sequences.
• Methods of synthesizing degenerate oligonucleotides are known to those skilled in the art (eg, Narang, SA (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al., (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acids Res. 1 1: 477).
• REM Recursive ensemble mutagenesis
• the probe may also be one or several kilobases long, eg 1 Kb, 1, 5 Kb or 3 Kb.
• SEQ ID No . 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 145, 149, 152, 159, 161, 165, 167 and / or 169, more preferably 165 and 167, most preferably
• DNA molecules which, under standard conditions, have the amino acids represented by SEQ ID No .: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 145, 149, 152, 159, 161, 165, 167 and / or 169, more preferably 165 and 167, most preferably 167 and for keratin-binding polypeptides encoding nucleic acid
• the keratin-binding effector molecules contain as keratin-binding polypeptides (ii) those polypeptides which contain at least one of the polypeptide sequences as shown in SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16 , 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66 , 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 100, 102, 104, 106, 108, 110, 112, 114 , 1 16, 1 18, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 146, 150, 153, 156, 157, 158, 160, 162, 164, 166, 168 or 170, provided that
• keratin-binding polypeptides (ii) are used which have a highly specific affinity for the desired organism.
• more than one keratin-binding polypeptide (ii) can also be used in combination with the effector molecule (i) according to the invention; for example, a keratin-binding polypeptide (ii) which has a high binding affinity to human skin keratin can be used in conjunction with another keratin-binding polypeptide (ii ), which has a high affinity for human hair keratin, can be combined with an effector molecule. It is also possible to use chimeric polypeptides which contain multiple copies of the same (or also different) keratin-binding polypeptides (ii) or their keratin-binding domains. Thus, for example, a particularly effective keratin binding could be achieved.
• Suitable keratin-binding polypeptides are known.
• desmoplakins and plectins contain keratin-binding domains (Fontao L, Favre B, Riou S, Geerts D, Jaunin F, Saurat JH, Green KJ, Sonnenberg A, Borradori L., Interaction of the bullous pemphigoid antigen 1 (BP230) and desmoplakin with intermediate , Mol Biol Cell, 2003 May; 14 (5): 1978-92, Epub 2003 Jan 26; Hopkinson SB, Jones JC, The N terminus of the transmembrane protein BP180 interacts with the N-terminal domain of BP230, in the presence of mediating keratin cytoskeleton anchorage to the cell surface at the site of the hemidesmosome, Mol Biol Cell. 2000 Jan; 1 1 (1): 277-86).
• the keratin-binding effector molecules of the invention are preferably used in hair cosmetics, preferably hair coloring. They allow a high concentration and long duration of action of nourishing, protective or color-changing effector molecules.
• keratin-binding polypeptides having a binding affinity to human skin, hair or nail keratin are used.
• said keratin-binding effector molecules contain at least one reactive dye (ii) which has at least one reactive anchor selected from the group consisting of
• bond to the dye molecule (F) is X is an electron-withdrawing radical or is an alkyl, -O-alkyl, cyano, hydroxy, halogen radical or H, k is 1, 2 or 3, n is 0 or 1, and
• V is fluorine or chlorine
• Ui, U2 are independently fluorine, chlorine or hydrogen
• Q 1, Q 2 independently of one another chlorine, fluorine, cyanamido, hydroxy, (C 1 -C 6) -alkoxy, phenoxy, sulfophenoxy, mercapto, (C 1 -C 6) -alkylmercapto, pyridino, carboxypyridino,
• Carbamoylpyridino or a group of the general formula (6) or (7) mean
• R 2 is hydrogen or (Ci-C 6) -alkyl, sulfo- (Ci-C 6) alkyl, or phenyl which is un- substituted or substituted by (Ci-C4) alkyl, (Ci-C4) Alkoxy, sulfo, halogen, carboxy, acetamido, ureido, R 3 and R 4 independently of one another have one of the meanings of R 2 , or are a group of the general formula (8)
• R 24 , R 25 and R 26 are (C 1 -C 4 ) -alkyl or (C 1 -C 4 ) -hydroxyalkyl;
• B- is the equivalent of an anion such as hydrogen sulfate, sulfate, fluoride, chloride, bromide,
• Dihydrogen phosphate hydrogen phosphate, phosphate, hydroxide or acetate
• the present invention relates to a keratin-binding effector molecule which comprises, as effector molecule, at least one reactive dye (ii) which contains at least one group of formula 1 which can be activated under alkaline conditions
• - represents the bond to the rest of the dye molecule (F);
• alkyl is generally a linear or branched hydrocarbon radical having 1 to 6 and preferably having 1 to 4 carbon atoms (C 1 -C 6 - or C 1 -C 4 -alkyl), such as methyl, ethyl, propyl , Isopropyl and the like.
• Haloge- nalkyl is alkyl as defined above, wherein the hydrogen atoms are partially or completely replaced by halogen atoms, in particular by fluorine atoms, as in trifluoromethyl, trichloromethyl, pentafluoroethyl, and the like.
• Alkoxy is an alkyl radical bonded via an oxygen atom as defined above.
• Optionally substituted phenyl means that the phenyl radical may have one or more, for example 1, 2, 3 or 4 substituents, which are for example selected under halogen, alkyl, alkoxy, nitro, cyano, COOH, SO3H and the like.
• Halogen is in particular fluorine, chlorine or bromine.
• Electron-withdrawing radicals X are those which exert an M and / or an I effect on the aromatic radical to which they are attached. These include, for example, fluorine or chlorine, CN, NO 2 and groups of the formulas -C (O) -R 1 and S (O) 2R 2 , wherein R 1 and R 2 independently of one another are OH, alkyl, haloalkyl, alkoxy or optionally substituted phenyl. If the formula 1 has several groups (k> 1), then the groups X may be the same or different.
• At least one of the groups X is a hydroxysulfonyl group (SO 3 H).
• variable k is preferably 1 or 2, i. of the formula 1 has one or two electron-withdrawing radicals X.
• "n" in Formula 1 is O, that is, Formula 1 is derived from benzene, and when "n" is 1, Formula 1 is derived from naphthalene.
• the group SO2-B may be located on the same benzene nucleus as the group X.
• keratin-binding effector molecules according to the invention have 1, 2 or 3, preferably 1 or 2, of the abovementioned reactive dyes.
• the group which can be activated under alkaline conditions according to formula 1 can (but does not have to) be part of the dye chromophore.
• the reactive dye has one or more, for example 1 to 10, in particular 2 to 8, functional groups per dye molecule which impart water solubility to the dye.
• functional groups which dissociate in an aqueous medium at a weakly acidic or alkaline pH, generally at pH values above 4, to form anionic groups.
• anionic or acidic functional groups which dissociate in an aqueous medium at a weakly acidic or alkaline pH, generally at pH values above 4, to form anionic groups.
• examples of such groups are hydroxysulfonyl groups (-SO 3 H), carboxyl groups (COOH) and hydroxysulfonyloxy groups (-O-SO 3 H) and the anions of these groups.
• anionic / acidic groups may be bound to a group of formula 1 and / or to other parts of the dye molecule.
• Suitable counterions are in particular alkali metal ions, especially sodium, potassium and lithium ions and ammonium ions, for example ammonium ions, which are derived from mono-, di- or triethanolamine.
• a particularly preferred subject of the invention is those keratin-binding effector molecules containing dyes ("F") selected from the group of phthalocyanine series dyes, anthraquinone dyes, azo dyes, formazan dyes, dioxazine dyes, actidine dyes, xanthene Dyes, polymethine dyes, stilbene dyes, sulfur dyes, triarylmethane dyes, benzopyran dyes, dibenzanthrone dyes, and the metal complexes of these dyes.
• F keratin-binding effector molecules containing dyes
• Such dyes F are known in part from the prior art, and may be e.g. Patent Applications WO 94/18381, EP-A 356 931, EP-A 559 617, EP-A 201 868, DE-A 195 23 245, DE-A 197 31 166, EP 745 640, EP-A 889 098, EP -A 1 097 971, EP-A 880 098 or in analogy to known production methods for structurally similar dyes, as they are, for example from EP 602 562, EP-A 597 41 1, EP-A 592 105 or DE 43 196 74 are known.
• an amino compound of the formula 1b is generally reacted with a dye precursor which has a nucleophilic displaceable group in a manner known per se.
• nucleophilic displaceable groups are halogen, in particular chlorine or bromine, which is bonded to an aromatic (as in halotriazine residues) or in the form of a halosulfonyl group or a halogeno-carbonyl group. Processes for this purpose are known from the prior art cited here and can be used in an analogous manner for the preparation of the dyes F.
• the amino compound 1 b may also initially be diazotized and then coupled to a corresponding dye precursor.
• the reaction product obtained in the reaction of the amino compound 1 b or of its diazonium salt with the dye precursor can already be the dye F or, in turn, can be a precursor for the dye F, which is further processed into the dye F in analogy to known processes.
• dyes may contain inorganic salts and actuators due to manufacturing.
• the proportion of such constituents len hereinafter also referred to as non-colored constituents, will generally amount to no more than 60 wt .-% and is often in the range of 10 to 50 wt .-%, based on the total weight of colored and non-colored constituents of the dye.
• the chromophore systems of the dyes (F) can have different structures, irrespective of whether they are reactive or non-reactive dyes.
• Each of the chromophores (1 to 7) shown below represents a compound that is representative of a particular structural class. This listing is not meant to be limiting. The person skilled in the art is, of course, aware that, in principle, all dyes belonging to these substance classes, directly as a reactive dye or via a linker molecule, can be bound to a keratin-binding polypeptide.
• the dyes may be metal-free dyes, but also metal complexes, preferably transition metal complexes, in particular complexes of transition metals of groups VI to X of the periodic table and hereunder in particular of Cu, Cr, Fe, Ni, Co and Mn.
• the molar ratio of transition metal to dye molecule in these metal complexes is usually in the range of 2: 1 to 1: 2.
• the complexing of the metal ions via deprotonated hydroxyl groups, via amino groups, imino groups, nitrogen atoms which are incorporated into an aromatic ⁇ -electron system, or via azo groups takes place in these dyes.
• N N-) containing the dyes.
• the bond with the reactive anchor at 1 a, 1 b and 1 c is of course also an azo bridge. a) monoazo
• keratin-binding effector molecules which contain a reactive dye (i) which comprises a reactive anchor which is selected from the following residues (1-1) to (1-43).
• V-SO 2 -CH CH 2
• V ⁇ -S0, -CH, -CH, -O-S0, H ⁇ f V-S0, -CH, -CH, -CI ⁇ f ⁇ SO 0 -CH CH,
• Particularly preferred reactive dyestuffs comprise at least one reactive anchor according to formula 1, this radical being at least one of those in the formulas (1 -1) to (1-12) and (1-16), (1-17), preferably (1-1) , (1-3), (1-4), (1-6), (1-7), (1-9), (1-10), (1-12), (1-16), ( 1-17), most preferably (1-1), (1-4), (1-7), (1-10), (1-17).
• Vinylsulfone anchor containing dyes are typically prepared as sulfuric acid ester compounds.
• the activation (elimination to the active vinylsulfone form) of the sulfuric acid ester compounds takes place in situ during dyeing in textile and leather applications, ie it is not necessary to pre-eliminate the dyes to vinylsulfone before use.
• the dyes may be if also be isolated as vinyl sulfone between and implemented at a later date with the substrate.
• Keratinbindedomäne (hereinafter also referred to as KBD) is selected a pH near the neutral point, and the reaction temperature for coupling with
• Dyes should not exceed 45 ° C, the dyes must be pre-elimination to the active vinyl sulfone form and thereafter with e.g. coupled to a KBD.
• Reaction with e.g. a KBD can be right after the elimination in the same fleet
• a pH range of 5-14 in particular 7-12 and a temperature range of 0-80 ° C, in particular 15-50 ° C, prefers 25-45 ° C.
• a pH range of pH 5-9, especially 7-8, and a temperature range of 20-50 ° C, in particular 25-45 ° C is set, wherein the dye quickly (often within minutes) with the substrate (in this case with a keratin-binding polypeptide / KBD).
• the activation (elimination) of the sulfuric acid ester to vinyl sulfone proceeds according to the scheme shown in Figure 1.
• Dyes with a heteroaromatic anchor can be directly reacted without preelimination (activation) with eg KBD ( Figure 4).
• the reaction conditions correspond to the conditions chosen for the vinylsulfone anchors.
• the reactive dyes used here can 0-20 wt .-%, usually 0-10gew. %, often 0- 5 wt .-% non-reactive secondary components.
• the minor components that do not have a reactive anchor do not react with the keratin-binding polypeptides. These can be removed during the synthesis or staining process.
• the keratin-binding polypeptides reacted with the reactive dye are applied to hair and the unbound dye components are washed off the hair. Furthermore, it is possible to purify the keratin-binding polypeptides reacted with the reactive dye by, for example, column chromatography. It is also possible to carry out the reaction between keratin-binding polypeptides and the reactive dye in a type of "column reactor.”
• the keratin-binding polypeptides could be coupled to a nickel affinity column, the dye could be bound to the keratin-binding polypeptides and the unfixed dye residues could be directly removed. to be washed. Subsequently, the keratin-binding polypeptide dye (keratin-binding effector molecule) could be eluted from the column.
• the keratin-binding effector molecules contain dyes which are suitable for cosmetic purposes and are approved as such.
• dyes are, for example, in the publication "Cosmetic Colorants” of the Dye Commission of the Irish Kla Chemie, Weinheim, 1984, and in the third completely revised edition of 1991 together.
• keratin-binding effector molecules in which the reactive dye (i) is indirectly coupled via a linker molecule to the keratin-binding polypeptide (ii).
• a keratin-binding effector molecule can take place by coupling an effector molecule (i) (for example selected from the above-described reactive dyes) containing at least one hydroxyl, amino or carboxyl function to one of the keratin-binding polypeptides (ii) described above using a linker molecule, which has at least two coupling functionalities, and a) in a first coupling step firstly the effector molecule (i) is bound to the linker molecule (iii), and b) in a further coupling step the reaction product from (a) via a still free coupling functionality of the linker molecule ( iii) is coupled to the keratin-binding polypeptide (ii).
• an effector molecule (i) for example selected from the above-described reactive dyes) containing at least one hydroxyl, amino or carboxyl function
• a linker molecule which has at least two coupling functionalities
• the linker molecule (iii) has at least two different coupling functionalities, very particularly preferred are linker molecules (iii) which have a maleimide group.
• linker molecules (iii) carboxy-group-bearing maleimides according to the general formula 9,
• n is an integer between 0 to 40 or 0-20, preferably between 0 to 15, more preferably between 0 and 10, most preferably between 1 and 9, or between 2 and 8, or between 3 and 7, on Most preferably, the use of the maleimidocaproic acid is most preferred. Further, the use of the maleimidocaproic acid chloride is most preferred.
• the linker molecule (iii) has at least two different coupling functionalities and additionally a module which increases the hydrophilicity. This preferred linker molecule is shown in Formula 9b,
• n corresponds to an integer between 0 to 40 or 0 to 20, preferably between 0 and 15, particularly preferably between 0 and 10, very particularly preferably between 1 and 9, or between 2 and 8, or between 3 and 7, and
• the linker molecule is a molecule according to the general formula 9c,
• Formula 9c wherein X is in the o-, m- or p-position for COOH or R-COOH, and R is a C1-C12 linear alkyl group such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert. Butyl, pentyl, isopentyl, neopentyl, tert.
• R can also correspond to the "module" described in formula 1b.
• linker molecules (ii) represented by the general formula 10 are used,
• n is an integer between 0 and 20, preferably between 0 and 15, more preferably between 1 and 10, most preferably between 1 and 8 and Y corresponds to a hydroxy or amino group
• the maleimidoalkanols are preferably maleimidoethanol, most preferably the maleimidopentanol.
• the linker molecule (iii) according to formula 10 has at least two different coupling functionalities and additionally a module which increases the hydrophilicity or lipophilicity. This preferred linker molecule is shown in Formula 10b, Formula 10b
• n corresponds to an integer between 0 to 40 or 0 to 20, preferably between 0 and 15, particularly preferably between 0 and 10, very particularly preferably between 1 and 9, or between 2 and 8, or between 3 and 7, and
• coupling of the linker molecule (Ni) with the effector molecule (i) is a carbodiimide-, anhydride- or acid chloride-mediated esterification reaction or amide formation, the use of the acid chloride the linker molecule (iii) is particularly preferred.
• Carbodiimide, anhydride or acid chloride mediated reaction Action means the activation of the carboxyl group of the linker molecule necessary for the formation of an ester or amide between linker molecule (iii) and effector molecule (i)
• Preferred carbodiimides are dicyclohexylcarbodiimide (DCC), diisopropylpodiimide (DIC), N '- (3-dimethylaminopropyl) -N-ethylcarbodiimide hydrochloride (EDC), the use of diisopropylcarbodiimide or EDC being particularly preferred.
• DCC dicyclohexylcarbodiimide
• DIC diisopropylpodiimide
• EDC N '- (3-dimethylaminopropyl) -N-ethylcarbodiimide hydrochloride
• CDI carbonyldiimidazole
• amides can be accomplished by reaction of the carbodiimide-activated compound with the amine.
• the amide formation can be carried out in the presence of additives such as N-hydroxysuccinimide, pentafluorophenol or N-hydroxybenzotriazole.
• additives such as N-hydroxysuccinimide, pentafluorophenol or N-hydroxybenzotriazole.
• additives are known in the art. If isolable active esters are obtained by means of these additives, the reactions of these isolated active esters with the effector molecules are also understood as carbodiimide-mediated esterification according to the invention.
• the conversion of the linker molecule (iii) to the anhydride is carried out by general methods, as known to the person skilled in the art. Preference is given to the use of mixed anhydrides, as are obtained, for example, by reaction with acetic anhydride, pivaloyl anhydride, acetyl chloride, pivaloyl chloride or chloroformates. Particularly preferred are pivaloyl anhydrides and the anhydrides with carbonic acid. When using the acid chlorides, it is desirable to control the anhydride formation in the presence of a tertiary base, e.g. Pyridine, triethylamine perform.
• a tertiary base e.g. Pyridine, triethylamine perform.
• the coupling of the linker molecule (iii) with the effector molecule (i) described under (a) can preferably be carried out following the activation of the linker molecule (iii) to the anhydride described above in the presence of a base.
• bases are: aromatic and tertiary alkylamines, e.g. Pyridine, triethylamine, tributylamine, trioctylamine, ethyldiisopropylamine, etc. In a particularly preferred embodiment, triethylamine is used as the base.
• the chlorinating agents used are the customary chlorinating agents known to the person skilled in the art, for example thionyl chloride, phosphorus trichloride, phosphorus pentachloride, oxalyl chloride,
• Phosgene or phosphorus oxychloride.
• SOCl 2 thionyl chloride
• thionyl chloride By using thionyl chloride it is possible, for example, to convert maleinimidocaproic acid into the acid chloride.
• Suitable solvents are: aromatic and aliphatic hydrocarbons, for example benzene, toluene, xylene, hexane, heptane, etc., halogenated hydrocarbons, for example methylene chloride, ethers, for example diethyl ether, THF etc., as well as an excess of the chlorinating agent itself.
• toluene is used.
• the chlorination can be carried out with or without a catalyst.
• DMF is particularly preferable.
• reaction product from step (a) may be further purified to separate possible isomers of the reaction product.
• linker effector molecule (iv) may be further purified to separate possible isomers of the reaction product.
• All common methods for the purification of chemical substances can be used, for example: distillation, rectification, crystallization, extractions and chromatographic purification methods.
• a column chromatography is performed.
• particularly advantageous dyes are those mentioned in the following list.
• the Color Index Numbers (CIN) are taken from the Rowe Color Index, 3rd Edition, Society of Dyers and Colourists, Bradford, England, 1971.
• such keratin-binding effector molecules are used for the inventive method for dyeing skin, hair or nails, containing one of the dye molecules shown in Table 3, coupled via a linker described above.
• the above dyes may also be used as effector molecules (i) on a skin or nail binding polypeptide sequence (ii) for skin or nail colouration, e.g. to be used in tattoos.
• Particularly suitable is the use of fluorescent dyes (eg the fluorescence dyes mentioned in Table 3) to achieve a healthier and brighter skin tone or skin whitening after application to the skin for example, in US Pat. No. 6,753,002.
• Fluorescent dyes for producing a healthier skin tone are described in "Filling the Fluorescent Palette, Cosmetics & Toiletries, 26-34, 121, No. 5, 2006".
• Preferred are e.g. Fluorescent dye fabrics from the company DayGlo.
• these keratin-binding effector molecules containing fluorescent dyes can also be used for lightening hair or for producing special reflexes or shimmering on the hair. This is e.g. in lair lightening by fluorescent dyes, Cosmetics & Toiletries, 56-57, 120, no. 7, 2005 "and the document cited therein US 2004/0258641.
• the binding of the reaction product resulting from step (a) described above with the keratin-binding polypeptide (ii) takes place via the second, still free anchor group of the linker molecule.
• an anchor group may be a thiol function by which the linker may form a disulfide bond with a cysteine residue of the keratin-binding polypeptide (ii).
• tailored linkers allows the exact adaptation of the linkage of the linker effector molecule to the keratin-binding polypeptide. In addition, it is thereby possible to link several effector molecules with a keratin-binding polypeptide (ii).
• the linker used depends on the functionality to be coupled. Suitable are e.g. Molecules which couple to keratin-binding polypeptides (ii) by means of sulfhydryl reactive groups (e.g., maleimides, pydridyl disulfides, ⁇ -haloacetyls, vinylsulfones, sulfatoalkylsulfones (preferably sulfatoethylsulfones).
• sulfhydryl reactive groups e.g., maleimides, pydridyl disulfides, ⁇ -haloacetyls, vinylsulfones, sulfatoalkylsulfones (preferably sulfatoethylsulfones).
• amino acids having suitable functions may also be added to the sequence, or amino acids of the polypeptide sequence may be substituted by such amino acid functions.
• suitable functions e.g., cysteines, lysines, aspartates, glutamates
• Methods for mutagenesis or manipulation of nucleic acid molecules are well known to those skilled in the art. Some selected methods are described below.
• linker effector molecule which has been prepared using the maleimidocaproic acid mentioned as being preferred for the inventive method.
• the cysteine residues present in the keratin-binding polypeptide are used for coupling.
• the binding of the ef maschineormoleküls such that they by the action of the skin's own enzymes (for example, esterases, lipases or glucosidases) or by the environmental conditions on the skin (eg, moisture, acidic pH) over time the keratin-binding polypeptides (ii) in the sense of a "slow release” or “controlled release” split off and can be released.
• the keratin-binding polypeptides (ii) can be used as an application system with which small amounts of the free effector molecules on the skin can be achieved by a single or repeated application.
• effectors from their corresponding derivatives for example from tocopherol acetate, ascorbyl palmitate or ascorbyl glucosides, can be released on the skin (exemplary literature: Redoules, D. et al, J. Invest.Dermatol. 270, Beijersbegen van Henegouwen, GMJ et al., J. Photochem., Photobiol., 29, 1995, 45).
• dyes carrying carboxyl, hydroxyl or amino groups are used for the process according to the invention.
• the effector molecules used may have one or more carboxyl, hydroxyl or amino groups.
• Another object of the present invention is the use of the above-described keratin-binding effector molecules in cosmetic compositions suitable for dyeing keratin fibers, preferably hair, skin or nails, more preferably human hair.
• the use of the abovementioned keratin-binding effector molecules according to the invention in agents is suitable for dyeing hair in combination with cosmetically suitable auxiliaries and adjuncts which are customarily used in hair dyeing compositions.
• the above-mentioned dyes preferably dyes approved for cosmetic purposes, can be used. These dyes are usually in concentration of 0.001 to 1 weight percent (wt .-%), preferably 0.01 to 0.9 wt .-%, particularly preferably 0.01 to 0.8 wt .-% or 0.01 to 0 , 7 wt .-%, most preferably 0.01 to 0.6 wt .-% or 0.01 to 0.5 wt .-%, most preferably 0.01 to 0.4 wt .-% or 0 , 01 to 0.3 wt .-% based on the total weight of the agent attached.
• wt .-% weight percent
• these dyes are usually in concentration of 0.001 to 1 weight percent (wt .-%), preferably 0.01 to 0.9 wt .-%, particularly preferably 0.01 to 0.8 wt .-% or 0.01 to 0 , 7 wt .-%, most preferably 0.01 to 0.6
• the agents can be a keratin-binding effector molecule according to the invention in a concentration of 1 to 10 wt .-%, preferably 2 to 8 wt .-%, 3 to 7 wt .-%, 4 to 6 wt .-% based on the Total weight of the agent included.
• the agents can be a keratin-binding effector molecule according to the invention in a concentration of 10 to 20 wt .-%, preferably 1 1 to 19 wt .-%, 12 to 18 wt .-%, 13 to 17 wt .-%, 14 to 16 wt .-% based on the total weight of the composition.
• the compositions should have a certain minimum viscosity.
• This viscosity is usually achieved by the use of thickeners, which are thus a further component of most hair dyes.
• thickeners usually crosslinked polyacrylic acids (eg carbonyl pol ®), hydroxyethyl cellulose, waxes, and especially mixtures of nonionic surfactants with specific HLB (hydrophobic lipophilic balance), anionic, cationic or non-ionic association polymers are used.
• HLB hydrophobic lipophilic balance
• ampholytic copolymers as thickeners for cosmetic compositions is known.
• ampholytic or amphoteric polymers are referred to having both anionogenic / anionic and cationogenic / cationic groups.
• Amphoteric polymers having a sufficient number of dissociable groups are water-soluble or water-dispersible and have found various uses in the pharmaceutical and cosmetic arts. Suitable thickeners or polymers are described in the patent applications WO 00/039176, WO 04/058837, EP-A-982 021, WO 01/62809, WO 05/004821, DE 202 07 896 U1 and WO 02/000181.
• the preparations may additionally contain conditioning substances based on silicone compounds.
• Suitable silicone compounds are, for example, polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes, silicone resins or dimethicone copolyols (CTFA) and amino-functional silicone compounds such as amodimethicones (CTFA).
• Blowing agents are the blowing agents commonly used for hairsprays or aerosol foams. Preference is given to mixtures of propane / butane, pentane, dimethyl ether, 1,1-difluoroethane (HFC-152a), carbon dioxide, nitrogen or compressed air.
• emulsifiers all emulsifiers commonly used in hair foams can be used. Suitable emulsifiers may be nonionic, cationic or anionic or amphoteric. Examples of nonionic emulsifiers (INCI nomenclature) are Laurethe, for example Laureth-4; Cetethees, for example cetheth-1, polyethylene glycol cetyl ethers, cetearethes, for example cetheareth-25, polyglycol fatty acid glycerides, hydroxylated lecithin, lactyl esters of fatty acids, alkylpolyglycosides.
• cationic emulsifiers are cetyldimethyl-2-hydroxyethylammonium dihydrogenphosphate, cetyltrimonium chloride, cetyltrimmonium bromide, cocotrimonium methylsulfate, quaternium-1 to x (INCI).
• Anionic emulsifiers may, for example, be selected from the group of alkyl sulfates, alkyl ether sulfates, alkyl sulfonates, alkylaryl sulfonates, alkyl succinates, alkyl sulfosuccinates, N-alkoyl sarcosinates, acyl taurates, acyl isethionates, alkyl phosphates, alkyl ether phosphates, alkyl ether carboxylates, alpha olefin sulfonates, especially the alkali and alkaline earth metal salts, e.g.
• alkyl ether sulfates, alkyl ether phosphates and alkyl ether carboxylates can have between 1 to 10 ethylene oxide or propylene oxide units, preferably 1 to 3 ethylene oxide units in the molecule.
• gel formers all gel formers customary in cosmetics can be used. These include lightly crosslinked polyacrylic acid, for example carbomer (INCI), celulose derivatives, e.g. Hydroxypropyl cellulose, hydroxyethyl cellulose, cationic modified celluloses, polysaccharides, e.g.
• Xanthan gum caprylic / capric triglyceride, sodium acrylate copolymers
• Suitable anionic surfactants include, for example, alkyl sulfates, alkyl ether sulfates, alkyl sulfonates, alkylaryl sulfonates, alkyl succinates, alkyl sulfosuccinates, N-alkoxy sarcosinates, acyl taurates, acyl isothionates, alkyl phosphates, alkyl ether phosphates, alkyl ether carboxylates, alpha olefin sulfonates, especially the alkali and alkaline earth metal salts, e.g. Sodium, potassium, magnesium, calcium, as well as ammonium and triethanolamine salts.
• the alkyl ether sulfates, alkyl ether phosphates and alkyl ether carboxylates can have between 1 to 10 ethylene oxide or propylene oxide units, preferably 1 to 3 ethylene oxide units in the molecule.
• Suitable examples are sodium lauryl sulfate, ammonium lauryl sulfate, sodium lauryl sulfate, ammonium lauryl ether sulfate, sodium lauroyl sarcosinate, sodium oleyl succinate, ammonium lauryl sulfosuccinate, sodium dodecylbenzenesulfonate, triethanolamine dodecylbenzenesulfonate.
• Suitable amphoteric surfactants are, for example, alkylbetaines, alkylamidopropylbetaines, alkylsulfobetaines, alkylglycinates, alkylcarboxyglycinates, alkylamphoacetates or -propionates, alkylamphodiacetates or -dipropionates.
• cocodimethylsulfopropyl betaine cocodimethylsulfopropyl betaine, lauryl betaine, cocamidopropyl betaine or sodium cocamphopropionate can be used.
• Suitable nonionic surfactants are, for example, the reaction products of aliphatic alcohols or alkylphenols having 6 to 20 C atoms in the alkyl chain, which may be linear or branched, with ethylene oxide and / or propylene oxide.
• the amount of alkylene oxide is about 6 to 60 moles per mole of alcohol.
• alkylamine oxides, mono- or dialkylalkanolamides, fatty acid esters of polyethylene glycols, alkylpolyglycosides or sorbitan ether esters are also suitable.
• the shampoo formulations may contain conventional cationic surfactants, e.g. quaternary ammonium compounds, for example cetyltrimethylammonium chloride.
• conventional cationic surfactants e.g. quaternary ammonium compounds, for example cetyltrimethylammonium chloride.
• Conventional conditioning agents in combination with the keratin-binding effector molecules according to the invention can be used in the shampoo formulations to achieve specific effects.
• cationic polymers with the name Polyquaternium according to INCI, in particular copolymers of vinylpyrrolidone / N-vinylimidazolium salts (Luviquat FC, Luviquat & commat, HM, Luviquat MS, Luviquat Care), copolymers of N-vinylpyrrolidone / dimethylaminoethyl methacrylate, quaternized with diethyl sulfate ( Luviquat D PQ 1 1), copolymers of N-vinylcaprolactam / N-vinylpyrrolidone / N-vinylimidazolium salts (Luviquat D Hold), cationic cellulose derivatives (Polyquaternium-4 and -10), acrylamide copolymers (Polyquaternium-7).
• protein hydrolysates can be used, as well as conditioning substances based on silicone compounds, for example polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes or silicone resins.
• silicone compounds for example polyalkylsiloxanes, polyarylsiloxanes, polyarylalkylsiloxanes, polyethersiloxanes or silicone resins.
• suitable silicone compounds are dimethicone copolyols (CTFA) and amino-functional silicone compounds such as amodimethicones (CTFA).
• CTFA dimethicone copolyols
• amino-functional silicone compounds such as amodimethicones
• cationic guar derivatives such as guar hydroxypropyltrimonium chloride (INCI) can be used.
• the hair cosmetic or skin cosmetic preparation is used for application on the skin (topically) or hair.
• Topical preparations are to be understood as meaning those preparations which are suitable for applying the active ingredients in finely distributed manner to the skin or the hair.
• aqueous and aqueous-alcoholic solutions sprays, foams, foam aerosols, Ointments, aqueous gels, O / W or W / O type emulsions, microemulsions or cosmetic stick preparations.
• the agent contains a carrier.
• a carrier is water, a gas, a water-based liquid, an oil, a gel, an emulsion or microemulsion, a dispersion or a mixture thereof.
• the mentioned carriers show good skin tolerance.
• Particularly advantageous for topical preparations are aqueous gels, emulsions or microemulsions.
• Nonionic surfactants, zwitterionic surfactants, ampholytic surfactants or anionic emulsifiers can be used as emulsifiers.
• the emulsifiers may be present in the composition according to the invention in amounts of 0.1 to 10, preferably 1 to 5 wt .-%, based on the composition.
• a surfactant of at least one of the following groups may be used:
• Polysiloxane-polyalkyl-polyether copolymers or corresponding derivatives Polysiloxane-polyalkyl-polyether copolymers or corresponding derivatives; Mixed esters of pentaerythritol, fatty acids, citric acid and fatty alcohol according to DE PS 1 165574 and / or mixed esters of fatty acids having 6 to 22 carbon atoms, methyl glucose and polyols, preferably glycerol or polyglycerol and polyalkylene glycols.
• zwitterionic surfactants can be used as emulsifiers.
• Zwitterionic surfactants are those surface-active compounds which carry at least one quaternary ammonium group and at least one carboxy or sulfonate group in the molecule.
• Particularly suitable zwitterionic surfactants are the so-called betaines, such as N-alkyl-N, N-dimethylammonium glycinates, for example cocoalkyldimethylammonium glycinate, N-acylamino-propyl-N, N-dimethylammonium glycinates, for example cocoacylaminopropyldimethylammonium glycinate, and 2-alkylbenzenesulfonate.
• 3-carboxymethyl-3-hydroxy-ethylimidazolines having in each case 8 to 18 C atoms in the alkyl or acyl group, and the cocoacylaminoethylhydroxyethyl carboxymethylglycinate.
• Particularly preferred is the known under the CTFA name Cocamidopropyl Betaine fatty acid amide derivative.
• ampholytic surfactants are surface-active compounds which, in addition to a Cs.is-alkyl or acyl group in the molecule, contain at least one free amino group and at least one -COOH or -SOaH group and are capable of forming internal salts.
• ampholytic surfactants are N-alkylglycines, N-alkylpropionic acids, N-alkylamino-butanoic acids, N-alkyliminodipropionic acids, N-hydroxyethyl-N-alkylamido-propylglycines, N-alkyltaurines, N alkylsarcosines, 2-alkylaminopropionic acids and alkylaminoacetic acids each having about 8 to 18 C atoms in the alkyl group.
• ampholytic surfactants are N-cocoalkylaminopropionate, cocoacylaminoethylaminopropionate and C 12/18 acylsarcosine.
• quaternary emulsifiers are also suitable, those of the esterquat type, preferably methyl-quaternized difatty acid triethanolamine ester salts, being particularly preferred.
• anionic emulsifiers alkyl ether sulfates, monoglyceride sulfates, fatty acid sulfates, sulfosuccinates and / or ether carboxylic acids can be used.
• oils bodies are silicone compounds, for example dimethylpolysiloxanes, methylphenylpolysiloxanes, cyclic silicones and also amino, fatty acid, alcohol, polyether, epoxy, fluorine, alkyl and / or glycoside-modified silicone compounds which may be both liquid and resinous at room temperature.
• the oil bodies may be present in the compositions according to the invention in amounts of from 1 to 90, preferably from 5 to 80, and in particular from 10 to 50,% by weight, based on the composition.
• the present invention relates to agents suitable for dyeing skin, nails and / or hair, preferably hair colorants, containing at least one of the above-described keratin-binding effector molecules according to the invention.
• a further subject of this invention is a process for dyeing hair, skin and / or nails using the keratin-binding effector molecules according to the invention.
• Keratin-binding effector molecules which contain at least one of the abovementioned keratin-binding polypeptides (ii) and at least one dyestuff or reactive dyestuff according to Tables 3, 5 and 6 are preferably used in this process.
• keratin-binding effector molecules with different dyes can be mixed with each other in the preparation of the preparations suitable for dyeing hair, the special color shades are achieved.
• the preparation of preparations with special color shades can e.g. be carried out by (a) mixture of selected reactive dyes or dyes in the
• keratin-binding effector molecules Preparation of the keratin-binding effector molecule, or (b) Mixing of individual keratin-binding effector molecules when preparing the hair dye.
• keratin-binding effector molecules are used, containing
• keratin-binding polypeptide having one of the sequences according to SEQ ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42,
• 158, 160, 162, 164, 166, 168 or 170 preferably in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 40, 42, 44, 46, 48, 146, 150, 153, 156, 157, 158, 160, 162, 164, 166,
• 168 or 170 more preferably 166 and 168, most preferably 168, or a polypeptide which is at least 40%, 45% or 50%, preferably at least 55%, 60%, 65% or 70%, especially preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93% or 94%, very particularly preferably at least 95% or 96% is identical to at least one of the sequences according to SEQ ID No .: 2, 4, 6, 8, 10, 12,
• the dyeing of the hair preferably takes place by applying a preparation containing the keratin-binding effector molecules according to the invention to the hair to be dyed in an amount and time sufficient to produce the desired color change.
• good staining with a suitable keratin-binding effector molecule can already be achieved after a very short time (a few minutes) or at least within half an hour (see Example 20).
• a reversible dyeing process in which the keratin-binding effect tormolekül in a displacement reaction of skin, hair or nails can be removed.
• a rinse with keratin can be used, whereby the keratin-binding effector molecules are displaced from their existing bond to the keratin and are saturated with the keratin from the rinse.
• rinsing with a high proportion of detergent (eg SDS) for washing off is possible (see Example 20).
• Bos taurus placophilin 1 partial mRNA Accession XM_868348
• Nucleic acid Xenopus laevis similar to placophilin 4 Accession BI390496 XM_621314 Protein Mus musculus desmoplakin, Accession XM_621315 Nucleic acid Rattus norvegicus similar to desmoplakin isoform II, Accession XM_225259 Protein Rattus norvegicus similar to desmoplakin isoform II, Accession XM_225260 Nucleic acid Pan troglodytes desmoplakin, Accession XM_518227 Protein Pan troglodytes desmoplakin, Accession XM_518228 Nucleic acid Gallus gallus similar to Desmoplakin , Accession XM_418957 Protein Gallus gallus similar to Desmoplakin, Accession XM_418958 Nucleic acid H.
• TRHY Nucleic Acid Human Trichohyalin
• TRHY Protein human trichohyalin
• EPPK1 Nucleic Acid H. sapiens epiplakin 1
• EPPK1 Protein H. sapiens epiplakin 1
• nucleic acid Lib152 (SEQ ID No .: 157) was amplified
• Example 1 Expression vectors and production strains
• KBD keratin-binding domains
• promoters e.g., IPTG-inducible, rhamnose inducible, arabinose inducible, methanol inducible, constitutive promoters, etc.
• constructs were tested in which the KBDs were expressed as fusion proteins (e.g., as a fusion with thioredoxin, or eGFP, or YaaD [B.subtilis, SWISS-PROT: P37527, PDX1], etc.).
• KBD-B Keratin-binding domain B, SEQ ID No .: 4
• KBD-C Keratin-binding domain C, SEQ ID No .: 10
• the mentioned vector constructs are not limiting for the stress.
• the vector map of the IPTG-inducible vector pQE30-KBD-B ( Figure 5), the methanol-inducible vectors pLib15 ( Figure 6) and pLib16 ( Figure 7) and the inducible vector pLib19 ( Figure 8) are exemplified. Analogous to the described vector constructions and expressions, KBD-C can also be used.
• KBD expression in B. megaterium was analogous to: Barg, H., Malten, M. & Jahn, D. (2005). Protein and vitamin production in Bacillus megaterium. Methods in Biotechnology- Micobial Products and Biotransformations (Barredo, J.-L., Ed, 205-224).
• Fungal production strains were Pichia pastoris (see example 3, eg GS1 15 and KM71 [both Invitrogen] and others) and Aspergillus nidulans (see example 4; eg RMS011 [Stringer, MA, Dean, RA, Sewall, TC, Timberlake, WE (1991) Rodletless, a new Aspergillus developmental mutant induced by direct gene activation. Genes Dev 5: 1 161-1 171] and SRF200 [Karos, M, Fischer, R (1999) Molecular characterization of HymA, to evolutionarily highly conserved and highly expressed protein of Aspergillus nidulans. Mol Genetics 260: 510-521], and others).
• Other fungal production hosts such as Aspergillus niger (KBD expression analogous to EP 0635574A1 and / or WO 98/46772) could also be used for KBD expression.
• Example 2 KBD expression in E. coli strains with IPTG inducible promoters, e.g. through the expression plasmid pQE30-KBD-B
• various production hosts were used, e.g. various E. coli strains (eg, XLI O-GoId [Stratagene], BL21-CodonPlus [Stratagene], and others), Bacillus megaterium, Bacillus subtilis, etc.
• E. coli strains e.g, XLI O-GoId [Stratagene], BL21-CodonPlus [Stratagene], and others
• Bacillus megaterium Bacillus subtilis
• Lambda maxiDNA (DNA lambda maxi kit, Qiagen company) was prepared from a cDNA library of human keratinocytes (BD Bioscience, Clontech,
• the PCR was carried out using the following oligonucleotides: Bag 43 (5 '- GGTCAGTTACGTGCAGCTGAAGG -3') (SEQ ID No .: 141) and bag 44 (5 'GCTGAGGCTGCCGGATCG -3') (SEQ ID No .: 142)
• Oligo Bag 43 (192ng / ⁇ l) 0.5 ⁇ l
• Oligo Bag 44 (181 ng / ⁇ l) 0.5 ⁇ l
• Bag 53 (5 '- CGCGCCTCGAGCCACATACTGGTCTGC -3') (SEQ ID No .: 143) and
• Bag 51 (5 '- GCTTAGCTGAGGCTGCCGGATCG -3') (SEQ ID No .: 144)
• Oligo Bag 53 (345ng / ⁇ l) 0.5 ⁇ l
• Oligo Bag 51 (157ng / ⁇ l) 0.5 ⁇ l
• the resulting approximately 1073 bp PCR product was excised from an agarose gel, purified and cloned into the vector: pCR2.1-TOPO (Invitrogen).
• the resulting vector pCR2.1-TOPO + KBD-B (5027 bp) was then transformed, amplified in E. coli, then cut with Xhol and EcoRI and the resulting KBD-B fragment in pBAD / HisA (Invitrogen; cleaved with Xhol and EcoRI).
• the newly formed vector pBAD / HisA + KBD-B (5171 bp) was again cut with Sacl and Stul and the resulting KBD-B fragment was cloned into pQE30 (Qiagen, cut with Sacl and SmaI).
• the resulting expression vector pQE30-KBD-B (4321 bp; see also Figure 5) was used for the following KBD-B expressions.
• the KBD-B expressed by the vector pQE30-KBD-B in E. coli (SEQ ID No .: 4) additionally contained the amino acids MRGSHHHHHHSACEL at the N-terminus and the amino acids GVDLQPSLIS (SEQ ID No .: 166) at the C-terminus.
• Precultures were inoculated from plate or glycerol culture with E. coli strains transformed with pQE30-KBD-B (e.g., XLI O-GoId [Stratagene]). Depending on the size of the main culture was inoculated in a tube or a small flask with LB medium (about 1: 100).
• the main culture was inoculated about 1: 100 with preculture, main culture: LB medium or suitable minimal medium with the respective antibiotics. Incubation at 250 rpm and 37 ° C.
• the induction was carried out with 1 mM IPTG from an OD (600 nm) of 0.5.
• the cells were centrifuged after 4 h induction.
• Example 3 Intracellular and secretory expression of KBD by Pichia pastoris strains using methanol-inducible promoters, e.g. through the expression plasmids pLib 15 and pLib 16 (shake flasks)
• Pichia pastoris strains were used, e.g. GS115 and KM71 (Pichia Expression Kit, Version M; Invitrogen Life Technologies).
• KBD-B by P. pastoris transformed with pLib15 (intracellular expression, vector see Figure 6) or pLib16 (secretory expression, vector see Figure 7) is described here.
• pLib15 a 948 bp KBD-B-encoding DNA fragment (SEQ ID No .: 145) was amplified by PCR using the oligonucleotides Lib148
• a 942 bp KBD-B encoding DNA fragment (SEQ ID NO: 149) was amplified by PCR using oligonucleotides Lib149 ( ⁇ ' -GCTGGAGAATTCTCAGCTAATTAAGCTTGGCTGCA-S ' (SEQ ID NO: 148)). and Lib150 (5 ' - - GCTAAGGAATTCCATCACCATCACCATCACGAGCCACATACTGGTCTGCT-S ' (SEQ ID No .: 151) as well as the vector pQE30-KBD-B (Example 2, Figure 5) as template amplified EcoRI restriction sites at both ends of the PCR products brought in.
• the PCR was carried out in 50 ⁇ l of reaction mixtures which were composed as follows: 1 ⁇ l of plasmid DNA pQE30-KBD-B 1 ⁇ l of dNTP mix (each 10 mM, Eppendorf) 5 ⁇ l of 10 ⁇ PCR buffer + MgCl 2 (Roche) 1 ⁇ l Lib148 or Lib150 5 ' primer (corresponds to 50 pmol)
• the PCR reactions were carried out under the following cycling conditions:
• Step 1 5 minutes 95 ° C (denaturation)
• Step 2 45 seconds 95 ° C
• Step 3 45 seconds 50 ° C (annealing)
• Step 4 2 minutes 72 ° C (elongation) 30 cycles of steps 2-4
• Step 5 10 minutes 72 ° C (post-elongation)
• Step 6 4 0 C (Pause)
• the PCR product which was amplified with the oligonucleotides Lib148 / Lib149 was digested with EcoRI and inserted into the EcoRI-cut vector pPIC3.5 (Pichia Expression Kit, Version M, Invitrogen Company). ligated. The correct KBD-B amplification was checked by sequencing the vector pLib15 resulting from the ligation ( Figure 6).
• the PCR product which was amplified with the oligonucleotides Lib149 / Lib150 was digested with EcoRI and inserted into the EcoRI-cut vector pPIC9 (Pichia Expression Kit, Version M, Invitrogen) ligated.
• the correct KBD-B amplification was verified by sequencing the ligation-derived vector pl_ib16 ( Figure 7).
• Electrocompetent cells and spheroplasts of the P. pastoris strains were probed with the circular and Stul linearized vectors pl_ib15 and pl_ib16, respectively
• the incubation of the main culture was carried out at 250-300 rpm and 30 ° C for 1-96 h. - The induction was maintained every 24 hours by adding 100% methanol at a final concentration of 0.5% methanol.
• the harvesting and digestion of the cells took place after the end of the main culture by means of a Menton Gaulin.
• the culture supernatant was collected and the KBD-B purified therefrom directly.
• P. pastoris KBD-B SEQ ID No .: 145) (pLib15) contained in addition to the polypeptide sequence SEQ ID No .: 4 additionally at the N-terminus, the amino acids MHHHHHH and at the C-terminus the amino acids GVDLQPSLIS.
• P. pastoris KBD-B (SEQ ID No .: 149) (pLib16) included in addition to the polypeptide sequence SEQ ID No .: 4 additionally at the N-terminus, the amino acids YVEFHHHHHH and at the C-terminus, the amino acids GVDLQPSLIS.
• pLib16 The secreted and processed by P. pastoris KBD-B (SEQ ID No .: 149) (pLib16) included in addition to the polypeptide sequence SEQ ID No .: 4 additionally at the N-terminus, the amino acids YVEFHHHHHH and at the C-terminus, the amino acids GVDLQPSLIS.
• pLib16 The secreted and processed by P. pastoris KBD-B (SEQ ID No .: 149) (pLib16) included in addition to the polypeptide sequence SEQ ID No .: 4 additionally at the N-terminus, the amino acids YVEFHHHHHH and at the C-terminus, the amino acids GVDLQPSLIS.
• A. nidulans wild type strains were used, e.g. RMS01 1 or SRF200.
• RMS01 1 or SRF200 the expression of KBD-B by A. nidulans, transformed with pl_ib19 ( Figure 8) is described.
• püb19 was a 922 bp (SEQ ID No .: 152) large, KBD-B DNA fragment encoding by PCR using the oligonucleotides Lib151 (5 '-CACCATGCATCACCATCACCATCACGAGCCACATACTGGTCTGCT-
• the PCR product was cloned into the vector pENTR / D (pENTR Directional TOPO ® Cloning TM Kit, version E, Invitrogen company)
• the correct KBD-B amplification was checked by sequencing
• the recombination of the KBD-B-encoding DNA fragment was carried out in the vector pMT-OvE (Toews MW, Warmbold J, Konzack S, Rischitor P , Veith D,
• the fungal mycelium was harvested by filtration, washed with distilled water, and transferred to flasks containing 100-500 mL of fresh minimal medium.
• 0.1% fructose was used as the C source instead of glucose.
• the medium was additionally supplemented with ethanol (1% final concentration) or glycerol (50 mM) or sodium acetate
• the mentioned additives for expression induction are not limiting for the stress.
• the main culture was incubated for a further 5-48 h at 200-250 rpm and 37 ° C.
• the fungal mycelium was harvested at 1500-3000 ⁇ g for 5 minutes at room temperature and disrupted by means of a Menton Gaulin.
• the A. nidulans-expressed KBD-B (SEQ ID No .: 152) (pLib19) contained in addition to the polypeptide sequence SEQ ID No .: 4 additionally at the N-terminus the amino acids MHHHHHH and at the C-terminus the amino acids
• Example 5 Cell disruption and inclusion body purification (pQE30-KBD-B). Soluble expressed KBD could be directly used or purified by chromatography (e.g., by means of Menton-Gaulin) after cell disruption (see Example 6). Insoluble KBD (e.g., in inclusion bodies) was purified as follows:
• the digest was recentrifuged (15000g), the pellet of which was 20mM
• the pH of the supernatant was adjusted to 7.5 - then centrifuged again and the supernatant on a Ni chelate
• Example 6 Purification of Keratin Binding Domain B via Ni Chelate Sepharose.
• the purification of the KBD could be purified by the attached His-tag over a Ni column chromatographisch.
• the material was packed in a column (eg diameter 2.6 cm, height 10 cm) and equilibrated with Buffer A + 4% Buffer B (equivalent to 20 mM imidazole).
• Buffer A + 4% Buffer B (equivalent to 20 mM imidazole).
• Buffer B equivalent to 20 mM imidazole.
• the protein extract (see, eg, Zeil-Hommen and Inclusion-Body-Reinvent) was applied to the column at pH 7.5 via a Superloop ( ⁇ KTA system) (flow about 5 ml / min).
• the eluate could be desalted (advantageous for samples to be concentrated).
• the eluate was e.g. desalted over a Sephadex G25 medium column (Amersham Company). Thereafter, it was possible to concentrate, for example, an Amicon chamber (Stirred Ultrafiltration Cell, Millipore).
• Buffer A 20 mM sodium dihydrogenphosphate 500 mM NaCl (optionally, buffers with lower NaCl can also be used).
• KBD is chromatographed, which has already been expressed soluble.
• Buffer B 20 mM sodium dihydrogen phosphate
• Example 7 Renaturation of keratin-binding domain B.
• Insoluble-expressed keratin-binding domain (for example, from inclusion bodies) can be renatured and thus activated as follows:
• Example 8 Binding to Skin 1 (Qualitative) A visual qualitative test was developed to check if KBD binds to skin. Used solutions:
• TBS 20 mM Tris; 15 mM NaCl pH 7.5
• TTBS TBS + 0.05% Tween20
• the first step is the transfer of the outer keratin layer from the skin to a stable carrier.
• a transparent adhesive strip was firmly applied to depilated human skin and removed again.
• the test can be carried out directly on the transparent adhesive strip or the adhering keratin layer can be transferred to a glass slide by sticking it on again.
• the detection of binding was carried out as follows:
• a blue color precipitate indicates that KBD has bound to the skin.
• a quantitative test has been developed that compares the hair / skin binding strength of the KBD with non-specific proteins. From a thawed dry piece of skin without hair (human or pig), a piece was drilled out with a 5 mm cork borer (or, in the case of a surface test, a piece of skin fitted into a falcon lid). The skin sample was then brought to a thickness of 2-3 mm to remove any existing tissue. The skin sample was then transferred to an eppendorf (protein lowbind) to perform binding detection (see also Figure 9) Alternatively, the episkin system [reconstituted human skin] from L'Oreal may be used:
• the absorbance was measured at 405 nm
• Peroxidase substrate (set shortly before): 0.1 ml TMB solution (42 mM TMB in DMSO)
• Example 10 Binding to Hair (Quantitative) In order to demonstrate the binding strength of KBD to hair compared to other proteins, a quantitative assay was developed (see also Figure 9). In this test, hair was first incubated with KBD and excess KBD was washed off. Subsequently, an antibody-peroxidase conjugate was coupled via the His tag of KBD. Unbound antibody-peroxidase conjugate was rinsed off again. The bound antibody-peroxidase conjugate [Monoclonal AntipolyHistidine Peroxidase Conjugate, produced in mouse, lyophilized powder, Sigma Company] can convert a colorless substrate (TMB) into a colored product that is phosphorous. measured at 405 nm.
• TMB colorless substrate
• the amount of absorption indicates the amount of bound KBD or control protein.
• Y-aaD from B.subtilis was chosen as the comparison protein and likewise had a His tag for detection, as is necessary for this test.
• His-tag instead of the His-tag, other specific antibodies conjugated to peroxidase can also be used.
• Peroxidase substrate (set shortly before): 0.1 ml TMB solution (42 mM TMB in DMSO) + 10 ml Substrate buffer (0.1 M sodium acetate pH 4.9) + 14.7 ⁇ l H 2 O 2 3%
• Table 4 Quantitative KBD activity test hair: 1) buffer; 2) comparative protein YaaD; 3) KBD-B denatured; 4) KBD-B renatured.
• the table shows the measured absorbance values at 405 nm.
• Example 1 Expression of KBD-D (SEQ ID No .: 167) by means of Escherichia coli strains using the expression plasmid pReeO24 with an IPTG inducible promoter ( Figure 8)
• E. coli strain XL10 Gold [Stratagene] was used.
• Lambda maxiDNA (DNA Lambda Maxi Kit, Qiagen Company) was prepared from a human keratinocyte cDNA library (BD Bioscience, Clontech, Human Keratinocyte cDNA, foreskin, log-phase primary culture, vector: ⁇ gt11).
• PCR for amplification of the KBD-D gene was performed in two steps. First, the 5 ⁇ nde and 3 ' end was independently amplified. These fragments were the template for amplification of the entire KBD-D gene.
• the PCR to amplify the 5 ' end was performed as follows:
• the primers had the following sequence:
• HRe6 5 - ATGAACCACTCGCCGCTCAAGACCGCCTTG - 3 ' (SEQ ID No .: 171)
• HRe9 5 ' - CGTTCCCGGTTCTCCTCAGGAGGCTGACTG - 3 ' (SEQ ID No .: 172)
• the PCR for amplification of the 3 'end was performed as follows:
• the primers had the following sequence:
• the 5 'end template and the 3 ⁇ nde- template was used as a template.
• the PCR was carried out as follows: 100 ⁇ l PCR approach:
• the resulting approximately 2150 bp PCR product was excised from an agarose gel, purified and cloned into the vector: pCR2.1 -TOPO (Invitrogen company).
• the resulting vector pRee019 (61 12 bp) was then transformed, amplified in E. coli. and the KBD-D gene is checked by sequencing.
• the KBD-D gene was cloned into the expression vector.
• another PCR was carried out with the vector pReeO19 as template:
• Precultures were inoculated from plate or glycerol culture with pReeO24 transformed E. coli strains (e.g., TG10). Depending on the size of the main culture was inoculated in a tube or a small flask with LB medium (about 1: 100).
• Antibiotics were used depending on the strain used (for pReeO24 transformed E. coli TG10 ampicillin 100 ⁇ g / ml). It was incubated at 250 rpm and 37 ° C.
• the main culture was inoculated approximately 1: 100 with preculture, main culture: LB medium or suitable minimal medium with the respective antibiotics. Incubation at 250 rpm and 37 ° C. - The induction was carried out with 1 mM IPTG from an OD 5 78nm of 1. Then the incubation temperature was lowered to room temperature (about 20 ° C). The cells were centrifuged 2 hours after induction. (See Figure 9)
• buffer A (1 OmM NaHaPO 4 , 2 mM KH 2 PO 4 , 10 mM NaCl, 8 M urea, 5 mM DTT).
• Example 12 The fractions from Example 12 containing purified KBD-D were placed in a dialysis tubing (MWCO 12-14KD). Then for about 1 hour against 1 L 8 M urea. dialyzed.
• KBD-D was used for the following activity tests.
• TBS 20 mM Tris; 150mM NaCl pH 7.5
• TTBS TBS + 0.05% Tween20
• the first step is the transfer of the outer keratin layer from the skin to a stable carrier.
• a transparent adhesive strip was firmly applied to depilated human skin and removed again.
• the test can be carried out directly on the transparent adhesive strip or the adhering keratin layer can be transferred to a glass slide by sticking it on again.
• the detection of binding was carried out as follows: For incubation with the various reagents Transfer into a Falcon vessel, if necessary add ethanol for degreasing, remove ethanol and dry the slides
• Peroxidase conjugate coupled via the His tag of KBD-B or -D. Unbound antibody-peroxidase conjugate was rinsed off again. The bound antibody-peroxidase conjugate can convert a colorless substrate (TMB) into a colored product which has been measured photometrically at 405 nm. The strength of the absorption indicates the amount of bound KBD-B or -D.
• TMB colorless substrate
• the test for binding to Haur was performed with human keratinocytes in microtiter plates as follows.
• the absorbance was measured at 405 nm
• Peroxidase substrate prepared shortly before: 0.1 ml TMB solution (42 mM TMB in DMSO)
• keratin binding domain to be tested (coupled to tag - e.g., His ⁇ , HA, etc.) in 1 ml PBS / 0.05% Tween 20; Incubation for 2 h at room temperature with slight swiveling movements.
• BSA bovine serum albumin
• PBS phosphate buffered saline
• Tween 20 polyoxyethylene sorbitan monolaureate, n about 20
• Tab.5 a Quantitative binding of KBD-D or KBD-B to the skin.
• the listed absorption values are standardized values on the surface (of skin or hair)
• Tab.5 c Quantitative binding of KBD-D and KBD-B to skin and hair after 10% SDS treatment in% relative to KBD-D and KBD-B untreated hair or skin. These results show that the protein can bind KBD-D to hair and more to skin (see Table 5). In contrast to KBD-B (SEQ ID No .: 166), the binding of KBD-D (SEQ ID No .: 168) is only influenced to a lesser extent by washing with up to 10% SDS solution (see Table 5a ).
• Ellmann's reagent 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB); 4 mg / 1 ml in 0.1 M Na phosphate buffer
• Example 17 Hair Binding Activity of KBD-B Dye
• KBD-B SEQ ID No .: 166
• a quantitative binding assay was performed (see Figure 9) First, hair was incubated with KBD-B dye and washed off unbound KBD-B dye. Subsequently, a peroxidase was coupled via the His-tag of the KBD-B. Unbound peroxidase was washed off again. The bound peroxidase can convert a colorless substrate (TMB) into a colored product that has been measured photometrically at 405 nm. The amount of absorption indicates the amount of bound KBD-B-panthenol. As a comparative sample KBD-B was chosen without dye. For exact execution see Example 10.
• the reactive dye capable of coupling was coupled to the KBD-B (SEQ ID No .: 166) via at least one of the two free SH groups of a cysteine. Ideally, therefore, the reaction between KBD-B and activated dye takes place in a molar ratio of 1: 2.
• Example 19a Coupling of reactive dyes to KBD-D (SEQ ID No .: 168)
• cysteines in KBD-D can be used analogously to KBD-B.
• KBD-D SEQ ID No .: 168
• KBD-D has 24 cysteines.
• targeted mutagenic cysteine residues can be inserted by directed mutagenesis.
• the coupling of the dye to the KBD-D can thus be carried out analogously to the manner described in Example 19 and the dyes (14_1 to 14-366) as under 19 b) for the KBD-B described also using the KBD-D done (see Ex. 65).
• the dyes 14_153, 14_154, 14-155, 14_156, 14_181, 14_182, 14_183, 14_276 and 14_289 are already in the vinyl sulfone form, i. H. these do not need to be activated (pre-eliminated), but can (according to Figure 1 1) be directly transposed with the KBD-D.
• the KDB-D reactive dye thus obtained could be used analogously to the KDB-D reactive dye from Ex. 65 in the cosmetic formulations according to Examples 66-108.
• Vinyl Sulfone Dyes (Formula 1): The reaction between KBD-B and activated dye is carried out in a molar ratio of 1: 2, since the KBD-B has two free cysteines for the effector coupling.
• the vinylsulfone dyes chosen for the coupling are usually synthesized in the form of sulfuric acid ester and therefore have to be activated to form the vinylsulfone form before reaction with KBD-B because the dyes can react with nucleophilic groups only in their vinylsulfone form.
• the activation is carried out under alkaline conditions, while the dye is adjusted to pH 1 1 in aqueous solution at room temperature for 2 minutes.
• the dyes 14_153, 14_154, 14-155, 14_156, 14_181, 14_182, 14_183, 14_276 and 14_289 are already in the vinyl sulfone form, ie they do not need to be activated (pre-eliminated), but can (according to FIG. 1 1) be directly converted with the KBD become. The color of the respective product is indicated.
• dyes e.g., dye 14_354, Figure 12
• dyes which have a substitutable halogen atom in their reactive anchor
• These dyes can be reacted without activation with the SH groups of KBD-B.
• the reaction between KBD and dye 14_354 takes place in a molar ratio of 1: 2, since the KBD-B has two free cysteines for the effector coupling.
• the reaction solution is gently shaken for 30 minutes at 30 ° C., pH 8-9.
• the following dyes (14_292 to 14_366) can be reacted with KBD-B (SEQ ID No .: 166) or KBD-D (SEQ ID No .: 168). The color of the respective product is indicated.
• a molecule with free SH groups e.g., cysteine
• cysteine e.g., cysteine
• the dyes used here are not to be purified after the synthesis, they contain both reactive and non-reactive secondary components.
• Such minor components may be added after the coupling reaction or e.g. be removed during the hair dyeing process.
• One possibility is to purify the dye-reacted KBD-B, e.g. by column chromatography. It is also possible to carry out the reaction between KBD-B and the reactive dye in a kind of "column reactor.”
• the KBD-B could be coupled to a nickel affinity column, the dye can be bound to KBD-B, and the unfixed dye residues can be directly washed out
• the KBD-B dye may be eluted from the column, or alternatively the KBD-B reacted with the dye may be applied to hair along with the non-reactive minor components and the unbound dye portion washed off the hair
• a 15% Tween 20 solution in water is suitable.
• a reactive red dye 14_264 was coupled to KBD-B (SEQ ID NO: 166) by the method described above. To show that the binding of KBD-B dye coupling to hair is mediated by the protein and not by the free dye itself, the same dye was treated only with cysteine but without KBD-B. Subsequently, KBD-B-14_264 and 14_264, respectively, were added to 5 mg of hair, briefly incubated and unbound KBD-B dye or pure Wash off the dye with a 15% Tween 20 solution. The result clearly shows that the binding to the hair is mediated by the KBD-B and a staining of the hair has taken place.
• Desmocosmetic preparations according to the invention are described below containing the keratin-binding effector molecule prepared according to Example 19 (keratin binding domain according to SEQ ID No .: ID 166 coupled with the dye 14_264).
• Said keratin-binding effector molecule is referred to in the following examples as keratin binding domain reactive dye 14_264. It is obvious to the person skilled in the art that all the other dyes described in Tables 6 and 7 can also be coupled with the KBD according to Example 19, 19 a or 19 b and can be used in the preparations mentioned below.
• Example 21 Shampoo (base formulation without keratin-binding domain reactive dye)
• phase A Weigh in the components of phase A and dissolve. Adjust the pH to 6-7. Add phase B and warm to approx. 50 ° C. Cool to room temperature while stirring.
• the content of keratin-binding domain reactive dye 14_264 in the following examples refers to 100% keratin-binding domain reactive dye 14_264.
• the active ingredient according to the invention can be used both in pure form and as an aqueous solution. In the case of the aqueous solution, the content of water must be the. be adapted in the respective formulation.
• Preparation Mix the components of phase A. Weigh out phase B and dissolve it clearly, then stir into phase A. Fill with phase C.
• Example 25 Two strands of blond, unbleached hair: Euro-natural hair, color 9/0, natural blond (2g) are treated with 0.5 g of the hair dye shampoo Example 22 / Variation 1 and the hair dye shampoo is left on the hair for 15 min. Subsequently, the hair strands are washed with water and cleaned with shampoo Example 21 and dried. The hair is completely red. There is no longer any blond hair to detect. A strand is reset as a comparison.
• the second tress is washed five times with Shampoo Example 21 and dried. After the fifth wash, the tress is compared with the return sample. chen. The tress washed five times is still completely red. Both strands have the same shade of red. There is no visual difference in color depth.
• Two strands of white hair selected, white Euro-natural hair (2 g) are treated with 0.5 g of the hair dye shampoo Example 22 / Variation 1 and the hair dye shampoo is left on the hair for 15 min. Subsequently, the hair strands are washed with water and cleaned with shampoo Example 21 and dried. The hair is completely red. There is no more white hair to detect. A strand is reset as a comparison.
• the second tress is washed five times with Shampoo Example 21 and dried. After the fifth wash, the tress is compared with the return pattern. The tress washed five times is still completely red. Both strands have the same shade of red. Visually, there is no difference in color depth.
• Two strands of blond, unbleached hair Two strands of blond, unbleached hair: Euro-natural hair, color 9/0, natural blonde
• Example 29 the second tress is washed five times with Shampoo Example 21 and dried. After the fifth wash, the tress is compared with the return pattern. The tress washed five times is still completely red. Both strands have the same shade of red. There is no visual difference in color depth.
• Example 29
• the second tress is washed five times with Shampoo Example 21 and dried. After the fifth wash, the tress is compared with the return pattern. The tress washed five times is still completely red. Both strands have the same shade of red. There is no visual difference in color depth.
• Example 30 Two Strands of White Hair: Selected White Euro Nature Hair (2g) is treated with 0.5g of the Color Styling Mousse Example 23 / Variation 1 and the Color Styling Mousse is left on the hair for 15 minutes. Subsequently, the hair strands are washed with water and cleaned with shampoo Example 21 and dried. The hair is completely red. There is no more white hair to detect. A strand is reset as a comparison.
• the second tress is washed five times with Shampoo Example 21 and dried. After the fifth wash, the tress is compared with the return pattern. The tress washed five times is still completely red. Both strands have the same shade of red. There is no visual difference in color depth visually.
• Example 31 Use of the KBD in a Day Care Emulsion - Type O / W

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Biochemistry (AREA)
• Birds (AREA)
• Epidemiology (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Biophysics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Toxicology (AREA)
• Gastroenterology & Hepatology (AREA)
• Zoology (AREA)
• Cosmetics (AREA)
• Peptides Or Proteins (AREA)

Priority Applications (1)

Applications Claiming Priority (4)

Publications (1)

Family

ID=37998364

Family Applications (1)

Country Status (8)

Families Citing this family (17)

Family Cites Families (13)

• 2006
  • 2006-11-23 BR BRPI0619199A patent/BRPI0619199A2/pt not_active IP Right Cessation
  • 2006-11-23 EP EP06830097A patent/EP1957525A2/de not_active Withdrawn
  • 2006-11-23 AU AU2006319259A patent/AU2006319259A1/en not_active Abandoned
  • 2006-11-23 CA CA002630587A patent/CA2630587A1/en not_active Abandoned
  • 2006-11-23 US US12/095,153 patent/US20090098074A1/en not_active Abandoned
  • 2006-11-23 WO PCT/EP2006/068823 patent/WO2007063024A2/de active Application Filing
  • 2006-11-23 JP JP2008542730A patent/JP2009523706A/ja not_active Withdrawn
  • 2006-11-23 MX MX2008006914A patent/MX2008006914A/es unknown

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events