EP1663118A4 - Konditionierer und färbemittel auf peptidbasis für haar, haut und nägel - Google Patents

Konditionierer und färbemittel auf peptidbasis für haar, haut und nägel

Info

Publication number
EP1663118A4
EP1663118A4 EP04788667A EP04788667A EP1663118A4 EP 1663118 A4 EP1663118 A4 EP 1663118A4 EP 04788667 A EP04788667 A EP 04788667A EP 04788667 A EP04788667 A EP 04788667A EP 1663118 A4 EP1663118 A4 EP 1663118A4
Authority
EP
European Patent Office
Prior art keywords
hair
peptide
pro
ser
skin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04788667A
Other languages
English (en)
French (fr)
Other versions
EP1663118A2 (de
Inventor
Xueying Huang
Hong Wang
Ying Wu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
EIDP Inc
Original Assignee
EI Du Pont de Nemours and Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by EI Du Pont de Nemours and Co filed Critical EI Du Pont de Nemours and Co
Priority to EP11150381A priority Critical patent/EP2374465A1/de
Publication of EP1663118A2 publication Critical patent/EP1663118A2/de
Publication of EP1663118A4 publication Critical patent/EP1663118A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q3/00Manicure or pedicure preparations
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/04Preparations for care of the skin for chemically tanning the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00Preparations for care of the hair
    • A61Q5/06Preparations for styling the hair, e.g. by temporary shaping or colouring
    • A61Q5/065Preparations for temporary colouring the hair, e.g. direct dyes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q5/00Preparations for care of the hair
    • A61Q5/12Preparations containing hair conditioners
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/40Chemical, physico-chemical or functional or structural properties of particular ingredients
    • A61K2800/57Compounds covalently linked to a(n inert) carrier molecule, e.g. conjugates, pro-fragrances
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/80Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
    • A61K2800/94Involves covalent bonding to the substrate

Definitions

  • the invention relates to the field of personal care products. More specifically, the invention relates to skin conditioners, hair conditioners, hair colorants, nail colorants, and skin colorants based upon specific skin- binding, hair-binding, and nail-binding peptides.
  • skin conditioners More specifically, the invention relates to skin conditioners, hair conditioners, hair colorants, nail colorants, and skin colorants based upon specific skin- binding, hair-binding, and nail-binding peptides.
  • Film-forming substances are widely used in compositions for skin and hair care as conditioning agents and moisturizers, and to protect the skin and hair against environmental and chemical damage. These substances adsorb onto and/or absorb into the skin or hair, forming a protective coating.
  • film-forming substances include synthetic polymers, such as silicones, polyvinylpyrrolidone, acrylic acid polymers, and polysaccharides, and proteins, such as collagen, keratin, elastin, casein, silk, and soy proteins. Many proteins are known to be particularly effective film-forming agents. Because of their low solubility at the conditions used in skin and hair care products, proteins are commonly used in the form of peptides, formed by the hydrolysis of the proteins.
  • film-forming substances are used to form a protective film on the surface of the hair to protect it from damage due to grooming and styling, shampooin , and exposure to ultraviolet light and the reactive chemicals commonly used in permanent wave agents, hair coloring products, bleaches, and ha ir straighteners, which denature the hair keratin protein. Moreover, these film-forming substances improve the elasticity of the hair.
  • Film-forrning substances that have been used in hair care products include proteins, such as keratin, collagen, soy, and silk proteins and hydrolysates thereof, and polymeric materials, such as polyacrylates, long chain alkyl quaternized amines, and siloxane polymers. For example, Cannell at al. in U.S. Patent No.
  • a hair care composition for treating hair against chemical and ultraviolet light damage. That composition comprises hydrolyzed protein, having an abundance of anionic arnino acids, particularly, sulfur-containing amino acids, and divalent cations. It is proposed in that disclosure that the anionic components of the hydrolyzed protein bind to the hair by means of cationic bridges. Amino acids and their derivatives have also been used in hair care compositions to condition and strengthen hair. For example, O'Toole et al. in WO 0051556 describe hair care compositions containing four or more amino acid compounds selected from histidine, lysine, methionine, tyrosine, tryptophan, and cysteine compounds.
  • Film-forming substances are also used in skin care compositions to form a protective film on the skin. These films can serve to lubricate and coat the skin to passively impede the evaporation of moisture and smooth and soften the skin.
  • Commonly used film-forming substances in skin care compositions include hydrolyzed animal and vegetable proteins (Puchalski et al., U.S. Patent No. 4,416,873, El-Menshawy et al., U.S. Patent No. 4,482,537, and Kojima et al., JP 02311412) and silk proteins (Philippe et al., U.S. Patent No. 6,280,747 and Fahnestock et al., copending U.S. Patent Application No. 10/704337).
  • Amino acids and derivatives have also been used in skin care compositions as conditioning agents.
  • Kojima et al. in JP 06065049 describe skin care compositions containing amino acids and/or their derivatives and docosahexaenoic acid, its salts or its esters.
  • Hair coloring agents may be divided into three categories, specifically, permanent, semi-permanent or direct, and temporary.
  • the permanent hair dyes are generally oxidative dyes that provide hair color that lasts about four to six weeks. These oxidative hair dyes consist of two parts, one part contains the oxidative dyes in addition to other ingredients, while the second part contains an oxidizing agent such as hydrogen peroxide. The two components are mixed immediately prior to use.
  • the oxidizing agent oxidizes the dye precursors, which then combine to form large color molecules within the hair shaft.
  • the oxidative hair dyes provide long-lasting color, the oxidizing agents they contain cause hair damage.
  • the semi-permanent or direct hair dyes are preformed dye molecules that are applied to the hair and provide color for about six to twelve shampoos. This type of hair dye is gentler to the hair because it does not contain peroxides, but the hair color does not last as long.
  • nanoparticle hair coloring materials are conventional direct hair dyes that are treated to obtain nanoscale dimensions and exhibit increased absorption into the hair.
  • Temporary hair dyes are coloring agents that are applied to the hair surface and are removed after one shampoo. It would be desirable to develop a hair coloring agent that provides the durability of the permanent hair dyes without the use of oxidizing agents that damage hair.
  • the major problem with the current skin care and hair care compositions, non-oxidative hair dyes, as well as nail coloring agents is that they lack the required durability required for long-lasting effects. For this reason, there have been attempts to enhance the binding of the cosmetic agent to the hair, skin or nails. For example, Richardson et al. in U.S. Patent No. 5,490,980 and Green et al. in U.S. Patent No.
  • 6,267,957 describe the covalent attachment of cosmetic agents, such as skin conditioners, hair conditioners, coloring agents, sunscreens, and perfumes, to hair, skin, and nails using the enzyme transglutaminase.
  • This enzyme crosslinks an amine moiety on the cosmetic agent to the glutamine residues in skin, hair, and nails.
  • Green et al. in WO 0107009 describe the use of the enzyme lysine oxidase to covalently attach cosmetic agents to hair, skin, and nails.
  • cosmetic agents have been covalently attached to proteins or protein hydrolyzates. For example, Lang et al. in U.S. Patent No.
  • 5,192,332 describe temporary coloring compositions that contain an animal or vegetable protein, or hydrolysate thereof, which contain residues of dye molecules grafted onto the protein chain.
  • the protein serves as a conditioning agent and does not enhance the binding of the cosmetic agent to hair, skin, or nails.
  • Horikoshi et al. in JP 08104614 and Igarashi et al. in U.S. Patent No. 5,597,386 describe hair coloring agents that consist of an anti-keratin antibody covalently attached to a dye or pigment. The antibody binds to the hair, thereby enhancing the binding of the hair coloring agent to the hair.
  • JP 09003100 describe an antibody that recognizes the surface layer of hair and its use to treat hair.
  • a hair coloring agent consisting of that anti-hair antibody coupled to colored latex particles is also described.
  • the use of antibodies to enhance the binding of dyes to the hair is effective in increasing the durability of the hair coloring, but these antibodies are difficult and expensive to produce.
  • Terada et al. in JP 2002363026 describe the use of conjugates consisting of single-chain antibodies, preferably anti-keratin, coupled to dyes, ligands, and cosmetic agents for skin and hair care compositions.
  • the single-chain antibodies may be prepared using genetic engineering techniques, but are still difficult and expensive to prepare because of their large size.
  • WO 00048558 describes the use of calycin proteins, such as ?-lactoglobulin, which contain a binding domain for a cosmetic agent and another binding domain that binds to at least a part of the surface of a hair fiber or skin surface, for conditioners, dyes, and perfumes. Again these proteins are large and difficult and expensive to produce.
  • Linter in U.S. Patent No. 6,620,419 describes peptides grafted to a fatty acid chain and their use in cosmetic and dermopharmaceutical applications. The peptides described in that disclosure are chosen because they stimulate the synthesis of collagen; they are not specific binding peptides that enhance the durability of hair and skin conditioners, and hair, nail, and skin colorants.
  • a method for identifying high-affinity phage-peptide clones is also described in those disclosures. The method involves using PCR to identify peptides that remain bound to the target after acid elution.
  • Reisch (Chem. Eng. News 80:16-21 (2002)) reports that a family of peptides designed to target an ingredient of specific human tissue has been developed for personal care applications.
  • no description of peptide-based conditioners or coloring agents are disclosed in that publication.
  • One of the peptide binding sequences of the instant invention, given as SEQ ID NO:3, has been reported for several other purposes. For example, Hupp et al.
  • WO 02065134 disclose the peptide sequence SEQ ID NO:3 as a peptide for use in modulating the binding of a p53 polypeptide to a p300 polypeptide, useful for regulating the mammalian cell cycle or to induce or prevent cell death.
  • Liu et al. in U.S. Patent No. 6,344,443 describe the use of that same peptide sequence to inhibit binding of tumor necrosis factor alpha to its receptor for preventing or reversing inflammatory changes in patients with arthritis and other inflammatory diseases.
  • Another peptide binding sequence of the instant invention, given as SEQ ID NO:4 was reported by Jagota et al. in WO 03102020 as a carbon nanotube-binding peptide.
  • peptide-based hair conditioners that provide improved durability for long lasting effects and are easy and inexpensive to prepare.
  • Applicants have met the stated needs by identifying peptide sequences using phage display screening that specifically bind to hair, skin, and nails with high affinity and using them to design peptide-based hair conditioners, skin conditioners, hair colorants, nail colorants, and skin colorants.
  • peptide-based conditioners and colorants are diblock compositions.
  • the invention provides a hair-binding peptide selected from the group consisting of SEQ ID NOs:5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 64, 66, 69, and 70.
  • the invention provides a nail-binding peptide as set forth in SEQ ID NO:60.
  • the invention provides a skin-binding peptide as set forth in SEQ ID NO:61.
  • the invention provides a diblock, peptide-based hair conditioner having the general structure (HBP) n - HCA, wherein a) HBP is a hair-binding peptide; b) HCA is a hair conditioning agent; and c) n ranges from 1 to about 1000.
  • HBP general structure
  • HCA hair-binding peptide
  • n ranges from 1 to about 1000.
  • SBP skin conditioner
  • SBP skin conditioner
  • the invention provides a diblock, peptide-based hair colorant having the general structure (HBP) n - C, wherein a) HBP is a hair-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000.
  • the invention provides a diblock, peptide- based nail colorant having the general structure (NBP) n - C, wherein a) NBP is a nail-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000.
  • the invention provides a diblock, peptide- based skin colorant having the general structure (SBP)n - C, wherein a) SBP is a skin-binding peptide; b) C is a coloring agent; and c) n ranges from 1 to about 10,000.
  • the invention provides a triblock, peptide- based hair conditioner having the general structure [(HBP) m - S] n - HCA, wherein a) HBP is a hair-binding peptide; b) HCA is a hair conditioning agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 1000.
  • the invention provides a triblock, peptide-based skin conditioner having the general structure [(SBP) - S] n - SCA, wherein a) SBP is a hair-binding peptide; b) SCA is a skin conditioning agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 1000.
  • the invention provides a triblock, peptide-based hair colorant having the general structure [(HBP) m - S] n - C, wherein a) HBP is a hair-binding peptide; b) C is a coloring agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000.
  • the invention provides a triblock, peptide- based nail colorant having the general structure [(NBP) m - S] n - C, wherein a) NBP is a hair-binding peptide; b) C is a coloring agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000.
  • the invention provides a triblock, peptide- based skin colorant having the general structure [(SBP) m - S] n - C, wherein a) SBP is a hair-binding peptide; b) C is a coloring agent; c) S is a spacer; d) m ranges from 1 to about 50; and e) n ranges from 1 to about 10,000.
  • the invention provides method for generating a high affinity hair, skin, or nail-binding peptide comprising the steps of : a) providing a library of combinatorial generated phage-peptides; b) contacting the library of (a) with a hair, skin, or nail sample to form a reaction solution comprising: (i) phage-peptide-hair, phage-peptide-skin, or phage- peptide-nail complexes; (ii) unbound hair, skin or nail, and (iii) uncomplexed peptides; c) isolating the phage-peptide-hair, phage-peptide-skin, or phage- peptide-nail complexes of (b); d) eluting the weakly-bound phage-peptides from the phage-peptide complex of (b); e) infecting bacterial host cells directly with the phage-peptide-hair, phage-peptide-s
  • the invention provides methods for forming a protective layer of a peptide-based conditioner on hair comprising applying the composition of the invention to the hair and allowing the formation of said protective layer.
  • the invention provides methods for forming a protective layer of a peptide-based conditioner on skin or lips comprising applying the composition of the invention to the skin or lips and allowing the formation of said protective layer.
  • the invention provides a method for coloring hair, eyebrows, skin or nails comprising applying the hair, eyebrows, skin or nail coloring composition of the invention to the hair, eyebrows, skin or nails for a period of time sufficient to cause coloration of the hair, eyebrows, skin or nails.
  • the invention provides a method for coloring hair, eyebrows or eyelashes comprising the steps of: a) providing a hair coloring composition comprising a hair colorant selected from the group consisting of: i) (HBP) n - C; and ii) [(HBP) m - S] k - C wherein 1) HBP is a hair-binding peptide; 2) C is a coloring agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the hair binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phage- peptides; B) contacting the library of (A) with a hair sample to form a reaction solution comprising: (i) phage-peptide-hair complex; (ii) unbound hair, and (iii) uncomplexed peptides
  • the invention provides a method for forming a protective layer of a peptide-based conditioner on hair comprising the steps of: a) providing a hair care composition comprising a hair conditioner selected from the group consisting of: i) (HBP) n - HCA; and ii) [(HBP)m - S] k - HCA wherein 1) HBP is a hair-binding peptide; 2) HCA is a hair conditioning agent; 3) n ranges from 1 to about 1 ,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 1 ,000; and wherein the hair binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phage- peptides; B) contacting the library of (A) with a hair sample to form a reaction solution comprising: (i) phage-peptide-hair complex; (ii) unbound hair,
  • the invention provides amethod for forming a protective layer on skin or lips comprising the steps of : a) providing a skin care composition comprising a skin conditioner selected from the group consisting of: i) (SBP)n - SCA; and ii) [(SBP) m - S] k - SCA wherein 1) SBP is a skin-binding peptide; 2) SCA is a skin conditioning agent; 3) n ranges from 1 to about 1 ,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 1 ,000; and wherein the skin binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phage- peptides; B) contacting the library of (A) with a skin sample to form a reaction solution comprising: (i) phage-peptide-skin complex; (ii) unbound skin, and (iii)
  • the invention provides a method for coloring skin or lips comprising the steps of: a) providing a cosmetic composition comprising a skin colorant selected from the group consisting of: i) (SBP)r, -C; and ii) [(SBP) m - S] k - C wherein 1) SBP is a skin-binding peptide; 2) C is a coloring agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the skin binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phage- peptides; B) contacting the library of (A) with a skin sample to form a reaction solution comprising: (i) phage-peptide-skin complex; (ii) unbound skin, and (iii) uncomplexed peptides; C) isol
  • the invention provides a method for coloring nails comprising the steps of: a) providing a nail polish composition comprising a nail colorant selected from the group consisting of: i) (NBP) n -C; and ii) [(NBP) m - S] k - C wherein 1) NBP is a nail-binding peptide; 2) C is a coloring agent; 3) n ranges from 1 to about 10,000; 4) S is a spacer; 5) m ranges from 1 to about 50; and 6) k ranges from 1 to about 10,000; and wherein the nail binding peptide is selected by a method comprising the steps of: A) providing a library of combinatorial generated phage- peptides; B) contacting the library of (A) with a nail sample to form a reaction solution comprising: (i) phage-peptide-nail complex; (ii) unbound nail, and (iii) uncomplexed peptides; C) isolating
  • SEQ ID NO:1 is the amino acid sequence of a hair-binding peptide.
  • SEQ ID NO:2 is the amino acid sequence of a skin-binding peptide.
  • SEQ ID NOs:3-52, 54-59 are the amino acid sequences of hair- binding peptides of the present invention
  • SEQ ID NO:53 is the amino acid sequence of a hair-binding and nail-binding peptide of the present invention.
  • SEQ ID NO:60 is the amino acid sequence of a nail-binding peptide of the present invention.
  • SEQ ID NO:61 is the amino acid sequence of a skin-binding peptide of the present invention.
  • SEQ ID NO:62 is the oligonucleotide primer used to sequence phage DNA.
  • SEQ ID NO:63 is the amino acid sequence of a peptide used as a control in the ELISA binding assay.
  • SEQ ID NO:64 is the amino acid sequence of a cysteine-attached hair-binding peptide.
  • SEQ ID NO:65 is the amino acid sequence of the Caspase 3 cleavage site.
  • SEQ ID NOs:66, 69, and 70 are the amino acid sequence of shampoo-resistant hair-binding peptides.
  • SEQ ID NOs:67 and 68 are the nucleotide sequences of the primers used to amplify shampoo-resistant, hair-binding phage peptides, as described in Example 8.
  • SEQ ID NOs:71-74 are the amino acid sequences of the biotinylated hair-binding and skin-binding peptides used Example 9.
  • SEQ ID NO:75 is the amino acid sequence of the fully protected D21 peptide used in Example 16.
  • SEQ ID NOs:76-98 are the amino acid sequences of hair-binding peptides.
  • SEQ ID NOs:99-104 are the amino acid sequences of skin-binding peptides.
  • the present invention provides peptide sequences that specifically bind to human hair, skin, and nails with high affinity. Additionally, the present invention provides peptide-based hair and skin conditioners, and hair, nail, and skin colorants with improved durability.
  • HBP hair-binding peptide
  • SBP skin-binding peptide
  • NBP nail-binding peptide
  • HCA hair conditioning agent
  • SCA skin conditioning agent
  • C coloring agent for hair, skin, or nails.
  • S means spacer.
  • peptide refers to two or more amino acids joined to each other by peptide bonds or modified peptide bonds.
  • hair refers to human hair, eyebrows, and eyelashes.
  • skin refers to human skin, or pig skin,
  • Vitro-Skin and EpiDermTM which are substitutes for human skin.
  • the term "nails” as used herein refers to human fingernails and toenails.
  • the term “stringency” as it is applied to the selection of the hair- binding, skin-binding, and nail-binding peptides of the present invention refers to the concentration of the eluting agent (usually detergent) used to elute peptides from the hair, skin, or nails. Higher concentrations of the eluting agent provide more stringent conditions.
  • the term "peptide-hair complex” means structure comprising a peptide bound to a hair fiber via a binding site on the peptide.
  • peptide-skin complex means structure comprising a peptide bound to the skin via a binding site on the peptide.
  • peptide-nail complex means structure comprising a peptide bound to fingernails or toenails via a binding site on the peptide.
  • peptide-substrate complex refers to either peptide-hair, peptide-skin, or peptide-nail complexes.
  • MB50 refers to the concentration of the binding peptide that gives a signal that is 50% of the maximum signal obtained in an ELISA-based binding assay, as described in Example 9. The MB50 provides an indication of the strength of the binding interaction or affinity of the components of the complex.
  • binding affinity refers to the strength of the interaction of a binding peptide with its respective substrate.
  • the binding affinity is defined herein in terms of the MB50 value, determined in an ELISA-based binding assay.
  • amino acid refers to the basic chemical structural unit of a protein or polypeptide. The following abbreviations are used herein to identify specific amino acids:
  • Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
  • Native gene refers to a gene as found in nature with its own regulatory sequences
  • Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer.
  • Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
  • Synthetic genes can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments which are then enzymatically assembled to construct the entire gene.
  • “Chemically synthesized”, as related to a sequence of DNA means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well-established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines.
  • the genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell.
  • the skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.
  • Codon sequence refers to a DNA sequence that codes for a specific amino acid sequence.
  • Suitable regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence.
  • Promoters refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions.
  • Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.
  • expression refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
  • transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance.
  • Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” or “recombinant” or “transformed” organisms.
  • the term “host cell” refers to cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence.
  • the terms “plasmid”, “vector” and “cassette” refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double- stranded DNA molecules.
  • Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
  • Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell.
  • “Expression cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.
  • phage or “bacteriophage” refers to a virus that infects bacteria. Altered forms may be used for the purpose of the present invention.
  • the preferred bacteriophage is derived from the "wild" phage, called M13.
  • M13 The M13 system can grow inside a bacterium, so that it does not destroy the cell it infects but causes it to make new phages continuously. It is a single-stranded DNA phage.
  • phage display refers to the display of functional foreign peptides or small proteins on the surface of bacteriophage or phagemid particles.
  • phage may be used to present peptides as segments of their native surface proteins.
  • Peptide libraries may be produced by populations of phage with different gene sequences.
  • PCR or “polymerase chain reaction” is a technique used for the amplification of specific DNA segments (U.S. Patent Nos. 4,683,195 and 4,800,159).
  • Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, - Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) (hereinafter "Maniatis”); and by Silhavy, T.
  • the present invention comprises specific hair-binding, skin-binding, and nail-binding peptides and their use in conditioners and coloring agents for the hair, skin, and nails.
  • Human hair samples are available commercially, for example from International Hair Importers and Products (Bellerose, NY), in different colors, such as brown, black, red, and blond, and in various types, such as African-American, Caucasian, and Asian. Additionally, the hair samples may be treated for example using hydrogen peroxide to obtain bleached hair.
  • Pig skin available from butcher shops and supermarkets, Vitro- Skin ® , available from IMS Inc. (Milford, CT), and EpiDermTM, available from MatTek Corp. (Ashland, MA), are good substitutes for human skin. Human fingernails and toenails may be obtained from volunteers.
  • Hair-Binding, Skin-Binding, and Nail-Binding Peptides Hair-binding peptides (HBPs), skin-binding peptides (SBPs) and nail-binding peptides (NBPs) as defined herein are peptide sequences that specifically bind with high affinity to hair, skin and nails, respectively.
  • the hair-binding, skin-binding, and nail-binding peptides of the present invention are from about 7 amino acids to about 45 amino acids, more preferably, from about 7 amino acids to about 20 amino acids, most preferably from about 7 to about 12 amino acids.
  • the binding peptides of the invention have a binding affinity for their respective substrate, as measured by MB50 values, of less than or equal to about 10 " M, less than or equal to about 10 "3 M, less than or equal to about 10 " M, less than or equal to about 10 "5 M, preferably less than or equal to about 10 "6 M, and more preferably less than or equal to about 10 " M.
  • Suitable hair-binding, skin-binding, and nail-binding peptide sequences may be selected using methods that are well known in the art.
  • the peptides of the present invention are generated randomly and then selected against a specific hair, skin, or nail sample based upon their binding affinity for the substrate of interest.
  • Patent No.5,639,603 and phage display technology
  • U.S. Patent No. 5,223,409 U.S. Patent No. 5,403,484, U.S. Patent No. 5,571 ,698, U.S. Patent No. 5,837,500.
  • Techniques to generate such biological peptide libraries are described in Dani, M., J. of Receptor & Signal Transduction Res., 21(4):447-468 (2001).
  • a preferred method to randomly generate peptides is by phage display.
  • Phage display is an in vitro selection technique in which a peptide or protein is genetically fused to a coat protein of a bacteriophage, resulting in display of fused peptide on the exterior of the phage virion, while the DNA encoding the fusion resides within the virion.
  • This physical linkage between the displayed peptide and the DNA encoding it allows screening of vast numbers of variants of peptides, each linked to a corresponding DNA sequence, by a simple in vitro selection procedure called "biopanning".
  • biopanning is carried out by incubating the pool of phage-displayed variants with a target of interest that has been immobilized on a plate or bead, washing away unbound phage, and eluting specifically bound phage by disrupting the binding interactions between the phage and the target.
  • the eluted phage is then amplified in vivo and the process is repeated, resulting in a stepwise enrichment of the phage pool in favor of the tightest binding sequences.
  • individual clones are characterized by DNA sequencing. After a suitable library of peptides has been generated, they are then contacted with an appropriate amount of the test substrate, specifically a hair, skin, or nail sample.
  • the test substrate is presented to the library of peptides while suspended iii solution.
  • a preferred solution is a buffered aqueous saline solution containing a surfactant.
  • a suitable solution is Tris-buffered saline (TBS) with 0.5% Tween 20.
  • TBS Tris-buffered saline
  • the solution may additionally be agitated by any means in order to increase the mass transfer rate of the peptides to the hair, skin, or nail surface, thereby shortening the time required to attain maximum binding.
  • TBS Tris-buffered saline
  • the solution may additionally be agitated by any means in order to increase the mass transfer rate of the peptides to the hair, skin, or nail surface, thereby shortening the time required to attain maximum binding.
  • Upon contact a number of the randomly generated peptides will bind to the hair, skin, or nail substrate to form a peptide-hair, peptide-skin or peptide-
  • peptides having varying degrees of binding affinities for the test substrate may be fractionated by selected washings in buffers having varying stringencies. Increasing the stringency of the buffer used increases the required strength of the bond between the peptide and substrate in the peptide-substrate complex.
  • a number of substances may be used to vary the stringency of the buffer solution in peptide selection including, but not limited to, acidic pH (1.5-3.0); basic pH (10-12.5); high salt concentrations such as MgCl2 (3-5 M) and LiCI (5-10 M); water; ethylene glycol (25-50%); dioxane (5-20%); thiocyanate (1-5 M); guanidine (2-5 M); urea (2-8 M); and various concentrations of different surfactants such as SDS (sodium dodecyl sulfate), DOC (sodium deoxycholate), Nonidet P-40, Triton X-100, Tween ® 20, wherein Tween" 20 is preferred.
  • Tris-HCI Tris-buffered saline
  • Tris-borate Tris-acetic acid
  • Triethylamine Triethylamine
  • phosphate buffer Tris-buffered saline solution
  • Tris-buffered saline solution Tris-buffered saline solution
  • peptides having increasing binding affinities for hair, skin or nail substrates may be eluted by repeating the selection process using buffers with increasing stringencies.
  • the eluted peptides can be identified and sequenced by any means known in the art.
  • the following method for generating the hair-binding peptides, skin-binding peptides, or nail-binding peptides of the present invention was used.
  • a library of combinatorial generated phage-peptides is contacted with the substrate of interest, specifically, a hair, skin, or nail sample, to form phage-peptide-hair, phage-peptide-skin, or phage-peptide-nail complexes.
  • the phage-peptide-substrate complex is separated from uncomplexed peptides and unbound substrate, and the bound phage- peptides from the phage-peptide-substrate complexes is eluted from the complex, preferably by acid treatment. Then, the eluted peptides are identified and sequenced.
  • a subtractive panning step is added. Specifically, the library of combinatorial generated phage- peptides is first contacted with the non-target to remove phage-peptides that bind to it. Then, the non-binding phage-peptides are contacted with the desired substrate and the above process is followed. Alternatively, the library of combinatorial generated phage-peptides may be contacted with the non-target and the desired substrate simultaneously.
  • the phage-peptide-substrate complexes are separated from the phage- peptide-non-target complexes and the method described above is followed for the desired phage-peptide-substrate complexes.
  • One embodiment of the present invention provides a modified phage display screening method for isolating peptides with a higher affinity for hair, skin, or nails.
  • the phage-peptide- substrate complexes are formed as described above.
  • these complexes are treated with an elution buffer. Any of the elution buffers described above may be used.
  • the elution buffer is an acidic solution.
  • the remaining, elution-resistant phage-peptide-substrate complexes are used to directly infect a bacterial host cell, such as E. coli ER2738.
  • the infected host cells are grown in an appropriate growth medium, such as LB (Luria-Bertani) medium, and this culture is spread onto agar, containing a suitable growth medium, such as LB medium with IPTG (isopropyl ⁇ -D-thiogalactopyranoside) and S-GalTM. After growth, the plaques are picked for DNA isolation and sequencing to identify the peptide sequences with a high binding affinity for the hair, skin, or nail substrate.
  • LB Lia-Bertani
  • IPTG isopropyl ⁇ -D-thiogalactopyranoside
  • S-GalTM S-GalTM
  • PCR may be used to identify the elution- resistant phage-peptides from the modified phage display screening method, described above, by directly carrying out PCR on the phage- peptide-substrate complexes using the appropriate primers, as described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976, which is incorporated herein by reference. Hair-binding, skin-binding, and nail-binding peptides have been identified using the above methods.
  • binding peptides were isolated that have a high affinity for normal brown hair, given as SEQ ID NOs:3-18, 28-38, 40-56, and 64; shampoo resistant, normal brown hair, given as SEQ ID NO:66, 69 and 70; bleached hair, given as SEQ ID NOs:7, 8, 19-27, 38-40, 43, 44, 47, 57, 58, and 59, fingernail, given as SEQ ID NOs:53 and 60; and skin, given as SEQ ID NO:61. Additionally, the fingernail-binding peptides were found to bind to bleached hair and may be used in the peptide-based hair conditioners and hair colorants of the invention.
  • the bleached hair-binding peptides will bind to fingernails and may be used in the peptide-based nail colorants of the invention.
  • Production of Binding Peptides The binding peptides of the present invention may be prepared using standard peptide synthesis methods, which are well known in the art (see for example Stewart et al., Solid Phase Peptide Synthesis, Pierce Chemical Co., Rockford, IL, 1984; Bodanszky, Principles of Peptide Synthesis, Springer-Verlag, New York, 1984; and Pennington et al., Peptide Synthesis Protocols, Humana Press, Totowa, NJ, 1994).
  • the peptides of the present invention may be prepared using recombinant DNA and molecular cloning techniques.
  • Genes encoding the hair-binding, skin-binding or nail-binding peptides may be produced in heterologous host cells, particularly in the cells of microbial hosts.
  • Preferred heterologous host cells for expression of the binding peptides of the present invention are microbial hosts that can be found broadly within the fungal or bacterial families and which grow over a wide range of temperature, pH values, and solvent tolerances. Because transcription, translation, and the protein biosynthetic apparatus are the same irrespective of the cellular feedstock, functional genes are expressed irrespective of carbon feedstock used to generate cellular biomass.
  • host strains include, but are not limited to, fungal or yeast species such as Aspergillus, Trichoderma, Saccharomyces, Pichia, Candida, Hansenula, or bacterial species such as Salmonella, Bacillus, Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Pseudomonas, Methylomonas, Methylobacter, Alcaligenes, Synechocystis, Anabaena, Thiobacillus, Methanobacterium and Klebsiella.
  • fungal or yeast species such as Aspergillus, Trichoderma, Saccharomyces, Pichia, Candida, Hansenula
  • bacterial species such as Salmonella, Bacillus, Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Pseudomonas, Methylomonas, Methylobacter, Alcaligenes, Synechocystis,
  • Such vectors include, but are not limited to, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from insertion elements, from yeast episoms, from viruses such as baculoviruses, retroviruses and vectors derived from combinations thereof such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • the expression system constructs may contain regulatory regions that regulate as well as engender expression. In general, any system or vector suitable to maintain, propagate or express polynucleotide or polypeptide in a host cell may be used for expression in this regard.
  • Microbial expression systems and expression vectors contain regulatory sequences that direct high level expression of foreign proteins relative to the growth of the host cell. Regulatory sequences are well known to those skilled in the art and examples include, but are not limited to, those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of regulatory elements in the vector, for example, enhancer sequences. Any of these could be used to construct chimeric genes for production of the any of the binding peptides of the present invention. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high level expression of the peptides. Vectors or cassettes useful for the transformation of suitable host cells are well known in the art.
  • the vector or cassette contains sequences directing transcription and translation of the relevant gene, one or more selectable markers, and sequences allowing autonomous replication or chromosomal integration.
  • Suitable vectors comprise a region 5' of the gene, which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.
  • Selectable marker genes provide a phenotypic trait for selection of the transformed host cells such as tetracycline or ampicillin resistance in E. coli.
  • Initiation control regions or promoters which are useful to drive expression of the chimeric gene in the desired host cell are numerous and familiar to those skilled in the art.
  • Virtually any promoter capable of driving the gene is suitable for producing the binding peptides of the present invention including, but not limited to: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, ara, tet, trp, IP ⁇ _, PR, T7, tac, and trc (useful for expression in
  • Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary, however, it is most preferred if included.
  • the vector containing the appropriate DNA sequence as described supra, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the peptide of the present invention. Cell-free translation systems can also be employed to produce such peptides using RNAs derived from the DNA constructs of the present invention. Optionally it may be desired to produce the instant gene product as a secretion product of the transformed host.
  • Secretion of desired proteins into the growth media has the advantages of simplified and less costly purification procedures. It is well known in the art that secretion signal sequences are often useful in facilitating the active transport of expressible proteins across cell membranes.
  • the creation of a transformed host capable of secretion may be accomplished by the incorporation of a DNA sequence that codes for a secretion signal which is functional in the production host. Methods for choosing appropriate signal sequences are well known in the art (see for example EP 546049 and WO 9324631 ).
  • the secretion signal DNA or facilitator may be located between the expression-controlling DNA and the instant gene or gene fragment, and in the same reading frame with the latter.
  • the peptide-based hair conditioners of the present invention are formed by coupling a hair-binding peptide (HBP) with a hair conditioning agent (HCA). Jhe hair-binding peptide part of the conditioner binds strongly to the hair, thus keeping the conditioning agent attached to the hair for a long lasting conditioning effect.
  • HBP hair-binding peptide
  • HCA hair conditioning agent
  • the hair-binding peptides include, but are not limited to, hair-binding peptides selected by the screening methods described above, including the hair-binding peptide sequences of the invention, given by SEQ ID NOs: 3-59, 64, 66, 69, and 70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind strongly to hair, but not to skin. Additionally, any known hair-binding peptide may be used, including but not limited to SEQ ID NOs: 3-59, 64, 66, 69, and 70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind strongly to hair, but not to skin. Additionally, any known hair-binding peptide may be used, including but not limited to SEQ ID NOs: 3-59, 64, 66, 69, and 70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind strongly to hair, but
  • the fingernail-binding peptide for bleached hair, the fingernail-binding peptide, given as SEQ ID NO:60, may also be used.
  • Hair conditioning agents as herein defined are agents which improve the appearance, texture, and sheen of hair as well as increasing hair body or suppleness. In the peptide-based hair conditioners of the present invention, any known hair conditioning agent may be used. Hair conditioning agents are well known in the art, see for example Green et al.
  • hair conditioning agents include, but are not limited to, cationic polymers, such as cationized guar gum, diallyly quaternary ammonium salt/acrylamide copolymers, quaternized polyvinylpyrrolidone and derivatives thereof, and various polyquatemium-compounds; cationic surfactants, such as stearalkonium chloride, centrimonium chloride, and Sapamin hydrochloride; fatty alcohols, such as behenyl alcohol; fatty amines, such as stearyl amine; waxes; esters; nonionic polymers, such as polyvinylpyrrolidone, polyvinyl alcohol, and polyethylene glycol; silicones; siloxanes, such as decamethylcyclopentasiloxane; polymer emulsions, such as amodimethicone; and voluminizing agents, such as for example chi
  • the preferred hair conditioning agents of the present invention contain amine or hydroxyl functional groups to facilitate coupling to the hair-binding peptides, as described below.
  • preferred conditioning agents are octylamine (CAS No. 111-86-4), stearyl amine (CAS No. 124-30-1 ), behenyl alcohol (CAS No. 661-19-8, Cognis Corp., Cincinnati, OH), vinyl group terminated siloxanes, vinyl group terminated silicone (CAS No. 68083-19-2), vinyl group terminated methyl vinyl siloxanes, vinyl group terminated methyl vinyl silicone (CAS No. 68951-99- 5), hydroxyl terminated siloxanes, hydroxyl terminated silicone (CAS No. 80801-30-5), amino-modified silicone derivatives, [(aminoethyl)amino]propyl hydroxyl dimethyl siloxanes,
  • the peptide-based hair conditioners of the present invention are prepared by covalently attaching a specific hair-binding peptide to a hair conditioning agent, either directly or via a spacer. Any known peptide or protein conjugation chemistry may be used to form the peptide-based hair conditioners of the present invention. Conjugation chemistries are well- known in the art (see for example, Hermanson, Bioconjugate Techniques, Academic Press, New York (1996)).
  • Suitable coupling agents include, but are not limited to, carbodiimide coupling agents, diacid chlorides, diisocyanates and other difunctional coupling reagents that are reactive toward terminal amine and/or carboxylic acid terminal groups on the peptides and to amine, carboxylic acid, or alcohol groups on the hair conditioning agent.
  • the preferred coupling agents are carbodiimide coupling agents, such as 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N,N'-dicyclohexyl-carbodiimide (DCC), which may be used to activate carboxylic acid groups for coupling to alcohol, and amine groups.
  • the spacer serves to separate the conditioning agent from the peptide to ensure that the agent does not interfere with the binding of the peptide to the hair.
  • the spacer may be any of a variety of molecules, such as alkyl chains, phenyl compounds, ethylene glycol, amides, esters and the like. Preferred spacers are hydrophilic and have a chain length from 1 to about 100 atoms, more preferably, from 2 to about 30 atoms.
  • spacers examples include, but are not limited to ethanol amine, ethylene glycol, polyethylene with a chain length of 6 carbon atoms, polyethylene glycol with 3 to 6 repeating units, phenoxyethanol, propanolamide, butylene glycol, butyleneglycolamide, propyl phenyl, and ethyl, propyl, hexyl, steryl, cetyl, and palmitoyl alkyl chains.
  • the spacer may be covalently attached to the peptide and the hair conditioning agent using any of the coupling chemistries described above.
  • a bifunctional cross-linking agent that contains a spacer and reactive groups at both ends for coupling to the peptide and the conditioning agent may be used.
  • Suitable bifunctional cross-linking agents include, but are not limited to diamines, such a as 1 ,6-diaminohexane; dialdehydes, such as glutaraldehyde; bis N- hydroxysuccinimide esters, such as ethylene glycol-bis(succinic acid N- hydroxysuccinimide ester), disuccinimidyl glutarate, disuccinimidyl suberate, and ethylene glycol-bis(succinimidylsuccinate); diisocyantes, such as hexamethylenediisocyanate; bis oxiranes, such as 1 ,4 butanediyl diglycidyl ether; dicarboxylic acids, such as succinyldisalicy
  • R-i is H or a substituent group such as -SO3Na, -NO2, or -Br; and R2 is a spacer such as -CH2CH2 (ethyl), -(CH2)3 (propyl), or -(CH2)3C6Hs (propyl phenyl).
  • R2 is a spacer such as -CH2CH2 (ethyl), -(CH2)3 (propyl), or -(CH2)3C6Hs (propyl phenyl).
  • An example of such a heterobifunctional cross-linking agent is 3-maleimidopropionic acid N-hydroxysuccinimide ester. The N- hydroxysuccinimide ester group of these reagents reacts with amine or alcohol groups on the conditioner, while the maleimide group reacts with thiol groups present on the peptide.
  • a thiol group may be incorporated into the peptide by adding a cysteine group to at least one end of the binding peptide sequence.
  • a cysteine group may be incorporated between the binding peptide sequence and the terminal cysteine to separate the reacting thiol group from the binding sequence.
  • the spacer may be a peptide composed of any amino acid and mixtures thereof.
  • the preferred peptide spacers are composed of the amino acids glycine, alanine, and serine, and mixtures thereof.
  • the peptide spacer may contain a specific enzyme cleavage site, such as the protease Caspase 3 site, given by SEQ ID NO:65, which allows for the enzymatic removal of the conditioning agent from the hair.
  • the peptide spacer may be from 1 to about 50 amino acids, preferably from 1 to about 20 amino acids.
  • These peptide spacers may be linked to the binding peptide sequence by any method know in the art. For example, the entire binding peptide-peptide spacer diblock may be prepared using the standard peptide synthesis methods described supra.
  • binding peptide and peptide spacer blocks may be combined using carbodiimide coupling agents (see for example, Hermanson, Bioconjugate Techniques, Academic Press, New York (1996)), diacid chlorides, diisocyanates and other difunctional coupling reagents that are reactive to terminal amine and/or carboxylic acid terminal groups on the peptides.
  • carbodiimide coupling agents see for example, Hermanson, Bioconjugate Techniques, Academic Press, New York (1996)
  • diacid chlorides diisocyanates
  • other difunctional coupling reagents that are reactive to terminal amine and/or carboxylic acid terminal groups on the peptides.
  • the entire binding peptide-peptide spacer diblock may be prepared using the recombinant DNA and molecular cloning techniques described supra.
  • the spacer may also be a combination of a peptide spacer and an organic spacer molecule, which may be prepared using the methods described above.
  • hair-binding peptides attached to the hair conditioning agent to enhance the interaction between the peptide-based hair conditioner and the hair. Either multiple copies of the same hair-binding peptide or a combination of different hair-binding peptides may be used.
  • large conditioning particles e.g., particle emulsions
  • a large number of hair-binding peptides i.e., up to about 1 ,000, may be attached to the conditioning agent.
  • a smaller number of hair-binding peptides can be attached to the smaller conditioner molecules, i.e., up to about 50.
  • the peptide-based hair conditioners are diblock compositions consisting of a hair-binding peptide (HBP) and a hair conditioning agent (HCA), having the general structure (HBP) n - HCA, where n ranges from 1 to about 1 ,000, preferably from 1 to about 50.
  • HBP hair-binding peptide
  • HCA hair conditioning agent
  • the peptide-based hair conditioners contain0 a spacer (S) separating the hair-binding peptide from the hair conditioning agent, as described above. Multiple copies of the hair-binding peptide may be attached to a single spacer molecule.
  • the peptide-based hair conditioners are triblock compositions consisting of a hair-binding peptide, a spacer, and a hair conditioning agent, having the 5 general structure [(HBP) m - S] n - HCA, where n ranges from 1 to about 1 ,000, preferably n is 1 to about 50, and m ranges from 1 to about 50, preferably m is 1 to about 10.
  • the peptide-based hair conditioners of the present invention may be used in compositions for hair care. It should also be recognized thatO the hair-binding peptides themselves can serve as conditioning agents for the treatment of hair.
  • Hair care compositions are herein defined as compositions for the treatment of hair, including but not limited to shampoos, conditioners, lotions, aerosols, gels, mousses, and hair dyes comprising an effective amount of a peptide-based hair conditioner or a5 mixture of different peptide-based hair conditioners in a cosmetically acceptable medium.
  • An effective amount of a peptide-based hair conditioner or hair-binding peptide for use in a hair care composition is herein defined as a proportion of from about 0.01 % to about 10%, preferably about 0.01 % to about 5% by weight relative to the total weightO of the composition.
  • Components of a cosmetically acceptable medium for hair care compositions are described by Philippe et al. in U.S. Patent No.
  • these hair care compositions can be aqueous,5 alcoholic or aqueous-alcoholic solutions, the alcohol preferably being ethanol or isopropanol, in a proportion of from about 1 to about 75% by weight relative to the total weight, for the aqueous-alcoholic solutions.
  • the hare care compositions may contain one or more conventional cosmetic or dermatological additives or adjuvants including but not limited to, antioxidants, preserving agents, fillers, surfactants, UVA and/or UVB sunscreens, fragrances, thickeners, wetting agents and anionic, nonionic or amphoteric polymers, and dyes or pigments.
  • Peptide-Based Skin Conditioners The peptide-based skin conditioners of the present invention are formed by coupling a skin-binding peptide (SBP) with a skin conditioning agent (SCA). The skin-binding peptide part of the conditioner binds strongly to the skin, thus keeping the conditioning agent attached to the skin for a long lasting conditioning effect.
  • the skin-binding peptides include, but are not limited to, skin-binding peptides selected by the screening methods described above, including the skin-binding peptide sequence of the invention, given as SEQ ID NO:61. Additionally, any known skin-binding peptide may be used, including but not limited to SEQ ID NO:2, and SEQ ID NOs:99-104, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively.
  • Skin conditioning agents as herein defined include, but are not limited to astringents, which tighten skin; exfoliants, which remove dead skin cells; emollients, which help maintain a smooth, soft, pliable appearance; humectants, which increase the water content of the top layer of skin; occlusives, which retard evaporation of water from the skin's surface; and miscellaneous compounds that enhance the appearance of dry or damaged skin or reduce flaking and restore suppleness .
  • any known skin conditioning agent may be used. Skin conditioning agents are well known in the art, see for example Green et al. supra, and are available commercially from various sources.
  • Suitable examples of skin conditioning agents include, but are not limited to, alpha-hydroxy acids, beta-hydroxy acids, polyols, hyaluronic acid, D,L-panthenol, polysalicylates, vitamin A palmitate, vitamin E acetate, glycerin, sorbitol, silicones, silicone derivatives, lanolin, natural oils and triglyceride esters.
  • the preferred skin conditioning agents of the present invention are polysalicylates, propylene glycol (CAS No. 57-55-6, Dow Chemical, Midland, Ml), glycerin (CAS No. 56-81-5, Proctor & Gamble Co.,
  • glycolic acid CAS No. 79-14-1 , DuPont Co., Wilmington, DE
  • lactic acid CAS No. 50-21-5, Alfa Aesar, Ward Hill, MA
  • malic acid CAS No. 617-48-1 , Alfa Aesar
  • citric acid CAS No. 77-92-9, Alfa Aesar
  • tartaric acid CAS NO. 133-37-9, Alfa Aesar
  • glucaric acid CAS No. 87- 73-0
  • galactaric acid CAS No. 526-99-8
  • 3-hydroxyvaleric acid CAS No. 10237-77-1
  • salicylic acid CAS No. 69-72-7, Alfa Aesar
  • 1 ,3 propanediol CAS No.
  • Polysalicylates may be prepared by the method described by White et al. in U.S. Patent No. 4,855,483, incorporated herein by reference.
  • Glucaric acid may be synthesized using the method described by Merbouh et al. (Carbohydr. Res. 336:75-78 (2001 ).
  • the 3-hydroxyvaleric acid may be prepared as described by Bramucci in WO 02012530.
  • the peptide-based skin conditioners of the present invention are prepared by covalently attaching a specific skin-binding peptide to the skin conditioning agent, either directly or via a spacer. Any of the coupling methods described above may be used.
  • the skin conditioning agent may be necessary to introduce reactive groups, such as carboxylic acid, alcohol, amine, or aldehyde groups, on the skin conditioning agent for coupling to the hair-binding peptide, as described above. It may also be desirable to have multiple skin-binding peptides attached to the skin conditioning agent to enhance the interaction between the peptide-based skin conditioner and the skin. Either multiple copies of the same skin-binding peptide or a combination of different skin-binding peptides may be used. In the case of large conditioning particles, a large number of skin-binding peptides, i.e., up to about 1 ,000, may be attached to the conditioning agent.
  • reactive groups such as carboxylic acid, alcohol, amine, or aldehyde groups
  • the peptide-based skin conditioners are diblock compositions consisting of a skin-binding peptide (SBP) and a skin conditioning agent (SCA), having the general structure (SBP) n - SCA, where n ranges from 1 to about 1 ,000, preferably from 1 to about 50.
  • the peptide-based skin conditioners contain a spacer (S) separating the skin-binding peptide from the skin conditioning agent, as described above. Multiple copies of the skin-binding peptide may be attached to a single spacer molecule.
  • the peptide-based skin conditioners are triblock compositions consisting of a skin binding peptide, a spacer, and a skin conditioning agent, having the general structure [(SBP) m - S] n - SCA, where n ranges from 1 to about 1 ,000, preferably n is 1 to about 50, and m ranges from 1 to about 50, preferably m is 1 to about 10.
  • the peptide-based skin conditioners of the present invention may be used in compositions for skin care. It should also be recognized that the skin-binding peptides themselves can serve as conditioning agents for skin.
  • Skin care compositions are herein defined as compositions comprising an effective amount of a peptide-based skin conditioner or a mixture of different peptide-based skin conditioners in a cosmetically acceptable medium.
  • the uses of these compositions include, but are not limited to, skin care, skin cleansing, make-up, and anti-wrinkle products.
  • An effective amount of a peptide-based skin conditioner or skin-binding peptide for skin care compositions is herein defined as a proportion of from about 0.001% to about 10%, preferably about 0.01% to about 5% by weight relative to the total weight of the composition. This proportion may vary as a function of the type of skin care composition. Suitable compositions for a cosmetically acceptable medium are described by Philippe et al. supra.
  • the cosmetically acceptable medium may be an anhydrous composition containing a fatty substance in a proportion generally of from about 10 to about 90% by weight relative to the total weight of the composition, where the fatty phase containing at least one liquid, solid or semi-solid fatty substance.
  • the fatty substance includes, but is not limited to, oils, waxes, gums, and so-called pasty fatty substances.
  • the compositions may be in the form of a stable dispersion such as a water-in-oil or oil-in-water emulsion.
  • compositions may contain one or more conventional cosmetic or dermatological additives or adjuvants, including but not limited to, antioxidants, preserving agents, fillers, surfactants, UVA and/or UVB sunscreens, fragrances, thickeners, wetting agents and anionic, nonionic or amphoteric polymers, and dyes or pigments.
  • Peptide-Based Hair Colorants The peptide-based hair colorants of the present invention are formed by coupling a hair-binding peptide (HBP) with a coloring agent (C). The hair-binding peptide part of the peptide-based hair colorant binds strongly to the hair, thus keeping the coloring agent attached to the hair for a long lasting hair coloring effect.
  • the hair-binding peptides include, but are not limited to, hair-binding peptides selected by the screening methods described above, including the hair-binding peptide sequences of the invention, given by SEQ ID NOs: 3-59, 64, 66, 69 and 70, most preferably the peptides given by SEQ ID NO:46 and SEQ ID NO:66, which bind strongly to hair, but not to skin. Additionally, any known hair-binding peptide may be used, including but not limited to SEQ ID NO:1 , and SEQ ID NOs:76-98, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively.
  • the fingernail-binding peptide For bleached hair, the fingernail-binding peptide, given as SEQ ID NO:60, may also be used.
  • Coloring agents as herein defined are any dye, pigment, and the like that may be used to change the color of hair, skin, or nails.
  • any known coloring agent may be used. Hair coloring agents are well known in the art (see for example Green et al.
  • Suitable hair coloring agents include, but are not limited to dyes, such as 4- hydroxypropylamino-3-nitrophenol, 4-amino-3-nitrophenol, 2-amino-6- chloro-4-nitrophenol, 2-nitro-paraphenylenediamine, N,N-hydroxyethyl-2- nitro-phenylenediamine, 4-nitro-indole, Henna, HC Blue 1 , HC Blue 2, HC Yellow 4, HC Red 3, HC Red 5, Disperse Violet 4, Disperse Black 9, HC Blue 7, HC Blue 12, HC Yellow 2, HC Yellow 6, HC Yellow 8, HC Yellow 12, HC Brown 2, D&C Yellow 1 , D&C Yellow 3, D&C Blue 1 , Disperse Blue 3, Disperse violet 1 , eosin derivatives such as D&C Red No.
  • dyes such as 4- hydroxypropylamino-3-nitrophenol, 4-amino-3-nitrophenol, 2-amino-6- chloro-4-nitrophenol, 2-nitro-paraphenylenediamine
  • halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No. 10; and pigments, such as D&C Red No. 36 and D&C Orange No. 17, the calcium lakes of D&C Red Nos. 7, 11 , 31 and 34, the barium lake of D&C Red No. 12, the strontium lake of D&C Red No. 13, the aluminum lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C Red No. 21 , and of FD&C Blue No.
  • the preferred hair coloring agents of the present invention are D&C Yellow 1 and 3, HC Yellow 6 and 8, D&C Blue 1 , HC Blue 1 , HC Brown 2, HC Red 5, 2-nitro- paraphenylenediamine, N,N-hydroxyethyl-2-nitro-phenylenediamine, 4- nitro-indole, and carbon black.
  • Metallic and semiconductor nanoparticles may also be used as hair coloring agents due to their strong emission of light (Vic et al. U.S. Patent Application Publication No. 2004/0010864).
  • Nanoparticles are herein defined as metallic or semiconductor particles with an average particle diameter of between 1 and 100 nm. Preferably, the average particle diameter of the particles is between about 1 and 40 nm. As used herein, “particle size” and “particle diameter” have the same meaning.
  • the metallic nanoparticles include, but are not limited to, particles of gold, silver, platinum, palladium, iridium, rhodium, osmium, iron, copper, cobalt, and alloys composed of these metals.
  • An “alloy” is herein defined as a homogeneous mixture of two or more metals.
  • the “semiconductor nanoparticles” include, but are not limited to, particles of cadmium selenide, cadmium sulfide, silver sulfide, cadmium sulfide, zinc oxide, zinc sulfide, zinc selenide, lead sulfide, gallium arsenide, silicon, tin oxide, iron oxide, and indium phosphide.
  • the nanoparticles are stabilized and made water-soluble by the use of a suitable organic coating or monolayer. As used herein, monolayer-protected nanoparticles are one type of stabilized nanoparticle. Methods for the preparation of stabilized, water-soluble metal and semiconductor nanoparticles are known in the art, and are described by Huang et al.
  • the color of the nanoparticles depends on the size of the particles. Therefore, by controlling the size of the nanoparticles, different colors may be obtained.
  • ZnS-coated CdSe nanoparticles cover the entire visible spectrum over a particle size range of 2 to 6 nm.
  • CdSe nanoparticles with a core size of 2.3, 4.2, 4.8 and 5.5 nm emit light at the , wavelength centered around 485, 565, 590, and 625 nm, respectively.
  • Water-soluble nanoparticles of different sizes may be obtained from a broad size distribution of nanoparticles using the size fractionation method described by Huang, supra.
  • That method comprises the regulated addition of a water-miscible organic solvent to a solution of nanoparticles in the presence of an electrolyte. Increasing additions of the water- miscible organic solvent result in the precipitation of nanoparticles of decreasing size.
  • the peptide-based hair colorants of the present invention are prepared by covalently attaching a specific hair-binding peptide to a coloring agent, either directly or via a spacer. Any of the coupling methods described above may be used. It may be necessary to introduce reactive groups, such as carboxylic acid, alcohol, amine, or aldehyde groups, on the coloring agent for coupling to the hair-binding peptide. These modifications may be done using routine chemistry, which is well known in the art.
  • the surface of carbon black particles may be oxidized using nitric acid, a peroxide such as hydrogen peroxide, or an inorganic initiator such as ammonium persulfate, to generate functional groups.
  • a peroxide such as hydrogen peroxide
  • an inorganic initiator such as ammonium persulfate
  • the carbon black surface is oxidized using ammonium persulfate as described by Carrasco-Marin et al. (J. Chem. Soc, Faraday Trans. 93:2211-2215 (1997)).
  • Amino functional groups may be introduced to the surface of carbon black using an organic initiator such as 2,2'- Azobis(2-methylpropionamide)-dihydrochloride.
  • the inorganic pigments and the nanoparticles may be derivatized to introduce carboxylic acid or amino functional groups in a similar manner.
  • hair-binding peptides attached to the coloring agent to enhance the interaction between the peptide-based hair colorant and the hair. Either multiple copies of the same hair-binding peptide or a combination of different hair-binding peptides may be used. In the case of large pigment particles, a large number of hair-binding peptides, i.e., up to about 10,000, may be attached to the pigment. A smaller number of hair-binding peptides can be attached to the smaller dye molecules, i.e., up to about 50.
  • the peptide-based hair colorants are diblock compositions consisting of a hair-binding peptide (HBP) and a coloring agent (C), having the general structure (HBP) n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500.
  • the peptide-based hair colorants contain a spacer (S) separating the binding peptide from the hair coloring agent, as described above. Multiple copies of the hair-binding peptide may be attached to a single spacer molecule.
  • the peptide- based hair colorants are triblock compositions consisting of a hair-binding peptide, a spacer, and a coloring agent, having the general structure [(HBP) m - S]n - C, where n ranges from 1 to about 10,000 , preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10.
  • the peptide-based hair colorants of the present invention may be used in hair coloring compositions for dyeing hair.
  • Hair coloring compositions are herein defined as compositions for the coloring, dyeing, or bleaching of hair, comprising an effective amount of peptide-based hair colorant or a mixture of different peptide-based hair colorants in a cosmetically acceptable medium.
  • an effective amount of a peptide-based hair colorant for use in a hair coloring composition is herein defined as a proportion of from about 0.001 % to about 20% by weight relative to the total weight of the composition.
  • Components of a cosmetically acceptable medium for hair coloring compositions are described by Dias et al., in U.S. Patent No. 6,398,821 and by Deutz et al., in U.S. Patent No. 6,129,770, both of which are incorporated herein by reference.
  • hair coloring compositions may contain sequestrants, stabilizers, thickeners, buffers, carriers, surfactants, solvents, antioxidants, polymers, and conditioners.
  • the conditioners may include the peptide-based hair conditioners and hair-binding peptides of the present invention in a proportion from about 0.01 % to about 10%, preferably about 0.01 % to about 5% by weight relative to the total weight of the hair coloring composition.
  • the peptide-based hair colorants of the present invention may also be used as coloring agents in cosmetic compositions that are applied to the eyelashes or eyebrows including, but not limited to mascaras, and eyebrow pencils.
  • These may be anhydrous make-up products comprising a cosmetically acceptable medium which contains a fatty substance in a proportion generally of from about 10 to about 90% by weight relative to the total weight of the composition, where the fatty phase containing at least one liquid, solid or semi-solid fatty substance, as described above.
  • the fatty substance includes, but is not limited to, oils, waxes, gums, and so-called pasty fatty substances.
  • these compositions may be in the form of a stable dispersion such as a water-in-oil or oil-in-water emulsion, as described above.
  • the proportion of the peptide-based- hair colorant is generally from about 0.001 % to about 20% by weight relative to the total weight of the composition.
  • Peptide-Based Nail Colorants The peptide-based nail colorants of the present invention are formed by coupling a nail-binding peptide (NBP) with a coloring agent (C).
  • the nail-binding peptide part of the peptide-based nail colorant binds strongly to the fingernails or toenails, thus keeping the coloring agent attached to the nails for a long lasting coloring effect.
  • the nail-binding peptides include, but are not limited to nail-binding peptides selected by the screening methods described above, including the nail-binding peptide sequences of the invention, given by SEQ ID NOs:53 and 60, most preferably the peptide given by SEQ ID NO:60. Additionally, the beached hair-binding peptides, given as SEQ ID NOs:7, 8, 19-27 38, 39, 40, 43-45, 47, 57,58. and 59 may be used.
  • the peptide-based nail colorants of the present invention are prepared by covalently attaching a specific nail-binding peptide to a coloring agent, either directly or via a spacer, using any of the coupling methods described above.
  • a coloring agent any of the coloring agents described above may be used.
  • the preferred coloring agents for use in the peptide-based nail colorants of the present invention include D&C Red Nos. 8, 10, 30 and 36, the barium lakes of D&C Red Nos. 6, 9 and 12, the calcium lakes of D&C Red Nos. 7, 11 , 31 and 34, the strontium lake of D&C Red No. 30 and D&C Orange No. 17 and D&C Blue No. 6.
  • nail-binding peptides attached to the coloring agent to enhance the interaction between the peptide-based nail colorant and the nails. Either multiple copies of the same nail-binding peptide or a combination of different nail-binding peptides may be used. In the case of large pigment particles, a large number of nail-binding peptides, i.e., up to about 10,000, may be attached to the pigment. A smaller number of nail-binding peptides can be attached to the smaller dye molecules, i.e., up to about 50.
  • the peptide-based nail colorants are diblock compositions consisting of a nail-binding peptide (NBP) and a coloring agent (C), having the general structure (NBP) n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500.
  • the peptide-based nail colorants contain a spacer (S) separating the binding peptide from the coloring agent, as described above. Multiple copies of the nail-binding peptide may be attached to a single spacer molecule.
  • the peptide- based nail colorants are triblock compositions consisting of a nail-binding peptide, a spacer, and a coloring agent, having the general structure
  • n ranges from 1 to about 10,000, preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10.
  • the peptide-based nail colorants of the present invention may be used in nail polish compositions for coloring fingernails and toenails.
  • Nail polish compositions are herein defined as compositions for the treatment and coloring of nails, comprising an effective amount of a peptide-based nail colorant or a mixture of different peptide-based nail colorants in a cosmetically acceptable medium.
  • An effective amount of a peptide-based nail colorant for use in a nail polish composition is herein defined as a proportion of from about 0.001 % to about 20% by weight relative to the total weight of the composition.
  • Components of a cosmetically acceptable medium for nail polishes are described by Philippe et al. supra.
  • the nail polish composition typically contains a solvent and a film forming substance, such as cellulose derivatives, polyvinyl derivatives, acrylic polymers or copolymers, vinyl copolymers and polyester polymers.
  • the nail polish may contain a plasticizer, such as tricresyl phosphate, benzyl benzoate, tributyl phosphate, butyl acetyl ricinoleate, triethyl citrate, tributyl acetyl citrate, dibutyl phthalate or camphor.
  • a plasticizer such as tricresyl phosphate, benzyl benzoate, tributyl phosphate, butyl acetyl ricinoleate, triethyl citrate, tributyl acetyl citrate, dibutyl phthalate or camphor.
  • the peptide-based skin colorants of the present invention are formed by coupling a skin-binding peptide (SBP) with a coloring agent (C).
  • SBP skin-binding peptide
  • C coloring agent
  • the skin-binding peptide part of the peptide-based skin colorant binds strongly to the skin, thus keeping the coloring agent attached to the skin for a long lasting skin coloring effect.
  • the skin-binding peptides include, but are not limited to, skin-binding peptides selected by the screening methods described above, including the skin-binding peptide sequence of the invention, given as SEQ ID NOs:61.
  • any known skin-binding peptide may be used, including but not limited to SEQ ID NO:2, and SEQ ID NOs:99-104, described by Janssen et al. in U.S. Patent Application Publication No. 2003/0152976 and by Janssen et al. in WO 04048399, respectively.
  • the peptide-based skin colorants of the present invention are prepared by covalently attaching a specific skin-binding peptide to a coloring agent, either directly or via a spacer, using any of the coupling methods described above. Any of the colorants described above may be used.
  • the preferred coloring agents for use in the peptide-based skin colorants of the present invention include the following dyes: eosin derivatives such as D&C Red No.
  • halogenated fluorescein derivatives such as D&C Red No. 27, D&C Red Orange No. 5 in combination with D&C Red No. 21 and D&C Orange No. 10, and the pigments: titanium dioxide, zinc oxide, D&C Red No. 36 and D&C Orange No. 17, the calcium lakes of D&C Red Nos. 7, 11 , 31 and 34, the barium lake of D&C Red No. 12, the strontium lake D&C Red No. 13, the aluminum lakes of FD&C Yellow No. 5, of FD&C Yellow No. 6, of D&C Red No. 27, of D&C Red No. 21 , of FD&C Blue No. 1 , iron oxides, manganese violet, chromium oxide, ultramarine blue, and carbon black.
  • the coloring agent may also be a sunless tanning agent, such as dihydroxyacetone, that produces a tanned appearance on the skin without exposure to the sun. It may also be desirable to have multiple skin-binding peptides attached to the coloring agent to enhance the interaction between the peptide-based skin colorant and the skin. Either multiple copies of the same skin-binding peptide or a combination of different skin-binding peptides may be used. In the case of large pigment particles, a large number of skin-binding peptides, i.e., up to about 10,000, may be attached to the pigment. A smaller number of skin-binding peptides can be attached to the smaller dye molecules, i.e., up to about 50.
  • the peptide-based skin colorants are diblock compositions consisting of a skin-binding peptide (SBP) and a coloring agent (C), having the general structure (SBP) n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500.
  • the peptide-based skin colorants contain a spacer (S) separating the binding peptide from the coloring agent, as described above. Multiple copies of the skin-binding peptide may be attached to a single spacer molecule.
  • the peptide-based skin colorants are triblock compositions consisting of a skin-binding peptide, a spacer, and a coloring agent, having the general structure [(SBP) m - S] n - C, where n ranges from 1 to about 10,000, preferably n is 1 to about 500, and m ranges from 1 to about 50, preferably m is 1 to about 10.
  • the peptide-based skin colorants of the present invention may be used as coloring agents in cosmetic and make-up products, including but not limited to foundations, blushes, lipsticks, lip liners, lip glosses, eyeshadows and eyeliners.
  • These may be anhydrous make-up products comprising a cosmetically acceptable medium which contains a fatty substance, or they may be in the form of a stable dispersion such as a water-in-oil or oil-in-water emulsion, as described above.
  • the proportion of the peptide-based skin colorant is generally from about 0.001 % to about 40% by weight relative to the total weight of the composition.
  • the present invention also comprises a method for forming a protective film of peptide-based conditioner on skin, hair, or lips by applying one of the compositions described above comprising an effective amount of a peptide-based skin conditioner or peptide-based hair conditioner to the skin, hair, or lips and allowing the formation of the protective film.
  • the compositions of the present invention may be applied to the skin, hair, or lips by various means, including, but not limited to spraying, brushing, and applying by hand.
  • the peptide- based conditioner composition is left in contact with the skin, hair, or lips for a period of time sufficient to form the protective film, preferably for at least about 0.1 to 60 min.
  • the present invention also provides a method for coloring hair by applying a hair coloring composition comprising an effective amount of a peptide-based hair colorant to the hair by means described above.
  • the hair coloring composition is allowed to contact the hair for a period of time sufficient to cause coloration of the hair, preferably between about 5 to about 50 min, and then the hair coloring composition may be rinsed from the hair.
  • the present invention also provides a method for coloring skin or lips by applying a skin coloring composition comprising an effective amount of a peptide-based skin colorant to the skin or lips by means described above.
  • the present invention also provides a method for coloring fingernails or toenails by applying a nail polish composition comprising an effective amount of a peptide-based nail colorant to the fingernails or toenails by means described above.
  • the present invention also provides a method for coloring eyebrows and eyelashes by applying a cosmetic composition comprising an effective amount of a peptide-based hair colorant to the eyebrows and eyelashes by means described above.
  • EXAMPLES The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only.
  • GENERAL METHODS Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, by T. J. Silhavy, M. L. Bennan, and L. W. Enquist, Experiments with Gone Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1984, and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-lnterscience, N.Y., 1987.
  • Phage Display Peptide Libraries The phage libraries used in the present invention, Ph.D.-12TM Phage Display Peptide Library Kit and Ph.D.-7TM Phage Display Library Kit, were purchased from New England BioLabs (Beverly, MA). These kits are based on a combinatorial library of random peptide 7 or 12-mers fused to a minor coat protein (pill) of M13 phage. The displayed peptide is expressed at the N-terminus of pill, such that after the signal peptide is cleaved, the first residue of the coat protein is the first residue of the displayed peptide.
  • the Ph.D.-7 and Ph.D.-12 libraries consist of 9 9 approximately 2.8 x 10 and 2.7 x 10 sequences, respectively.
  • a volume of 10 ⁇ L contains about 55 copies of each peptide sequence.
  • Each initial round of experiments was carried out using the original library provided by the manufacture in order to avoid introducing any bias into the results.
  • Preparation of Hair Samples The samples used as normal hair were 6-inch medium brown human hairs obtained from International Hair Importers and Products (Bellerose, NY). The hairs were placed in 90% isopropanol for 30 min at room temperature and then washed 5 times for 10 min each with deionized water. The hairs were air-dried overnight at room temperature.
  • the medium brown human hairs were placed in 6% H 2 O 2 , which was adjusted to pH 10.2 with ammonium hydroxide, for 10 min at room temperature and then washed 5 times for 10 min each with deionized water. The hairs were air-dried overnight at room temperature.
  • the normal and bleached hair samples were cut into 0.5 to 1 cm lengths and about 5 to 10 mg of the hairs was placed into wells of a custom 24-well biopanning apparatus that had a pig skin bottom. An equal number of the pig skin bottom wells were left empty. The pig skin bottom apparatus was used as a subtractive procedure to remove phage-peptides that have an affinity for skin.
  • This apparatus was created by modifying a dot blot apparatus (obtained from Schleicher & Schuell, Keene, NH) to fit the biopanning process. Specifically, the top 96-well block of the dot blot apparatus was replaced by a 24-well block. A 4 x 6 inch treated pig skin was placed under the 24-well block and panning wells with a pig skin bottom were formed by tightening the apparatus. The pig skin was purchased from a local supermarket and stored at -80 °C. Before use, the skin was placed in deionized water to thaw, and then blotted dry using a paper towel. The surface of the skin was wiped with 90% isopropanol, and then rinsed with deionized water.
  • a dot blot apparatus obtained from Schleicher & Schuell, Keene, NH
  • the 24-well apparatus was filled with blocking buffer consisting of 1 mg/mL BSA in TBST containing 0.5% Tween® 20 (TBST-0.5%) and incubated for 1 h at 4 °C. The wells and hairs were washed 5 times with TBST-0.5%. One milliliter of TBST-0.5% containing 1 mg/mL BSA was added to each well. Then, 10 ⁇ L of the original phage library (2 x 10 11 pfu), either the 12-mer or 7-mer library, was added to the pig skin bottom wells that did not contain a hair sample and the phage library was incubated for 15 min at room temperature.
  • the unbound phages were then transferred to pig skin bottom wells containing the hair samples and were incubated for 15 min at room temperature.
  • the hair samples and the wells were washed 10 times with TBST-0.5%.
  • the hairs were then transferred to clean, plastic bottom wells of a 24-well plate and 1 mL of a non-specific elution buffer consisting of 1 mg/mL BSA in 0.2 M glycine-HCI, pH 2.2, was added to each well and incubated for 10 min to elute the bound phages.
  • 160 ⁇ L of neutralization buffer consisting of 1 M Tris-HCI, pH 9.2, was added to each well.
  • the eluted phages from each well were transferred to a new tube for titering and sequencing.
  • the eluted phage was diluted with SM buffer (100 mM NaCl, 12.3 mM MgSO 4 -7 H 2 O, 50 mM Tris-HCI, pH 7.5, and 0.01 wt/vol % gelatin) to prepare 10-fold serial dilutions of 10 1 to 10 4 .
  • SM buffer 100 mM NaCl, 12.3 mM MgSO 4 -7 H 2 O, 50 mM Tris-HCI, pH 7.5, and 0.01 wt/vol % gelatin
  • coli ER2738 (New England BioLabs), grown in LB medium for 20 min and then mixed with 3 mL of agarose top (LB medium with 5 mM MgCl 2 , and 0.7% agarose) at 45 °C. This mixture was spread onto a S- GalTM/LB agar plate (Sigma Chemical Co.) and incubated overnight at 37 °C.
  • the S-GalTM/LB agar blend contained 5 g of tryptone, 2.5 g of yeast extract, 5 g of sodium chloride, 6 g of agar, 150 mg of 3,4- cyclohexenoesculetin- ⁇ -D-galactopyranoside (S-GalTM), 250 mg of ferric ammonium citrate and 15 mg of isopropyl ⁇ -D-thiogalactoside (IPTG) in 500 mL of distilled water.
  • the plates were prepared by autoclaving the S- GalTM /LB for 15 to 20 min at 121-124 °C. The single black plaques were randomly picked for DNA isolation and sequence analysis.
  • the remaining eluted phages were amplified by incubating with diluted E.coli ER2738, from an overnight culture diluted 1 :100 in LB medium, at 37 °C for 4.5 h. After this time, the cell culture was centrifuged for 30 s and the upper 80% of the supernatant was transferred to a fresh tube, 1/6 volume of PEG/NaCI (20% polyethylene glyco-800, 2.5 M sodium chloride) was added, and the phage was allowed to precipitate overnight at 4°C. The precipitate was collected by centrifugation at 10,000 x g at 4 °C and the resulting pellet was resuspended in 1 mL of TBS. This was the first round of amplified stock.
  • the amplified first round phage stock was then titered according to the same method as described above. For the next round of biopanning, more than 2 x10 11 pfu of phage stock from the first round was used. The biopanning process was repeated for 3 to 6 rounds depending on the experiments.
  • the single plaque lysates were prepared following the manufacture's instructions (New England Labs) and the single stranded phage genomic DNA was purified using the QIAprep Spin M13 Kit (Qiagen, Valencia, CA) and sequenced at the DuPont Sequencing Facility using -96 gill sequencing primer (5'-CCCTCATAGTTAGCGTAACG-3'), given as SEQ ID NO:62.
  • the displayed peptide is located immediately after the signal peptide of gene III.
  • the amino acid sequences of the eluted normal hair-binding phage peptides from the 12-mer library isolated from the fifth round of biopanning are given in Table 1.
  • the amino acid sequences of the eluted bleached hair-binding phage peptides from the 12-mer library isolated from the fifth round of biopanning are given in Table 2.
  • Repeated amino acid sequences of the eluted normal hair-binding phage peptides from the 7- mer library from 95 randomly selected clones, isolated from the third round of biopanning, are given in Table 3.
  • the frequency represents the number of identical sequences tha occurred out of 23 sequenced clones.
  • Table 2 Amino Acid Seguences of Eluted Bleached Hair-Binding Phage Peptides from 12-Mer Library
  • the frequency represents the number of identical sequences that occurred out of 24 sequenced clones.
  • EXAMPLE 2 Selection of High Affinity Hair-Binding Phage Peptides Using a Modified Method The purpose of this Example was to identify hair-binding phage peptides with a higher binding affinity. The hairs that were treated with the acidic elution buffer, as described in Example 1 , were washed three more times with the elution buffer and then washed three times with TBST-0.5%. These hairs, which had acid resistant phage peptides still attached, were used to directly infect 500 ⁇ L of mid-log phase bacterial host cells, E.
  • coli ER2738 (New England BioLabs), which were then grown in LB medium for 20 min and then mixed with 3 mL of agarose top (LB medium with 5 mM MgCI 2 , and 0.7% agarose) at 45 °C. This mixture was spread onto a LB medium/IPTG/ S-GalTM plate (LB medium with 15 g/L agar, 0.05 g/L IPTG, and 0.04 g/L S-GalTM) and incubated overnight at 37 °C. The black plaques were counted to calculate the phage titer. The single black plaques were randomly picked for DNA isolation and sequencing analysis, as described in Example 1.
  • EXAMPLE 3 Selection of High Affinity Fingernail-Binding Phage Peptides The purpose of this Example was to identify phage peptides that have a high binding affinity to fingernails.
  • the modified biopanning method described in Example 2 was used to identify high affinity, fingernail-binding phage-peptide clones.
  • Human fingernails were collected from test subjects. The fingernails were cleaned by brushing with soap solution, rinsed with deionized water, and allowed to air-dry at room temperature. The fingernails were then powdered under liquid N 2 , and 10 mg of the fingernails was added to each well of a 96-well filter plate.
  • the fingernail samples were treated for 1 h with blocking buffer consisting of 1 mg/mL BSA in TBST-0.5%, and then washed with TBST-0.5%.
  • the fingernail samples were incubated with phage library (Ph.D-12 Phage Display Peptide Library Kit), and washed 10 times using the same conditions described in Example 1.
  • phage library Ph.D-12 Phage Display Peptide Library Kit
  • the fingernail samples were washed three more times with the elution buffer and then washed three times with TBST-0.5%.
  • the acid- treated fingernails, which had acid resistant phage peptides still attached, were used to directly infect E. coli ER2738 cells as described in Example 2.
  • the frequency represents the number of identical sequences that occurred out of 75 sequenced clones.
  • EXAMPLE 4 Selection of High Affinity Skin-Binding Phage Peptides The purpose of this Example was to identify phage peptides that have a high binding affinity to skin. The modified biopanning method described in Examples 2 and 4 was used to identify the high affinity, skin- binding phage-peptide clones. Pig skin served as a model for human skin in the process. The pig skin was prepared as described in Example 1. Three rounds of screenings were performed with the custom, pig skin bottom biopanning apparatus using the same procedure described in Example 4. A total of 28 single black phage plaques were picked randomly for DNA isolation and sequencing analysis and one repeated clone was identified.
  • This assay measures the output pfu retained by 10 mg of hair surfaces, having a signal to noise ratio of 10 3 to 10 4 .
  • the input for all the phage clones was 10 14 pfu. It should be emphasized that this assay measures the peptide-expressing phage particle, rather than peptide binding.
  • Normal hairs were cut into 0.5 cm lengths and 10 mg of the cut hair was placed in each well of a 96-well filter plate (Qiagen). Then, the wells were filled with blocking buffer containing 1 mg/mL BSA in TBST-0.5% and incubated for 1 h at 4 °C. The hairs were washed 5 times with TBST- 0.5%.
  • the wells were then filled with 1 mL of TBST-0.5% containing 1 mg/mL BSA and then purified phage clones (10 14 pfu) were added to each well.
  • the hair samples were incubated for 15 min at room temperature and then washed 10 times with TBST-0.5%.
  • the hairs were transferred to a clean well and 1.0 mL of a non-specific elution buffer, consisting of 1 mg/mL BSA in 0.2 M Glycine-HCI at pH 2.2, was added to each well.
  • the samples were incubated for 10 min and then 160 ⁇ L of neutralization buffer (1 M Tris-HCI, pH 9.2) was added to each well.
  • the eluted phages from each well were transferred to a new tube for titering and sequencing analysis.
  • the eluted phage was diluted with SM buffer to prepare 10-fold serial dilutions of 10 1 to 10 8 .
  • a 10 ⁇ L aliquot of each dilution was incubated with 200 ⁇ L of mid-log phase E. coli ER2738 (New England BioLabs), and grown in LB medium for 20 min and then mixed with 3 mL of agarose top (LB medium with 5 mM MgC , and 0.7% agarose) at 45 °C.
  • This mixture was spread onto a LB medium/IPTG/Xgal plate (LB medium with 15 g/L agar, 0.05 g/L IPTG, and 0.04 g/L Xgal) and incubated overnight at 37 °C.
  • the blue plaques were counted to calculate the phage titers, which are given in Table 9.
  • ELISA Enzyme-linked immunosorbent assay
  • a unique hair or pig skin-bottom 96-well apparatus was created by applying one layer of Parafilm R under the top 96-well block of a Minifold I Dot-Blot System (Schleicher & Schuell, Inc., Keene, NH), adding hair or a layer of hairless pig skin on top of the Parafilm cover, and then tightening the apparatus.
  • the hair-covered well was incubated for 1 h at room temperature with 200 ⁇ L of blocking buffer, consisting of 2% non-fat dry milk (Schleicher & Schuell, Inc.) in TBS.
  • a second Minifold system with pig skin at the bottom of the wells was treated with blocking buffer simultaneously to serve as a control.
  • the blocking buffer was removed by inverting the systems and blotting them dry with paper towels.
  • the systems were rinsed 6 times with wash buffer consisting of TBST-0.05%.
  • the wells were filled with 200 ⁇ L of TBST- 0.5% containing 1 mg/mL BSA and then 10 ⁇ L (over 10 12 copies) of purified phage stock was added to each well.
  • the samples were incubated at 37 °C for 15 min with slow shaking.
  • the non-binding phage was removed by washing the wells 10 to 20 times with TBST-0.5%.
  • the synthetic hair-binding peptide D21 given as SEQ ID NO:46, was synthesized by SynPep (Dublin, CA).
  • SynPep As a control, an unrelated synthetic skin-binding peptide, given as SEQ ID NO:61 , was added to the system.
  • the experimental conditions were similar to those used in the ELISA method described in Example 5.
  • the phage-complexed hairs were washed with 10%, 30% and 50% shampoo solutions (Pantene Pro-V shampoo, Sheer Volume, Proctor & Gamble, Cincinnati, OH), for 5 min in separate tubes, followed by six TBS buffer washes.
  • the washed hairs were directly used to infect host bacterial cells as described in the modified biopanning method, described in Example 2.
  • a potential problem with this method is the effect of the shampoo on the phage's ability to infect bacterial host cells.
  • a known amount of phage particles was added to a 10% shampoo solution for 5 min, and then a portion of the solution was used to infect bacterial cells.
  • the titer of the shampoo-treated phage was 90% lower than that of the untreated phage.
  • the 30% and 50% shampoo treatments gave even more severe damage to the phage's ability to infect host cells. Nevertheless, two shampoo-resistant hair-binding phage-peptides were identified, as shown in Table 12.
  • EXAMPLE 8 Selection of Shampoo-Resistant Hair-Binding Phage-Peptides Using PCR
  • the purpose of this Example was to select shampoo-resistant hair- binding phage-peptides using a PCR method to avoid the problem of shampoo induced damage to the phage.
  • This principle of the PCR method is that DNA fragments inside the phage particle can be recovered using PCR, regardless of the phage's viability, and that the recovered DNA fragments, corresponding to the hair-binding peptide sequences, can then been cloned back into a phage vector and packaged into healthy phage particles.
  • Biopanning experiments were performed using 7-mer and 12-mer phage-peptide libraries against normal and bleached hairs, as described in Example 1.
  • the phage-treated hairs were subjected to 5 min of shampoo washes, followed by six TBS buffer washes.
  • the shampoo-washed hairs were put into a new tube filled with 1 mL of water, and boiled for 15 min to release the DNA. This DNA-containing, boiled solution was used as a DNA template for PCR reactions.
  • the primers used in the PCR reaction were primers: M13KE-1412 Forward 5'- CAAGCCTCAGCGACCGAATA -3', given as SEQ ID NO:67 and M13KE- 1794 Reverse 5'- CGTAACACTGAGTTTCGTCACCA -3', given SEQ ID NO:68.
  • the PCR conditions were: 3 min denaturing at 96 °C, followed by 35 cycles of 94 °C for 30 sec, 50 °C for 30 sec and 60 °C for 2 min.
  • the PCR products (-400 bp), and M13KE vector (New England BioLabs) were digested with restriction enzymes Eag I and Acc651.
  • the ligation and transformation conditions as described in the Ph.D.TM Peptide Display Cloning System (New England Biolabs), were used.
  • the amino acid sequence of the resulting shampoo-resistant hair-binding phage-peptide is NTSQLST, given as SEQ ID NO:70.
  • EXAMPLE 9 Determination of the Affinity of Hair-Binding and Skin-Binding Peptides The purpose of this Example was to determine the affinity of the hair-binding and skin-binding peptides for their respective substrates, measured as MB50 values, using an ELISA assay. Hair-binding and skin-binding peptides were synthesized by Synpep Inc. (Dublin, CA). The peptides were biotinylated by adding a biotinylated lysine residue at the C-terminus of the amino acid binding sequences for detection purposes and an amidated cysteine was added to the C- terminus of the sequence.
  • the amino acid sequences of the peptides tested are given as SEQ ID NOs:71-74, as shown in Table 13.
  • the procedure used was as follows. The setup of the surface specific 96-well system used was the same as that described in Example 5. Briefly, the 96-wells with hair or pig skin surfaces were blocked with blocking buffer (SuperBlockTMfrom Pierce Chemical Co., Rockford, IL) at room temperature for 1 h, followed by six washes with TBST-0.5%, 2 min each, at room temperature. Various concentrations of biotinylated, binding peptide were added to each well, incubated for 15 min at 37 °C, and washed six times with TBST-0.5%, 2 min each, at room temperature.
  • blocking buffer SuperBlockTMfrom Pierce Chemical Co., Rockford, IL
  • HRP horseradish peroxidase conjugate
  • the skin was treated with D-biotin to block the excess streptavidin binding sites.
  • the remaining steps were identical to those used for the hair samples.
  • the results were plotted as A450 versus the concentration of peptide using GraphPad Prism 4.0 (GraphPad Software, Inc., San Diego, CA).
  • the MB50 values were calculated from Scatchard plots and are summarized in Table 13. The results demonstrate that the binding affinity of the hair-binding peptides (D21 , F35, and I-B5) and the skin binding peptide (SEQW ID NO:61 ) for their respective substrate was high, while the binding affinity of the hair-binding peptides (D-21 and l-B5)for skin was relatively low.
  • EXAMPLE 10 Preparation of a Peptide-Based-Carbon Black Hair Colorant
  • the purpose of this Example was to prepare a peptide-based- carbon black hair colorant by covalently linking the hair-binding peptide D21 , given as SEQ ID NO:46, to the surface of carbon black particles.
  • the surface of the carbon black particles was functionalized by reaction with 2,2'-azobis(2methylpropionamide)-dihydrochloride to introduce free amino groups.
  • the functionalized carbon black particles were then covalently linked to the specific hair-binding peptide.
  • Carbon black (Nipex ® 160-IQ from Degussa, Allendale, NJ), 2.0 g, and 1.0 g of 2,2'-Azobis(2-methylpropionamide)dihydrochloride (Aldrich, Milwaukee, Wl) were added to a 100 mL round-bottom flask and 30 mL of dioxane was added. The flask was purged with nitrogen for 5 min. Then, the flask was sealed with a rubber septum and the reaction mixture was stirred at 65 °C for 14 h.
  • the hair-binding peptide from phage clone D21 (0.25 g), given as SEQ ID NO:46 (95% purity, obtained from SynPep, Dublin, CA) was mixed with 2.5 mL of deionized water in a 25 mL round- bottom flask. Then, 20 mg of NaOH and 0.25 mL of t-butyl alcohol were added. After stirring the mixture for 2 min, 0.12 g of di-tert-butyl dicarbonate (t-Boc anhydride) (Aldrich) was added dropwise. The flask was sealed with a rubber septum and the reaction mixture was stirred overnight at room temperature.
  • t-Boc anhydride di-tert-butyl dicarbonate
  • the reaction mixture was clear at the beginning of the reaction and became cloudy and then, precipitated after 1 h.
  • water (10 mL)
  • the reaction mixture formed a milky emulsion, which was then extracted three times with 5 mL portions of methylene chloride.
  • the organic layer was washed twice with 5 mL portions of deionized water.
  • the clear water layers were all combined and dried by lyophilization, yielding 0.20 g of a fluffy white powder (80% yield).
  • the product was analyzed by liquid chromatography-mass spectrometry (LC-MS) and was found to have a molecular weight of 1323 g/mol, with a purity of 90% by weight.
  • LC-MS liquid chromatography-mass spectrometry
  • EXAMPLE 12 Preparation of a Peptide-Based Hair Conditioner
  • the purpose of this Example was to prepare a peptide-based hair conditioner by covalently linking the hair-binding D21 peptide, given as SEQ ID NO:46, with behenyl alcohol using carbodiimide coupling.
  • Behenyl alcohol (Aldrich) 81.7 mg, and 62.0 mg of dicyclohexyl carbodiimide (DCC) were dissolved in 2.0 mL of THF in a 25 mL round- bottom flask.
  • DCC dicyclohexyl carbodiimide
  • EXAMPLE 13 Preparation of a Peptide-Based Hair Conditioner
  • the purpose of this Example was to prepare a peptide-based hair conditioner by covalently linking the hair-binding, cysteine-attached D21 peptide, given as SEQ ID NO:64, with octylamine using the heterobifunctional cross-linking agent 3-maleimidopropionic acid N- hydroxysuccinimide ester.
  • Octylamine obtained from Aldrich (Milwaukee, Wl) was diluted by adding 11.6 mg to 0.3 mL of DMF.
  • This diluted solution was added to a stirred solution containing 25 mg of 3-maleimidopropionic acid N- hydroxysuccinimide ester (Aldrich) and 5 mg of diisopropylethylamine (Aldrich) in 0.2 mL of DMF in a 5 mL round bottom flask.
  • the reaction mixture turned turbid immediately and then became clear several minutes later.
  • the solution was stirred for another 4 h.
  • the solution was then dried under high vacuum.
  • the product, octylamine-attached maleimidopropionate was purified by column chromatography using a Silica gel 60 (EMD Chemicals, formerly EM Science, Gibbstown, NJ) column and DMF/ether as the eluent.
  • cysteine-attached D21 peptide obtained from SynPep, Dublin, CA
  • SEQ ID NO:64 50 mg of cysteine-attached D21 peptide
  • SEQ ID NO:46 0.5 mL of 0.1 M phosphate buffer at pH 7.2
  • This mixture was stirred at room temperature for 6 h.
  • EXAMPLE 14 Preparation of a Peptide-Based-Carbon Black Hair Colorant The purpose of this Example was to prepare a peptide-based carbon black hair colorant using carbon black that was functionalized with ethanol amine. The number of peptides attached to the carbon black surface was estimated from chemical analyses. Preparation of Acid Functionalized Carbon Black Particles: In a 1 ,000 mL beaker was added 25.5 g of carbon black (Nipex-
  • the average size of the functionalized carbon black particles was 100 nm, as measured using a particle size analyzer (Microtrac Ultrafine Particle Analyzer, Microtrac Inc., Montgomeryville, PA).
  • a particle size analyzer Microtrac Ultrafine Particle Analyzer, Microtrac Inc., Montgomeryville, PA.
  • Amino-Functionalized Carbon Black Using Ethanolamine: Two grams of the dried, acid functionalized carbon black, 25 mL of ethanolamine (99% from Aldrich) and 1 mL of concentrated H2SO4 (98%, GR grade from EMD Chemicals) were mixed in a 100 mL round bottom flask. The mixture was stirred rapidly with a magnetic stirrer and refluxed for 6 h.
  • a 30% shampoo solution Pantene Pro-V shampoo
  • the flask was sealed with a rubber stopper and the reaction mixture was stirred at 50 °C for 5 h and then, at room temperature overnight. After the reaction was completed, the solvent was pumped out under vacuum. After drying, 122 mg of the solid product was obtained. The yield was about 90%.
  • the solid product was dissolved in N, N-dimethylacetamide (DMAC, from EMD Chemicals) and 5 mg/mL of the product solution in DMAC was prepared for GPC (gel permeation chromatography) analysis with refractive index detection to determine the molecular weight.
  • the original polysiloxane (Dow Corning 2-8566) was not soluble in DMAC and was not observed in the separation region of the chromatogram.
  • the D21 peptide had a sharp, low molecular weight peak, and the product sample contained 2 peaks, one from the free D21 peptide and a broad peak, which was attributed to polysiloxane grafted with D21 peptide.
  • the weight-average molecular weight (M w ) was calculated from polymethylmethacrylate (PMMA) standards.
  • the M w of D21 peptide and the peptide-polysiloxane conditioner were 4.7x10 3 , and 4.4x10 4 , respectively.
  • a cleavage reagent (which is named Reagent K by SynPep) having the following composition: trifluoroacetic acid/H2O/thioanisole/ethanedithiol/phenol (85:5:5:2.5:2.5, by volume) was used to cleave the protecting groups from the side functional groups of the D21 peptide.
  • Reagent K (1 mL) was pre-cooled to -20 °C and then, added to 100 mg of the D21 peptide-polysiloxane conditioner. The mixture was stirred for 3-4 h at room temperature and then Reagent K was removed under high vacuum.
  • EXAMPLE 17 Effectiveness of Peptide-Based Hair Conditioner The purpose of this Example was to demonstrate the effectiveness of a peptide-based hair conditioner in reducing frictional forces in human hair fibers and to compare its performance against a commercial conditioning agent. Fiber friction is a significant contributor to combing behavior of hair fiber assemblies (i.e., multiple fibers).
  • the single hair fiber characterization of frictional forces can be related to the combing behavior of the hair assembly.
  • I nterfiber friction studies illustrate the improvement to the hair surface from conditioner applications. The lower the interfiber friction, the smoother the hair looks and feels, and the easier it is to comb.
  • the interfiber friction measurement method employed in this Example is one of a few hair fiber tests to give hard, quantitative data and is generally accepted in the industry.
  • the peptide-based hair conditioner described in Example 12 which consists of the hair-binding peptide given as SEQ ID NO:46 covalently linked to behenyl alcolhol, was used in a formulation consisting of a mixture of 0.25% by weight of the peptide-based conditioner and 1.5% by weight of PerformixTM Lecithin (ADM Lecithin, Decatur. IL) in distilled water.
  • PerformixTM Lecithin ADM Lecithin, Decatur. IL
  • Frictional force measurements of treated hair fibers were measured by the Interfiber friction test using a single-fiber friction apparatus, as describe by Kamath et al. (J. Appl. Polymer Sci., 85:394-414 (2002) ⁇ . Hair fibers were evaluated at high normal forces (high load) (0.74 g) against a chromed steel wire, crosshead speed of 1 mm/min, using an Instron
  • the peptide-based conditioner had a lower average friction than the Dow Corning 929 Cationic Emulsion conditioner in both cases. Subsequently, a conditioning sample of 1.5% lecithin was tested for fiber friction (low load) and the average mean frictional force was 3.366 mg, indicating that the conditioning effects observed with the peptide-based conditioner was not due to the presence of the lecithin in the formulation. These results demonstrate the effectiveness of the peptide-based hair conditioner.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Dermatology (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Cosmetics (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP04788667A 2003-09-08 2004-09-08 Konditionierer und färbemittel auf peptidbasis für haar, haut und nägel Withdrawn EP1663118A4 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP11150381A EP2374465A1 (de) 2003-09-08 2004-09-08 Pflegespülung auf Peptidbasis und Färbemittel für Haar, Haut und Nägel

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US50149803P 2003-09-08 2003-09-08
US56264504P 2004-04-15 2004-04-15
PCT/US2004/029514 WO2005025505A2 (en) 2003-09-08 2004-09-08 Peptide-based conditioners and colorants for hair, skin, and nails

Publications (2)

Publication Number Publication Date
EP1663118A2 EP1663118A2 (de) 2006-06-07
EP1663118A4 true EP1663118A4 (de) 2008-10-15

Family

ID=34316487

Family Applications (2)

Application Number Title Priority Date Filing Date
EP04788667A Withdrawn EP1663118A4 (de) 2003-09-08 2004-09-08 Konditionierer und färbemittel auf peptidbasis für haar, haut und nägel
EP11150381A Withdrawn EP2374465A1 (de) 2003-09-08 2004-09-08 Pflegespülung auf Peptidbasis und Färbemittel für Haar, Haut und Nägel

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP11150381A Withdrawn EP2374465A1 (de) 2003-09-08 2004-09-08 Pflegespülung auf Peptidbasis und Färbemittel für Haar, Haut und Nägel

Country Status (8)

Country Link
EP (2) EP1663118A4 (de)
JP (1) JP5180475B2 (de)
CN (2) CN1863501B (de)
BR (1) BRPI0406215A (de)
CA (1) CA2503838C (de)
MX (1) MXPA05004820A (de)
NO (1) NO20051968L (de)
WO (1) WO2005025505A2 (de)

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7309482B2 (en) * 2003-09-08 2007-12-18 E.I. Du Pont De Nemours And Company Long lasting waterproof sunscreen comprising metal oxide and peptide conditioner
US7220405B2 (en) * 2003-09-08 2007-05-22 E. I. Du Pont De Nemours And Company Peptide-based conditioners and colorants for hair, skin, and nails
US7285264B2 (en) * 2003-09-08 2007-10-23 E.I. Du Pont De Nemours And Company Peptide-based body surface coloring reagents
US7736633B2 (en) * 2005-09-28 2010-06-15 E.I. Du Pont De Nemours And Company Method for enhancing effects of colorants and conditioners
US8318659B2 (en) * 2005-11-15 2012-11-27 E I Du Pont De Nemours And Company Peptide-based organic sunscreens
US20080280810A1 (en) * 2006-10-30 2008-11-13 O'brien John P Peptides having affinity for body surfaces
US20080175798A1 (en) * 2006-12-11 2008-07-24 Beck William A Peptide-based hair protectants
JP5466819B2 (ja) * 2007-09-28 2014-04-09 花王株式会社 毛髪化粧料
WO2009059455A1 (en) * 2007-11-06 2009-05-14 Kao Corporation Hair cosmetic composition
WO2009073759A1 (en) * 2007-12-04 2009-06-11 Boston Cosmetics, Llc Pigment compositions for hair coloring
CN102015540B (zh) * 2008-05-02 2014-11-26 宝丽化学工业有限公司 二氧化钛微粒复合物和包含该二氧化钛微粒复合物的组合物
JP2012522057A (ja) * 2009-03-30 2012-09-20 ジヨンソン・アンド・ジヨンソン・コンシユーマー・カンパニーズ・インコーポレーテツド 化粧用剤の送達のためのペプチドに基づく系
GB2488493B (en) 2009-12-24 2017-12-06 Unilever Plc Sunless tanning compositon comprising dihydroxyacetone and pyranones
US8821839B2 (en) 2010-10-22 2014-09-02 Conopco, Inc. Compositions and methods for imparting a sunless tan with a vicinal diamine
US8398959B2 (en) 2010-12-06 2013-03-19 Conopco, Inc. Compositions and methods for imparting a sunless tan with functionalized adjuvants
US8961942B2 (en) 2011-12-13 2015-02-24 Conopco, Inc. Sunless tanning compositions with adjuvants comprising sulfur comprising moieties
CN109393613A (zh) * 2018-10-22 2019-03-01 安徽罗曼丝发制品有限公司 一种延长假发使用寿命的防护方法
CN110101153B (zh) * 2019-04-22 2021-08-31 太和县金意成毛发制品有限公司 一种修复假发中角质蛋白活性的处理方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0736544A1 (de) * 1995-04-05 1996-10-09 Unilever Plc Mundpflegemittel
US6232287B1 (en) * 1998-03-13 2001-05-15 The Burnham Institute Molecules that home to various selected organs or tissues
US20030152976A1 (en) * 2000-04-14 2003-08-14 Janssen Giselle G. Methods for selective targeting
WO2005117537A2 (en) * 2004-04-15 2005-12-15 E.I. Dupont De Nemours And Company Peptide-based carbon nanotube hair colorants and their use in hair colorant and cosmetic compositions

Family Cites Families (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4416873A (en) 1982-06-01 1983-11-22 Charles Of The Ritz Group Ltd. Combined allantoin-hydrolyzed animal protein skin preparation
US4482537A (en) 1983-09-19 1984-11-13 Charles Of The Ritz Group Ltd. Skin conditioning composition
US5192332A (en) * 1983-10-14 1993-03-09 L'oreal Cosmetic temporary coloring compositions containing protein derivatives
US4588661A (en) 1984-08-27 1986-05-13 Engelhard Corporation Fabrication of gas impervious edge seal for a bipolar gas distribution assembly for use in a fuel cell
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4855483A (en) 1988-02-18 1989-08-08 General Electric Company Method for preparing polysalicylates
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
JPH02311412A (ja) 1989-05-26 1990-12-27 Ichimaru Pharcos Co Ltd 動物又は植物由来ペプチドのカチオン化修飾物を含有する化粧料
EP0546049B1 (de) 1990-08-28 1995-07-19 E.I. Du Pont De Nemours And Company Eine methode für die schnelle selektion von effizienten sekretionsvektoren
US5449754A (en) 1991-08-07 1995-09-12 H & N Instruments, Inc. Generation of combinatorial libraries
US5639603A (en) 1991-09-18 1997-06-17 Affymax Technologies N.V. Synthesizing and screening molecular diversity
EP0644938A1 (de) 1992-05-29 1995-03-29 E.I. Du Pont De Nemours And Company Herstellung von Streptavidin aus Bacillus Subtilis
US5585275A (en) 1992-09-02 1996-12-17 Arris Pharmaceutical Corporation Pilot apparatus for peptide synthesis and screening
JPH06227955A (ja) * 1992-12-08 1994-08-16 Kanebo Ltd 染毛剤又は化粧料及び前処理剤並びに染毛方法
US5480971A (en) 1993-06-17 1996-01-02 Houghten Pharmaceuticals, Inc. Peralkylated oligopeptide mixtures
US5490980A (en) 1994-09-28 1996-02-13 Chesebrough-Pond's Usa Co., Division Of Conopco, Inc. Covalent bonding of active agents to skin, hair or nails
JP3227317B2 (ja) 1994-10-04 2001-11-12 カネボウ株式会社 毛髪染毛前処理剤および毛髪染毛前処理化粧料ならびに染毛方法
JPH093100A (ja) 1995-04-18 1997-01-07 Kanebo Ltd 毛髪表層認識抗体,毛髪処理剤及び染毛剤並びに毛髪損傷診断剤
RU2173134C2 (ru) 1995-06-26 2001-09-10 Ханс Шварцкопф ГмбХ унд Ко. КГ Средство для обработки волос
US6013250A (en) 1995-06-28 2000-01-11 L'oreal S. A. Composition for treating hair against chemical and photo damage
US6398821B1 (en) 1996-12-23 2002-06-04 The Procter & Gamble Company Hair coloring compositions
JP3545588B2 (ja) 1997-03-24 2004-07-21 株式会社資生堂 毛髪化粧料
WO1999036570A2 (en) 1998-01-20 1999-07-22 Pericor Science Inc Transglutaminase linkage of agents to tissue
FR2774588B1 (fr) 1998-02-11 2000-05-05 Oreal Composition cosmetique ou dermatologique contenant au moins une proteine de soie d'arachnides naturelle, recombinante ou un analogue
DE69939527D1 (de) * 1998-03-13 2008-10-23 Burnham Inst Zielsuchende verbindungen für verschiedene organe und gewebe
US6344443B1 (en) 1998-07-08 2002-02-05 University Of South Florida Peptide antagonists of tumor necrosis factor alpha
FR2783169B1 (fr) 1998-09-15 2001-11-02 Sederma Sa Utilisation cosmetique ou dermopharmaceutique de peptides pour la cicatrisation et pour l'amelioration de l'aspect cutane lors du vieillissement naturel ou accelere (heliodermie, pollution)
GB9903584D0 (en) 1999-02-18 1999-04-07 Univ Leeds Modified calycins
GB9913765D0 (en) 1999-06-14 1999-08-11 Procter & Gamble Hair care compoaitions
WO2001007009A1 (en) 1999-07-22 2001-02-01 Pericor Science, Inc. Lysine oxidase linkage of agents to tissue
DE19961938A1 (de) 1999-12-22 2001-06-28 Cognis Deutschland Gmbh Verwendung von nanoskaligen Haarfarbstoffen
DE60033455T2 (de) * 1999-12-27 2007-11-29 Crucell Holland B.V. Menschlischer monoklonaler Antikörper gegen Ep-CAM und dessen Verwendung in Krebstherapie
US6774209B1 (en) * 2000-04-03 2004-08-10 Dyax Corp. Binding peptides for carcinoembryonic antigen (CEA)
DK1360500T3 (da) 2000-04-14 2010-05-25 Genencor Int Fremgangsmåde til selektiv målretning
KR100457350B1 (ko) * 2000-06-01 2004-11-16 이경림 IgE-의존적 히스타민 방출인자(HRF)의 수용체,HRF 결합 펩타이드 및 그들을 코딩하는 핵산, 및그들의 용도
JP2002363026A (ja) 2000-06-02 2002-12-18 Nihon Kolmar Co Ltd 化粧剤の吸着を増強させる方法および化粧料
US6562603B2 (en) 2000-08-04 2003-05-13 E. I. Du Pont De Nemours And Company 3-hydroxycarboxylic acid production and use in branched polymers
GB0103508D0 (en) 2001-02-13 2001-03-28 Univ Dundee Screening method and agents
US7186274B2 (en) 2002-04-08 2007-03-06 L'oreal Method for treating human keratin fibers with organomodified metallic particles
US7304128B2 (en) 2002-06-04 2007-12-04 E.I. Du Pont De Nemours And Company Carbon nanotube binding peptides
AU2003294266A1 (en) 2002-11-25 2004-06-18 Genencor International, Inc. Skin or hair binding peptides

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0736544A1 (de) * 1995-04-05 1996-10-09 Unilever Plc Mundpflegemittel
US6232287B1 (en) * 1998-03-13 2001-05-15 The Burnham Institute Molecules that home to various selected organs or tissues
US20030152976A1 (en) * 2000-04-14 2003-08-14 Janssen Giselle G. Methods for selective targeting
WO2005117537A2 (en) * 2004-04-15 2005-12-15 E.I. Dupont De Nemours And Company Peptide-based carbon nanotube hair colorants and their use in hair colorant and cosmetic compositions

Also Published As

Publication number Publication date
JP2007505132A (ja) 2007-03-08
EP2374465A1 (de) 2011-10-12
NO20051968L (no) 2005-07-04
CN102138869B (zh) 2013-05-01
CN1863501A (zh) 2006-11-15
CN1863501B (zh) 2011-05-25
BRPI0406215A (pt) 2005-08-09
NO20051968D0 (no) 2005-04-22
CA2503838A1 (en) 2005-03-24
EP1663118A2 (de) 2006-06-07
CA2503838C (en) 2014-08-19
WO2005025505A2 (en) 2005-03-24
JP5180475B2 (ja) 2013-04-10
MXPA05004820A (es) 2005-09-20
CN102138869A (zh) 2011-08-03
WO2005025505A3 (en) 2005-06-09

Similar Documents

Publication Publication Date Title
US7759460B2 (en) Peptide-based conditioners and colorants for hair, skin, and nails
US8475772B2 (en) Peptide-based oral care surface reagents for personal care
US20050226839A1 (en) Pepetide-based body surface reagents for personal care
US7285264B2 (en) Peptide-based body surface coloring reagents
CA2503838C (en) Peptide-based conditioners and colorants for hair
WO2008054746A1 (en) Peptides having affinity for body surfaces and modified by attachment of charged block at least one extremity
AU2004269781B8 (en) Peptide-based conditioners and colorants for hair, skin, and nails
US20100311641A1 (en) Peptide-based body surface coloring reagents

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060310

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

RIC1 Information provided on ipc code assigned before grant

Ipc: C07K 14/00 20060101ALI20060718BHEP

Ipc: A61K 38/16 20060101ALI20060718BHEP

Ipc: A61K 38/08 20060101ALI20060718BHEP

Ipc: C07K 7/06 20060101ALI20060718BHEP

Ipc: A61K 8/99 20060101ALI20060718BHEP

Ipc: A61K 38/10 20060101ALI20060718BHEP

Ipc: A61K 8/18 20060101AFI20060718BHEP

Ipc: C07K 7/08 20060101ALI20060718BHEP

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20080916

RIC1 Information provided on ipc code assigned before grant

Ipc: C07K 7/06 20060101ALI20080910BHEP

Ipc: C07K 7/08 20060101ALI20080910BHEP

Ipc: A61K 38/08 20060101AFI20080910BHEP

Ipc: A61K 38/10 20060101ALI20080910BHEP

Ipc: A61K 38/16 20060101ALI20080910BHEP

Ipc: C07K 14/00 20060101ALI20080910BHEP

17Q First examination report despatched

Effective date: 20090223

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110111