EP1592784A1 - Procedes de modification genetique d'organismes de l'espece blakeslea, organismes correspondants et leur utilisation - Google Patents

Procedes de modification genetique d'organismes de l'espece blakeslea, organismes correspondants et leur utilisation

Info

Publication number
EP1592784A1
EP1592784A1 EP04700993A EP04700993A EP1592784A1 EP 1592784 A1 EP1592784 A1 EP 1592784A1 EP 04700993 A EP04700993 A EP 04700993A EP 04700993 A EP04700993 A EP 04700993A EP 1592784 A1 EP1592784 A1 EP 1592784A1
Authority
EP
European Patent Office
Prior art keywords
seq
transformation
vector
blakeslea
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP04700993A
Other languages
German (de)
English (en)
Inventor
Markus Matuschek
Thorsten Heinekamp
Andre Schmidt
Axel Brakhage
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10300649A external-priority patent/DE10300649A1/de
Priority claimed from DE2003141272 external-priority patent/DE10341272A1/de
Application filed by BASF SE filed Critical BASF SE
Publication of EP1592784A1 publication Critical patent/EP1592784A1/fr
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/179—Colouring agents, e.g. pigmenting or dyeing agents
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L31/00—Edible extracts or preparations of fungi; Preparation or treatment thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
    • A23L5/40—Colouring or decolouring of foods
    • A23L5/42—Addition of dyes or pigments, e.g. in combination with optical brighteners
    • A23L5/43—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives
    • A23L5/44—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives using carotenoids or xanthophylls
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi

Definitions

  • the invention relates to a method for the genetic modification of organisms of the genus Blakeslea, corresponding organisms and their use.
  • Blakeslea mushrooms are known as production organisms. So z. B. Blakeslea trispora is used as a production organism for ⁇ -carotene (Ciegler, 1965, Adv Appl Microbiol. 7: 1) and lycopene (EP 1201762, EP 1184464, WO 03/038064). Blakeslea can also be used to produce other lipophilic substances such as other carotenoids and their precursors, phospholipids, triacylglycerides, steroids, waxes, fat-soluble vitamins, provitamins and cofactors or for the production of hydrophilic substances such as e.g. Proteins, amino acids, nucleotides and water-soluble vitamins, provitamins and cofactors.
  • hydrophilic substances such as e.g. Proteins, amino acids, nucleotides and water-soluble vitamins, provitamins and cofactors.
  • Carotenoids are used in animal feed, food,
  • the carotenoids mainly serve as pigments for coloring. Be next to it the antioxidant effects of carotenoids and other properties of these substances are used.
  • the carotenoids are divided into the pure hydrocarbons, the carotenes and the oxygenated hydrocarbons, the xanthophylls. Xanthophylls such as canthaxanthin and astaxanthin are used, for example, to pigment chicken eggs and fish (Britton et al. 1998, Carotenoids, Vol 3, Biosynthesis and Metabolism).
  • the carotenes ß-carotene and lycopene are mainly used in human nutrition.
  • ⁇ -carotene is used, for example, as a beverage dye.
  • Lycopene has a disease preventive effect (Argwal and Rao, 2000, CMAJ 163: 739-744; Rao and Argwal 1999, Nutrition Research 19: 305-323).
  • the colorless carotenoid precursor phytoene is particularly suitable for applications as an antioxidant.
  • the chemical synthesis is multi-stage, technically very complex and causes high manufacturing costs.
  • fermentative processes are technically relatively simple and are based on inexpensive starting materials. Fermentative processes for the production of carotenoids can be economically attractive and competitive for chemical synthesis if the productivity of the previous fermentative processes would be increased or new carotenoids could be produced on the basis of the known production organisms.
  • a method for the genetic modification of Blakeslea trispora is necessary especially if Blakeslea is to be used for the production of xanthophylls because these compounds are not naturally synthesized by Blakeslea.
  • various DNA sequences from Blakeslea trispora are known, in particular the DNA sequence which codes for the genes of carotenoid biosynthesis from geranylgeranyl pyrophosphate to ⁇ -carotene (WO 03/027293).
  • the Agrobacterium-mediated transformation was successfully used as a method for producing genetically modified fungi. So z. B. by the following organisms
  • Agrobacteria have been transformed: Saccharomyces cerevisiae (Bundock et al., 1995, EMBO Journal, 14: 3206-3214), Aspergillus awamori,
  • a transformation mediated by Agrobacterium and subsequent homologous recombination of the transferred DNA has so far been detected in the following organisms: Aspergillus awamori (Gouka et al. 1999, Nature Biotech 17: 598-601), Glarea lozoyensis (Zhang et al., 2003, Mol. Gen Genomics 268: 645-655), Mycosphaerella graminicola (Zwiers et al. 2001, Curr. Genet. 39: 388-393).
  • Electroporation is known as another method for transforming fungi.
  • the integrative transformation of yeast by electroporation was developed by Hill, Nucl. Acids. Res. 17: 8011.
  • the transformation by Chakaborty and Kapoor was described (1990, Nucl. Acids. Res. 18: 6737).
  • a "biolistic” method i.e. the transfer of DNA by bombarding cells with DNA-loaded particles, has been described, for example, for Trichoderma harzianum and Gliocladium virens (Lorito et al. 1993, Curr. Genet. 24: 349-356).
  • a particular difficulty in the production of specifically genetically modified Blakeslea and Blakeslea trispora is the fact that their cells are multinucleated at all stages of the sexual and vegetative cell cycle.
  • the genetic modification is usually only present in one or a few nuclei, i.e. the cells are heterokaryotic.
  • the genetically modified Blakeslea species in particular Blakeslea trispora
  • the strains must therefore be homokaryotic with regard to the genetic modification.
  • a recessive selection marker for Phycomyces blakesleanus is e.g. Dar + strains take up the toxic riboflavin analogue 5-carbon-5-deazariboflavin; Dar ⁇ strains, however, do not (Delbrück et al. 1979, Genetics 92:27). Recessive mutants are selected by adding 5-carbon-5-deazariboflavin (DARF).
  • DARF 5-carbon-5-deazariboflavin
  • the object of the present invention is to provide a method with which a genetic modification of Blakeslea strains, Blakeslea trispora in particular is possible.
  • This object is achieved comprehensively by a method for producing a genetically modified organism of the Blakeslea genus
  • the method according to the invention it is possible to specifically and stably genetically modify multinuclear cells of the Blakeslea fungi in order to obtain mycelium from cells with uniform nuclei. It is preferably cells from Blakeslea trispora fungi.
  • Transformation is understood to mean the transmission of genetic information into the organism, in particular fungus. This should include all possibilities known to the person skilled in the art for introducing the information, in particular DNA, e.g. B. bombardment with DNA-loaded particles, transformation by means of protoplasts, microinjection of DNA, electroporation, conjugation or transformation of competent cells, chemicals or agrobacteria mediated transformation.
  • a genetic section, a gene or several are considered as genetic information Genes understood.
  • the genetic information can e.g. B. with the help of a vector or as free nucleic acid (z. B. DNA, RNA) and otherwise introduced into the cells and either incorporated into the host genome by recombination or present in the cell in free form. Homologous recombination is particularly preferred.
  • the preferred transformation method is the Agrobacterium tumefaciens-mediated transformation.
  • the donor DNA to be transferred is first inserted into a vector which (i) has the T-DNA ends flanking the DNA to be transferred, which (ii) contains a selection marker and (iii) optionally promoters and terminators for has the gene expression of the donor DNA.
  • This vector is transferred to an Agrobacterium tumefaciens strain which contains a Ti plasmid with the vir genes. vir genes are responsible for DNA transfer in Blakeslea.
  • This two-vector system is used to transfer Agrobacterium's DNA into Blakeslea.
  • the agrobacteria are first incubated in the presence of acetosyringones.
  • Acetosyringone induces the vir genes. Then Blakeslea trispora spores are incubated together with the induced cells from Agrobacterium tumefaciens on medium containing acetosyringone and then transferred to medium which allows selection of the transformants, i.e. which enables genetically modified strains of Blakeslea.
  • vector is used in the present application as a name for a DNA molecule which is used for introducing and possibly for multiplying foreign DNA into a cell (see also "Vector” in Römpp Lexikon Chemie - CDROM Version 2.0, Stuttgart / New York: Georg Thieme Verlag 1999).
  • vector should be understood to mean plasmids, cosmids, etc., which serve this purpose.
  • expression is understood to mean the transfer of genetic information starting from DNA or RNA into a gene product (here preferably carotenoids) and is also intended to include the term overexpression, which means increased expression, so that an expression already in the untransformed cell (wild-type) manufactured product is increasingly produced or makes up a large part of the total content of the cell.
  • a gene product here preferably carotenoids
  • Genetic modification is understood to mean the introduction of genetic information into a recipient organism so that it is stably expressed and passed on during cell division. Thereafter, homokaryontization is carried out if necessary, i.e. the production of cells containing only uniform nuclei, d. H. Cores with the same genetic information content.
  • a selection of the mononuclear spores is preferably carried out for homokaryotization.
  • a small proportion of Blakeslea trispora spores are mononuclear, so that these may be identified by specific labeling, e.g. B.
  • FACS Fluorescence Activated Cell Sorting
  • a core reduction can first be carried out for homokaryotization.
  • a mutagenic agent can be used for this, in particular N-methyl-N'-nitro-nitrosoguanidine (MNNG) acts.
  • MNNG N-methyl-N'-nitro-nitrosoguanidine
  • high-energy rays such as UV or X-rays
  • the FACS procedure or recessive selection markers can then be used for selection.
  • Selection means the selection of cells whose nuclei contain the same genetic information, i. H. Cells that have the same properties as resistance or the manufacture or increased manufacture of a product.
  • 5-carbon-5-deazariboflavin may
  • hygromycin hyg
  • ⁇ '-fluororotate uracil
  • the vector used in transformation (i) can be designed in such a way that the genetic information contained in the vector is integrated into the genome of at least one cell. Genetic information in the cell can be switched off.
  • the vector used in the transformation (i) can also be designed such that the genetic information contained in the vector is expressed in the cell, i. H. genetic information is inserted which is not present in the corresponding wild type or which is amplified or overexpressed by the transformation.
  • the vector can contain any genetic information on the genetic changes of organisms of the genus Blakeslea.
  • “Genetic information” is preferably understood to mean nucleic acids, the introduction of which into the organism of the Blakeslea genus leads to a genetic change in organisms of the Blakeslea genus, that is to say, for example, to cause, increase or reduce enzyme activities compared to the starting organism.
  • the vector can contain, for example, genetic information for the production of lipophilic substances such as carotenoids and their precursors, phospholipids, triacylglycerides, steroids, waxes, fat-soluble vitamins, provitamins and cofactors or genetic information for the production of hydrophilic substances such as proteins, amino acids, nucleotides and water-soluble vitamins, Provitamins and cofactors.
  • the vector used preferably contains genetic information for the production of carotenoids or xanthophylls or their precursors.
  • the vector preferably contains genetic information which causes the carotenoid biosynthesis enzymes to be localized in the cell compartment in which the carotenoid biosynthesis takes place.
  • Genetic information for the production of astaxanthin, zeaxanthin, echinenone, ⁇ -cryptoxanthin, andonixanthin, adonirubin, canthaxanthin, 3- and 3'-hydroxyechinenone, lycopene, lutein, ⁇ -carotene, phytoene or phytofluene is particularly preferred.
  • Genetic information for the production of phytoene, bixin, lycopene, zeaxanthin, canthaxanthin and astaxanthin is very particularly preferred.
  • organisms are produced and cultivated which have an increased synthesis rate for intermediates in carotenoid biosynthesis and consequently have an increased productivity for end products in carotenoid biosynthesis.
  • the activities of the enzymes 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase, Isopentenyl pyrophosphate isomerase and geranyl pyrophosphate synthase increased.
  • organisms are produced and cultivated which have an increased HMG-CoA reductase activity compared to the wild type.
  • HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).
  • HMG-CoA reductase is understood to mean a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A into mevalonate.
  • HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme A converted or amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.
  • the HMG-CoA reductase activity is increased compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the formed amount of mevalonate increased.
  • This increase in HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type HMG-CoA reductase activity.
  • the HMG-CoA reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.
  • the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase into the organism, the expression of which in the organism compared with the wild type, is subject to reduced regulation.
  • a reduced regulation compared to the wild type means a regulation which is reduced compared to the wild type defined above, preferably no regulation at the expression or protein level.
  • the reduced regulation can preferably be achieved by a promoter which is functionally linked to the coding sequence in the nucleic acid construct and which is subject to a reduced regulation in the organism compared to the wild-type promoter.
  • promoters ptefl from Blakeslea trispora and pgpdA from Aspergillus nidulans are subject to only a reduced regulation and are therefore particularly preferred as promoters.
  • the reduced regulation can be achieved by using as nucleic acid encoding an HMG-CoA reductase uses a nucleic acid, the expression of which in the organism is subject to reduced regulation compared to the organism's own orthologic nucleic acid.
  • nucleic acid which encodes only the catalytic region of the HMG-CoA reductase (truncated (t-) HMG-CoA reductase) is particularly preferred.
  • the membrane domain responsible for regulation is missing.
  • the nucleic acid used is therefore subject to reduced regulation and leads to an increase in the gene expression of the HMG-CoA reductase.
  • nucleic acids are introduced into Blakeslea trispora which have the sequence SEQ ID. NO. 75 included.
  • HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the sequences from databases with homology the SEQ ID. NO. 75 easy to find.
  • HMG-CoA reductases and thus also for the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can furthermore be started, for example, from the sequence SEQ ID. NO. 75 from various organisms whose genomic sequence is not known, can be easily found in a manner known per se by hybridization and PCR techniques.
  • the reduced regulation is achieved by encoding a nucleic acid
  • HMG-CoA reductase uses a nucleic acid whose expression in the organism is subject to a reduced regulation compared to the organism's own orthologic nucleic acid and uses a promoter which is subject to a reduced regulation in the organism compared to the wild-type promoter.
  • the gene expression of the phytoendesaturase is switched off by the transformation, so that the phytoene produced by the organisms can be obtained.
  • the vector used in transformation (i) therefore preferably comprises a sequence coding for a fragment of the phytoendesaturase gene, in particular carB from Blakeslea trispora with SEQ ID NO: 69.
  • the gene expression of the lycopene cyclase is switched off by transformation, so that the lycopene produced by the organisms can be obtained.
  • the vector used in the transformation therefore preferably comprises a sequence coding for a fragment of the gene of lycopene cyclase, in particular carR from Blakeslea trisporas. (WO 03/027293).
  • the organisms of the Blakeslea genus are, for example, enabled to produce xanthophylls, such as zeaxanthin or astaxanthin, by the genetically modified organisms of the Blakeslea genus having a hydroxylase activity and / or a ketolase activity compared to the wild type.
  • the vector used in the transformation (i) thus contains genetic information which, after expression, has a ketolase and / or hydroxylase activity unfold so that the organisms produce zeaxanthin or astaxanthin.
  • Ketolase activity means the enzyme activity of a ketolase.
  • a ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted ⁇ -ionone ring of carotenoids.
  • a ketolase is understood to be a protein which has the enzymatic activity to convert ⁇ -carotene into canthaxanthin.
  • ketolase activity is understood to mean the amount of ⁇ -carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.
  • wild type is understood to mean the corresponding non-genetically modified starting organism of the Blakesleaa genus.
  • organism can be understood to mean the starting organism (wild type) of the Blakesleaa genus or a genetically modified organism of the Blakesleaa genus according to the invention, or both.
  • Wild type is preferably understood to mean a reference organism in each case for causing the ketolase activity and for causing the hydroxylase activity.
  • This reference organism of the genus Blakeslea is Blakeslea trispora ATCC 14271 or ATCC 14272, which differ only in the mating type.
  • ketolase activity in genetically modified organisms of the genus Blakesleaa according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
  • the determination of the ketolase activity in organisms of the genus Blakeslea is based on the method of Fraser et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997).
  • the ketolase activity in extracts is determined with the substrates beta-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate).
  • Substrate / product ratios from the ketolase assays are determined by means of HPLC.
  • the genetically modified organism of the genus Blakesleaa according to the invention has ketolase activity in comparison to the genetically unmodified wild type and is therefore preferably able to transgenically express a ketolase.
  • the ketolase activity in the organisms of the genus Blakesleaa is caused by gene expression of a nucleic acid encoding a ketolase.
  • the gene expression of a nucleic acid encoding a ketolase is preferably caused by introducing nucleic acids which encode ketolases into the starting organism of the Blakesleaa genus.
  • any ketolase gene that is to say any nucleic acids encoding a ketolase, can be used for this.
  • nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.
  • nucleic acid sequences such as that which have already been processed to use corresponding cDNAs.
  • nucleic acids encoding a ketolase and the corresponding ketolases that can be used in the method according to the invention are, for example, sequences from:
  • Haematoccus pluvialis especially from Haematoccus pluvialis Flotow em. Wille (Accession NO: X86782; nucleic acid: SEQ ID NO: 11, protein SEQ ID NO: 12),
  • Agrobacterium aurantiacum (Accession NO: D58420; nucleic acid: SEQ ID NO: 15, protein SEQ ID NO: 16),
  • Alicaligenes spec. (Accession NO: D58422; nucleic acid: SEQ ID NO: 17, protein SEQ ID NO: 18), Paracoccus marcusii (Accession NO: Y15112; nucleic acid: SEQ ID NO: 19, protein SEQ ID NO: 20),
  • Synechocystis sp. Strain PC6803 (Accession NO: NP442491; nucleic acid: SEQ ID NO: 21, protein SEQ ID NO: 22),
  • Bradyrhizobium sp. (Accession NO: AF218415; nucleic acid: SEQ ID NO: 23, protein SEQ ID NO: 24),
  • Nostoc punctiforme ATTC 29133 nucleic acid: Acc.-No. NZ_AABC01000195, base pair 55.604 to 55.392 (SEQ ID NO: 27); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 28) (annotated as putative protein) or
  • Nostoc punctiforme ATTC 29133 nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 29), protein: (SEQ ID NO: 30) (not annotated).
  • ketolases and ketolase genes which can be used in the method according to the invention can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences described above and in particular with easily find the sequences SEQ ID NO: 12 and / or 26 and / or 30.
  • ketolases and ketolase genes can also be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID NO: 12 and / or 26 and / or 30 from various organisms, the genomic sequence of which is not known, by hybridization techniques easy to find in a manner known per se.
  • the hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.
  • the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C.) and those with high stringency (with 0.2X SSC at 50 ° C., preferably at 65 ° C. ) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).
  • the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.
  • Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied.
  • Denaturing agents such as formamide or SDS can also be used during hybridization be used. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.
  • Hybridization conditions with, for example, (i) 4X SSC at 65 ° C, or
  • Salmon sperm DNA at 68 ° C, or (v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or (vi) 50% formamide, 4X SSC at 42 ° C, or
  • nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% at the amino acid level with the sequence z SEQ ID NO: 12 and has the enzymatic property of a ketolase.
  • This can be a natural ketolase sequence which can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which can be started from the sequence SEQ ID NO: 12 by artificial variation, for example by substitution , Insertion or deletion of amino acids has been modified.
  • nucleic acids which encode a protein are introduced, comprising the amino acid sequence SEQ ID NO: 26 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% in particular 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% at the amino acid level with the sequence SEQ ID NO: 26 and has the enzymatic property of a ketolase.
  • This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which, starting from the sequence SEQ ID NO: 26, can be found by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.
  • nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 30 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99% at the amino acid level with the sequence SEQ ID NO: 30 and has the enzymatic property of a ketolase.
  • This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms, or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 30 by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.
  • substitution is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid is similar Has property like the original amino acid, e.g. replacement of Glu by Asp, Gin by Asn, Val by He, Leu by Ile, Ser by Thr.
  • Deletion is the replacement of an amino acid with a direct link.
  • Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.
  • Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.
  • Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) using the following parameters becomes:
  • a protein that has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 12 or 26 or 30 is accordingly understood to mean a protein which, when comparing its sequence with the sequence SEQ ID NO: 12 or 26 or 30, in particular according to the above program logarithm with the above parameter set, has an identity of at least 20%, preferably 80%, 85%, particularly 90%, in particular 95%.
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • codon usage can easily be determined on the basis of computer evaluations of other known genes from organisms of the Blakesleaa genus.
  • a nucleic acid containing the sequence SEQ ID NO: 11 is introduced into the organism of the genus.
  • a nucleic acid containing the sequence SEQ ID NO: 25 is introduced into the organism of the genus.
  • a nucleic acid containing the sequence SEQ ID NO: 29 is introduced into the organism of the genus.
  • ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the Chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • the vector used in transformation (i) therefore preferably comprises a sequence coding for a ketolase, in particular the ketolase Nostoc punctiforme from with SEQ ID NO: 72.
  • Hydroxylase activity means the enzyme activity of a hydroxylase.
  • a hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted ⁇ -ionone ring of carotenoids.
  • a hydroxylase is understood to mean a protein which has the enzymatic activity to convert ⁇ -carotene into zeaxanthin or cantaxanthin into astaxanthin.
  • hydroxyase activity is understood to mean the amount of ⁇ -carotene or cantaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase. If the hydroxylase activity is higher than that of the wild type, the amount of ⁇ -carotene or canthaxantine or the amount of zeaxanthin or astaxanthin formed is increased by the protein hydroxylase in a certain time compared to the wild type.
  • This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the wild type.
  • hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
  • the activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalactosylglycerides are added to a certain amount of organism extract.
  • the hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (Xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L .; Biochim. Biophys. Acta 1391 (1998 ), 320-328):
  • the in vitro assay is carried out in a volume of 0.250 ml volume.
  • the mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP +
  • the hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):
  • the in vitro assay is carried out in a volume of 250 ⁇ l volume.
  • the mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 ⁇ g of chromoplastid stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP.
  • NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.
  • the hydroxylase activity can be increased in various ways, for example by switching off inhibitory ones
  • the increase in the gene expression of the nucleic acids encoding a hydroxylase compared to the wild type can also be achieved in various ways, for example by inducing the hydroxylase gene by activators or by introducing one or more hydroxylase gene copies, i.e. by introducing at least one nucleic acid encoding a hydroxylase into the thief Organism of the genus Blakesleaa.
  • the gene expression of a nucleic acid encoding a hydroxylase is increased by introducing at least one nucleic acid encoding a hydroxylase into the organism of the genus Blakesleaa.
  • any hydroxylase gene that is to say any nucleic acid which codes for a hydroxylase, can be used for this purpose.
  • nucleic acid sequences which have already been processed such as the corresponding cDNAs, are preferred to use.
  • a hydroxylase gene is a nucleic acid encoding a hydroxylase from Haematococcus pluvialis with the accession no. AX038729 (WO 0061764; nucleic acid: SEQ ID NO: 31, protein: SEQ ID NO: 32), from Erwinia uredovora 20D3 (ATCC 19321, Accession No. D90087; nucleic acid: SEQ ID NO: 33, protein: SEQ ID NO: 34 ) or Hydroxylase from Thermus thermophilus (DE 102 34 126.5) encoded by the sequence with SEQ ID NO 76.
  • Additional hydroxylases are encoded by the nucleic acids with the following accession numbers
  • the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase.
  • nucleic acids encoding proteins are preferably used which contain the amino acid sequence SEQ ID NO: 32, 34 or encoded by the sequence with SEQ ID NO 76 or one of these sequences by substitution, insertion or deletion Sequence derived from amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 80%, most preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% Amino acid level with the sequence SEQ. ID. NO: 32, 34 or encoded by the sequence with SEQ ID NO 76 and which have the enzymatic property of a hydroxylase.
  • hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO: 31, 33 or 76 easy to find.
  • hydroxylases and hydroxylase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 31, 33 or 76 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se Easy to find.
  • nucleic acids are introduced into organisms which encode proteins, containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 32, 34 or encoded by the sequence with the SEQ ID NO 76.
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this.
  • the codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms concerned.
  • a nucleic acid containing the sequence SEQ is brought. ID. NO: 31, 33 or 76 in the organism.
  • All of the above-mentioned hydroxylase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, 2nd edition, Wiley Press New York, pages 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • the vector used in the transformation (i) therefore preferably comprises a sequence coding for a hydroxlase, in particular a hydroxlase from Haematococcus pluvialis with the SEQ ID NO: 70 or a hydroxlase from Erwinia uredova with the SEQ ID NO: 71 or a hydroxylase from Thermus thermophilus encoded by the sequence with SEQ ID NO 76.
  • the vector used in transformation (i) preferably also contains expression-regulating and supporting areas, in particular promoters and terminators.
  • the vector used in transformation (i) preferably contains the gpd and / or the ptefl promoter and / or the trpC terminator. This have proven particularly useful for transforming blakeslea.
  • the use of "inverted repeats" IR, Römpp Lexikon der Biotechnologie 1992, Thieme Verlag Stuttgart, page 407 "Inverse repetitive sequences" for regulating expression or transcription is also within the scope of the invention.
  • the gpd promoter used in the vector advantageously has the sequence SEQ ID NO: 1.
  • the trpC terminator used in the vector advantageously has the sequence SEQ ID NO: 2.
  • the ptefl promoter used in the vector advantageously has the sequence SEQ ID NO: 35.
  • the gpd promoter and the trpC terminator from Aspergillus nidulans and the ptefl promoter from Blakeslea trispora are used.
  • the vector used in transformation (i) contains a resistance gene. It is preferably a hygromycin resistance gene (hph), in particular that from E. coli. This resistance gene has proven to be particularly suitable for the detection of the transformation and selection of the cells.
  • hph hygromycin resistance gene
  • P-gpdA the promoter of glyceraldehyde-3-phosphate dehydrogenase from Aspergillus nidulans, is therefore preferably used as the promoter for hph.
  • the terminator for hph is preferably t-trpC, the terminator of the trpC gene, coding for anthranilate synthase components from Aspergillus nidulans.
  • Descendants of the pBinAHyg vector have proven to be particularly suitable as vectors.
  • the vector used for the transformation therefore preferably comprises SEQ ID NO: 3.
  • the vectors therefore comprise the sequence SEQ ID NO: 69 coding for the phytoendesaturase.
  • the vectors further comprise the sequence SEQ ID NO: 72 coding for a ketolase.
  • the vectors further comprise the sequence SEQ ID NO: 70 or 71 or 76 coding for a hydoxylase.
  • the vector thus encompasses both a sequence SEQ ID NO: 72 coding for a ketolase and the sequence SEQ ID NO: 70 or 71 or 76 coding for a hydoxylase and thus enables the production of astaxanthin.
  • vectors selected from the group consisting of SEQ ID NO: 37 to 51 and 62 can be used in the context of the invention.
  • the genetically modified organisms can be used to produce carotenoids, xanthophylls or their precursors, in particular phytoene, bixion, astaxanthin, zeaxanthin and canthaxanthin.
  • New carotenoids that do not naturally occur in the wild type can also be generated by introducing the appropriate genetic information from the specifically genetically modified cells or the mycelium formed by them and then isolated. It is preferably possible to obtain carotenoids or their precursors with the specifically genetically modified cells or the mycelium formed by them.
  • the genetic modification is only carried out in cells of one of the mating types that occur (in Blakeslea trispora (+) or (-)), the corresponding other, unaltered mating type is added for cultivation, since this ensures good production of the carotenoids or their precursors due to the can be achieved from the second, unchanged mating type of substances released (e.g. trisporic acids).
  • the genetic modification is advantageously carried out in cells of both mating types and these are cultivated together. As a result, particularly good growth and optimal production of the carotenoids or their precursors are achieved. (Artificial) addition of trisporic acids is also possible and useful.
  • Trisporic acids are sex hormones in Mucorales mushrooms, such as Blakeslea, which stimulate the formation of zygophores and the production of ß-carotene (van den Ende 1968, J. Bacteriol. 96: 1298-1303, Austin et al. 1969, Nature 223: 1178 - 1179, Reschke Tetrahedron Lett. 29: 3435-3439, van den late 1970, J. Bacteriol. 101: 423-428).
  • Agrobacterium tumefaciens LBA4404 was grown according to Hoekema et al. (1983, Nature 303: 179-180) at 28 ° C for 24 h in Agrobacteria Minimal Medium (AMM): 10 mM K 2 HP0 4 , 10 mM KH 2 P0 4 , 10 mM glucose, MM salts (2, 5mM NaCl, 2mM MgS0 4 , 700 ⁇ M CaCl 2 , 9 ⁇ M FeS0 4 , 4mM (NH 4 ) 2 S0 4 ).
  • Agrobacteria Minimal Medium 10 mM K 2 HP0 4 , 10 mM KH 2 P0 4 , 10 mM glucose, MM salts (2, 5mM NaCl, 2mM MgS0 4 , 700 ⁇ M CaCl 2 , 9 ⁇ M FeS0 4 , 4mM (NH 4 ) 2 S0 4 ).
  • the plasmid pBinAHyg was electroporated into the Agrobacterium strain LBA 4404 (Hoekema et al., 1983, Nature 303: 179-180) (Mozo and Hooykaas, 1991, Plant Mol. Biol. 16: 917-918).
  • the following antibiotics were used for the selection of agrobacteria: rifampicin 50 mg / l (selection for the A. tumefaciens chromosome), streptomycin 30 mg / l (selection for the helper plasmid) and kanamycin 100 mg / l (selection for the binary vector).
  • agrobacteria were grown after 24 h in AMM to an OD 60 o of 0.15 in induction medium (IM: MM salts, 40 mM MES (pH 5.6), 5 mM glucose, 2 mM phosphate, 0.5 % Glycerol, 200 ⁇ M acetosyringone) and again grown overnight in IM to an OD ⁇ oo of approximately 0.6.
  • IM induction medium
  • IM MM salts, 40 mM MES (pH 5.6), 5 mM glucose, 2 mM phosphate, 0.5 % Glycerol, 200 ⁇ M acetosyringone
  • the medium contained hygromycin in a concentration of 100 mg / l for selection for transformed Blakeslea cells and 100 mg / l cefotaxime for selection against agrobacteria.
  • the incubation was carried out at 26 ° C. for about 7 days. The mycelium was then transferred to fresh selection plates.
  • spores formed were rinsed off with 0.9% NaCl and on CM 17-1 agar (3 g / l glucose, 200 mg / l L-asparagine, 50 mg / l MgSO 4 ⁇ 7H 2 0, 150 mg / l KH 2 P0 4 , 25 ⁇ g / l thiamineHCI, 100 mg / l yeast extract, 100 mg / l Na-deoxycholate, 100 mg / L hygromycin, 100 mg / L cefotaxime, pH 5.5.18 g / l agar).
  • the spores were individually deposited on selective medium using a BectonDickson FACS device (model Vantage + Diva Option).
  • the gpdA-hph-trpC cassette was isolated as a BglII / HindIII fragment from the plasmid pANsCosI (FIG. 1, Osiewacz, 1994, Curr. Genet. 26: 87-90, SEQ ID NO: 4) and inserted into the BamHI / HindIII fragment. Hindlll opened binary plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12: 8711-8721) ligated. The vector thus obtained was designated pBinAHyg (FIG. 2, SEQ ID NO: 3) and contained the E.
  • the plasmid pBinAHyg was electroporated into the agrobacterial strain LBA 4404 (Hoekema et al., 1983, Nature 303: 179-180) (Mozo and Hooykaas, 1991, Plant Mol. Biol. 16: 917-918).
  • the following antibiotics were used for the selection of agrobacteria: rifampicin 50 mg / l (selection for the A. tumefaciens chromosome), streptomycin 30 mg / l (selection for the helper plasmid) and kanamycin 100 mg / l (selection for the binary vector).
  • agrobacteria were grown after 24 h in AMM to an OD6 60 of 0.15 in induction medium (IM: MM salts, 40 mM MES (pH 5.6), 5 mM Glucose, 2 mM phosphate, 0.5% glycerol, 200 ⁇ M acetosyringone) and diluted again overnight in IM to an OD 660 of approximately 0.6.
  • IM MM salts, 40 mM MES (pH 5.6), 5 mM Glucose, 2 mM phosphate, 0.5% glycerol, 200 ⁇ M acetosyringone
  • the medium contained hygromycin in a concentration of 100 mg / l for selection for transformed Blakeslea cells and 100 mg / l cefotaxime for selection against agrobacteria.
  • the incubation was carried out at 26 ° C. for about 7 days. The mycelium was then transferred to fresh selection plates.
  • CM 17-1 agar 3 g / l glucose, 200 mg / l L-asparagine, 50 mg / l MgSO 4 ⁇ 7H 2 0, 150 mg / l KH2P04, 25 ⁇ g / l thiamine-HCl, 100 mg / l yeast extract, 100 mg / l Na deoxycholate, pH 5.5, 100 mg / l cefotaxime, 100 mg / l hygromycin, 18 g / l agar). The transfer of spores to fresh selection plates was repeated three times. The transformant Blakeslea trispora GVO 3005 was isolated in this way.
  • the spores were deposited individually using the BectonDickinson FacsVantage + Diva Option on CM-17 agar with 100 mg / l cefotaxime, 100 mg / l hygromycin. In this case, fungal mycelium was only formed where the spores were genetically modified.
  • the primers hph-forward (5'-CGATGTAGGAGGGCGTGGATA, SEQ ID NO: 5) and hph-reverse (5'-GCTTCTGCGGGCGATTTGTGT, SEQ ID NO: 6) were used to detect the hygromycin resistance gene (hph).
  • the expected fragment of hph was 800 bp in length.
  • nptlll-forward (5'-TGAGAATATCACCGGAATTG, SEQ ID NO: 7)
  • nptlll-reverse 5'-AGCTCGACATACTGTTCTTCC, SEQ ID NO: 8
  • the expected fragment of nptlll was 700 bp in length.
  • GTGAATGGAAATCCCATCGCTGTC SEQ ID NO: 9
  • MAT293 5'-AGTGGGTACTCTAAAGGCCATACC, SEQ ID NO: 10.
  • hygromycin resistance gene hph
  • glyceraldehyde-3-phosphate dehydrogenase gene gpdl
  • GMOs genetically modified organisms
  • the aim is to obtain strains of Blakeslea with the insertion of the foreign DNA in all nuclei, i.e.
  • the goal is a homonucleate recombinant fungal mycelium.
  • a small proportion of the Blakeslea trispora spores or the genetically modified strains of Blakeslea trispora are naturally single-core.
  • the mononuclear spores were sorted out by FACS and analyzed for MEP (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l Agar) with 100 mg / l cefotaxime and 100 mg / l hygromycin plated.
  • the mycelia formed here were homonucleate.
  • the spores of a 3-day-old smear were washed away with 10 ml Tris-HCI 50mMol + 0.1% Span20 per agar plate.
  • the spore concentration was 0.5 to 0.8 x 10 7 spores per ml.
  • 1 ml of DMSO and 10 ⁇ l of Syto 11 were added to 9 ml of spore suspension.
  • the dyeing was then carried out at 30 ° C. for 2 hours. Selection and storage was carried out using a FacsVantage + Diva Option device from Becton Dickinson.
  • MNNG N-methyl-N'-nitro-N-nitrosoguanidine
  • a spore suspension with 1 x 10 7 spores / ml in Tris / HCl buffer, pH 7.0 was first prepared.
  • MNNG was added to the spore suspension at a final concentration of 100 ⁇ g / ml.
  • the time of incubation in MNNG was chosen so that the survival rate of the spores was approx. 5%.
  • the spores were washed three times with 1 g / l Span 20 in 50 mM phosphate buffer pH 7.0 and sorted or selected according to the method described under 1).
  • X-rays and UV rays could also be used to reduce the number of nuclei in the spores, as described by Cerdä-Olmedo and Patricia Reau in Mutation Res., 9 (1970), 369-384.
  • the recessive selection marker pyrG can be used as a recessive selection marker for the selection of homonucleater mycelia.
  • Wild-type strains of Blakeslea trispora are pyrG + . These strains cannot grow in the presence of the pyrimidine analog 5-fluororotate (FOA) because they convert FOA to lethal metabolites through the orotidine-5'-monophosphate decarboxylase.
  • Genetically modified Blakesleaa which are homonucleate pyrG " , lack the enzyme activity orotidine-5'-monophosphate decarboxylase. As a result, these pyrG " strains cannot use 5-fluororotate. The strains therefore grow in the presence of FOA and uracil. In the case of the coupling of the mutation pyrG " and the insertion of foreign DNA on the core of a mononuclear spore, homonucleates recombinant fungal mycelium can be formed from this spore
  • Homonucleate GMOs from Blakeslea trispora with the phenotype pyrG " were selected as follows.
  • MEP (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l) was used as described above.
  • l agar plated with 100 mg / l cefotaxime and 100 mg / l hygromycin Transformants were washed off with 10 ml Tris-HCl 50mM + 0.1% Span20 per agar plate. The spore concentration was 0.5 to 0.8 x 10 7 spores per ml.
  • the spores were then plated on FOA medium with 100 mg / l cefotaxime and 100 mg / l hygromycin.
  • FOA medium contained 20 g glucose, 1 g FOA, 50 mg uracil, 200 ml citrate buffer (0.5 M, pH 4.5) and 40 ml trace salt solution according to Sutter, 1975, PNAS, 72: 127 per liter.
  • Homonucleate pyrG " mutants showed growth on the uracil-containing FOA medium, but no growth when plated on FOA medium without uracil.
  • homonucleate GMOs were produced from the Blakeslea trispora GMOs described below for the production of xanthophylls.
  • Exemplary embodiments for the production of genetically modified organisms of Blakeslea trispora for the production of carotenoids and carotenoid precursors were generated by the "overlap-extension PCR” method and by subsequent insertion of the amplification products into the plasmid pBinAHyg.
  • the "overlap-method” extension PCR was carried out as in Innis et al. (Eds.) PCR protocols: a guide to methods and applications, Academic Press, San Diego.
  • the transformation of the pBinAHyg derivatives and the production Homonucleating of genetically modified strains of Blakeslea trispora was carried out as described above.
  • plasmids (descendants of pBinAHyg) were used for the genetic engineering of Blakeslea trispora for the production of zeaxanthin.
  • BTpcarRA-HPcrtZ SEQ ID NO: 38, FIG. 6
  • p-carB-HPcrtZ containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarB promoter from Blakeslea trispora (Seq. PBinAHygBTpcarB-ID NOcr : 39, Fig. 7)
  • p-carRA-HPcrtZ-TAG-3'carA-IR containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora.
  • An inverted repeat structure is located downstream of the hydroxylase gene, which originates from the 3 ′ end of carA and the region located downstream of carA (IR, SEQ ID NO: 74, inverted repeat V approx. 350 bp from carA, then about 200 bp, loop 'and then about 350 bp inverted repeat 2') (Seq. pBinAHyg-BTpcarRA-HPcrtZ-TAG-3'carA-IR, SEQ ID NO: 40, Fig.
  • p-carRA-HPcrtZ-GCG-3'carA-IR containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora.
  • the hydroxylase gene is fused to an inverted repeat structure derived from the 3 'end of carA and the region downstream of carA (IR, SEQ ID NO: 74, inverted repeat 1' approx. 350 bp from carA , then approx. 200 bp, loop 'and then approx. 350 bp inverted repeat 2').
  • the derived fusion protein consequently consists of the hydroxylase from Haematococcus pluvialis and the carboxy terminus from CarA from Blakeslea trispora (Seq. PBinAHyg-
  • BTpcarRA-HPcrtZ-GCG-3'carA-IR SEQ ID NO: 41, Fig. 9
  • p-tef1-EUcrtZ containing gene of the hydroxylase EUcrtZ (SEQ ID NO: 71) from Erwinia uredova 20D3 (Accession No. D90087) under the control of the ptefl promoter (Seq. pBinAHygBTpTEFI -EUcrtZ, SEQ ID NO: 42, Fig.
  • p-carRA-EUcrtZ containing gene of the hydroxylase EUcrtZ from Erwinia uredova 20D3 under the control of the promoter pcarRA from Blakeslea trispora (Seq. pBinAHygBTpcarRA-EUcrtZ, SEQ ID NO:
  • p-gpdA-BTcarR-HPcrtZ-BTcarA containing gene fusion from genes of the lycopene cyclase carR from Blakeslea trispora, the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 and the phytoene synthase carA from Blakeslea trispora under control of the gpdAllin promoter - carR_crtZ_carA, SEQ ID NO: 46, Fig. 14);
  • Blakeslea trispora (Seq. PBinAHygBTpTEFI-NpucrtW, SEQ ID NO: 47, Fig. 15); p-carRA-NPcrtW, containing the gene of the ketolase NPcrtW from Nostoc punctiform PCC73102 under the control of the pcarRA promoter from Blakeslea trispora (Seq. pBinAHygBTpcarRA-NpucrtW,
  • p-carB-NPcrtW containing the kostolase NPcrtW gene from Nostoc punctiform PCC73102 under the control of the pcarB promoter from Blakeslea trispora (Seq. pBinAHygBTpcarB-NpucrtW, SEQ ID NO: 49, Fig. 17);
  • plasmids (descendants of pBinAHyg) were used to modify Blakeslea trispora for production used by Astaxanthin, encode for hydroxylases (crtZ) and
  • PCC73102 (ORF148, Accesion No. NZ_AABC01000196) both under the control of the pcarRA promoter from Blakeslea trispora (Seq. PBinAHygBTpcarRA-HPcrtZ-BTpcarRA-NpucrtW, SEQ ID NO: 50, Fig. 18); - p-carRA-EUcrtZ-pcarRA-NPcrtW, containing the gene of
  • the cloning of p-tef from Blakeslea trispora was based on a sequence of the structural gene for the translation elongation factor 1- ⁇ from Blakeslea trispora already published in GenBank (AF157235). Starting from the sequence entry AF157235, primers for the inverse PCR were selected in order to amplify and sequence the promoter region located upstream of the structural gene.
  • a 3000 bp fragment was obtained in the following approach: template DNA (1 ⁇ g genomic DNA from Blakeslea trispora ATCC 14272) primer MAT344 5'- GGCGTACTTGAAGGAACCCTTACCG-3 '(SEQ ID NO: 63) and MAT 345 5'-ATTGATGCTCCCGGTCACCGTGATT-3' (SEQ ID NO: 64) each 0.25 ⁇ M, 100 ⁇ M dNTP, 10 ⁇ l Herculase polymerase buffer 10x, 5 U Herculase (addition at 85 ° C), H 2 0 ad 100 ⁇ l.
  • the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 60 ° C, 30 s. 72 ° C, 60 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle).
  • the sequence section which lies upstream of the putative start codon of the gene tefl within 3000 bp fragment was designated as promoter ptefl.
  • a 315 bp DNA probe was produced by the following PCR.
  • Reaction mixture 1 ⁇ g of genomic DNA from Blakeslea trispora ATCC 14272, primer MAT314 5'- CCGATGGCGACGACGGAAGGTTGTT-3 '[SEQ ID NO 79] and MAT315 5'-CATGTTCATGCCCATTGCATCACCT-3' [SEQ ID NO 80] each 0.25 ⁇ M dNTP, 10 ⁇ l Herculase polymerase buffer 10x, 5 U Herculase (Addition at 85 ° C), H 2 0 ad 100 ul.
  • the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 58 ° C, 30 s. 72 ° C, 30 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle).
  • the cosmid library was screened with this DNA probe. A clone was identified, the cosmid of which hybridized with the DNA probe. The insertion of this cosmid was sequenced. The DNA sequence contained a section which was assigned to the gene of an HMG-CoA reductase [SEQ ID NO 75].
  • the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 40 ° C, 30 s, 72 ° C, 30 s, 95 ° C, 30 s (35 cycles); 72 ° C, 10 min (1 cycle).
  • the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 60 ° C, 30 s, 72 ° C, 3 min, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle);
  • the cloned sequence section is shown schematically in FIG. 20 [SEQ ID NO 77]. Sequencing was carried out in the strand and counter-strand direction with the cloned fragments and with the PCR products. The sequence of the cloned sequence section is shown in Fig. 21 [SEQ ID NO 78].
  • Gap Weight 8 Length Weight: 2
  • Phaffia rhodozyma 50.460
  • Neurospora crassa 47.943
  • Neurospora crassa 51, 896
  • Neurospora crassa 42.130
  • Neurospora crassa 60.230
  • the Blakeslea trispora genomic DNA identified three exons which, when combined, result in a coding region whose derived gene product has 72.7% identical aminoacyl residues over the entire length with the Phytoendesaturase CarB from Phycomyces blakesieeanus. This sequence section from three possible exons and two possible introns was therefore referred to as the carB gene.
  • the coding sequence of carB from Blakeslea trispora was determined by PCR with cDNA from Blakeslea trispora as a template and with the primers Bol1425 5'-AGAGAGGGATCCTTAAATGCGAATATCGTTGC-3 '(SEQ ID 56) and Bol1426 ⁇ '-AGATAGAGAAT (AGATAGAGAGAT) SEQ ID 57). The DNA fragment obtained was sequenced. The location of exons and introns was confirmed by comparison of the cDNA with the genomic DNA of carB.
  • the coding sequence of carB is shown schematically in FIG.
  • the Ndel cleavage site in carB was first removed by the overlap extension PCR method, and a Ndel cleavage site was inserted at the 5 end of the gene and a BamHI cleavage site at the 3 'end.
  • the DNA fragment obtained was ligated to the vector pJOE2702.
  • the plasmid obtained was designated pBT4 and cloned together with pCAR-AE in Escherichia coli XL1-Blue. Expression was carried out by induction with rhamnose. Enzyme activity was demonstrated by detecting lycopene synthesis via HPLC. The cloning steps are described below: PCR 1.1:
  • PCR 2 was carried out to produce the coding sequence for carB from Blakeslea trispora for cloning in pJOE2702:
  • CarB The gene product derived from carB was called CarB. Based on the peptide sequence analysis, CarB has the following properties:
  • the plasmids pCAR-AE and pBT4 were therefore transferred to Escherichia coli. After growth in liquid culture, the carotenoids were extracted from the cells and characterized (see above). It was demonstrated by HPLC analysis that the Escherichia coli XL1-Blue (pCAR-AE) strain produces phytoene and the Escherichia coli XL1-Blue (pCAR-AE) (pBT4) strain produces lycopene. CarB consequently shows the enzyme activity of a phytoendesaturase.
  • pBinAHyg ⁇ carB SEQ. ID. NO: 62, Fig. 22
  • the precursor of pBinAHyg ⁇ carB is pBinAHyg (SEQ. ID. NO: 3, Fig. 2).
  • pBinAHyg was constructed as follows:
  • the gpdA-hph cassette was isolated as a BglII / HindIII fragment from the plasmid pANsCosI (SEQ. ID. NO: 4, Fig. 1, Osiewacz, 1994, Curr. Genet. 26: 87-90) and opened in the BamHI / HindIII fragment binary plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12: 8711-8721) ligated.
  • the vector obtained in this way was designated pBinAHyg and contains the E.
  • coli hygromycin resistance gene (hph) under the control of the gpd promoter and the trpC terrminator from Aspergillus nidulans and the corresponding border sequences which are necessary for the DNA transfer from Agrobacterium.
  • the amplification of the coding sequence of carB with the primers MAT350 and MAT353 by means of PCR was carried out with the following parameters: 50 ng pBT4 with 0.25 ⁇ M MAT350 ( ⁇ '-ACTTTATTGGATCCTTAAAT-GCGAATATCGTTGCTGC-3 '; SEQ ID NO 58), 0, 25 ⁇ M MAT353 (5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3 '; SEQ ID NO 61), 100 ⁇ M dNTP, 10 ⁇ L Pfu polymerase buffer, 2.5 U Pfu polymerase (addition at 85 ° C., “hot start”) and ad 100 ⁇ L H 2 0 temperature profile: 1.
  • the plasmid pBinAHyg ⁇ carB was transferred into the agrobacterial strain LBA 4404, for example by electroporation (see above).
  • the plasmid from Agrobacterium tumefaciens LBA 4404 was then transferred into Blakeslea trispora ATCC 14272 and in Blakeslea trispora ATCC 14271 (see above)
  • the successful detection of the gene transfer in Blakesleslea trispora was carried out via polymerase chain reaction according to the following protocol:
  • shake flasks were inoculated with spore suspensions of (+) and (-) strains of the Blakeslea trispora GMO.
  • the shake flasks were incubated at 26 ° C at 250 rpm for 7 days.
  • trisporic acids were added to mixtures of the strains after 4 days and incubated for a further 3 days.
  • the final concentration of trisporic acids was 300 - 400 ⁇ g / ml.
  • Eluent A 50 mM NaH 2 PO 4 , pH 2.5 with perchloric acid
  • Extracts from the fermentation broths were used as the matrix. Before the HPLC, each sample was filtered through a 0.22 ⁇ m filter. The samples were kept cool and protected from light. For the calibration, 50-1000 mg / l were weighed out and dissolved in THF. Phytoene was used as standard, which under the given conditions had a retention time of 7.7 min. having.
  • Extracts from the fermentation broths were used as the matrix. Before the HPLC, each sample was filtered through a 0.22 ⁇ m filter. The samples were kept cool and protected from light. For the calibration, 10 mg were weighed out and dissolved in 100 ml of THF. The following carotenoids with the following retention times were used as standard: ⁇ -carotene (12.5 min), lycopene (11.7 min), echinenone (10.9 min), cryptoxanthin (10.5 min), canthaxanthin (8.7 min) , Zeaxanthin (7.6 min) and astaxanthin (6.4 min) [s. Fig 23].
  • GMOs genetically modified organisms
  • the vector pBinAHygBTpTEFI -HPcrtZ was transferred into Blakeslea trispora by agrobacterium-mediated transformation (see above).
  • a hygromycin-resistant clone was isolated and transferred to a potato-glucose agar plate (Merck KGaA, Darmstadt). After three days of incubation at 26 ° C, a spore suspension was prepared from this plate.
  • a 250 ml Erlenmeyer flask without baffles with 50 ml growth medium (corn flour 47 g / l, soy flour 23 g / l, KH 2 P0 4 0.5 g / l, thiamine-HCl 2.0 mg / l, pH with NaOH sterilization set to 6.2-6.7) was inoculated with 1x10 5 spores. This preculture incubated for 48 hours at 26 ° C and 250 rpm.
  • a 250 ml Erlenmeyer flask without baffle was used for the main culture containing 40 ml of production medium inoculated with 4 ml of the preculture and incubated for 8 days at 26 ° C. and 150 rpm.
  • the production medium contained 50 g / l glucose, casein acid hydrolyzates 2 g / l, yeast extract 1 g / l, L-asparagine 2 g / l, KH 2 P0 4 1.5 g / l, MgS0 4 x 7 H 2 0 0 , 5 g / l, thiamine-HCl 5 mg / l, Span20 10 g / l, Tween 80 1 g / l, linoleic acid 20 g / l, corn steep liquor 80 g / l. After 72 hours, kerosene was added at a final concentration of 40 g / l kerosene.
  • the remaining approximately 35 ml of culture are made up to 40 ml with water.
  • the cells are then disrupted 3 times at 1500 bar in a high-pressure homogenizer, type Micron Lab 40, from APV Gaulin.
  • the suspension with the disrupted cells was mixed with 35 ml of THF and shaken for 60 min at RT in the dark at 250 rpm. Then 2 g of NaCl were added and the mixture was shaken again. The extraction batch was then centrifuged at 5000 x g for 10 min. The colored THF phase was removed and the cell mass was completely decolorized.
  • the THF phase was concentrated to 1 ml on a rotary evaporator at 30 mbar and 30 ° C. and then again taken up in 1 ml of THF. After centrifugation at 20,000 x g for 5 min, an aliquot of the upper phase was removed and analyzed by HPLC (FIG. 24, FIG. 23).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Husbandry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés de fabrication d'un organisme génétiquement modifié de l'espèce Blakeslea, consistant (i) à transformer au moins une des cellules ; (ii) à homocaryotiser éventuellement les cellules obtenues en (i) de manière à créer des cellules dont les noyaux présentent une ou plusieurs caractéristiques génétiques modifiées de façon similaire et amènent ladite modification génétique à s'exprimer ; et, (iii) à sélectionner et cultiver la ou les cellules génétiquement modifiées.
EP04700993A 2003-01-09 2004-01-09 Procedes de modification genetique d'organismes de l'espece blakeslea, organismes correspondants et leur utilisation Ceased EP1592784A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DE10300649 2003-01-09
DE10300649A DE10300649A1 (de) 2003-01-09 2003-01-09 Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen
DE10341272 2003-09-08
DE2003141272 DE10341272A1 (de) 2003-09-08 2003-09-08 Verfahren zur gentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren Verwendung
PCT/EP2004/000100 WO2004063358A1 (fr) 2003-01-09 2004-01-09 Procedes de modification genetique d'organismes de l'espece blakeslea, organismes correspondants et leur utilisation

Publications (1)

Publication Number Publication Date
EP1592784A1 true EP1592784A1 (fr) 2005-11-09

Family

ID=32714778

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04700993A Ceased EP1592784A1 (fr) 2003-01-09 2004-01-09 Procedes de modification genetique d'organismes de l'espece blakeslea, organismes correspondants et leur utilisation

Country Status (6)

Country Link
US (1) US20060099670A1 (fr)
EP (1) EP1592784A1 (fr)
JP (1) JP2006513729A (fr)
KR (1) KR20050092740A (fr)
RU (1) RU2005125073A (fr)
WO (1) WO2004063358A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006515516A (ja) * 2003-01-09 2006-06-01 ビーエーエスエフ　アクチェンゲゼルシャフト 遺伝子改変されたＢｌａｋｅｓｌｅａ属の生物を使用する、カロチノイドまたはそれらの前駆体を製造するための方法、上記方法によって製造されたカロチノイドまたはそれらの前駆体、ならびにそれらの使用
WO2004074490A2 (fr) * 2003-02-24 2004-09-02 Genoclipp Biotechnology B.V. Procede de transformation de souches de blakeslea
EP2371967B1 (fr) 2005-03-18 2015-06-03 DSM IP Assets B.V. Production de caroténoïdes dans des levures oléagineuses et des champignons
EP2078092A2 (fr) 2006-09-28 2009-07-15 Microbia, Inc. Production de caroténoïdes dans des levures et des champignons oléagineux
US8907165B2 (en) 2009-04-22 2014-12-09 Medicine In Need Corporation Production of provitamin A carotenoids in mushrooms and uses thereof
US10081797B2 (en) * 2012-12-20 2018-09-25 Dsm Ip Assets B.V. Carotene hydroxylases and their use for producing carotenoids
KR101844726B1 (ko) * 2017-12-11 2018-04-02 이태영 건축물 감리용 드론 및 이를 이용한 건축물 감리방법

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1184464A2 (fr) * 1999-06-09 2002-03-06 Vitatene, S.A. Procede de production de lycopene

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5466599A (en) * 1993-04-19 1995-11-14 Universal Foods Corporation Astaxanthin over-producing strains of phaffia rhodozyma
DK0979294T3 (en) * 1997-04-11 2015-08-31 Dsm Ip Assets Bv Gene conversion AS A TOOL FOR CONSTRUCTION OF RECOMBINANT INDUSTRIAL filamentous fungi
EP1238068A1 (fr) * 1999-12-08 2002-09-11 California Institute Of Technology Evolution dirigee de voies de biosynthese et de biodegradation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1184464A2 (fr) * 1999-06-09 2002-03-06 Vitatene, S.A. Procede de production de lycopene

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Mehta et al. (1995) Appl. Microbiol. Biotechnol. 42, 836-838. *
Mehta et al. (1997) Appl. Environ. Microbiol. 63, 3657-3661. *
Murillo et al. (1976) Mol. Gen Genet. 148, 19-24. *
Roncerro et al. (1984) Mut. Res. 125, 195-204. *

Also Published As

Publication number Publication date
KR20050092740A (ko) 2005-09-22
US20060099670A1 (en) 2006-05-11
JP2006513729A (ja) 2006-04-27
RU2005125073A (ru) 2006-06-10
WO2004063358A1 (fr) 2004-07-29

Similar Documents

Publication Publication Date Title
EP1592783A2 (fr) Procede pour realiser des carotinoides ou leur precurseurs au moyen d'organismes genetiquement modifies de l'espece blakeslea , carotinoide ou precurseurs obtenus selon ce procede et utilisation associee
DE69631924T2 (de) Fermentative Herstellung von Carotenoiden
Verdoes et al. Metabolic engineering of the carotenoid biosynthetic pathway in the yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma)
Verdoes et al. Isolation and functional characterisation of a novel type of carotenoid biosynthetic gene from Xanthophyllomyces dendrorhous
DE69722766T2 (de) Verbesserte fermentative Herstellung von Carotenoide
DE69433969T2 (de) Dna - kette zur synthese von xanthophyll und prozess zur herstellung von xanthophyll
EP3030648B1 (fr) Méthylotrophes pour aquaculture et alimentation animale
EP1471151B1 (fr) Procede ameliore de production de lycopene par fermentation de souches selectionnees de blakeslea trispora.
EP1531683B1 (fr) Utilisation de plantes ou de parties de plantes contenant de l' astaxanthine du genre tagetes comme produit de fourrage
JPH05504686A (ja) 遺伝子操作した宿主におけるカロテノイドの生合成
US20050003474A1 (en) Carotenoid biosynthesis
DE10300649A1 (de) Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen
DE60005871T2 (de) Astaxanthin Synthetase
EP1592784A1 (fr) Procedes de modification genetique d'organismes de l'espece blakeslea, organismes correspondants et leur utilisation
DE19916140A1 (de) Carotinhydroxylase und Verfahren zur Herstellung von Xanthophyllderivaten
DE60313631T2 (de) Produktion von zeaxanthin und beta-cryptoxanthin durch phaffia
JP2005522193A (ja) キサントフィロミセス・デンドロロウス（Ｘａｎｔｈｏｐｈｙｌｌｏｍｙｃｅｓｄｅｎｄｒｏｒｈｏｕｓ）の選択された株の発酵によるアスタキサンチンの製造法
Iturriaga et al. Structure and function of the genes involved in the biosynthesis of carotenoids in the mucorales
US7252964B2 (en) Isolated carotenoid biosynthesis gene cluster involved in canthaxanthin production and applications thereof
US20180105839A1 (en) Compositions and methods of biosynthesizing xanthophylls
DE10341271A1 (de) Verfahren zur Herstellung von Carotinoiden oder deren Vorstufen mittels gentechnisch veränderter Organismen der Gattung Blakeslea, mit dem Verfahren hergestellte Carotinoide oder deren Vorstufen und deren Verwendung
DE10341272A1 (de) Verfahren zur gentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren Verwendung
US20060141557A1 (en) Production of canthaxanthin by phaffia
CN106414744A (zh) 适于酵母中的异源基因表达的启动子
DE102005029170A1 (de) System zur Genexpression in Hefen der Gattung Sporidiobolus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050809

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BASF SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20091101