EP1844066A1 - Mit anti-apoptotischen mitgliedern der bcl-2 protein-familie interagierendes beclin-proteinmotiv und dessen verwendung - Google Patents

Mit anti-apoptotischen mitgliedern der bcl-2 protein-familie interagierendes beclin-proteinmotiv und dessen verwendung

Info

Publication number
EP1844066A1
EP1844066A1 EP06709201A EP06709201A EP1844066A1 EP 1844066 A1 EP1844066 A1 EP 1844066A1 EP 06709201 A EP06709201 A EP 06709201A EP 06709201 A EP06709201 A EP 06709201A EP 1844066 A1 EP1844066 A1 EP 1844066A1
Authority
EP
European Patent Office
Prior art keywords
bcl
protein
motif
apoptotic
beclin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06709201A
Other languages
English (en)
French (fr)
Inventor
Oliver Geneste
John Hickman
Jean-Christophe Rain
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hybrigenics SA
Laboratoires Servier SAS
Original Assignee
Hybrigenics SA
Laboratoires Servier SAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hybrigenics SA, Laboratoires Servier SAS filed Critical Hybrigenics SA
Publication of EP1844066A1 publication Critical patent/EP1844066A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57496—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving intracellular compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2510/00—Detection of programmed cell death, i.e. apoptosis

Definitions

  • the present invention is part of the research and development of new agents useful for regulating apoptotic and / or autophagy programmed cell death in the treatment of cancer patients.
  • the present invention relates to a novel method of identifying modulators of programmed cell death comprising the interaction between a motif of the Beclin protein and an anti-apoptotic member of the protein family.
  • Modulators identified using the method described above are administered to cancer patients in order to induce apoptotic and / or autophagic programmed cell death in the latter.
  • the invention relates to a motif of the Beclin protein capable of interacting with an anti-apoptotic member of the Bcl-2 family of proteins and its use for inducing programmed cell death in cancer patients.
  • the programmed cell death is composed, on the one hand, of apoptosis and, on the other hand, of autophagic death.
  • Apoptosis is the best known phenomenon. This type of cell death involves morphological changes, such as core condensation, DNA fragmentation, as well as biochemical phenomena, such as the activation of caspases that will degrade key structural components of the cell to induce it. his disassembly and his death.
  • Process regulation Apoptosis is complex and involves the activation or repression of several intracellular signaling pathways.
  • Autophagic death is a second less known mechanism of programmed cell death. At the cellular level, autophagy can be summed up in three stages: the formation of an initial autophagic vacuole
  • Autophagosome and the maturation of the autophagosome into a degradative vacuole and its fusion with the lysosome.
  • Autophagic death therefore involves processes of lysosomal degradation, characterized by the accumulation of autophagic vacuoles, independent of a caspase-type regulatory pathway.
  • cancer is defined by two main characteristics: growth and cell proliferation unregulated by external signals and the ability to invade tissues, and, where appropriate, appropriate, the ability to form metastases by colonizing remote sites. These characteristics are the consequence of the intrinsic properties of the cancer cells, that is to say their karyotypic and genomic instability, their uncontrolled proliferation, their metastatic power accompanied by the acquisition of new phenotypes as well as the activation and derepression of oncogenes in said cancer cells.
  • cancer is understood to mean any phase of cell growth or proliferation having the above characteristics, evolving notably towards the development of primary tumors and / or metastatic tumors (secondary tumors). Maintaining a cell alive or programming its death requires the regulation of a major signaling pathway involving in particular proteins of the Bcl-2 family.
  • Proteins of the Bcl-2 family are divided into three main classes. Anti-apoptotic proteins, such as Bcl-2, BCI-XL and BcI-W, show strong homology in their four BH domains.
  • pro-apoptotic proteins are divided into two categories: on the one hand, multidomain proteins such as BAX and BAK and, on the other hand, pro-apoptotic proteins such as BID, NOXA, PUMA, BlK, BIM and BAD. characterized by the presence of a single domain of homology, the motive
  • the BH3 motif is an amphiphilic helical ⁇ region whose sequence homology is relatively low in the Bcl-2 family of proteins.
  • the presence of the BH3 motif in a protein is required to allow interaction with the anti-apoptotic members of the Bcl-2 family of proteins.
  • the activity of an anti-apoptotic member of the Bcl-2 family of proteins is regulated by the product of the pro-apoptotic genes of said family, the two proteins assembling into heterodimers. Under this state the anti-apoptotic member of the Bcl-2 family of proteins is inactive and therefore no longer has its anti-apoptotic activity.
  • the specific interaction of the BH3 motif with the anti-apoptotic members of the Bcl-2 family of proteins can be modified by modulators so as to specifically induce apoptotic programmed cell death.
  • apoptotic signaling pathway can also be modulated by viral infection strategies. Indeed, a large number of viral proteins interfere with the pathway of apoptosis by structural homology, functional mimicry or at the level of the transduction of pro and anti-apoptotic signals. Thus, some viruses encode anti-apoptotic Bcl-2 analogs that inhibit the mitochondrial pathway or effector phase blocking caspase inhibitors. Early apoptosis of the infected cell is a host defense mechanism limiting the abundance of virus particles; on the other hand, delayed apoptosis of the host cell allows the virus to replicate and spread.
  • Autophagy is involved in the survival mechanism of the cell and is also associated in the course of programmed cell death. Many studies have established that autophagy is under the control of tumor suppressor gene products such as Beclin, PTEN, TSC1. Inactivation of these genes and reduction of autophagic abilities are early events of tumor progression in cancer patients. Beclin plays a central and early role in the phenomenon of autophagy, particularly in the formation of autophagic vacuoles or autophagosomes (Edinger et al., Detective autophagy leads to cancer, Cancer CeII December 2003).
  • Tumor resistance to chemotherapy agents is a central problem in medical oncology. There is the appearance of acquired resistance manifesting itself at the level of tumors which initially responded to chemotherapy and then develop, in the more or less short term, resistance to treatment. These resistances present at the level of tumor cells are generally associated with an inhibition of the caspase-dependent pathway or apoptotic pathway of programmed cell death at which the main current anticancer treatments (cytotoxic agents) act. To be more effective, anticancer treatments must therefore propose an alternative and / or complementary strategy to treatments acting on the apoptotic pathway of programmed cell death with a view, at least in part, to disadvantages of known treatments acting exclusively on apoptosis.
  • the invention proposes to act, via dual modulators, on the autophagic and / or apoptotic pathway. Therefore, the modulation of the caspase-independent or autophagic pathway implemented in the context of the invention provides an alternative to the treatments acting specifically at the level of the apoptotic pathway.
  • the inventors have developed a strategy consisting, on the one hand, in verifying the structural interaction between the anti-apoptotic members of the Bcl-2 protein family and the Beclin protein, and on the other hand, to look for modulators of this interaction that will inherently be able to act on both the anti-apoptotic members of the Bcl-2 family of proteins as well as on the Beclin protein. Consequently, these dual modulators thus selected would be ideal for obtaining drug candidates for combating pathologies that deregulate programmed apoptotic and / or autophagic cell death.
  • the selection and identification of modulators of the protein interaction between Beclin protein or a specific motif thereof and an anti-apoptotic member of the Bcl-2 family of proteins was studied on the basis of the double hybrid system. .
  • Fields et al. (US 5,283,173, US 5,468,614, US 5,667,973) initially described and developed this dual hybrid system.
  • the dual hybrid system initially consists of a yeast test between two recombinant proteins.
  • the first protein, called “bait” is a fusion protein containing a DNA binding domain (BD) linked upstream of a protein A.
  • the second protein is also a fusion protein, commonly called “prey”, containing an activation domain (activation domain or AD) bound to a protein B.
  • the binding and activation domains commonly used are those of Gal4 or E. CoIi Lex A.
  • the proteins A and B are respectively an anti-apoptotic member of the Bcl-2 protein family and a specific Beclin motif.
  • a and B by protein interaction allows the formation, by complementation, of a functional domain (BD-AD) capable of binding to the binding site (BS or BS) present upstream of a reporter gene and ensuring the transcription of said reporter gene.
  • BD-AD functional domain capable of binding to the binding site (BS or BS) present upstream of a reporter gene and ensuring the transcription of said reporter gene.
  • This motif of the Beclin protein has, in particular, been demonstrated in the context of the invention.
  • This motif of the Beclin protein is able to interact very specifically with the anti-apoptotic members of the Bcl-2 family of proteins for use in selecting specific modulators of apoptosis and / or autophagy. .
  • This interaction specificity is related to the sequence, three-dimensional structure, and / or helicity of the original motif of the Beclin protein.
  • this original motif of the 26 amino acid Beclin protein corresponds to the precise domain of interaction with Bcl-2, BCI-XL and / or BcI-W and has the typical structural criteria allowing the formation of homo- or heterodimers.
  • This motif makes it an ideal candidate for the development of a test for highly efficient screening of molecules capable of modulating the interactions between this Beclin peptide and an anti-apoptotic protein.
  • Numerous screening assays for protein-protein interaction modulators are found in the literature, but often have limitations on their sensitivity and high-throughput feasibility.
  • the commonly used methods require the implementation of complex tools (fusion proteins, recombinant proteins, etc.) that are not very compatible with high throughput screening. They generate most often a significant background noise and are unreliable from a quantitative point of view: they have a reduced reading window that does not allow optimal screening of the molecules tested.
  • the peptide corresponding to the Beclin motif GTMENLSRRLKVTGDLFDIMSGQTDV may advantageously be used for the screening of compounds modulating the protein interaction between the Beclin motif and an anti-apoptotic member of the Bcl-2 proteins either by activating or inhibiting this interaction.
  • the subject of the invention is a method for identifying modulators of programmed cell death comprising a step of interaction between the motif GTMENLSRRLKVTGDLFDIMSGQTDV of the Beclin protein and an anti-apoptotic member of the Bcl-2 family of proteins and a step of detection of the interaction in the presence or absence of the test compound.
  • the method for identifying modulators of programmed cell death comprises the following steps: a) Fluorescence probe labeling of the motif
  • modulator is meant any compound capable of increasing, preventing or at least limiting a specific activity such as a protein-protein interaction, an enzymatic activity, an attachment to cellular receptors.
  • the modulators are inhibitors or activators of the protein interaction between the Beclin partners and the anti-apoptotic members of the Bcl-2 family of proteins.
  • the invention also relates to a method of identifying an inhibitor of the interaction between the motif of the Beclin protein and an anti-apoptotic member of the Bcl-2 family of proteins capable of decreasing the fluorescence polarization with respect to a control consisting of this interaction in the absence of modulator.
  • the invention also relates to a method for identifying an activator of the interaction between the motif of the Beclin protein and an anti-apoptotic member of the Bcl-2 family of proteins capable of increasing the fluorescence polarization relative to to a control consisting of this interaction in the absence of a modulator.
  • the fluorescent ligand ie the fluorescent Beclin peptide
  • after binding with the anti-apoptotic partner of the Bcl-2 protein family has a lower rotation constant than the corresponding free ligand and thus the fluorescence emitted by the bound ligand becomes polarized.
  • the fluorescence probe used in the screening method according to the invention is bodipy, Oregon Green and preferably fluorescein.
  • the anti-apoptotic member of the protein family More particularly, the anti-apoptotic member of the protein family
  • Bcl-2 acting as a partner of the interaction in the screening and identification process according to the invention, may be the Bcl-2 protein, BCI-XL or BcI-W.
  • the anti-apoptotic member of the Bcl-2 family of proteins is a fusion protein.
  • fusion protein is meant the fusion between a domain of the Bcl-2 protein, BCI-XL OR BCI-W and a domain of a protein such as GST (Glutathione-S-transferase).
  • amino acid sequence is to be understood a peptide sequence isolated from the natural context. These include isolated sequences, synthesized chemically and / or purified and possibly modified by genetic engineering.
  • the term "functional variants” means the amino acid sequences of the Beclin motif comprising conservative substitutions or conservative point mutations and having essentially the same properties that this motif encoded by the sequence SEQ ID NO.1, is the ability to interact with an anti-apoptotic member of the family of Bcl-2 proteins.
  • the conservative substitutions or mutations of the amino acid sequence SEQ ID NO.1 are, for example, the following: glycine by alanine (GA), valine by leucine (V-L); aspartic acid by glutamic acid (D-
  • the inventors observed that the peptide sequence Beclin motif SEQ ID NO.1 interacted with an anti-apoptotic member of the family of Blc-2 proteins, such as Bcl-2, BCI-XL or BCI-W.
  • the invention also relates to the nucleic acid sequence 5'ggcaccatggagaacctcagccgaagactgaaggtcactggggacctttttgacatcatgtcgggcc agacagatgtg 3 '(SEQ ID NO.2) encoding the original motif of the Beclin protein.
  • This nucleic acid sequence according to the invention can be obtained according to the genetic code from the amino acid sequence of the Beclin motif and its variants. "Variants" of this nucleic acid sequence include:
  • sequences of a mammalian species homologous to the sequence SEQ ID No. 2 isolated in humans.
  • stringent conditions the conditions which allow the specific hybridization of two single-stranded DNA sequences at about 65 ° C., for example in a solution of 6 ⁇ SSC, 0.5% SDS, 5 ⁇ Denhardt's solution and 100 ⁇ ⁇ g of nonspecific carrier DNA or any other equivalent ionic strength solution and after washing at 65 ° C, for example in a solution of not more than 0.2 x SSC and 0.1% SDS or any other solution of equivalent ionic strength.
  • the parameters defining the stringency conditions depend on the temperature at which 50% of the paired strands separate (Tm). For sequences with more than
  • Tm 81, 5 + 0.41 (% G + C) + 16.6Log (cation concentration) - 0.63 (% formamide) - (600 / number of bases) .
  • Tm 4 (G + C) + 2 (A + T).
  • sequences of a species of mammals homologous to the sequence SEQ ID No. 2 a sequence of structure similar to the sequence SEQ ID No. 2 and coding a polypeptide having essentially the same properties in non-mammalian species -humans, especially primates, rats or mice.
  • the percentage identity between two homologous sequences in the functional regions is generally greater than 80%, preferably greater than 90%.
  • the invention also relates to a recombinant vector comprising a nucleic acid sequence as claimed according to the invention.
  • vector it is necessary to understand any type of vector allowing the introduction of the nucleic acid sequence into a host cell and possibly the expression of the polypeptide encoded by the nucleic acid sequence in the host cell.
  • a vector is for example a plasmid, a cosmid, an artificial bacterial chromosome or a bacteriophage comprising the sequences necessary for the expression of the motif of the Beclin protein.
  • the recombinant vector according to the invention comprises the sequences necessary for the expression of the claimed motif of the protein.
  • Beclin in the host cell include sequences promoting transcription and translation in the host cell as well as terminator sequences.
  • the recombinant vector may also include sequences encoding secretion signals allowing the release of translated proteins into the extracellular environment.
  • the invention also relates to the host cells transformed with a recombinant vector according to the invention.
  • these host cells are bacterial cells such as Escherichia coli, for example streptococci or eukaryotic cells such as yeast cells, filamentous fungi, insect cells and preferably mammalian cells.
  • This amino acid sequence peptide SEQ ID NO.1 can also be chemically synthesized by Neosystem.
  • Synthesis SEQ ID NO.1 and its functional variants are synthesized on a solid support according to the Boc / benzyl strategy using an "Applied Biosystems 430A" peptide synthesizer. The synthesis is based on the development of the desired sequence on the resin, followed by deprotection of the N- and C-terminal amino functions. In Boc / benzyl strategy, it is necessary to introduce the amino acid Boc-L-Lys (Fmoc) -OH during the synthesis of the peptide. After developing the entire sequence, the amino function is deprotected and the peptide cut off from the resin in the presence of a strong acid.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a peptide, corresponding to the SEQ ID NO.1 motif of Beclin according to the invention as active principle in combination with one or more pharmaceutically acceptable excipients.
  • excipients of a pharmaceutical composition any agent ensuring the transport of the active ingredient in the internal routes in the patient treated.
  • active principle is meant any substance responsible for the pharmacodynamic or therapeutic properties of the pharmaceutical composition.
  • non-toxic, pharmaceutically acceptable excipients mention may be made, by way of indication and without limitation, of diluents, solvents, preservatives, wetting agents, emulsifiers, dispersing agents, binders, blowing agents, disintegrating agents, retardants, lubricants, absorbents, suspending agents, dyes or flavoring agents.
  • the present invention concerns not only the pharmaceutical composition considered as such and defined above, but also the use of this composition in an induction method programmed cell death of the apoptotic and / or autophagic type according to the invention.
  • the present invention thus relates to a method for inducing apoptotic programmed cell death, Le. programmed caspase-dependent cell death pathway, and / or autophagic-type, ie programmed independent caspase cell death pathway comprising administering to the cancer patient an effective amount of a pharmaceutical composition comprising a Beclin peptide of sequence SEQ ID NO.1.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising at least one modulator, activator or inhibitor, identified from the modulator identification method according to the invention, as the active principle of said composition in combination with one or more pharmaceutically acceptable excipients. acceptable.
  • the invention also relates to a method of inducing programmed apoptotic (caspase-dependent) and / or autophagic (independent caspase) programmed cell death from the administration of an effective amount of composition defined above to a patient suffering from Cancer.
  • compositions as described above can be used in the treatment of cancers by action on programmed apoptotic and / or autophagic cell death.
  • compositions according to the invention are in a form suitable for oral, parenteral, nasal, percutaneous, rectal, perlingual, ocular or respiratory administration and in particular simple or coated tablets, sublingual tablets, sachets, packets, the capsules, glossettes, lozenges, suppositories, creams, ointments, dermal gels, and ampoules drinkable or injectable.
  • FIG. 2 nucleic acid sequence SEQ ID NO.2 coding for the Beclin motif interacting with an anti-apoptotic member of the Bcl-2 protein family.
  • FIG. 3 determination of Ki in fluorescence polarization of the Beclin competitor peptide, mutated or otherwise, on the interaction between the pro-apoptotic peptide Bak and the anti-apoptotic members Bcl-2, BCI-XL and BcI-W.
  • FIG. 4 co-immunoprecipitation results between the BcI-protein
  • FIG. 5 determination of the K 0 of the interaction between BCI-XL and the Beclin peptide.
  • BCI-XL (accession number Z23115) deleted from its C-terminus (1-209) and fused to the DNA binding domain LexA-Bcl-2 (accession number XM_008738) deleted from its C-terminus terminally (1-211) and fused to the LexA DNA binding domain.
  • URA3 UASGAL1-LacZ, Met
  • UASGAL1-LacZ Met
  • Met a culture medium lacking in leucine
  • the conjugation is carried out with a ratio "bait” / "prey” equal to 2.
  • a quantity of yeast cells "baits” obtained in stage 1) a) corresponding to 50 units DOeoonm is mixed with yeasts "prey” obtained in stage 1 ) b). After centrifugation, the pellet is resuspended in YPGIu medium, spread on YPGIu culture dishes and incubated for 4 hours at 30 ° C.
  • the selection of the conjugated yeasts containing a "bait” and a “prey” capable of interacting together is carried out on a DO-Leu-Trp-His medium: the absence of leucine and tryptophan makes it possible to maintain a selection pressure that only allows the yeasts containing the two types of plasmids ( "Bait” / "prey") to grow; the absence of histidine in the medium makes it possible to select the conjugated yeasts containing a "bait" plasmid and a "prey” plasmid capable of interacting together: this complementation makes it possible to activate the HIS3 gene, as a reporter gene coding for an enzyme involved in the biosynthesis of histidine.
  • the "prey” fragments of a colony of yeasts selected according to the conjugation method described in paragraph 2) are amplified by PCR from a crude lysate of this colony, using primers specific for the "prey” vector: ABS1 '-GCTTTGGAATCACTACAGG-3' (SEQ ID NO.3)
  • the PCR products are then sequenced and the sequences obtained are identified by comparison with databases.
  • the determination of Ki in fluorescence polarization consists in measuring the competitive effect of the Beclin peptide on the interaction between the pro-apoptotic peptide Bak and the anti-apoptotic members of the Bcl-2 family of proteins such as Bcl-X L , Bcl -2 or BcI-W.
  • the following reagents are mixed in the specified order: a) of the competitor peptide to a final concentration of 1 nM to 100 ⁇ M; b) Fluorescent ligand peptide (Bak BH3 carboxyfluorescein) at a final concentration of 15 nM; c) the anti-apoptotic member of the Bcl-2 protein family to a final concentration of 100 nM for BCI-XL, 1 MM for Bcl-2 and BcI-W.
  • the mixture is then incubated for 30 minutes at room temperature and the fluorescence polarization determined on the device (Packard) Fusion (excitation at 485 nm and reading at 530 nm). The values are given in mP (fluorescence polarization unit).
  • Determination of Ki in fluorescence polarization consists of measuring the competitive effect of the mutated Beclin peptide, from leucine to alanine at position 116 of the complete sequence of the Beclin protein (L116A), on the interaction between the pro-apoptotic peptide BAK anti-apoptotic members of the Bcl-2 protein family such as BCI-XL, Bcl-2 OR BCI-W.
  • the sequence of the mutated peptide (L116A) is as follows:
  • the protocol for determining Ki in fluorescence polarization is identical to the protocol described above.
  • HeLa cells are co-transfected (Effectene kit, Qiagen) with an expression vector encoding the Bcl-X L protein carrying a flag epitope and an expression vector encoding the wild-type or mutated Beclin protein (L116A). Twenty-four hours after transfection, the cells are taken up in the lysis buffer (10 mM Hepes pH 7.5, 150 mM KCl, 5 mM MgCl 2, 1 mM EDTA, 0.4% Triton, antiproteases and antiphosphatases), incubated in ice and centrifuged at room temperature. 10000 rpm. The supernatant (cell lysate) is then incubated in the presence of agarose beads conjugated to anti-Flag antibodies (Flag M2 agarose, sigma) for 2 hours.
  • lysis buffer 10 mM Hepes pH 7.5, 150 mM KCl, 5 mM MgCl 2, 1 mM EDTA, 0.4% Trit
  • the agarose beads are then centrifuged and washed in lysis buffer and then taken up in Laemli buffer and analyzed by Western blots with anti-Beclin antibodies.
  • Example 2 Fluorescent (fluorescein-coupled) dissolved in buffer containing Na 2 HPO 4 20 mM pH 7.4, 1 I of 1 mM EDTA, 50 mM NaCl, acid pluronic F- 0.05% at a concentration of 15 nM is incubated in the presence of increasing concentrations of the GFT-BcI-XL fusion protein (10 -9 to 10 -5 M) and the fluorescence polarization is then measured by the apparatus. In Vision (Packard Perkin-Elmer). A KD of 0.2 ⁇ M for this interaction could thus be determined. 2) Identification of Bcl-XL-peptide Interaction Inhibitor
  • the products to be tested are distributed in 384-well plates (Corning Fiat Bottom) at a final concentration of 10 ⁇ g / ml.
  • a well is filled with an equivalent amount of buffer / solvent without test compound and will constitute the control.
  • the peptide obtained in Example 1 labeled with fluorescein is added to each well so as to obtain a final concentration ranging from 1 to 100 nM.
  • the GST-BcI-XL or GST-Bcl-2 or GST-BcI-W fusion protein is then added so as to obtain a final concentration of 0.1 to 1 ⁇ M in a buffer containing 20 mM Na 2 HPO 4 pH. 7.4, 1 mM EDTA, 50 mM NaCl, 0.05% pluronic acid F-68.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP06709201A 2005-02-01 2006-01-31 Mit anti-apoptotischen mitgliedern der bcl-2 protein-familie interagierendes beclin-proteinmotiv und dessen verwendung Withdrawn EP1844066A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0500977A FR2881429B1 (fr) 2005-02-01 2005-02-01 Motif de la proteine beclin interagissant avec les membres anti-apoptotiques de la famille de proteines bcl-2 et utilisations
PCT/FR2006/000205 WO2006082303A1 (fr) 2005-02-01 2006-01-31 Motif de la proteine beclin interagissant avec les membres anti-apoptotiques de la famille de proteines bcl-2 et utilisations

Publications (1)

Publication Number Publication Date
EP1844066A1 true EP1844066A1 (de) 2007-10-17

Family

ID=34954188

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06709201A Withdrawn EP1844066A1 (de) 2005-02-01 2006-01-31 Mit anti-apoptotischen mitgliedern der bcl-2 protein-familie interagierendes beclin-proteinmotiv und dessen verwendung

Country Status (7)

Country Link
US (1) US7919233B2 (de)
EP (1) EP1844066A1 (de)
JP (1) JP2008532486A (de)
CN (1) CN101111518A (de)
CA (1) CA2596672A1 (de)
FR (1) FR2881429B1 (de)
WO (1) WO2006082303A1 (de)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPWO2009123145A1 (ja) * 2008-03-31 2011-07-28 福岡県 パラスポリン−１受容体及びその用途
EP2358752A1 (de) * 2008-12-04 2011-08-24 Yeda Research And Development Company Ltd. Zusammensetzungen und verfahren zur diagnose und behandlung von krebs und neurodegenerativen krankheiten, die mit beclin-1 in zusammenhang stehen
US20110301093A1 (en) 2009-05-06 2011-12-08 Yeda Research And Development Co. Ltd. At The Weizmann Institute Of Science Compositions and methods for diagnosing and treating cancer and neurodegenerative diseases related to beclin-1
JP6124409B2 (ja) * 2012-02-09 2017-05-10 国立大学法人 東京医科歯科大学 ベンゾチオフェン化合物、該化合物を有効成分とするオルタナティブオートファジー誘導剤及び抗癌剤、並びに抗癌活性を有する化合物をスクリーニングするための方法
US8802633B1 (en) * 2013-03-18 2014-08-12 Board Of Regents, The University Of Texas System Autophagy-inducing peptide analogs
EP3046571A4 (de) * 2013-09-18 2017-03-15 Ndsu Research Foundation Zusammensetzungen und verfahren zur behandlung von mit y-herspesviren assoziierten erkrankungen
CN107098965B (zh) * 2017-04-14 2019-11-05 深圳人仁生物医药科技有限公司 Beclin1突变蛋白及其制备方法和应用

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5858669A (en) * 1996-09-13 1999-01-12 The Trustees Of Columbia University In The City Of New York Beclin, a novel bcl-2 interacting gene near BRCA1 on chromosome 17q21 and methods of use
US6432914B1 (en) * 1996-09-13 2002-08-13 The Trustees Of Columbia University In The City Of New York Beclin and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006082303A1 *

Also Published As

Publication number Publication date
CA2596672A1 (fr) 2006-08-10
WO2006082303A1 (fr) 2006-08-10
US7919233B2 (en) 2011-04-05
FR2881429B1 (fr) 2007-04-06
FR2881429A1 (fr) 2006-08-04
JP2008532486A (ja) 2008-08-21
CN101111518A (zh) 2008-01-23
US20090099072A1 (en) 2009-04-16

Similar Documents

Publication Publication Date Title
EP1844067A2 (de) Mit anti-apoptotischen mitgliedern der bcl-2 protein-familie interagierende neue peptide und deren verwendung
Linseman et al. Glycogen synthase kinase-3β phosphorylates Bax and promotes its mitochondrial localization during neuronal apoptosis
EP1844066A1 (de) Mit anti-apoptotischen mitgliedern der bcl-2 protein-familie interagierendes beclin-proteinmotiv und dessen verwendung
Kim et al. Structural requirements for VAP-B oligomerization and their implication in amyotrophic lateral sclerosis-associated VAP-B (P56S) neurotoxicity
EP2403869B1 (de) Peptide zur Behandlung von Krebs und insbesondere chronischer lymphoider Leukämie
CA2305816C (fr) Peptides capables d'inhiber l'interaction entre les presenilines et le peptide .beta.-amyloide ou son precurseur
Gilliam et al. Affinity-guided design of caveolin-1 ligands for deoligomerization
EP1651668B1 (de) Peptid welches mit den anti-apoptotischen proteinen der familie bcl-2 interagiert
EP1346226B1 (de) Screening-verfahren auf basis der siah-numb-wechselwirkung
WO2005033147A1 (fr) Polypeptide d’interaction comprenant un motif heptapeptidique et un domaine de penetration cellulaire
CA2432327A1 (fr) Procede de criblage base sur les partenaires de liaison de tsap6
EP1257642B1 (de) Partnern des ptb1 domäne aus fe65, herstellung und verwendungen davon
CA2347121A1 (fr) Polypeptides (mbp1) capables d'interagir avec les mutants oncogeniques de la proteine p53
FR2784383A1 (fr) Polypeptides capables d'interagir avec les mutants oncogeniques de la proteine p53
JP2004041192A (ja) ラットｓｋａｐ５５タンパク質およびそれをコードする遺伝子
Santoso The role of the prion determining domain of Sup35p in formation, propagation, and manifestation of a species barrier of the yeast prion (PSI (+))
FR2805266A1 (fr) Compositions utilisables pour reguler l'activite de la parkine
CA2408207A1 (fr) Peptides liant la proteine phosphatase 2a et polynucleotides les codant
FR2804962A1 (fr) Partenaires du domaine ptb1 de fe65, preparation et utilisations

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070711

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK YU

17Q First examination report despatched

Effective date: 20090408

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120403