Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
  • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P13/00—Preparation of nitrogen-containing organic compounds
  • C12P13/04—Alpha- or beta- amino acids

Definitions

• the present invention relates to the use of nucleic acid sequences for the regulation of the transcription and expression of genes, the novel promoters and expression units themselves, methods for altering or causing the transcription rate and / or expression rate of genes, expression cassettes containing the expression units, genetically modified microorganisms altered or induced rate of transcription and / or rate of expression and methods for
• biosynthetic products such as, for example, fine chemicals, such as, inter alia, amino acids, vitamins but also proteins
• fine chemicals such as, inter alia, amino acids, vitamins but also proteins
• Diole substances which are collectively referred to as fine chemicals / proteins, include, among others, organic acids, both proteinogenic and non-proteinogenic amino acids, nucleotides and nucleosides, lipids and fatty acids, diols, carbohydrates, aromatic compounds, vitamins and cofactors, as well as proteins and enzymes.
• Their production is most conveniently made on a large scale by culturing bacteria that have been developed to produce and secrete large quantities of the desired substance.
• Particularly suitable organisms for this purpose are coryneform bacteria, gram-positive non-pathogenic bacteria.
• Process improvements may include fermentation measures, such as stirring and supply of oxygen, or the composition of the nutrient media, such as the sugar concentration during fermentation, or the processing of the product, for example by ion exchange chromatography but also spray-drying, or the intrinsic performance characteristics of the microorganism concern yourself.
• RNA polymerase holoenzymes also called -35 and -10 regions
• ribosomal 16S RNA also ribosomal binding site or Shine-Dalgamo Called sequence.
• sequence of a ribosomal binding site also called Shine-Dalgarno sequence, for the purposes of this invention is understood to mean polynucleotide sequences which are up to 20 bases upstream of the initiation codon of the translation.
• Nucleic acid sequences with promoter activity can influence the formation of mRNA in different ways. Promoters whose activity is independent of the physiological growth phase of the organism are called constitutive. Again other promoters react to external chemical as well as physical stimuli such as oxygen, metabolites, heat, pH, etc. Still others show a strong dependence of their activity in different growth phases. For example, in the literature promoters are described which show a particularly pronounced activity during the exponential growth phase of microorganisms, or else exactly in the stationary phase of microbial growth. Both characteristics of promoters can have a favorable effect on productivity for the production of fine chemicals and proteins depending on the metabolic pathway.
• promoters which, during growth, turn off the expression of a gene, but turn it on after optimal growth, to regulate a gene that controls the production of a metabolite.
• the altered strain has the same growth parameters as the Monocytes, but produces more product per cell. This type of modification can increase both the titer (g product / liter) and the C yield (g product / gC source).
• regulated promoters may increase or decrease the rate at which a gene is transcribed, depending on the internal and / or external conditions of the cell.
• an inducer may stimulate the rate of transcription from the promoter.
• Inducers may directly or indirectly affect transcription from the promoter.
• suppressors is capable of reducing or inhibiting transcription from the promoter. Like the inducer, the suppressors can act directly or indirectly.
• promoters known that are regulated by temperature Thus, for example, the level of transcription of such promoters may be increased or decreased by increasing the growth temperature above the normal growth temperature of the cell.
• promoters from C. glutamicum have been described to date.
• the promoter of the malate synthase gene from C. glutamicum was described in DE 4440118. This promoter was preceded by a structural protein coding for a protein. After transformation of such a construct into a coryneform bacterium, the expression of the downstream structural gene is regulated. The expression of the structural gene is induced as soon as a corresponding inducer is added to the medium.
• the object of the invention was to provide further promoters and / or expression units with advantageous properties.
• nucleic acids with promoter activity containing
• transcription is understood to mean the process by which a complementary DNA molecule is produced by a DNA template, in which process proteins such as RNA polymerase are involved in so-called sigma factors and transcriptional regulatory proteins then serves as a template in the process of translation, which then leads to the biosynthetically active protein.
• the rate at which a biosynthetic active protein is produced is a product of the rate of transcription and translation. Both rates can be influenced according to the invention and thus influence the rate of formation of products in a microorganism.
• a "promoter” or a “nucleic acid with promoter activity” is understood as meaning according to the invention a nucleic acid which, in functional linkage with a nucleic acid to be transected, regulates the transcription of this nucleic acid.
• a "functional linkage” is understood to mean, for example, the sequential arrangement of one of the nucleic acids according to the invention with promoter activity and a nucleic acid sequence to be transcribed and, if appropriate, further regulatory elements, for example nucleic acid sequences which ensure the transcription of nucleic acids, and for example Terminator such that each of the regulatory elements can fulfill its function in the transcription of the nucleic acid sequence.
• further regulatory elements for example nucleic acid sequences which ensure the transcription of nucleic acids, and for example Terminator such that each of the regulatory elements can fulfill its function in the transcription of the nucleic acid sequence.
• Genetic control sequences such as for example enhancer sequences, can also function
• Preference is given to arrangements in which the nucleic acid sequence to be transcribed is positioned behind the (ie at the 3 'end) of the promoter sequence according to the invention rd, so that both sequences are covalently linked.
• the distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is
• promoter activity is understood as meaning the amount of RNA, that is to say the transcription rate, formed by the promoter in a specific time.
• RNA per promoter activity is meant according to the invention the amount of RNA per promoter formed by the promoter in a certain time.
• wild-type is understood according to the invention as the corresponding starting microorganism.
• microorganism may be understood as meaning the starting microorganism (wild-type) or a genetically modified microorganism according to the invention or both.
• the term "wild-type" is used to change or cause the promoter activity or transcription rate, to change or cause the expression activity or expression rate, and for the Er ⁇ increase the content of biosynthetic products each understood a reference organism.
• this reference organism is Corynebacterium glutamicum ATCC 13032.
• starting microorganisms are used which are already capable of producing the desired fine chemical.
• particularly preferred microorganisms of the bacteria of the genus Corynebacteria and the particularly preferred fine chemicals L-lysine, L-methionine and L-threonine those starting microorganisms which are already able to produce L-lysine, L-methionine and / or are particularly preferred To produce L-threonine.
• these are particularly preferably corynebacteria in which, for example, the gene coding for an aspartokinase (ask gene) is deregulated or the feed-back inhibition is stopped or reduced.
• such bacteria have a mutation in the ask gene which leads to a reduction or abolition of the feedback inhibition, for example the mutation T3111.
• RNA With a "caused promoter activity" or transcription rate with respect to a gene compared to the wild type, the formation of a RNA is thus caused in comparison to the wild type, which was thus not present in the wild type.
• the amount of RNA formed is thus changed in a certain time compared to the wild type.
• the increased promoter activity or transcription rate can be achieved, for example, by regulating the transcription of genes in the microorganism by nucleic acids according to the invention having promoter activity or by nucleic acids having increased specific promoter activity, the genes being heterologous with respect to the nucleic acids having promoter activity.
• Vorzusgweise the regulation of the transcription of genes in the microorganism by nucleic acids according to the invention with promoter activity or by nucleic acids with increased specific promoter activity is achieved by one or more nucleic acids according to the invention having promoter activity, where appropriate with altered specific promoter activity, are introduced into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the incorporated nucleic acid according to the invention having promoter activity is optionally altered specific promoter activity, or
• nucleic acid constructs comprising a nucleic acid according to the invention having promoter activity, optionally with altered specific promoter activity, and functionally linking one or more nucleic acids to be transcribed into which microorganism introduces.
• nucleic acids according to the invention with promoter activity contain
• nucleic acid sequence SEQ. ID. NO. 1 or B a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 or
• SEQ. ID. NO. 1 represents the promoter sequence of the elongation factor TS (PEF-TS) from Corynebacterium glutamicum.
• SEQ. ID.NO. 1 corresponds to the wild-type promoter sequence.
• the invention further relates to nucleic acids with promoter activity comprising a sequence derived from this sequence by substitution, insertion or deletion of nucleotides, which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 1 has.
• promoters according to the invention can be prepared, for example, from various organisms whose genomic sequence is known by identity comparisons of the nucleic acid sequences from data Banks with the above-described sequences SEQ ID NO: 1 easily find.
• substitution in the description refers to the replacement of one or more nucleotides by one or more nucleotides.
• “Deletion” is the replacement of a nucleotide by a direct bond Insertions are insertions of nucleotides into the nucleic acid sequence which formally replaces a direct bond with one or more nucleotides.
• Identity between two nucleic acids is understood to mean the identity of the nucleotides over the entire nucleic acid length, in particular the identity which was determined by comparison with the Vector NTI Suite 7.1 software from Informax (USA) using the Clustal method (Higgins DG, Sharp PM Biosci 1989 Apr; 5 (2): 151-1) is calculated by setting the following parameters: and sensitive multiple sequence alignments on a microcomputer.
• a nucleic acid sequence which has an identity of at least 90% with the sequence SEQ ID NO: 1 is accordingly understood to mean a nucleic acid sequence which, in a comparison of its sequence with the sequence SEQ ID NO: 1, in particular special according to the above program logarithm with the above parameter set has an identity of at least 90%.
• Particularly preferred promoters have with the nucleic acid sequence SEQ. ID. NO. 1 has an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, more preferably 99%.
• promoters can furthermore readily be found starting from the above-described nucleic acid sequences, in particular starting from the sequence SEQ ID NO: 1 from various organisms whose genomic sequence is unknown, by hybridization techniques in a manner known per se.
• Another object of the invention therefore relates to nucleic acids with Promotoreducationi- tat, containing a nucleic acid sequence with the nucleic acid sequence SEQ. ID. No. 1 hybridized under stringent conditions.
• This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50, or more preferably more than 150 nucleotides.
• the hybridization is carried out according to the invention under stringent conditions.
• Hybridization conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd Edition, ColD Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biolgy, John Wiley & Sons, NY (1989), 6.3.1-6.3.6:
• stringent hybridization conditions are meant in particular: The overnight incubation at 42 ° C in a solution consisting of 50% formamide, 5 x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6 ), 5x Denhardt solution, 10% dextran sulfate, and 20 g / ml denatured, sheared salmon sperm DNA, followed by washing the filter with 0.1x SSC at 65 0 C.
• 5 x SSC 750 mM NaCl, 75 mM trisodium citrate
• 50 mM sodium phosphate pH 7.6
• 5x Denhardt solution 10% dextran sulfate
• a “functionally equivalent fragment” for nucleic acid sequences with promoter activity fragments understood that have substantially the same or higher specific promoter activity as the starting sequence.
• fragments is meant partial sequences of the nucleic acids having promoter activity described by embodiment A), B) or C. Preferably, these fragments have more than 10, more preferably more than 12, 15, 30, 50 or more preferably more than 150 contiguous nucleotides of the nucleic acid sequence SEQ ID NO: 1.
• nucleic acid sequence SEQ. ID. NO. 1 is a promoter, i. for the transcription of genes.
• the SEQ. ID. NO. 1 has been described without function assignment in Genbank entry AP005283. Therefore, the invention further relates to the novel nucleic acid sequences according to the invention with promoter activity.
• the invention relates to a nucleic acid with promoter activity containing
• nucleic acid having the sequence SEQ. ID. NO. 1 is excluded.
• nucleic acids with promoter activity can furthermore be produced in a manner known per se by chemical synthesis from the nucleotide units, for example by fragment condensation of individual overlapping, complementary nucleic acid units of the double helix.
• the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner by the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897).
• the An ⁇ storage of synthetic oligonucleotides and filling gaps with the Klenow fragment of the DNA polymerase and ligation reactions and general cloning procedures are in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Col. Spring Harbor Laboratory Press.
• the invention further relates to the use of an expression unit comprising one of the nucleic acids according to the invention with promoter activity and additionally functional combines a nucleic acid sequence which ensures the translation of ribonucleic acids, for the expression of genes.
• an expression unit is understood as meaning a nucleic acid with expression activity, ie a nucleic acid which, in functional linkage with a nucleic acid or gene to be expressed, regulates the expression, ie the transcription and the translation of this nucleic acid or gene.
• a “functional linkage” is understood to mean, for example, the sequential arrangement of one of the expression units according to the invention and of a nucleic acid sequence to be expressed transgenically and, if appropriate, further regulatory elements such as, for example, a terminator such that each of the regulators regulates
• genetic control sequences such as enhancer sequences, may also function from more distant locations or even from other DNA molecules
• Preference is given to arrangements in which the nucleic acid sequence to be transgenically expressed is positioned behind (ie at the 3 'end) of the expression unit sequence according to the invention, so that both sequences are covalently linked to one another between the expression unit sequence and the nucleic acid sequence to be expressed transgene less than 200 base pairs, more preferably less than 100 base pairs, most preferably less than 50 base pairs.
• expression activity is understood to mean the amount of protein formed by the expression unit over a certain period of time, ie the expression rate.
• the amount of protein formed is thus changed in a specific time compared to the wild type.
• “changed” is preferably increased or decreased.
• the increased expression activity or expression rate can be achieved, for example, by regulating the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity, wherein the genes are heterologous with respect to the expression units.
• the regulation of the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity according to the invention is achieved by
• one or more expression units according to the invention optionally with altered specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes takes place under the control of the introduced expression units according to the invention, optionally with altered specific expression activity, or
• nucleic acid constructs containing an expression unit according to the invention, optionally with altered specific expression activity, and functionally linked one or more nucleic acids to be expressed into the microorganism.
• the expression unit according to the invention contains:
• G a nucleic acid sequence which is linked to the nucleic acid sequence SEQ. ID. NO. 2 hybridized under stringent conditions or
• SEQ. ID. NO. 2 represents the nucleic acid sequence of the expression unit of the elongation factor TS (PEF-TS) from Corynebacterium glutamicum.
• SEQ. ID.NO. 2 corresponds to the sequence of the expression unit of the wild-type.
• the invention furthermore relates to expression units comprising a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at the nucleic acid level with the sequence SEQ. ID. NO. 2 has.
• a nucleic acid sequence which has an identity of at least 90% with the sequence SEQ ID NO: 2 is accordingly understood to be a nucleic acid sequence which, in a comparison of its sequence with the sequence SEQ ID NO: 2, in particular above program logarithm with the above parameter set has an identity of at least 90%.
• Particularly preferred expression units have with the nucleic acid sequence SEQ. ID. NO. 2 has an identity of 91%, more preferably 92%, 93%, 94%, 95%, 96%, 97%, 98%, most preferably 99%.
• expression units can furthermore easily be found starting from the above-described nucleic acid sequences, in particular starting from the sequence SEQ ID NO: 2 from various organisms whose genomic sequence is unknown, by hybridization techniques in a manner known per se.
• a further subject of the invention therefore relates to expression units comprising a nucleic acid sequence which is linked to the nucleic acid sequence SEQ. ID. No. 2 hybridized under stringent conditions.
• This nucleic acid sequence comprises at least 10, more preferably more than 12, 15, 30, 50 or particularly preferably more than 150 nucleotides.
• hybridizing is meant the ability of a poly or oligonucleotide to bind under stringent conditions to a nearly complementary sequence, while under these conditions nonspecific binding between non-complementary partners is avoided.
• sequences should preferably be 90-100%, complementary.
• the property of complementary sequences to be able to specifically bind to one another for example, in the Northern or Southern Blot technique or in the primer binding in PCR or RT-PCR advantage.
• hybridization is carried out according to the invention under stringent conditions.
• stringent conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd Edition, ColD Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6:
• the nucleotide sequences according to the invention also allow the generation of probes and primers which are useful for the identification and / or cloning of homologous sequences in other cell types and microorganisms.
• probes or primers usually comprise a nucleotide sequence region which hybridizes under stringent conditions to at least about 12, preferably at least about 25, such as about 40, 50 or 75 consecutive nucleotides of a sense strand of a nucleic acid sequence according to the invention or of a corresponding antisense strand ,
• nucleic acid sequences which comprise so-called silent mutations or are altered according to the codon usage of a specific source or host organism, in comparison with a specifically mentioned sequence, as well as naturally occurring variants, such as e.g. Splice variants or allelic variants, of which
• a “functionally equivalent fragment” is meant for expression units, fragments having substantially the same or a higher specific expression activity as the starting sequence.
• substantially the same is meant a specific expression activity which has at least 50%, preferably 60%, more preferably 70%, more preferably 80%, more preferably 90%, most preferably 95% of the specific expression activity of the starting sequence.
• “Fragments” are to be understood as meaning partial sequences of the expression units described by embodiment E), F) or G.
• these fragments Preferably, these fragments have more than 10, more preferably more than 12, 15, 30, 50 or, even more preferably, more than 150 contiguous nucleotides of the nucleic acid sequence SEQ ID NO: 1.
• nucleic acid sequence SEQ. ID. NO. 2 as expression unit, i. for the expression of genes.
• the invention further relates to the new expression units according to the invention.
• the invention relates to an expression unit comprising a nucleic acid according to the invention with promoter activity additionally functionally linked to a nucleic acid sequence which ensures the translation of ribonucleic acids.
• the invention particularly preferably relates to an expression unit containing
• nucleic acid sequence SEQ. ID. NO. 2 or F a sequence derived from this sequence by substitution, insertion or deletion of nucleotides which has an identity of at least 90% at nucleic acid level with the sequence SEQ. ID. NO. 2 or
• G a nucleic acid sequence which is linked to the nucleic acid sequence SEQ. ID. NO. 2 hybridized under stringent conditions or
• nucleic acid having the sequence SEQ. ID. NO. 2 is excluded.
• the expression units according to the invention comprise one or more of the following genetic elements: a minus 10 ("-10") sequence; a minus 35 (“-35”) sequence; a transcription start, an enhancer region; and an operator region.
• these genetic elements are specific for the species Corynebacteria, especially for Corynebacterium glutamicum.
• All of the abovementioned expression units can furthermore be prepared in a manner known per se by chemical synthesis from the nucleotide units, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
• the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner by the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, p. 896-897).
• the addition of synthetic oligonucleotides and filling in of gaps using the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Col. Spring Harbor Laboratory Press.
• nucleic acid molecules of the present invention are preferably in the form of an isolated nucleic acid molecule.
• An "isolated" nucleic acid molecule is separated from other nucleic acid molecules present in the natural source of the nucleic acid and, moreover, may be substantially free of other cellular material or culture medium when produced by recombinant techniques or free of chemical precursors or other chemicals when chemically synthesized.
• the invention further comprises the nucleic acid molecules complementary to the specifically described nucleotide sequences or a portion thereof.
• the promoters and / or expression units according to the invention can be used, for example, with particular advantage in improved processes for the fermentative preparation of biosynthetic products as described below.
• the promoters and / or expression units according to the invention have the particular advantage that they are induced in microorganisms by stress.
• this stress induction can be controlled for an increase in the rate of inflammation / expression of desired genes.
• this stress phase is reached very early, so that here very early an increased transcription / expression rate of desired genes can be achieved.
• nucleic acids with promoter activity according to the invention can be used for modification, ie for increasing or reducing, or for causing the transcription rate of genes in microorganisms in comparison to the wild type.
• the expression units according to the invention can be used for altering, that is to say for increasing or reducing, or for causing the expression rate of genes in microorganisms in comparison to the wild type.
• nucleic acids according to the invention with promoter activity and the expression units according to the invention can be used to regulate and enhance the biologic fertil of various biosynthetic products, such as Feinchemika ⁇ lien, proteins, in particular amino acids, serve in microorganisms, in particular in Corynebacterium species.
• the invention therefore relates to a method for altering or causing the transcription rate of genes in microorganisms in comparison to the wild type
• the change or causation of the transcription rate of genes in microorganisms in comparison to the wild type can be achieved by modifying, ie increasing or decreasing, the specific promoter activity in the microorganism. This can be done, for example, by targeted mutation of the nucleic acid sequence according to the invention with promoter activity, that is to say by targeted substitution, de-insertion or insertion of nucleotides. Increased or decreased promoter activity can be achieved by exchanging the nucleotides in the binding site of the RNA polymerase holoenzyme binding sites (also known to the person skilled in the art as the -10 region and the region known).
• binding sites also known to the person skilled in the art as regulators
• regulatory proteins also known to the person skilled in the art as repressors and activators
• the nucleic acid sequence SEQ. ID. NO. 21 preferably represents the ribosomal binding site of the expression units according to the invention, the sequences SEQ. ID. NOs. 19 or 20 represent the -10 region of the expression units according to the invention. Changes in the nucleic acid sequence in these regions lead to a change in the specific expression activity.
• the invention therefore relates to the use of the nucleic acid sequence SEQ. ID. NO. 21 as a ribosomal binding site in expression units which enable the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.
• the invention relates to the use of the nucleic acid sequences SEQ. ID. NOs. 19 or 20 as -10-region in expression units which allow the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium.
• the invention relates to an expression unit which enables the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, comprising the nucleic acid sequence SEQ. ID. NO. 21.
• the nucleic acid sequence SEQ. ID. NO. 21 used as a ribosomal binding site.
• the invention relates to an expression unit which allows the expression of genes in bacteria of the genus Corynebacterium or Brevibacterium, containing at least one of the nucleic acid sequences SEQ. ID. NOs. 19 or 20.
• one of the nucleic acid sequences SEQ. ID. NOs. 19 or 20 is used as the -10 region.
• increasing or reducing in comparison with the wild type means an increase or reduction of the specific activity with respect to the nucleic acid according to the invention having promoter activity of the wild-type, that is to say, for example, with reference to SEQ ID NO.
• the transcription rate of genes in microorganisms can be changed or caused in comparison to the wild type by transcribing genes in the microorganism by nucleic acids according to the invention having promoter activity or by nucleic acids having modified specific promoter activity according to embodiment a). wherein the genes are heterologous with respect to the nucleic acids having promoter activity.
• one or more nucleic acids according to the invention having promoter activity, optionally with altered specific promoter activity are introduced into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity, optionally with altered specific promoter activity , or
• embodiment b2) introduces one or more endogenous genes into the genome of the microorganism such that the transcription of one or more of the introduced endogenous genes takes place under the control of the endogenous nucleic acids according to the invention having promoter activity, optionally with altered specific promoter activity or
• nucleic acid constructs comprising a nucleic acid according to the invention with promoter activity, optionally with altered specific promoter activity, and functionally linked one or more endogenous nucleic acids to be transcribed, into which microorganism introduces.
• embodiment b2) introduces one or more exogenous genes into the genome of the microorganism such that the transcription of one or more of the introduced exogenous genes under the control of the endogenous nucleic acids according to the invention having promoter activity, optionally with modified specific pro motor activity, or occurs
• nucleic acid constructs comprising a nucleic acid according to the invention with promoter activity, optionally with altered specific promoter activity, and functionally linked one or more exogenous nucleic acids to be transcribed, into which microorganism introduces.
• the insertion of genes according to embodiment b2) can be carried out so that the gene is integrated into coding regions or non-coding regions. Preferably, the insertion takes place in non-coding regions.
• the insertion of nucleic acid constructs according to embodiment b3) can be carried out chromosomally or extrachromosomally.
• the insertion of the nucleic acid constructs is chromosomal.
• a "chromosomal" integration is the insertion of an exogenous DNA fragment into the chromosome of a host cell, which is also used for homologous recombination between an exogenous DNA fragment and the corresponding region on the chromosome of the host cell.
• nucleic acids according to the invention with modified specific promoter activity according to embodiment a). These can be present in the microorganism in Example b), as described in embodiment a), and can be prepared or introduced into the microorganism in isolated form.
• endogenous is meant genetic information, such as genes, that are already contained in the wild-type genome.
• exogenous are meant genetic information, such as genes, which are not contained in the wild-type genome.
• genes with regard to regulation of transcription by the nucleic acids having promoter activity according to the invention are preferably understood to be nucleic acids which have a region to be transcribed, for example a region which regulates translation, a coding region and optionallylasting Regulation.s institute, such as a terminator included.
• genes with respect to the expression regulation described below by the expression units according to the invention are preferably understood as meaning nucleic acids which contain a coding region and optionally further regulatory elements, such as, for example, a terminator.
• a coding region is meant a nucleic acid sequence encoding a protein.
• heterologous with reference to nucleic acids with promoter activity and genes is understood that the genes used in the wild type are not transcribed under regulation of the nucleic acids according to the invention with promoter activity, but that a new functional link not occurring in the wild type is produced and the functional combination of inventive nucleic acid with promoter activity and specific gene does not occur in the wild type.
• heterologous in terms of expression units and genes is meant that the genes used are not expressed in the wild-type under regulation of the expression units according to the invention, but that a new, not occurring in the wild type functional linkage is formed and the functional combination of inventive Expression unit and specific gene does not occur in the wild type.
• the regulation of the transcription of genes in the microorganism is achieved by nucleic acids according to the invention with promoter activity or by nucleic acids according to the invention with increased specific promoter activity according to embodiment (ah) in that
• bh1 introduces one or more nucleic acids according to the invention with promoter activity, optionally with increased specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced invention Nucleic acid with promoter activity, optionally with increased specific promoter activity, takes place or
• bh2 introduces one or more genes into the genome of the microorganism such that the transcription of one or more of the genes introduced takes place under the control of the endogenous nucleic acids according to the invention with promoter activity, optionally with increased specific promoter activity, or
• the invention further relates, in a preferred embodiment, to a method for reducing the transcription rate of genes in microorganisms in comparison to the wild type, by
• nucleic acids with reduced specific promoter activity according to embodiment a) into the genome of the microorganism, so that the transcription of endogenous genes takes place under the control of the incorporated nucleic acid with reduced promoter activity.
• the invention further relates to a method for altering or causing the expression rate of a gene in microorganisms compared to the wild type
• the change or causation of the expression rate of genes in microorganisms can take place in comparison to the wild type, that in the microorganism, the specific expression activity is changed, that is increased or decreased.
• This can be done, for example, by targeted mutation of the nucleic acid sequence according to the invention with promoter activity, ie by targeted substitution, deletion or insertion of nucleotides.
• the extension of the distance between the Shine-Dalgamo sequence and the translational start codon usually leads to a change, a reduction or else an increase in the specific expression activity.
• a change in the specific expression activity can also be achieved by shortening or lengthening the sequence of the Shine-Dalgamo region (ribosomal binding site) in its distance from the translational start codon by deletions or insertions of nucleotides. But also by the fact that the sequence of the Shine-Dalgamo region is changed so that the homology to complementary 3 'Page 16S rRNA either increased or decreased.
• the change or causation of the expression rate of genes in microorganisms in comparison to the wild type can be effected by regulating the expression of genes in the microorganism by expression units according to the invention or by expression units according to the invention with altered specific expression activity according to embodiment c) wherein the genes are heterologous with respect to the expression units.
• nucleic acid constructs containing an expression unit according to the invention, optionally with modified specific expression activity, and functionally linked to one or more nucleic acids to be expressed, into which microorganisms are introduced.
• one or more expression units according to the invention are introduced into the genome of the microorganism such that expression of one or more endogenous genes takes place under the control of the introduced expression units or
• embodiment d2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with altered specific expression activity, or
• nucleic acid constructs containing an expression unit according to the invention, optionally with modified specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.
• microorganism so that the expression of one or more of the incorporated genes takes place under the control of the endogenous expression units according to the invention, optionally with altered specific expression activity, or
• nucleic acid constructs comprising an expression unit according to the invention, optionally with altered specific expression activity, and functionally linked one or more exogenous nucleic acids to be expressed, into which microorganism introduces.
• genes according to embodiment d2) can be carried out so that the gene is integrated into coding regions or non-coding regions. Vor ⁇ preferably the insertion into non-coding regions. 6
• the insertion of nucleic acid constructs according to embodiment d3) can be effected chromosomally or extrachromosomally.
• the insertion of the nucleic acid constructs is chromosomal.
• nucleic acid constructs are also referred to below as expression cassettes.
• embodiment d) it is also preferred to use expression units according to the invention with modified specific expression activity according to embodiment c). These can be present in the microorganism and prepared in embodiment d), as described in embodiment d), or introduced into the microorganism in isolated form.
• the regulation of the expression of genes in the microorganism by expression units according to the invention or by expression units with increased specific expression activity according to embodiment c) is achieved by
• dh1 introduces one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism such that the expression of one or more endogenous genes takes place under the control of the introduced expression units, if appropriate with increased specific expression activity, or
• dh2 introduces one or more genes into the genome of the microorganism, so that the expression of one or more of the genes introduced under the control of the endogenous expression units according to the invention, given if increased specific expression activity, or
• nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganism introduces.
• the invention further relates to a method for reducing the expression rate of genes in microorganisms compared to the wild type by
• dr introduces expression units with reduced specific expression activity according to embodiment (s) into the genome of the microorganism, so that expression of endogenous genes takes place under the control of the introduced expression units with reduced expression activity.
• the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of Feinchemi ⁇ kalien, wherein the genes optionally further regulatory elements can contain.
• the genes are selected from the group nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, encoding nucleic acids a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, encoding nucleic acids Protein from the biosynthetic pathway of carbohydrate hydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, encoding nucleic acids a protein from the biosynthetic pathway of vitamins, encoding nucleic acids a protein from the biosynthetic pathway of vitamins, encoding nucle
• the proteins from the biosynthesis path of amino acids are selected from the group aspartate kinase, aspartate semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate Dehydrogenase, 3-phosphoglycerate kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate-quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease , Transketolase, transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystah
• Preferred proteins and nucleic acids encoding these proteins of the above-described proteins from the biosynthetic pathway of amino acids are protein sequences or nucleic acid sequences of microbial origin, preferably from bacteria of the genus Corynebacterium or Brevibacterium, preferably from coryneform bacteria, particularly preferably from Corynebacterium glutamicum.
• Another example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of the fructose-1,6-bisphosphatase 2, or also called fbr2, (SEQ ID NO. 23) and the corresponding nucleic acid sequence encoding a fructose-1, 6-bisphosphatase 2 (SEQ ID NO: 22).
• Another example of a particularly preferred protein sequence and the corresponding nucleic acid sequence encoding this protein from the biosynthetic pathway of amino acids is the sequence of the protein in sulfate reduction, or else called RXA077, (SEQ ID NO: 3) and the corresponding Nucleic acid sequence encoding a protein in sulfate reduction (SEQ ID NO: 4)
• proteins from the biosynthesis pathway of amino acids each have the amino acid sequence given in Table 1 for this protein, the respective protein in each case at least one of the amino acid positions indicated in Table 2 / column 2 for this amino acid sequence another proteinogenic amino acid than the respective amino acid indicated in Table 2 / Column 3 in the same line.
• the proteins have the amino acid indicated in Table 2 / Column 4 in the same row on at least one of the amino acid positions indicated in Table 2 / Column 2 for the amino acid sequence.
• the proteins indicated in Table 2 are mutated proteins of the biosynthetic pathway of amino acids which have particularly advantageous properties and are therefore particularly suitable for expression. sion of the corresponding nucleic acids by the promoter according to the invention and for the production of amino acids. For example, the T3111 mutation results in switching off the feedback inhibition from ask.
• nucleic acids which encode a mutated protein from Table 2 described above can be prepared by conventional methods.
• the starting point for the preparation of the nucleic acid sequences encoding a mutated protein is, for example, the genome of a Corynebacterium glutamicum strain which is obtainable from the American Type Culture Collection under the name ATCC 13032 or the nucleic acid sequences referred to in Table 1.
• a Corynebacterium glutamicum strain which is obtainable from the American Type Culture Collection under the name ATCC 13032 or the nucleic acid sequences referred to in Table 1.
• Corynebacterium glutamicum it is preferable for Corynebacterium glutamicum to use the codon usage of Corynebacterium glutamicum.
• the codon usage of the particular organism can be determined in a manner known per se from databases or patent applications which describe at least one protein and a gene which codes for this protein from the desired organism.
• mutated protein with a specific function (column 5) and a specific starting amino acid sequence (table 1)
• at least one mutation is described in columns 2, 3 and 4, and several mutations are also described for some sequences. These multiple mutations always refer to the above-mentioned, closest starting amino acid sequence (Table 1).
• the term "at least one of the amino acid positions" of a particular amino acid sequence is preferably understood to mean at least one of the mutations described for this amino acid sequence in columns 2, 3 and 4.
• the SacB method is known to the person skilled in the art and is described, for example, in Schwarz A, Tauch A, Jäger W, Kalinowski J, Thierbach G, Pühler A .; Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of deficient deletions in the chromosomes of Corynebacterium glutamicum, Gene. 1994 JuI 22; 145 (1): 69-73 and Blomfield IC, Vaughn V, remainder RF 1 Eisenstein Bl .; Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC-101 replicon; Mol Microbiol. 1991 Jun; 5 (6): 1447-57.
• the change or causation of the transcription rate and / or expression rate of genes in microorganisms is effected by introducing nucleic acids according to the invention having promoter activity or inventive expression units into the microorganism.
• the change or causation of the transcription rate and / or expression rate of genes in microorganisms takes place by introduction of the above-described nucleic acid constructs or expression cassettes into the microorganism.
• the invention therefore further relates to an expression cassette comprising
• At least one further nucleic acid sequence to be expressed ie a gene to be expressed
• genetic control elements such as a terminator
• the nucleic acid sequence to be expressed is at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.
• the nucleic acid sequence to be expressed is particularly preferably selected from the group of nucleic acids encoding a protein from the biosynthesis pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthetic pathway of nucleotides and nucleosides, nucleic acids encoding a protein from the biosynthetic pathway of organic acids , Nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthetic pathway of carbohydrates, nucleic acids encoding a protein from the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the biosynthetic pathway
• Preferred proteins from the biosynthetic pathway of amino acids are described above and their examples in Tables 1 and 2.
• the physical position of the expression unit relative to the gene to be expressed is selected so that the expression unit regulates the transcription and preferably also the translation of the gene to be expressed and thus enables the formation of one or more proteins.
• the "enabling education” involves constitutively increasing the formation, weakening or blocking the formation under specific conditions and / or increasing the formation under specific conditions.
• the “conditions” include: (1) adding a component to the culture medium, (2) removing one (1) adding a component to the culture medium, (2) removing a component from the culture medium, (3) replacing a component in the culture medium with a second component, (4) increasing the temperature of the culture medium, (5) lowering the temperature of the culture medium Culture medium, and (6) regulation of atmospheric conditions, such as oxygen or nitrogen concentration, in which the culture medium is maintained.
• the invention furthermore relates to an expression vector comprising an above-described expression cassette according to the invention.
• Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985). Vectors other than plasmids are also to be understood as meaning all other vectors known to the person skilled in the art, such as, for example, phages, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be autonomously replicated in the host organism or replicated chromosomally.
• Plasmid ⁇ vectors such as. B.
• pCLiK5MCS or those based on pCG4 (US-A 4,489,160) or pNG2 (Serwold-Davis et al., FEMS Microbiology Letters 66, 119-124 (1990)) or pAG1 (US-A 5,158,891), can be in be used in the same way.
• those plasmid vectors by means of which one can apply the method of gene amplification by integration into the chromosome, as described for example by Remscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)) for the duplication or amplification of the hom-thrB operon.
• the complete gene is cloned into a plasmid vector that can replicate in a host (typically E. coli) but not in C. glutamicum.
• vectors which are used are pSUP301 (Simon et al., Bio / Technology 1, 784-791 (1983)), pK18mob or pK19mob (Schäfer et al., Gene 145, 69-73 (1994)), Berard et al. , Journal of Molecular Biology, 234: 534-541 (1993)), pEM1 (Schrumpf et al., 1991, Journal of Bacteriology 173: 4510-4516) or pBGS8 (Spratt et al., 1986, Gene 41: 337-342) Question.
• the plasmid vector containing the gene to be amplified is then transformed into the desired strain of C. glutamicum by transformation.
• the invention further relates to a genetically modified microorganism, wherein the genetic modification leads to a change or causation of the transcription rate of at least one gene in comparison to the wild type and is conditioned by
• nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with altered specific promoter activity according to embodiment a) is achieved by
• b1) introduces one or more nucleic acids with promoter activity according to claim 1, optionally with modified specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under the control of the introduced nucleic acid with promoter activity according to An ⁇ Speech 1, optionally with altered specific promoter activity, takes place or
• the invention further relates to a genetically modified microorganism having an increased or caused transcription rate of at least one gene in comparison to the wild type, wherein
• Promoter activity according to embodiment ah), wherein the genes are heterologous with respect to the nucleic acids having promoter activity.
• nucleic acids with promoter activity according to claim 1 or by nucleic acids with promoter activity according to claim 1 with altered specific promoter activity according to embodiment a) is achieved by
• bh1 introduces one or more nucleic acids with promoter activity according to claim 1, where appropriate with increased specific promoter activity, into the genome of the microorganism such that the transcription of one or more endogenous genes under control of the introduced nucleic acid with promoter activity, optionally with increased specific promoter activity, or
• bh2 introduces one or more genes into the genome of the microorganism such that the transcription of one or more of the introduced genes takes place under the control of the endogenous nucleic acids with promoter activity according to claim 1, optionally with increased specific promoter activity, or
• the invention further relates to a genetically modified microorganism having a reduced transcription rate of at least one gene in comparison to the wild type, wherein
• nucleic acids with reduced promoter activity according to embodiment a) have been introduced into the genome of the microorganism, so that the
• the invention further relates to a genetically modified microorganism, wherein the genetic modification leads to a change or causation of the Expressionsra ⁇ te of at least one gene in comparison to the wild type and is caused by
• d1) introduces one or more expression units according to claim 2 or 3, optionally with altered specific expression activity, into the genome of the microorganism such that the expression of one or more endogenous genes under the control of the introduced expression units according to claim 2 or 3, optionally with altered specific expression activity, or
• d2) introduces one or more genes into the genome of the microorganism such that the expression of one or more of the genes introduced takes place under the control of the endogenous expressing units according to claim 2 or 3, optionally with altered specific expression activity, or
• the invention further relates to a genetically modified microorganism having an increased or caused expression rate of at least one gene in comparison to the wild type, wherein
• dh1 introduces one or more expression units according to claim 2 or 3, optionally with increased specific expression activity, into the genome of the microorganism, so that the expression of one or more endogenous genes under the control of the introduced expression units according to claim 2 or 3, if appropriate with increased specific expression activity, takes place or
• dh2 introduces one or more genes into the genome of the microorganism such that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to claim 2 or 3, optionally with increased specific expression activity, or
• nucleic acid constructs containing an expression unit according to claim 2 or 3, optionally with increased specific expression activity, and functionally linked to one or more nucleic acids to be expressed, into which microorganism introduces.
• the invention further relates to a genetically modified microorganism having a reduced expression rate of at least one gene in comparison to the wild type, wherein it) the specific expression activity in the microorganism of at least one endogenous expression unit according to claim 2 or 3, which regulates the expression of at least one edogenic gene, is reduced in comparison with the wild-type or
• one or more expression units according to claim 2 or 3 were introduced with reduced expression activity in the genome of the microorganism, so that the expression of at least one gene under the control of the introduced expression unit according to claim 2 or 3 takes place with reduced expression activity.
• the invention relates to a genetically modified microorganism containing an expression unit according to claim 2 or 3 and functionally linked to a gene to be expressed, wherein the gene is heterologous with respect to the expression unit.
• This genetically modified microorganism particularly preferably contains an expression cassette according to the invention.
• the present invention particularly preferably relates to genetically modified microorganisms, in particular coryneform bacteria, which contain a vector, in particular
• Shuttle vector or plasmid vector carrying at least one recombinant nucleic acid of the invention definition carrying at least one recombinant nucleic acid of the invention definition.
• the genes described above are at least one nucleic acid encoding a protein from the biosynthetic pathway of fine chemicals.
• the genes described above are selected from the group consisting of nucleic acids encoding a protein from the biosynthetic pathway of proteinogenic and non-proteinogenic amino acids, nucleic acids encoding a protein from the biosynthesis pathway of nucleotides and nucleosides, Nucleic acids encoding a protein from the biosynthetic pathway of organic acids, nucleic acids encoding a protein from the biosynthetic pathway of lipids and fatty acids, nucleic acids encoding a protein from the biosynthetic pathway of diols, nucleic acids encoding a protein from the biosynthesis pathway of carbohydrates, nucleic acids encoding a protein the biosynthetic pathway of aromatic compound, nucleic acids encoding a protein from the biosynthetic pathway of vitamins, nucleic acids encoding a protein from the biosynthetic pathway of cofactors and nucleic acids encoding a protein from the bio
• Preferred proteins from the biosynthetic pathway of amino acids are selected from the group aspartate kinase, aspartate-semialdehyde dehydrogenase, diaminopimelate dehydrogenase, diaminopimelate decarboxylase, dihydrodipicolinate synthetase, dihydrodipicolinate reductase, glyceraldehyde-3-phosphate dehydrogenase, 3-phosphoglycerate Kinase, pyruvate carboxylase, triosephosphate isomerase, transcriptional regulator LuxR, transcriptional regulator LysR1, transcriptional regulator LysR2, malate quinone oxidoreductase, glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrognease, transketolase, transaldolase, homoserine O-acetyltransferase, cystahionine gamma synthase, cystahionine
• Preferred microorganisms or genetically modified microorganisms are bacteria, algae, fungi or yeasts.
• microorganisms are, in particular, coryneform bacteria.
• Preferred coryneform bacteria are bacteria of the genus Corynebacterium, in particular of the species Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium thermoaminogenes, Corynebacterium melassecola and Corynebacterium efficiens or of the genus Brevibacterium, in particular of the species Brevibacterium flavum, Brevibacterium lactofermentum and Brevibacterium divaricatum.
• Particularly preferred bacteria of the genera Corynebacterium and Brevibacterium are selected from the group Corynebacterium glutamicum ATCC 13032, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium thermoaminogenes FERM BP-1539, Corynebacterium melassecola ATCC 17965, Corynebacterium efficiens DSM 44547, Corynebacterium efficiens DSM 44548.
• the abbreviation KFCC means the Korean Federation of Culture Collection
• the abbreviation ATCC means the American strain strain culture collection
• the abbreviation DSM the German Collection of Microorganisms.
• NRRL ARS Culture Collection, Northern Regional Research Laboratory, Peoria, IL
• NCIMB National Collection of Industrial and Marine Bacteria Ltd., Aberdeen, UK
• DSMZ German Collection of Microorganisms and Cell Cultures, Braunschweig,
• inventive nucleic acids with promoter activity and the expression units according to the invention make it possible with the aid of the above-described inventive methods to regulate the metabolic pathways to specific biosynthetic products in the above-described inventive genetically modified microorganisms.
• metabolic pathways which lead to a specific biosynthetic product by causing or increasing the transcription rate or expression rate of genes of this biosynthetic pathway in which the increased protein amount to increased total activity of these proteins of the desired biosynthetic pathway and thus to an increased metabolic flux to the gewün - leads biosynthetic product.
• metabolic pathways which lead away from a specific biosynthetic product can be attenuated by reducing the transcription rate or expression rate of genes of this pathway leading to reduced total protein activity of these proteins of the unwanted biosynthetic pathway and thus in addition to increased metabolic activity selfluß leads to the desired biosynthetic product.
• the genetically modified microorganisms according to the invention are, for example, able to produce biosynthetic products from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol.
• the invention therefore relates to a process for the production of biosynthetic products by culturing genetically modified microorganisms according to the invention.
• the transcription rate or expression rate of different genes must be increased or reduced.
• At least one altered, that is to say increased or reduced, transcription rate or expression rate of a gene can be attributed to a nucleic acid according to the invention having promoter activity or the expression unit according to the invention.
• Transcription rates or expression rates of further genes in the genetically modified microorganism can, but need not, go back to the nucleic acids according to the invention with promoter activity or the expression units according to the invention.
• the invention therefore furthermore relates to a process for the preparation of biosynthetic products by culturing genetically modified microorganisms according to the invention.
• Preferred biosynthetic products are fine chemicals.
• fine chemical is well known in the art and includes compounds produced by an organism and used in various industries, such as, but not limited to, the pharmaceutical, agricultural, cosmetics, food and feed industries. These compounds include organic acids such as tartaric acid, itaconic acid and diaminopimelic acid, both proteinogenic and non-proteinogenic amino acids, purine and pyrimidine bases, nucleosides and nucleotides (as described for example in Kuinaka, A. (1996) Nucleotides and Related Compounds, pp. 561-612, Biotechnology Vol. 6, Rehm et al., ed.
• VCH Weinheim and the citations contained therein
• lipids saturated and unsaturated fatty acids (for example arachidonic acid), diols (for example propane). diol and butanediol), carbohydrates (for example hyaluronic acid and trehalose), aromatic compounds (for example aromatic amines, vanillin and indigo), vitamins and cofactors (as described in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", Pp. 443-613 (1996) VCH: Weinheim and the citations therein; and Ong, AS, Niki, E. and Packer, L.
• amino acids comprise the basic structural units of all proteins and are therefore essential for normal cell function.
• amino acid is known in the art.
• the proteinogenic amino acids of which there are 20 species, serve as structural units for proteins in which they are linked via peptide bonds, whereas the non-proteinogenic amino acids (of which hundreds are known) usually do not occur in proteins (see Ullmann's Encyclopedia of Industrial Chemistry, Vol. A2, pp. 57-97 VCH: Weinheim (1985)).
• the amino acids may be in the D or L configuration, although L-amino acids are usually the only type found in naturally occurring proteins. place. Biosynthesis and degradation pathways of each of the 20 proteinogenic amino acids are well characterized in both prokaryotic and eukaryotic cells (see, for example, Stryer, L.
• the "essential" amino acids histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine
• the "essential" amino acids referred to as having to be taken up with the nutrition due to the complexity of their biosynthesis, are synthesized by simple synthetic routes converted into the remaining 11 "nonessential" amino acids (alanine, arginine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine and tyrosine).
• Higher animals have the ability to synthesize some of these amino acids, however, the essential amino acids must be taken up with food for normal protein synthesis to take place.
• Lysine is an important amino acid not only for human nutrition, but also for monogastric animals such as poultry and pigs.
• Glutamate is most commonly used as a flavor additive (monosodium glutamate, MSG) as well as widely used in the food industry, as are aspartate, phenylalanine, glycine and cysteine.
• Glycine, L-methionine and tryptophan are all used in the pharmaceutical industry.
• Glutamine, valine, leucine, isoleucine, histidine, arginine, proline, serine and alanine are used in the pharmaceutical and cosmetics industries. Threonine, tryptophan and D- / L-methionine are widely used feed additives (Leuchtenberger, W. (1996) Amino acids - technical production and use, pp. 466-502 in Rehm et al., (Ed.) Biotechnology Vol. 6, chapters 14a, VCH: Weinheim).
• amino acids are also useful as precursors for the synthesis of synthetic amino acids and proteins such as N-acetylcysteine, S-carboxymethyl-L-cysteine, (S) -5-hydroxytryptophan and others in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A2, pp. 57-97, VCH, Weinheim, 1985.
• Ketoglutarate an intermediate in the citric acid cycle.
• Glutamine, proline and arginine are each produced sequentially from glutamate.
• the biosynthesis of serine takes place in a three-step process and begins with 3-phosphoglycerate (an intermediate in glycolysis), and after oxidation, transamination and hydrolysis steps yields this amino acid.
• Cysteine and Glycine are each from serine, the former by condensation of homocysteine with serine, and the latter by transfer of the side-chain ⁇ -carbon atom to tetrahydrofolate, in a serine transhydroxymethylase catalyzed reaction.
• Phenylalanine and tyrosine are synthesized from the precursors of the glycolysis and pentose phosphate pathway, erythrose 4-phosphate and phosphoenolpyruvate in a 9-step biosynthetic pathway that differs only in the last two steps after the synthesis of prephenate. Tryptophan is also produced from these two starting molecules, but its synthesis takes place in an 11-step pathway.
• Tyrosine can also be prepared from phenylalanine in a reaction catalyzed by phenylalanine hydroxylase.
• Alanine, valine and leucine are each biosynthesis products from pyruvate, the end product of glycolysis. Aspartate is formed from oxalacetate, an intermediate of the citrate cycle.
• Asparagine, methionine, threonine and lysine are each produced by conversion of aspartate.
• Isoleucine is formed from threonine.
• histidine is formed from 5-phosphoribosyl-1-pyrophosphate, an activated sugar.
• Amino acids whose amount exceeds the protein biosynthetic needs of the cell can not be stored, and are instead degraded to provide intermediates for the cell's major metabolic pathways (for review, see Stryer, L., Biochemistry, 3rd Ed. Chapter 21 "Amino Acid Degradation and the Urea Cycle", S 495-516 (1988)). While the cell is capable of converting unwanted amino acids into useful metabolic intermediates, amino acid production is expensive in terms of energy, precursor molecules and the enzymes necessary for their synthesis.
• Vitamins, cofactors and nutraceuticals comprise another group of molecules. Higher animals have lost the ability to synthesize them and thus need to ingest them, although they are readily synthesized by other organisms, such as bacteria. These molecules are either biologically active molecules per se or precursors of biologically active substances which serve as electron carriers or intermediates in a number of metabolic pathways. In addition to their nutritional value, these compounds also have a significant industrial value as dyes, xidants and catalysts or other processing aids. (For an overview of the structure, activity and industrial applications of these compounds see, for example, Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", Vol. A27, pp. 443-613, VCH: Weinheim, 1996).
• vitamin is known in the art and includes nutrients that are needed by an organism for normal function, but can not be synthesized by that organism itself.
• the group of vitamins may include cofactors and nutraceutical compounds.
• cofactor includes non-proteinaceous compounds that are necessary for the occurrence of normal enzyme activity. These compounds may be organic or inorganic; the cofactor molecules according to the invention are preferably organic.
• nutraceutical includes food additives that are beneficial to the health of plants and animals, especially humans. Examples of such molecules are vitamins, antioxidants and also certain lipids (eg polyunsaturated fatty acids).
• Thiamine (vitamin B 1 ) is produced by chemical coupling of pyrimidine and thiazole
• Riboflavin (vitamin B 2 ) is synthesized from guanosine 5'-triphosphate (GTP) and ribose 5'-phosphate. In turn, riboflavin is used to synthesize flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD).
• the family of compounds collectively referred to as "vitamin B6" eg, pyridoxine, pyridoxamine, pyridoxal-5'-phosphate and the commercially used pyridoxine hydrochloride) are all derivatives of the common structural unit 5-hydroxy-6-methylpyridine.
• Panthothenate (pantothenic acid, R - (+) - N- (2,4-dihydroxy-3,3-dimethyl-1-oxobutyl) - ⁇ -alanine) can be prepared either by chemical synthesis or by fermentation.
• the last steps in pantothenate biosynthesis consist of the ATP-driven condensation of ⁇ -alanine and pantoic acid.
• the enzymes responsible for the biosynthesis steps for the conversion into pantoic acid, into ⁇ -alanine and for the condensation in pantothenic acid are known.
• the metabolically active form of pantothenate is coenzyme A, whose biosynthesis proceeds through 5 enzymatic steps.
• Pantothenate, pyridoxal-5'-phosphate, cysteine and ATP are the precursors of coenzyme A. These enzymes not only catalyze the formation of pantothenate, but also also the production of (R) -pantoic acid, (R) -pantolactone, (R) -panthenol (provitamin B 5 ), pantethein (and its derivatives) and coenzyme A.
• the biosynthesis of biotin from the precursor molecule pimeloyl-CoA in microorganisms has been extensively studied, and several of the genes involved have been identified. It has been found that many of the corresponding proteins are involved in Fe cluster synthesis and belong to the class of nifS proteins.
• the lipoic acid is derived from octanoic acid and serves as a coenzyme in energy metabolism, where it becomes part of the pyruvate dehydrogenase complex and of the ⁇ -ketoglutarate dehydrogenase complex.
• the folates are a group of substances which are all derived from folic acid, which in turn is derived from L-glutamic acid, p-aminobenzoic acid and 6-methylpterin.
• guanosine 5'-triphosphate GTP
• L-glutamic acid L-glutamic acid
• p-aminobenzoic acid The biosynthesis of folic acid and its derivatives, starting from the metabolic intermediates guanosine 5'-triphosphate (GTP), L-glutamic acid and p-aminobenzoic acid, has been extensively studied in certain microorganisms.
• Corrinoids such as the Cobalamine and especially Vitamin Bi 2
• the porphyrins belong to a group of chemicals that are characterized by a tetrapyrrole ring system.
• the biosynthesis of vitamin B 12 is sufficiently complex that it has not yet been fully characterized, however, a large part of the participating enzymes and substrates is now known.
• Nicotinic acid (nicotinate) and nicotinamide are pyridine derivatives, also referred to as "niacin”.
• Niacin is the precursor of the important coenzymes NAD (Ntkotinamidadenine dinucleotide) and NADP (Nicotinamide Nadeinucleotide Phosphate) and their reduced forms.
• purine and pyrimidine metabolism and their corresponding proteins are important targets for the treatment of tumors and viral infections.
• purine or pyrimidine includes nitrogen-containing bases which are part of the nucleic acids, coenzymes and nucleotides.
• nucleotide includes the basic structural units of the nucleic acid molecules which comprise a nitrogen-containing base, a pentose sugar (in the case of RNA, the sugar is ribose, in the case of DNA the sugar D is Deoxyribose) and phosphoric acid.
• nucleoside includes molecules which serve as precursors of nucleotides, but unlike the nucleotides have no phosphoric acid moiety.
• nucleotides that do not form nucleic acid molecules but serve as energy stores (i.e., AMPs) or coenzymes (i.e., FAD and NAD).
• the purine and pyrimidine bases, nucleosides and nucleotides also have other possibilities of use: as intermediates in the biosynthesis of various fine chemicals (eg thiamine, S-adenosylmethionine, folates or riboflavin), as energy carrier for the cell (for example ATP or GTP) and chemicals themselves are commonly used as flavor enhancers (eg, IMP or GMP) or for many medical applications (see, for example, Kuninaka, A. (1996) Nucleotides and Related Compounds in Biotechnology Vol. Weinheim, pages 561-612).
• Enzymes involved in purine, pyrimidine, nucleoside or nucleotide metabolism are also increasingly serving as targets against which chemicals are used plant protection, including fungicides, herbicides and insecticides.
• the purine nucleotides are made via a series of steps via the intermediate lnosine 5'-phosphate (IMP) from ribose-5-phosphate, resulting in the production of guanosine 5'-monophosphate (GMP) or adenosine 5'-monophosphate (AMP), from which the triphosphate forms used as nucleotides can be easily prepared. These compounds are also used as energy stores, so that their degradation provides energy for many different biochemical processes in the cell.
• IMP intermediate lnosine 5'-phosphate
• AMP adenosine 5'-monophosphate
• These compounds are also used as energy stores, so that their degradation provides energy for many different biochemical processes in the cell.
• the Pyrimidinbiosynthe- se via the formation of uridine 5'-monophosphate (UMP) from ribose-5-phosphate.
• UMP is converted to cytidine 5'-triphosphate (CTP).
• the deoxy forms of all nucleotides are prepared in a one-step reduction reaction from the diphosphate ribose form of the nucleotide to the diphosphate-deoxyribose form of the nucleotide. After phosphorylation, these molecules can participate in DNA synthesis.
• Trehalose consists of two molecules of glucose linked together by ⁇ , ⁇ -1, 1 bonding. It is commonly used in the food industry as a sweetener, as an additive for dried or frozen foods, and in beverages. However, it is also used in the pharmaceutical, cosmetics and biotechnology industries (see, for example, Nishimoto et al., (1998) US Patent No. 5,759,610; Singer, MA and Lindquist, S. Trends Biotech 16 (1998) 460-467; Paiva, CLA and Panek, AD Biotech Ann. Rev. 2 (1996) 293-314; and Shiosaka, MJ Japan 172 (1997) 97-102). Trehalose is produced by enzymes from many microorganisms and naturally released into the surrounding medium from which it can be recovered by methods known in the art.
• biosynthetic products are selected from the group of organic acids, proteins, nucleotides and nucleosides, both proteinogenic and non-proteinogenic amino acids, lipids and fatty acids, diols, carbohydrates, aromati cal compounds, vitamins and cofactors, enzymes and proteins.
• Preferred organic acids are tartaric acid, itaconic acid and diaminopimelic acid
• nucleosides and nucleotides are described, for example, in Kuninaka, A. (1996) Nucleotides and Related Compounds, pp. 561-612, Biotechnology Vol. 6, Rehm et al., Ed. VCH: Weinheim and the citations contained therein.
• Preferred biosynthetic products are also lipids, saturated and unsaturated fatty acids, such as, for example, arachidonic acid, diols, for example propanediol and butanediol, carbohydrates, for example hyaluronic acid and trehalose, aromatic compounds, for example aromatic amines, vanillin and indigo, Vitamins and cofactors as described, for example, in Ullmann's Encyclopedia of Industrial Chemistry, Vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim and the citations contained therein; and Ong, AS, Niki, E. and Packer, L.
• saturated and unsaturated fatty acids such as, for example, arachidonic acid, diols, for example propanediol and butanediol
• carbohydrates for example hyaluronic acid and trehalose
• aromatic compounds for example aromatic amines, vanillin and indigo
• Vitamins and cofactors as described, for
• biosynthetic products are amino acids, more preferably essential amino acids, in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid , L-serine, L-proline, L-valine, L-isoleucine, L-cysteine, L-tyrosine, L-histidine, L-arginine, L-asparagine, L-aspartic acid and L-threonine, L-homoserine, in particular L-lysine, L-methionine and L-threonine.
• essential amino acids in particular L-glycine, L-alanine, L-leucine, L-methionine, L-phenylalanine, L-tryptophan, L-lysine, L-glutamine, L-glutamic acid , L-serine,
• both the L and the D form of the amino acid preferably the L-form, that is, for example, L-lysine, L-methionine and L-threonine stood.
• the invention relates in particular to a process for the preparation of lysine by cultivating genetically modified microorganisms with an increased or caused expression rate of at least one gene in comparison to the wild type, wherein
• the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment (ch), whereby the genes are heterologous with respect to the expression units,
• genes are selected from the group consisting of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a diaminopimelate dehydrogenase, nucleic acids encoding a diaminopimelate decarboxylase, nucleic acids encoding a dihydrodipicolinate synthetase, encoding nucleic acids a dihydridipicolinate reductase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvic acid vat carboxylase, nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a transcriptional regulator LuxR, nucleic acids encoding a transcriptional regulator Lux
• dh1 brings one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism such that the expression of one or more of these endogenous genes under the control of the introduced expression units according to the invention, if appropriate with increased specific expression activity, done or
• dh2 introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity, or
• nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganisms are introduced.
• a further preferred embodiment of the process for the preparation of lysine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase Activity, diaminopilate dehydrogenase activity, diaminopimelate decarboxylase activity, dihydrodipic colinate synthetase activity, dihydridipicolinate Rductase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, activity of the transcriptional regulator LuxR, activity of the Transcriptional Regulators LysR1, Transcriptional Regulators Activity LysR2, Malate Quinone Oxodoreductase Activity, Glucose-6-phosphate Deydrognease Activity, 6-Phos
• a further particularly preferred embodiment of the process for the preparation of lysine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, O-acetyl homoserine sulfhydrylase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, homoserine kinase activity, homoserine dehydrogenase activity, threonine exporter activity, threonine efflux protein Activity, asparaginase activity, aspartate decarboxylase activity and threonine synthase activity.
• the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acet
• nucleic acid according to the invention having promoter activity and / or an expression unit according to the invention.
• the invention further relates to a process for the production of methionine by cultivating genetically modified microorganisms having an increased or caused expression rate of at least one gene in comparison to the wild type, wherein
• dh1 brings one or more expression units according to the invention, optionally with increased specific expression activity, into the genome of the microorganism so that the expression of one or more of these endogenous genes under the control of the incorporated expression units according to the invention, optionally with increased specific expression activity, done or
• dh2 introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the genes introduced takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity, or ie3) one or more nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked to one or more nucleic acids to be expressed, into which microorganism introduces.
• a further preferred embodiment of the method for producing methionine described above is characterized in that the genetically modified microorganisms in comparison to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase Activity, homoserine dehydrogenase activity, glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxyiase activity, triosephosphate isomerase activity, homosein O-acetyltransferase activity, cystahionine gamma synthase activity , Cystahionin beta-lyase activity, serine hydroxymethyltransferase activity, O-acetyl homoserine sulfhydrylase activity, methylene tetrahydrofolate reductase activity, phosphoserine aminotransferase activity
• Phosphosulfate reductase activity ferredoxin sulfite reductase activity, ferredoxin NADPH reductase activity, ferredoxin activity activity protein of sulfate reduction RXA077, activity of a sulfate-reducing protein RXA248, activity of a protein of sulfate reduction RXA247, activity an RXA655 regulator and activity of an RXN2910 regulator
• a further particularly preferred embodiment of the method for the production of methionine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the homoserine kinase activity, threonine Dehydratase activity, threonine synthase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthase activity, dihydrodipicolinate reductase activity, and diaminopicolinate decarboxylase activity.
• the invention further relates to a process for the production of threonine by cultivating genetically modified microorganisms having an increased or caused expression rate of at least one gene in comparison to the wild type, wherein
• the expression of genes in the microorganism is regulated by expression units according to the invention or by expression units according to the invention with increased specific expression activity according to embodiment (ch), whereby the genes are heterologous with respect to the expression units,
• genes are selected from the group of nucleic acids encoding an aspartate kinase, nucleic acids encoding an aspartate semialdehyde dehydrogenase, nucleic acids encoding a glyceraldehyde-3-phosphate dehydrogenase, nucleic acids encoding a 3-phosphoglycerate kinase, nucleic acids encoding a pyruvate carboxylase , Nucleic acids encoding a triosephosphate isomerase, nucleic acids encoding a homoserine kinase, nucleic acids encoding a threonine synthase, nucleic acids encoding a threonine exporter carrier, nucleic acids encoding a glucose-6-phosphate dehydrogenase, nucleic acids encoding a transaldolase, nucleic acids encoding a transketolase, Nucleic acids encoding a mal
• one or more expression units according to the invention optionally with increased specific expression activity, into the genome of the microorganism ein ⁇ , so that the expression of one or more of these endogenous genes under the control of the introduced expression units according to the invention, given if increased specific expression activity, or
• dh2 introduces one or more of these genes into the genome of the microorganism, so that the expression of one or more of the introduced genes takes place under the control of the endogenous expression units according to the invention, optionally with increased specific expression activity, or
• nucleic acid constructs containing an expression unit according to the invention, optionally with increased specific expression activity, and functionally linked one or more nucleic acids to be expressed, into which microorganisms are introduced.
• a further preferred embodiment of the method for the production of threonine described above is characterized in that the genetically modified microorganisms in addition to the wild type additionally an increased activity, at least one of the activities selected from the group aspartate kinase activity, aspartate semialdehyde dehydrogenase activity , Glyceraldehyde-3-phosphate dehydrogenase activity, 3-phosphoglycerate kinase activity, pyruvate carboxylase activity, triosephosphate isomerase activity, threonine synthase activity, threonine export carrier activity, transaldolase activity, transketolase Activity, glucose-6-phosphate dehydrogenase activity, malate-quinone oxidoreductase activity, homoserine kinase activity, biotin ligase activity, phosphoenolpyruvate carboxylase activity, threonine efflux protein activity, protein OpcA- Activity, 1-phosphofructokina
• a further particularly preferred embodiment of the above-described method for the production of threonine is characterized in that the genetically modified microorganisms in addition to the wild type additionally a reduced activity, at least one of the activities selected from the group threonine dehydratase activity, homoserine O-acetyltransferase activity, serine hydroxymethyltransferase activity, O-acetylhomoserine sulfhydrylase activity, meso-diaminopimelate D-dehydrogenase activity, phosphoenolpyruvate carboxykinase activity, pyruvate oxidase activity, dihydrodipicolinate synthetase activity, dihydrodipolinate reductase Activity, asparaginase activity, aspartate decarboxylase activity, lysine exporter activity, acetolactate synthase activity, ketol-Aid reductoisomerase activity, branched chain aminotransferas
• nucleic acid according to the invention having promoter activity and / or an expression unit according to the invention.
• activity of a protein in enzymes means the enzyme activity of the corresponding protein, in other proteins, for example structure or transport proteins, the physiological activity of the proteins.
• the enzymes are usually able to convert a substrate into a product or to catalyze this conversion step.
• the "activity" of an enzyme is understood to mean the amount of substrate or amount of product converted by the enzyme in a specific time.
• the amount of substrate or the amount of product formed is thus increased by the enzyme compared to the wild type in a certain time.
• this increase in "activity" in all the activities described above and below is at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the "wild-type activity".
• the amount of substrate or the amount of product formed is thus reduced by the enzyme compared to the wild type in a certain time.
• a reduced activity is preferably understood to mean the partial or substantially complete interruption or blocking of the functionality of this enzyme in a microorganism based on different cell biological mechanisms.
• a reduction in activity includes a reduction in the amount of an enzyme to a substantially complete absence of the enzyme (ie lack of detectability of the corresponding activity or lack of immunological Detectability of the enzyme).
• the activity in the microorganism is reduced by at least 5%, more preferably by at least 20%, more preferably by at least 50%, more preferably by 100%, compared to the wild type.
• “reduction” also means the complete absence of the corresponding activity.
• the activity of certain enzymes in genetically modified microorganisms and in the wild type and thus the increase or reduction of the enzyme activity can be determined by known methods, such as enzyme assays.
• a pyruvate carboxylase is understood as meaning a protein which has the enzymatic activity of converting pyruvate into oxaloacetate.
• a pyruvate carboxylase activity is understood as meaning the amount of pyruvate or amount of oxaloacetate converted in a certain time by the protein pyruvate carboxylase.
• the amount of pyruvate reacted or the amount of oxaloacetate formed is thus increased by the protein pyruvate carboxylase compared to the wild type in a specific time.
• this increase in pyruvate carboxylase activity is at least 5%, more preferably at least 20%, more preferably at least 50%, even more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, especially at least 600% of the pyruvate carboxylase. Activity of the wild type.
• a phosphoenolpyruvate carboxykinase activity as the enzyme activity of a phosphoenolpyruvate carboxykinase.
• a phosphoenolpyruvate carboxykinase is meant a protein having the enzymatic activity of converting oxaloacetate to phosphoenolpyruvate.
• phosphoenolpyruvate-carboxykinase activity is understood as meaning the amount of oxaloacetate reacted or the amount of phosphoenolpyruvate formed in a certain time by the protein phosphoenolpyruvate.
• a reduction in phosphoenolpyruvate carboxykinase activity includes a quantitative reduction of a phosphoenolpyruvate carboxykinase to an essentially complete absence of phosphoenolpyruvate carboxykinase (ie, lack of detectability of phosphoenolpyruvate carboxykinase activity or lack of immunological detectability of phosphoenolpyruvate carboxykinase ).
• the phosphoenolpyruvate carboxykinase activity is reduced by at least 5%, more preferably by at least 20%, more preferably by at least 50%, more preferably by 100% as compared to the wild-type.
• “reduction” also means the complete absence of the phosphoenolpyruvate carboxykinase activity.
• the additional increase of activities can take place by different ways, for example by switching off inhibitory regulation mechanisms on expression and protein level or by increasing the gene expression of nucleic acids coding the proteins described above against the wild type.
• the increase in the gene expression of the nucleic acids encoding the above-described proteins relative to the wild-type can also be effected by various means, for example by inducing the gene by activators or as described above by increasing the promoter activity or increasing the expression activity or by introducing one or more gene copies into the microorganism.
• the person skilled in the art can take further different measures individually or in combination.
• the copy number of the respective genes can be increased, or the promoter and regulatory region or ribosome binding site located upstream of the structural gene can be mutated.
• inducible promoters it is additionally possible to increase the expression in the course of fermentative production. Measures to extend the lifetime of the mRNA also improve the expression.
• enzyme activity is also enhanced.
• the genes or gene constructs may either be present in different copy number plasmids or be integrated and amplified in the chromosome. Alternatively, overexpression of the genes in question can be achieved by changing the composition of the medium and culture.
• biosynthetic products in particular L-lysine, L-methionine and L-threonine
• L-lysine in particular L-lysine
• L-methionine in particular L-methionine
• L-threonine in particular L-threonine
• the gene expression of a nucleic acid encoding one of the proteins described above is increased by introducing at least one nucleic acid encoding a corresponding protein into the microorganism.
• Introduction of the nucleic acid can be chromosomally or extrachromosomally, ie by increasing the copy number on the chromosome and / or a copy of the gene on a replicating plasmid in the host microorganism.
• the introduction of the nucleic acid for example in the form of an expression cassette containing the nucleic acid, preferably takes place chromosomally, in particular by the SacB method described above.
• any gene encoding one of the proteins described above can be used for this purpose.
• genomic nucleic acid sequences from eukaryotic sources containing introns in the event that the host microorganism is unable or unable to express the corresponding proteins, preferably already processed nucleic acid sequences, such as the corresponding cDNAs to use.
• the reduction of the above-described activities in microorganisms is carried out by at least one of the following processes:
• Knockout mutants can preferably be obtained by targeted insertion into the desired target gene by homologous recombination or introduction of sequence-specific
• Introducing a promoter with reduced promoter activity or an expression unit with reduced expression activity can also be used to reduce its activity or function.
• the introduction of a dominant-negative variant of a protein or of an expression cassette which ensures its expression can also be advantageous.
• Each of these methods can cause a reduction in the amount of protein, mRNA amount and / or activity of a protein.
• a combined application is also conceivable.
• Other methods are known in the art and may include inhibiting or inhibiting processing of the protein, transport of the protein or its mRNA, inhibition of ribosome attachment, inhibition of RNA splicing, induction of an RNA degrading enzyme and / or inhibition of translation elongation or termination ,
• the step of cultivating the genetically modified microorganisms is preferably followed by isolating biosynthetic products from the microorganisms or from the fermentation broth. These steps may take place simultaneously and / or preferably after the culturing step.
• the genetically modified microorganisms according to the invention can be used continuously or discontinuously in the batch process (batch culturing) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the production of biosynthetic products, in particular L-lysine, L-methionine and L-threonine, to be cultured.
• biosynthetic products in particular L-lysine, L-methionine and L-threonine, to be cultured.
• a summary of known cultivation methods is in the textbook by Chmiel (Bioreatechnik 1. Introduction to the bioprocess engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (bioreactors and peripheral facilities (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)).
• the culture medium to be used must suitably satisfy the requirements of the respective strains. Descriptions of culture media for various-organisms Mik ⁇ contained in the handbook "Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington DC USA 1, 1981).
• These media which can be used according to the invention usually comprise one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements.
• Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Very good sources of carbon are, for example, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugar can also be added to the media via complex compounds such as molasses or other by-products of sugar refining. It may also be advantageous to add mixtures of different carbon sources.
• Other possible sources of carbon are oils and fats such.
• Nitrogen sources are usually organic or inorganic nitrogen compounds or materials containing these compounds.
• Exemplary nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn steep liquor, soybean meal, soy protein, yeast extract, meat extract and others.
• the nitrogen sources can be used singly or as a mixture.
• Inorganic salt compounds which may be included in the media include the chloride, phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron
• sulfur source for the production of fine chemicals in particular of methionine
• inorganic compounds such as, for example, sulfates, sulfites, dithionites, tetrathionates, thiosulfates, sulfides, but also organic sulfur compounds, such as mercaptans and thiols.
• Phosphoric acid potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the phosphorus source.
• Chelating agents can be added to the medium to keep the metal ions in solution.
• Particularly suitable chelating agents include dihydroxyphenols, such as catechol or protocatechuate, or organic acids, such as citric acid.
• the fermentation media used according to the invention usually also contain other growth factors, such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine.
• growth factors and salts are often derived from complex me- serving components such as yeast extract, molasses, corn steep liquor and the like.
• suitable precursors can be added to the culture medium. The exact composition of the media compounds will depend heavily on the particular experiment and will be decided on a case by case basis.
• Growth media can also be obtained from commercial suppliers, such as Standard 1 (Merck) or BHI (Brain heart infusion, DIFCO) and the like.
• All media components are sterilized either by heat (20 min at 1, 5 bar and 121 0 C) or by sterile filtration.
• the components can either be sterilized together or, if necessary, sterilized separately. All media components may be present at the beginning of the culture or added randomly or in batches as desired.
• the temperature of the culture is normally between 15 ° C and 45 ° C, preferably at 25 ° C to 40 0 C and can be kept constant or changed during the experiment.
• the pH of the medium should be in the range of 5 to 8.5, preferably around 7.0.
• the pH for cultivation can be controlled during cultivation by addition of basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid.
• foam anti-foaming agents such as. As fatty acid polyglycol, are used.
• suitable selective substances such as e.g. As antibiotics, are added.
• oxygen or oxygen-containing gas mixtures such. B. ambient air, registered in the culture.
• the temperature of the culture is usually 2O 0 C to 45 ° C.
• the culture is continued until a maximum of the desired product has formed. This goal is usually reached within 10 hours to 160 hours.
• the fermentation broths thus obtained usually have a dry matter content of 7.5 to 25% by weight.
• the fermentation is driven sugar-limited at least at the end, but in particular over at least 30% of the fermentation time. This means that during this time the concentration of utilizable sugar in the fermentation medium is maintained at 0 to 3 g / l, or lowered.
• the isolation of biosynthetic products from the fermentation broth and / or the microorganisms takes place in a manner known per se in accordance with the physicochemical properties of the biosynthetic desired product and the biosynthetic by-products.
• the fermentation broth can then be further processed, for example.
• the biomass may be wholly or partly by Separationsmetho ⁇ the, such. As centrifugation, filtration, decantation or a combination of these methods from the fermentation broth or be completely left in it.
• the fermentation broth with known methods, such as. B. with the aid of a rotary evaporator, thin film evaporator, falling film evaporator, by reverse osmosis, or by nanofiltration, thickened or aufkon ⁇ centered.
• This concentrated fermentation broth can then be worked up by freeze drying, spray drying, spray granulation or by other methods.
• the product-containing broth is subjected to chromatography with a suitable resin, the desired product or impurities being wholly or partially retained on the chromatography resin. If necessary, these chromatographic steps can be repeated using the same or different chromatography resins.
• the person skilled in the art is familiar with the choice of suitable chromatography resins and their most effective use.
• the purified product may be concentrated by filtration or ultrafiltration and stored at a temperature at which the stability of the product is maximized.
• biosynthetic products can be obtained in different forms, for example in the form of their salts or esters.
• the identity and purity of the isolated compound (s) can be determined by techniques of the prior art. These include high performance liquid chromatography (HPLC), spectroscopic methods, staining procedures, thin layer chromatography, NIRS, enzyme assay or microbiological assays. These analytical methods are summarized in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140; Malakhova et al. (1996) Biotekhnologiya 11 27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry (1996) Vol. A27, VCH: Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp.
• ampicillin resistance and origin of replication of the vector pBR322 with the oligonucleotide primers SEQ ID NO 5: and SEQ ID NO 6: were amplified by means of the polymerase chain reaction (PCR).
• SEQ ID NO 6 5'-TCTAGACTCGAGCGGCCGCGCGGCCGGCCTTTAAATTGAAGACGAAAGGGCCTC G-3 '
• the oligonucleotide primer SEQ ID NO 5: contains in 5'-3 'direction the sites for the restriction endonucleases Smal, BamHI, Nhel and Ascl and the oligonucleotide primer SEQ ID NO 6: in 5'-3' direction Interfaces for the restriction endonucleases Xbal, Xhol, Notl and Dral.
• the PCR reaction was carried out by standard method as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo polymerase (Stratagene, La JoIIa, USA).
• the resulting DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• the blunt ends of the DNA fragment were ligated together with the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the Hersteilers and the ligation mixture by standard methods as in Sambrook et al. (Molecular Corning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA).
• Plasmid-carrying cells were achieved by plating on ampicillin (50 ⁇ g / ml) -containing LB agar (Lennox, 1955, Viroiogy, 1: 190).
• the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
• the resulting plasmid is named pCLiKI.
• a kanamycin resistance cassette was amplified using the oligonucleotide primers SEQ ID NO: 7 and SEQ ID NO: 8.
• SEQ ID NO: 7 5'-GAGATCTAGACCCGGGGATCCGCTAGCGGGCTGCTAAAGGAAGCGGA-S '
• the oligonucleotide primer SEQ ID NO: 7 in 5'-3 'direction contains the cut portions for the restriction endonucleases Xbal, Smal, BamHI, NheI and the oligonucleotide primer SEQ ID NO: 8 in 5'-3' direction the Interfaces for the restriction endonucleases Ascl and Nhel.
• the PCR reaction was carried out by standard method as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with Pf uTurbo polymerase (Stratagene, La JoIIa, USA).
• the resulting DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• the DNA fragment was cut with the restriction endonucleases XbaI and AscI (New England Biolabs, Beverly, USA) and then again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to cleaned by the manufacturer.
• the vector pCLJKI was also cut with the restriction endonucleases XbaI and AscI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions.
• the linearized vector (about 2.1 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Rosche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA).
• plasmid-carrying cells were achieved by plating on ampicillin (50 ⁇ g / ml) and kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virolgy, 1: 190).
• the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
• the resulting plasmid is named pCLiK2.
• the vector pCLiK2 was cut with the restriction endonuclease Dral (New England Biolabs, Beverly, USA). After electrophoresis in a 0.8% agarose gel, a ca. 2.3 kb vector fragment was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions. This vector fragment was religated using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture was purified by standard methods as described in Sambrook et al. (Molecular Cloning, A Laboratory Manual, Colard Spring Harbor, supra; 989)), transformed into competent E.
• coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
• the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
• the resulting plasmid is named pCLiK3.
• the replication origin pHM1519 was amplified using the oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10.
• SEQ ID NO: 10 5'-GAGAGGGCGGCCGCTCAAGTCGGTCAAGCCACGC-S '
• the oligonucleotide primers SEQ ID NO: 9 and SEQ ID NO: 10 contain cleavage sites for the restriction endonuclease NotI.
• the PCR reaction was carried out by standard method, such as Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press (1990)) with PfuTurbo polymerase (Stratagene, La JoIIa, USA).
• the resulting 2.7 kb DNA fragment was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• the DNA fragment was cleaved with the restriction endonuclease Notl (New England Bio ⁇ labs, Beverly, USA) and subsequently again with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to cleaned by the manufacturer.
• the vector pCLiK3 was likewise cut with the restriction endonuclease NotI and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions.
• the linearized vector (approximately 2.3 kb) was isolated using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the cut PCR fragment and the ligation mixture by standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, Colard Spring Harbor, described (1989)), in competent E. coli XL-1 Blue (Stratagene, La JoIIa 1
• the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
• the resulting plasmid is named pCLiK ⁇ .
• the two synthetic, largely complementary oligonucleotides SEQ ID NO: 11 and SEQ ID NO: 12 the restriction endonuclease sites Swal, Xhol, Aatl, Apal, Asp718 containing MluI, NdeI, SpeI, EcoRV, SalI, ClaI, BamHI, XbaI and SmaI, by heating together at 95 0 C and cooling slowly to a double-stranded DNA fragment pooled.
• SEQ ID NO: 11 5'-TCGAATTTAAATCTCGAGAGGCCTGACGTCGGGCCCGGTACCACGCGTCATAT
• SEQ ID NO: 12 5'-GATCATTTAAATCCCGGGTCTAGAGGATCCCAATTGTTAATTAACGCAGAAGAG
• the vector pCLiK ⁇ was cut with the restriction endonuclease Xhol and BamHI (New England Biolabs, Beverly, USA) and dephosphorylated with alkaline phosphatase (I (Roche Diagnostics, Mannheim)) according to the manufacturer's instructions. After electrophoresis in a 0.8% agarose gel, the linearized vector (about 5.0 kb) was isolated with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• This vector fragment was ligated with the aid of the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer with the synthetic double-stranded DNA fragment and the ligation onsansatz according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190).
• the plasmid DNA of an individual clone was isolated with the Qiaprep Spin Miniprep Kit (Qiagen, Hilden) according to the manufacturer and checked by restriction digests.
• the resulting plasmid is named pCLiK5MCS.
• Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated by means of ABI Prism 377 (PE Applied Biosystems, Rothstadt).
• the resulting plasmid pCLiK5MCS is listed as SEQ ID NO: 13.
• Chromosomal DNA from C. glutamicum ATCC 13032 was isolated according to Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. With the oligonucleotide primers BK 1849 SEQ ID NO 14 and BK 1862 SEQ ID NO 15 33, the chromosomal DNA as template and Pfu Turbo Polymerase (Strata genes) was using the polymerase chain reaction (PCR) by standard methods, as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Acadic Press, amplified the metA gene encoding homoserine O-acetyltransferase.
• PCR polymerase chain reaction
• BK 1862 SEQ ID NO 15 5'-atgcccaccctcgcgcc -3 '
• the obtained DNA fragment of about 1134 bp size was purified using the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• oligonucleotide primers Haf 26 SEQ ID NO 16 and Haf 27 SEQ ID NO 17, the chromosomal DNA as template and Pfu Turbo Polymerase (Stratagene) were amplified by polymerase chain reaction (PCR) according to standard methods as described in Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press, the expression unit of the gene (SEQ ID 2), which codes for the elongation factor TS, amplified.
• Haf 26 SEQ ID NO 16 5'-gagaggatcccccccacgacaatggaac-3 'and Haf 27 SEQ ID NO 17
• the obtained DNA fragment of about 195 bp size was purified with the GFX TM PCR, DNA and Gel Band Purification Kit (Amersham Pharmacia, Freiburg) according to the manufacturer's instructions.
• the primers Haf 27 and BK 1862 contain an overlapping sequence and are homologous to each other at their 5 'ends.
• PCR products obtained above were used as templates for a further PCR in which the primers BK 1849 (SEQ ID NO 14) and Haf 26 (SEQ ID NO 16) were used.
• the vector fragment was ligated together with the PCR fragment using the Rapid DNA Ligation Kit (Roche Diagnostics, Mannheim) according to the manufacturer's instructions and the ligation mixture according to standard methods as in Sambrook et al. (Molecular Cloning, A Laboratory Manual, ColD Spring Harbor, described (1989)), transformed into competent E. coli XL-1 Blue (Stratagene, La JoIIa, USA). Selection for plasmid-carrying cells was achieved by plating on kanamycin (20 ⁇ g / ml) -containing LB agar (Lennox, 1955, Virology, 1: 190). The preparation of the plasmid DNA was carried out by methods and materials of Fa. Quiagen.
• Sequencing reactions were performed according to Sanger et al. (1977) Proceedings of the National Academy of Sciences USA 74: 5463-5467. The sequencing reactions were separated and evaluated by ABI Prism 377 (PE Applied Biosystems, Wei ⁇ terstadt).
• the resulting plasmid was designated pClik 5a MCS P EF-TS metA (SEQ ID NO: 18).
• the strain Corynebacterium glutamicum ATCC13032 was in each case transformed with the plasmids pClik ⁇ MCS, pClik MCS EF-TS metA according to the method described (Liebl, et al. (1989) FEMS Microbiology Letters 53: 299-303).
• the transformation mixture was plated on CM plates which additionally contained 20 mg / l kanamycin to achieve selection for plasmid-containing cells. Obtained Kan-resistant clones were picked and separated.
• the cells were removed by centrifugation at 4 ° C. and washed twice with cold Tris-HCl buffer (0.1%, pH 8.0) After renewed centrifugation, the cells were poured into cold Tris-HCl buffer (0.1%, pH 8.0) and set an OD 600 of 160.
• 1 ml of this cell suspension was transferred to 2 ml Ribolyser tubes from Hybaid and incubated in a Ribolyser from Hybaid at a rotation setting of 6 , Three lysed for each 30 sec.
• the lysate wur ⁇ de by 30 min centrifugation at 15,000 rpm at 4 0 C in a Eppendorfzentrif u- ge clarified and the supernatant into a new Eppendororfcup transferred.
• the protein content was determined by Bradford, MM (1976) Anal. Biochem. 72: 248-254.
• the measurement of the enzymatic activity of MetA was carried out as follows. Reactions of 1 ml contained 100 mM potassium phosphate buffer (pH 7.5), 5 mM MgCl 2, 100 mM acetyl CoA, 5 mM L-homoserines, 500 ⁇ M DTNB (Ellman's reagent). and cell extract. The test was started by addition of the respective protein lysate and incubated at room temperature. Kinetics were then recorded at 412 nm for 10 min.
• the activity of MetA could be improved by the use of the heterologous expression unit P EF .
• TS are significantly increased.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Biotechnology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Biomedical Technology (AREA)
• Microbiology (AREA)
• Biophysics (AREA)
• Molecular Biology (AREA)
• Physics & Mathematics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Plant Pathology (AREA)
• Medicinal Chemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Analytical Chemistry (AREA)
• Immunology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Related Child Applications (1)

Publications (1)

Family

ID=35628646

Family Applications (2)

Family Applications Before (1)

Country Status (11)

Families Citing this family (19)

Family Cites Families (27)

• 2004
  • 2004-07-20 DE DE102004035065A patent/DE102004035065A1/de not_active Withdrawn
• 2005
  • 2005-07-16 JP JP2007521865A patent/JP2008506400A/ja not_active Withdrawn
  • 2005-07-16 AT AT07123761T patent/ATE531819T1/de active
  • 2005-07-16 EP EP07123761A patent/EP1942198B1/de not_active Not-in-force
  • 2005-07-16 PL PL07123761T patent/PL1942198T3/pl unknown
  • 2005-07-16 KR KR20077003895A patent/KR20070032076A/ko not_active Application Discontinuation
  • 2005-07-16 WO PCT/EP2005/007752 patent/WO2006008097A2/de active Application Filing
  • 2005-07-16 BR BRPI0513227-4A patent/BRPI0513227A/pt not_active IP Right Cessation
  • 2005-07-16 US US11/632,740 patent/US20070269871A1/en not_active Abandoned
  • 2005-07-16 ES ES07123761T patent/ES2376035T3/es active Active
  • 2005-07-16 CN CNA2005800241401A patent/CN1989256A/zh active Pending
  • 2005-07-16 EP EP05759718A patent/EP1771574A2/de not_active Withdrawn
  • 2005-07-16 CN CNA2007103011879A patent/CN101230350A/zh active Pending
• 2008
  • 2008-03-17 US US12/050,146 patent/US8735159B2/en not_active Expired - Fee Related
  • 2008-04-02 JP JP2008095810A patent/JP5710096B2/ja not_active Expired - Fee Related
• 2014
  • 2014-05-08 US US14/272,781 patent/US20140242704A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events