EP1592784A1 - Method for the genetic modification of organisms of the genus blakeslea, corresponding organisms, and the use of the same - Google Patents

Abstract

The invention relates to a method for producing a genetically modified organism of the genus Blakeslea, said method comprising the following steps: (i) at least one of the cells is transformed, (ii) the cells obtained in step (i) are optionally rendered homokaryotic, so that cells are created in which the nuclei are all homogeneously modified in at least one genetic characteristic and convert said genetic modification into an expression, and (iii) the genetically modified cell or cells are selected and cultivated.

Description

 Process for the technical change of organisms of the genus Blakeslea, corresponding organisms and their

use

The invention relates to a method for the genetic modification of organisms of the genus Blakeslea, corresponding organisms and their use.

Blakeslea mushrooms are known as production organisms. So z. B. Blakeslea trispora is used as a production organism for β-carotene (Ciegler, 1965, Adv Appl Microbiol. 7: 1) and lycopene (EP 1201762, EP 1184464, WO 03/038064). Blakeslea can also be used to produce other lipophilic substances such as other carotenoids and their precursors, phospholipids, triacylglycerides, steroids, waxes, fat-soluble vitamins, provitamins and cofactors or for the production of hydrophilic substances such as e.g. Proteins, amino acids, nucleotides and water-soluble vitamins, provitamins and cofactors.

The high productivities for ß-carotene and lycopene make Blakeslea, especially Blakeslea trispora attractive for the economical fermentative production of carotenoids and their precursors.

However, it is also of interest to further increase the productivity of the previously naturally produced carotenes and their precursors and to produce further carotenoids, such as. B. to enable xanthophylls that have so far not been formed or isolated by Blakeslea or only to a very small extent.

Carotenoids are used in animal feed, food,

Dietary supplements, cosmetics and medicines added. The carotenoids mainly serve as pigments for coloring. Be next to it the antioxidant effects of carotenoids and other properties of these substances are used. The carotenoids are divided into the pure hydrocarbons, the carotenes and the oxygenated hydrocarbons, the xanthophylls. Xanthophylls such as canthaxanthin and astaxanthin are used, for example, to pigment chicken eggs and fish (Britton et al. 1998, Carotenoids, Vol 3, Biosynthesis and Metabolism). The carotenes ß-carotene and lycopene are mainly used in human nutrition. β-carotene is used, for example, as a beverage dye. Lycopene has a disease preventive effect (Argwal and Rao, 2000, CMAJ 163: 739-744; Rao and Argwal 1999, Nutrition Research 19: 305-323). The colorless carotenoid precursor phytoene is particularly suitable for applications as an antioxidant.

The majority of the carotenoids and their precursors, which are used as additives for the above-mentioned applications, are produced by chemical synthesis. The chemical synthesis is multi-stage, technically very complex and causes high manufacturing costs. In contrast, fermentative processes are technically relatively simple and are based on inexpensive starting materials. Fermentative processes for the production of carotenoids can be economically attractive and competitive for chemical synthesis if the productivity of the previous fermentative processes would be increased or new carotenoids could be produced on the basis of the known production organisms.

A method for the genetic modification of Blakeslea trispora is necessary especially if Blakeslea is to be used for the production of xanthophylls because these compounds are not naturally synthesized by Blakeslea. So far, various DNA sequences from Blakeslea trispora are known, in particular the DNA sequence which codes for the genes of carotenoid biosynthesis from geranylgeranyl pyrophosphate to β-carotene (WO 03/027293).

However, no methods for genetically modifying Blakeslea, in particular Blakeslea trispora, are known.

In some cases, the Agrobacterium-mediated transformation was successfully used as a method for producing genetically modified fungi. So z. B. by the following organisms

Agrobacteria have been transformed: Saccharomyces cerevisiae (Bundock et al., 1995, EMBO Journal, 14: 3206-3214), Aspergillus awamori,

Aspergilius nidulans, Aspergillus niger, Colletotrichum gloeosporioides, Fusarium solani pisi, Neurospora crassa, Trichoderma reesei, Pleurotus ostreatus, Fusarium graminearum (van der Toorren et al., 1997, EP

870835), Agraricus bisporus, Fusarium venenatum (de Groot et al., 1998,

Nature Biotechnol. 16: 839-842), Mycosphaerella graminicola (Zwiers et al.

2001, curr. Genet. 39: 388-393), Glarea lozoyensis (Zhang et al., 2003, Mol. Gen. Genomics 268: 645-655), Mucor miehei (Monfort et al. 2003,

FEMS Microbiology Lett. 244: 101-106).

Of particular interest is a homologous recombination in which as many sequence homologies as possible exist between the DNA to be introduced and the cell DNA, so that a location-specific introduction or deactivation of genetic information in the genome of the recipient organism is possible. Otherwise, the donor DNA is integrated into the genome of the recipient organism by illegitimate or non-homologous recombination, which is not site-specific. A transformation mediated by Agrobacterium and subsequent homologous recombination of the transferred DNA has so far been detected in the following organisms: Aspergillus awamori (Gouka et al. 1999, Nature Biotech 17: 598-601), Glarea lozoyensis (Zhang et al., 2003, Mol. Gen Genomics 268: 645-655), Mycosphaerella graminicola (Zwiers et al. 2001, Curr. Genet. 39: 388-393).

Electroporation is known as another method for transforming fungi. The integrative transformation of yeast by electroporation was developed by Hill, Nucl. Acids. Res. 17: 8011. For filamentous fungi, the transformation by Chakaborty and Kapoor was described (1990, Nucl. Acids. Res. 18: 6737).

A "biolistic" method, i.e. the transfer of DNA by bombarding cells with DNA-loaded particles, has been described, for example, for Trichoderma harzianum and Gliocladium virens (Lorito et al. 1993, Curr. Genet. 24: 349-356).

However, these methods have so far not been successfully used for the targeted genetic modification of Blakeslea and in particular Blakeslea trispora.

A particular difficulty in the production of specifically genetically modified Blakeslea and Blakeslea trispora is the fact that their cells are multinucleated at all stages of the sexual and vegetative cell cycle. In spores of Blakeslea trispora strain NRRL2456 and NRRL2457 z. B. an average of 4.5 nuclei per spore was detected (Metha and Cerdä-Olmedo, 1995, Appl. Microbiol. Biotechnol. 42: 836-838). As a result, the genetic modification is usually only present in one or a few nuclei, i.e. the cells are heterokaryotic. If the genetically modified Blakeslea species, in particular Blakeslea trispora, are to be used for production, it is particularly important in the case of a gene deletion that the genetic strains in the production strains are present in all cores, so that a stable and high synthesis performance without by-products is possible. The strains must therefore be homokaryotic with regard to the genetic modification.

Only for Phycomyces blakesleeanus has a method been described to generate homokaryotic cells (Roncero et al., 1984, Mutat. Res. 125: 195). By adding the mutagenic agent MNNG (N-methyl-N'-nitro-N-nitrosoguanidine), nuclei in the cells are eliminated by the process described there, so that statistically a certain number of cells with only one functional nucleus is present. The cells are then subjected to a selection in which only mononuclear cells with a recessive selection marker can grow into a mycelium. The progeny of these selected cells are multinucleated and homokaryotic. A recessive selection marker for Phycomyces blakesleanus is e.g. Dar ⁺ strains take up the toxic riboflavin analogue 5-carbon-5-deazariboflavin; Dar ^{^} strains, however, do not (Delbrück et al. 1979, Genetics 92:27). Recessive mutants are selected by adding 5-carbon-5-deazariboflavin (DARF).

However, this method is not known for Blakeslea, in particular Blakeslea trispora, and in particular has not been described in connection with a transformation.

The object of the present invention is to provide a method with which a genetic modification of Blakeslea strains, Blakeslea trispora in particular is possible. In addition, it is an object of the invention to provide a method which allows the production of homokaryotic genetically modified strains. It is also an object of the invention to provide genetically modified cells.

This object is achieved comprehensively by a method for producing a genetically modified organism of the Blakeslea genus

(i) transforming at least one of the cells,

(ii) if necessary, homokaryotization of the cells obtained from (i), so that cells are formed in which the nuclei in one or more genetic features are all changed in the same way and bring about this genetic change, and

(iii) selection of the genetically modified cell or cells.

With the method according to the invention, it is possible to specifically and stably genetically modify multinuclear cells of the Blakeslea fungi in order to obtain mycelium from cells with uniform nuclei. It is preferably cells from Blakeslea trispora fungi.

Transformation is understood to mean the transmission of genetic information into the organism, in particular fungus. This should include all possibilities known to the person skilled in the art for introducing the information, in particular DNA, e.g. B. bombardment with DNA-loaded particles, transformation by means of protoplasts, microinjection of DNA, electroporation, conjugation or transformation of competent cells, chemicals or agrobacteria mediated transformation. A genetic section, a gene or several are considered as genetic information Genes understood. The genetic information can e.g. B. with the help of a vector or as free nucleic acid (z. B. DNA, RNA) and otherwise introduced into the cells and either incorporated into the host genome by recombination or present in the cell in free form. Homologous recombination is particularly preferred.

The preferred transformation method is the Agrobacterium tumefaciens-mediated transformation. For this purpose, the donor DNA to be transferred is first inserted into a vector which (i) has the T-DNA ends flanking the DNA to be transferred, which (ii) contains a selection marker and (iii) optionally promoters and terminators for has the gene expression of the donor DNA. This vector is transferred to an Agrobacterium tumefaciens strain which contains a Ti plasmid with the vir genes. vir genes are responsible for DNA transfer in Blakeslea. This two-vector system is used to transfer Agrobacterium's DNA into Blakeslea. For this purpose, the agrobacteria are first incubated in the presence of acetosyringones. Acetosyringone induces the vir genes. Then Blakeslea trispora spores are incubated together with the induced cells from Agrobacterium tumefaciens on medium containing acetosyringone and then transferred to medium which allows selection of the transformants, i.e. which enables genetically modified strains of Blakeslea.

The term vector is used in the present application as a name for a DNA molecule which is used for introducing and possibly for multiplying foreign DNA into a cell (see also "Vector" in Römpp Lexikon Chemie - CDROM Version 2.0, Stuttgart / New York: Georg Thieme Verlag 1999). In the present application, the term "vector" should be understood to mean plasmids, cosmids, etc., which serve this purpose. In the present application, expression is understood to mean the transfer of genetic information starting from DNA or RNA into a gene product (here preferably carotenoids) and is also intended to include the term overexpression, which means increased expression, so that an expression already in the untransformed cell (wild-type) manufactured product is increasingly produced or makes up a large part of the total content of the cell.

Genetic modification is understood to mean the introduction of genetic information into a recipient organism so that it is stably expressed and passed on during cell division. Thereafter, homokaryontization is carried out if necessary, i.e. the production of cells containing only uniform nuclei, d. H. Cores with the same genetic information content.

This homokaryotization is particularly necessary if the genetic information introduced by transformation is recessive, i.e. H. did not come to expression. However, does the transformation lead to a dominant presence of genetic information, i.e. H. if it is pronounced, homokaryotization is not absolutely necessary.

A selection of the mononuclear spores is preferably carried out for homokaryotization. Naturally, a small proportion of Blakeslea trispora spores are mononuclear, so that these may be identified by specific labeling, e.g. B. Have the staining of the cell nuclei sorted out. This is preferably carried out by means of FACS (Fluorescence Activated Cell Sorting) based on the lower fluorescence of the mononuclear cells.

Alternatively, a core reduction can first be carried out for homokaryotization. A mutagenic agent can be used for this, in particular N-methyl-N'-nitro-nitrosoguanidine (MNNG) acts. It is also possible to use high-energy rays, such as UV or X-rays, for core reduction. The FACS procedure or recessive selection markers can then be used for selection.

Selection means the selection of cells whose nuclei contain the same genetic information, i. H. Cells that have the same properties as resistance or the manufacture or increased manufacture of a product. In addition to the FACS method, 5-carbon-5-deazariboflavin (may) and hygromycin (hyg) or δ'-fluororotate (FOA) and uracil are preferably used in the selection.

The vector used in transformation (i) can be designed in such a way that the genetic information contained in the vector is integrated into the genome of at least one cell. Genetic information in the cell can be switched off.

However, the vector used in the transformation (i) can also be designed such that the genetic information contained in the vector is expressed in the cell, i. H. genetic information is inserted which is not present in the corresponding wild type or which is amplified or overexpressed by the transformation.

The vector can contain any genetic information on the genetic changes of organisms of the genus Blakeslea.

“Genetic information” is preferably understood to mean nucleic acids, the introduction of which into the organism of the Blakeslea genus leads to a genetic change in organisms of the Blakeslea genus, that is to say, for example, to cause, increase or reduce enzyme activities compared to the starting organism. The vector can contain, for example, genetic information for the production of lipophilic substances such as carotenoids and their precursors, phospholipids, triacylglycerides, steroids, waxes, fat-soluble vitamins, provitamins and cofactors or genetic information for the production of hydrophilic substances such as proteins, amino acids, nucleotides and water-soluble vitamins, Provitamins and cofactors.

The vector used preferably contains genetic information for the production of carotenoids or xanthophylls or their precursors.

The vector preferably contains genetic information which causes the carotenoid biosynthesis enzymes to be localized in the cell compartment in which the carotenoid biosynthesis takes place.

Genetic information for the production of astaxanthin, zeaxanthin, echinenone, β-cryptoxanthin, andonixanthin, adonirubin, canthaxanthin, 3- and 3'-hydroxyechinenone, lycopene, lutein, β-carotene, phytoene or phytofluene is particularly preferred. Genetic information for the production of phytoene, bixin, lycopene, zeaxanthin, canthaxanthin and astaxanthin is very particularly preferred.

Accordingly, in a preferred variant of the invention, organisms are produced and cultivated which have an increased synthesis rate for intermediates in carotenoid biosynthesis and consequently have an increased productivity for end products in carotenoid biosynthesis. To increase the synthesis rate for intermediates in carotenoid biosynthesis, the activities of the enzymes 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase, Isopentenyl pyrophosphate isomerase and geranyl pyrophosphate synthase increased.

Accordingly, in a particularly preferred variant of the invention, organisms are produced and cultivated which have an increased HMG-CoA reductase activity compared to the wild type.

HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).

An HMG-CoA reductase is understood to mean a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A into mevalonate.

Accordingly, HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme A converted or amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.

If the HMG-CoA reductase activity is increased compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the formed amount of mevalonate increased.

This increase in HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type HMG-CoA reductase activity. In a preferred embodiment, the HMG-CoA reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.

In a particularly preferred embodiment of the method according to the invention, the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase into the organism, the expression of which in the organism compared with the wild type, is subject to reduced regulation.

A reduced regulation compared to the wild type means a regulation which is reduced compared to the wild type defined above, preferably no regulation at the expression or protein level.

The reduced regulation can preferably be achieved by a promoter which is functionally linked to the coding sequence in the nucleic acid construct and which is subject to a reduced regulation in the organism compared to the wild-type promoter.

For example, the promoters ptefl from Blakeslea trispora and pgpdA from Aspergillus nidulans are subject to only a reduced regulation and are therefore particularly preferred as promoters.

These promoters show an almost constitutive expression in Blakeslea trispora, so that the transcriptional regulation no longer takes place via the intermediates of carotenoid biosynthesis.

In a further preferred embodiment, the reduced regulation can be achieved by using as nucleic acid encoding an HMG-CoA reductase uses a nucleic acid, the expression of which in the organism is subject to reduced regulation compared to the organism's own orthologic nucleic acid.

The use of a nucleic acid which encodes only the catalytic region of the HMG-CoA reductase (truncated (t-) HMG-CoA reductase) is particularly preferred. The membrane domain responsible for regulation is missing. The nucleic acid used is therefore subject to reduced regulation and leads to an increase in the gene expression of the HMG-CoA reductase.

In a particularly preferred embodiment, nucleic acids are introduced into Blakeslea trispora which have the sequence SEQ ID. NO. 75 included.

Further examples of HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the sequences from databases with homology the SEQ ID. NO. 75 easy to find.

Further examples of HMG-CoA reductases and thus also for the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can furthermore be started, for example, from the sequence SEQ ID. NO. 75 from various organisms whose genomic sequence is not known, can be easily found in a manner known per se by hybridization and PCR techniques.

In a particularly preferred embodiment, the reduced regulation is achieved by encoding a nucleic acid

HMG-CoA reductase uses a nucleic acid whose expression in the organism is subject to a reduced regulation compared to the organism's own orthologic nucleic acid and uses a promoter which is subject to a reduced regulation in the organism compared to the wild-type promoter.

Accordingly, in a preferred variant of the invention, the gene expression of the phytoendesaturase is switched off by the transformation, so that the phytoene produced by the organisms can be obtained. In one embodiment of the invention, the vector used in transformation (i) therefore preferably comprises a sequence coding for a fragment of the phytoendesaturase gene, in particular carB from Blakeslea trispora with SEQ ID NO: 69.

Accordingly, in a preferred variant of the invention, the gene expression of the lycopene cyclase is switched off by transformation, so that the lycopene produced by the organisms can be obtained. In one embodiment of the invention, the vector used in the transformation therefore preferably comprises a sequence coding for a fragment of the gene of lycopene cyclase, in particular carR from Blakeslea trisporas. (WO 03/027293).

In a further preferred embodiment, the organisms of the Blakeslea genus are, for example, enabled to produce xanthophylls, such as zeaxanthin or astaxanthin, by the genetically modified organisms of the Blakeslea genus having a hydroxylase activity and / or a ketolase activity compared to the wild type.

In a further preferred variant of the invention, the vector used in the transformation (i) thus contains genetic information which, after expression, has a ketolase and / or hydroxylase activity unfold so that the organisms produce zeaxanthin or astaxanthin.

Ketolase activity means the enzyme activity of a ketolase.

A ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted β-ionone ring of carotenoids.

In particular, a ketolase is understood to be a protein which has the enzymatic activity to convert β-carotene into canthaxanthin.

Accordingly, ketolase activity is understood to mean the amount of β-carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.

According to the invention, the term “wild type” is understood to mean the corresponding non-genetically modified starting organism of the Blakesleaa genus.

Depending on the context, the term “organism” can be understood to mean the starting organism (wild type) of the Blakesleaa genus or a genetically modified organism of the Blakesleaa genus according to the invention, or both.

“Wild type” is preferably understood to mean a reference organism in each case for causing the ketolase activity and for causing the hydroxylase activity. This reference organism of the genus Blakeslea is Blakeslea trispora ATCC 14271 or ATCC 14272, which differ only in the mating type.

The ketolase activity in genetically modified organisms of the genus Blakesleaa according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The determination of the ketolase activity in organisms of the genus Blakeslea is based on the method of Fraser et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997). The ketolase activity in extracts is determined with the substrates beta-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate). Substrate / product ratios from the ketolase assays are determined by means of HPLC.

In this preferred embodiment, the genetically modified organism of the genus Blakesleaa according to the invention has ketolase activity in comparison to the genetically unmodified wild type and is therefore preferably able to transgenically express a ketolase.

In a further preferred embodiment, the ketolase activity in the organisms of the genus Blakesleaa is caused by gene expression of a nucleic acid encoding a ketolase.

In this preferred embodiment, the gene expression of a nucleic acid encoding a ketolase is preferably caused by introducing nucleic acids which encode ketolases into the starting organism of the Blakesleaa genus. In principle, any ketolase gene, that is to say any nucleic acids encoding a ketolase, can be used for this.

All nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the case of genomic ketolase sequences from eukaryotic sources which contain introns, in the event that the host organism of the genus Blakesleaa is unable or unable to express the corresponding ketolase, preference is given to nucleic acid sequences such as that which have already been processed to use corresponding cDNAs.

Examples of nucleic acids encoding a ketolase and the corresponding ketolases that can be used in the method according to the invention are, for example, sequences from:

Haematoccus pluvialis, especially from Haematoccus pluvialis Flotow em. Wille (Accession NO: X86782; nucleic acid: SEQ ID NO: 11, protein SEQ ID NO: 12),

Haematoccus pluvialis, NIES-144 (Accession NO: D45881; nucleic acid: SEQ ID NO: 13, protein SEQ ID NO: 14),

Agrobacterium aurantiacum (Accession NO: D58420; nucleic acid: SEQ ID NO: 15, protein SEQ ID NO: 16),

Alicaligenes spec. (Accession NO: D58422; nucleic acid: SEQ ID NO: 17, protein SEQ ID NO: 18), Paracoccus marcusii (Accession NO: Y15112; nucleic acid: SEQ ID NO: 19, protein SEQ ID NO: 20),

Synechocystis sp. Strain PC6803 (Accession NO: NP442491; nucleic acid: SEQ ID NO: 21, protein SEQ ID NO: 22),

Bradyrhizobium sp. (Accession NO: AF218415; nucleic acid: SEQ ID NO: 23, protein SEQ ID NO: 24),

Nostoc sp. Strain PCC7120 (Accession NO: AP003592, BAB74888; nucleic acid: SEQ ID NO: 25, protein SEQ ID NO: 26),

Nostoc punctiforme ATTC 29133, nucleic acid: Acc.-No. NZ_AABC01000195, base pair 55.604 to 55.392 (SEQ ID NO: 27); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 28) (annotated as putative protein) or

Nostoc punctiforme ATTC 29133, nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 29), protein: (SEQ ID NO: 30) (not annotated).

Further natural examples of ketolases and ketolase genes which can be used in the method according to the invention can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences described above and in particular with easily find the sequences SEQ ID NO: 12 and / or 26 and / or 30. Further natural examples of ketolases and ketolase genes can also be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID NO: 12 and / or 26 and / or 30 from various organisms, the genomic sequence of which is not known, by hybridization techniques easy to find in a manner known per se.

The hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.

Such hybridization conditions are described, for example, in Sambrook, J., Fritsch, EF, Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9.31-9.57 or in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6.

For example, the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C.) and those with high stringency (with 0.2X SSC at 50 ° C., preferably at 65 ° C. ) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).

In addition, the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.

Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied. Denaturing agents such as formamide or SDS can also be used during hybridization be used. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.

Some exemplary conditions for hybridization and washing step are given as a result:

(1) Hybridization conditions with, for example, (i) 4X SSC at 65 ° C, or

(ii) 6X SSC at 45 ° C, or (iii) 6X SSC at 68 ° C, 100 mg / ml denatured fish sperm DNA, or (iv) 6X SSC, 0.5% SDS, 100 mg / ml denatured, fragmented

Salmon sperm DNA at 68 ° C, or (v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or (vi) 50% formamide, 4X SSC at 42 ° C, or

(vii) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCI, 75 mM sodium citrate at 42 ° C, or ( viii) 2X or 4X SSC at 50 ° C (moderate conditions), or (ix) 30 to 40% formamide, 2X or 4X SSC at 42 ° C (moderate conditions).

(2) washing steps for 10 minutes each with for example

(i) 0.015 M NaCI / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C, or (ii) 0.1X SSC at 65 ° C, or

(iii) 0.1X SSC, 0.5% SDS at 68 ° C, or

(iv) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C, or

(v) 0.2X SSC, 0.1% SDS at 42 ° C, or

(vi) 2X SSC at 65 ° C (moderate conditions). In a preferred embodiment of the genetically modified organisms of the genus Blakeslea according to the invention, nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% at the amino acid level with the sequence z SEQ ID NO: 12 and has the enzymatic property of a ketolase.

This can be a natural ketolase sequence which can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which can be started from the sequence SEQ ID NO: 12 by artificial variation, for example by substitution , Insertion or deletion of amino acids has been modified.

In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, comprising the amino acid sequence SEQ ID NO: 26 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% in particular 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% at the amino acid level with the sequence SEQ ID NO: 26 and has the enzymatic property of a ketolase. This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which, starting from the sequence SEQ ID NO: 26, can be found by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.

In a further preferred embodiment of the method according to the invention, nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 30 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99% at the amino acid level with the sequence SEQ ID NO: 30 and has the enzymatic property of a ketolase.

This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms, or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 30 by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.

In the description, the term “substitution” is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid is similar Has property like the original amino acid, e.g. replacement of Glu by Asp, Gin by Asn, Val by He, Leu by Ile, Ser by Thr.

Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.

Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) using the following parameters becomes:

Multiple alignment parameters:

Gap penalty 10

Gap length penalty 10

Pairwise alignment parameter: K-tuple 1

Gap penalty 3

Window 5

Diagonal saved 5

Under a protein that has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 12 or 26 or 30 is accordingly understood to mean a protein which, when comparing its sequence with the sequence SEQ ID NO: 12 or 26 or 30, in particular according to the above program logarithm with the above parameter set, has an identity of at least 20%, preferably 80%, 85%, particularly 90%, in particular 95%.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons which are frequently used in accordance with the Blakesleaa-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other known genes from organisms of the Blakesleaa genus.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 11 is introduced into the organism of the genus.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 25 is introduced into the organism of the genus.

In a further, particularly preferred embodiment, a nucleic acid containing the sequence SEQ ID NO: 29 is introduced into the organism of the genus.

All of the above-mentioned ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The Chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In one embodiment of the invention, the vector used in transformation (i) therefore preferably comprises a sequence coding for a ketolase, in particular the ketolase Nostoc punctiforme from with SEQ ID NO: 72.

Hydroxylase activity means the enzyme activity of a hydroxylase.

A hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted β-ionone ring of carotenoids.

In particular, a hydroxylase is understood to mean a protein which has the enzymatic activity to convert β-carotene into zeaxanthin or cantaxanthin into astaxanthin.

Accordingly, hydroxyase activity is understood to mean the amount of β-carotene or cantaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase. If the hydroxylase activity is higher than that of the wild type, the amount of β-carotene or canthaxantine or the amount of zeaxanthin or astaxanthin formed is increased by the protein hydroxylase in a certain time compared to the wild type.

This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the wild type.

The hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:

The activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalactosylglycerides are added to a certain amount of organism extract.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (Xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L .; Biochim. Biophys. Acta 1391 (1998 ), 320-328):

The in vitro assay is carried out in a volume of 0.250 ml volume. The mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP +

Spinach oxidoreductase, 0.25 mM NADPH, 0.010 mg beta-carotene (in 0.1 mg Tween 80 emulsified), 0.05 mM a mixture of mono- and digalactosylglycerides (1: 1), 1 unit of catalysis, 200 mono- and digalactosylglycerides, (1: 1), 0.2 mg bovine serum albumin and organism extract in different volume. The reaction mixture is incubated at 30 ° C for 2 hours. The reaction products are extracted with organic solvent such as THF, acetone or chloroform / methanol (2: 1) * and determined by means of HPLC.

The hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):

The in vitro assay is carried out in a volume of 250 μl volume. The mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 μg of chromoplastid stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP. NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.

An alternative assay with a radioactive substrate is described in Fräser and Sandmann (Biochem. Biophys. Res. Comm. 185 (1) (1992) 9-15).

The hydroxylase activity can be increased in various ways, for example by switching off inhibitory ones

Regulation mechanisms at expression and protein level or through Increasing the gene expression of nucleic acids encoding a hydroxylase compared to the wild type.

The increase in the gene expression of the nucleic acids encoding a hydroxylase compared to the wild type can also be achieved in various ways, for example by inducing the hydroxylase gene by activators or by introducing one or more hydroxylase gene copies, i.e. by introducing at least one nucleic acid encoding a hydroxylase into the thief Organism of the genus Blakesleaa.

In a preferred embodiment, the gene expression of a nucleic acid encoding a hydroxylase is increased by introducing at least one nucleic acid encoding a hydroxylase into the organism of the genus Blakesleaa.

In principle, any hydroxylase gene, that is to say any nucleic acid which codes for a hydroxylase, can be used for this purpose.

In the case of genomic hydroxylase sequences from eukaryotic sources which contain introns, if the host organism is unable or unable to express the corresponding hydroxylase, nucleic acid sequences which have already been processed, such as the corresponding cDNAs, are preferred to use.

An example of a hydroxylase gene is a nucleic acid encoding a hydroxylase from Haematococcus pluvialis with the accession no. AX038729 (WO 0061764; nucleic acid: SEQ ID NO: 31, protein: SEQ ID NO: 32), from Erwinia uredovora 20D3 (ATCC 19321, Accession No. D90087; nucleic acid: SEQ ID NO: 33, protein: SEQ ID NO: 34 ) or Hydroxylase from Thermus thermophilus (DE 102 34 126.5) encoded by the sequence with SEQ ID NO 76.

Additional hydroxylases are encoded by the nucleic acids with the following accession numbers

| emb | CAB55626.1, CAA70427.1, CAA70888.1, CAB55625.1, AF499108 1, AF315289_1, AF296158J, AAC49443.1, NP_194300.1, NP_200070.1, AAG10430.1, CAC06712.1, AAM88619.1, CAC95130.1, AAL80006.1, AF162276, AA053295.1, AAN85601.1, CRTZ_ERWHE, CRTZ_PANAN, BAB79605.1, CRTZ_ALCSP, CRTZ_AGRAU, CAB56060.1, ZP_00094836.1, AAC4457038.1, B774 NP_344225.1, NP_849490.1, ZP_00087019.1, NP_503072.1, NP_852012.1, NP_115929.1, ZP_00013255.1

In the preferred transgenic organisms of the genus Blakeslea according to the invention, in this preferred embodiment there is at least one hydroxylase gene compared to the wild type.

In this preferred embodiment, the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase.

In the preferred embodiment described above, nucleic acids encoding proteins are preferably used which contain the amino acid sequence SEQ ID NO: 32, 34 or encoded by the sequence with SEQ ID NO 76 or one of these sequences by substitution, insertion or deletion Sequence derived from amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 80%, most preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% Amino acid level with the sequence SEQ. ID. NO: 32, 34 or encoded by the sequence with SEQ ID NO 76 and which have the enzymatic property of a hydroxylase.

Further examples of hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO: 31, 33 or 76 easy to find.

Further examples of hydroxylases and hydroxylase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 31, 33 or 76 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se Easy to find.

In a further particularly preferred embodiment, to increase the hydroxylase activity, nucleic acids are introduced into organisms which encode proteins, containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 32, 34 or encoded by the sequence with the SEQ ID NO 76.

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms concerned. In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO: 31, 33 or 76 in the organism.

All of the above-mentioned hydroxylase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In further embodiments of the invention, the vector used in the transformation (i) therefore preferably comprises a sequence coding for a hydroxlase, in particular a hydroxlase from Haematococcus pluvialis with the SEQ ID NO: 70 or a hydroxlase from Erwinia uredova with the SEQ ID NO: 71 or a hydroxylase from Thermus thermophilus encoded by the sequence with SEQ ID NO 76.

The vector used in transformation (i) preferably also contains expression-regulating and supporting areas, in particular promoters and terminators.

The vector used in transformation (i) preferably contains the gpd and / or the ptefl promoter and / or the trpC terminator. This have proven particularly useful for transforming blakeslea. The use of "inverted repeats" (IR, Römpp Lexikon der Biotechnologie 1992, Thieme Verlag Stuttgart, page 407 "Inverse repetitive sequences") for regulating expression or transcription is also within the scope of the invention.

The gpd promoter used in the vector advantageously has the sequence SEQ ID NO: 1. The trpC terminator used in the vector advantageously has the sequence SEQ ID NO: 2. The ptefl promoter used in the vector advantageously has the sequence SEQ ID NO: 35.

In particular, the gpd promoter and the trpC terminator from Aspergillus nidulans and the ptefl promoter from Blakeslea trispora are used.

In particular, the vector used in transformation (i) contains a resistance gene. It is preferably a hygromycin resistance gene (hph), in particular that from E. coli. This resistance gene has proven to be particularly suitable for the detection of the transformation and selection of the cells.

P-gpdA, the promoter of glyceraldehyde-3-phosphate dehydrogenase from Aspergillus nidulans, is therefore preferably used as the promoter for hph. The terminator for hph is preferably t-trpC, the terminator of the trpC gene, coding for anthranilate synthase components from Aspergillus nidulans.

Descendants of the pBinAHyg vector have proven to be particularly suitable as vectors. The vector used for the transformation therefore preferably comprises SEQ ID NO: 3. In addition, depending on the desired carotenoid or its precursor, there is a sequence coding for a hydroxylase, ketolase, phytoendesaturase etc. as described above. In one embodiment of the invention, the vectors therefore comprise the sequence SEQ ID NO: 69 coding for the phytoendesaturase. In a further embodiment of the invention, the vectors further comprise the sequence SEQ ID NO: 72 coding for a ketolase. In a further embodiment of the invention, the vectors further comprise the sequence SEQ ID NO: 70 or 71 or 76 coding for a hydoxylase. Corresponding combinations of the aforementioned sequences are also within the scope of the invention. In one embodiment, the vector thus encompasses both a sequence SEQ ID NO: 72 coding for a ketolase and the sequence SEQ ID NO: 70 or 71 or 76 coding for a hydoxylase and thus enables the production of astaxanthin.

In particular, vectors selected from the group consisting of SEQ ID NO: 37 to 51 and 62 can be used in the context of the invention.

With the method according to the invention, genetically modified organisms Blakeslea, in particular of the Blakeslea trispora species, or mycelium formed from them can be obtained.

The genetically modified organisms can be used to produce carotenoids, xanthophylls or their precursors, in particular phytoene, bixion, astaxanthin, zeaxanthin and canthaxanthin. New carotenoids that do not naturally occur in the wild type can also be generated by introducing the appropriate genetic information from the specifically genetically modified cells or the mycelium formed by them and then isolated. It is preferably possible to obtain carotenoids or their precursors with the specifically genetically modified cells or the mycelium formed by them.

If the genetic modification is only carried out in cells of one of the mating types that occur (in Blakeslea trispora (+) or (-)), the corresponding other, unaltered mating type is added for cultivation, since this ensures good production of the carotenoids or their precursors due to the can be achieved from the second, unchanged mating type of substances released (e.g. trisporic acids). However, the genetic modification is advantageously carried out in cells of both mating types and these are cultivated together. As a result, particularly good growth and optimal production of the carotenoids or their precursors are achieved. (Artificial) addition of trisporic acids is also possible and useful.

Trisporic acids are sex hormones in Mucorales mushrooms, such as Blakeslea, which stimulate the formation of zygophores and the production of ß-carotene (van den Ende 1968, J. Bacteriol. 96: 1298-1303, Austin et al. 1969, Nature 223: 1178 - 1179, Reschke Tetrahedron Lett. 29: 3435-3439, van den late 1970, J. Bacteriol. 101: 423-428).

The invention is explained in more detail below with the aid of examples.

material and methods

Unless otherwise described, molecular genetic work was carried out using the methods in Current Protocols in Molecular Biology (Ausubel et al., 1999, John Wiley & Sons).

Strains and growing conditions The Blakeslea trispora strains ATCC 14271 (mating type (+)) and ATCC14272 (mating type (-)) were obtained from the American Type Culture Collection. B. trispora was grown in MEP medium (malt extract peptone medium): 30 g / l malt extract (Difco), 3 g / l peptone (Soytone, Difco), 20 g / l agar, pH 5.5 setting , ad 1000 ml with H ₂ 0 at 28 ° C.

Agrobacterium tumefaciens LBA4404 was grown according to Hoekema et al. (1983, Nature 303: 179-180) at 28 ° C for 24 h in Agrobacteria Minimal Medium (AMM): 10 mM K ₂ HP0 ₄ , 10 mM KH ₂ P0 ₄ , 10 mM glucose, MM salts (2, 5mM NaCl, 2mM MgS0 ₄ , 700µM CaCl ₂ , 9µM FeS0 ₄ , 4mM (NH ₄ ) ₂ S0 ₄ ).

Transformation of Agrobacterium tumefaciens The plasmid pBinAHyg was electroporated into the Agrobacterium strain LBA 4404 (Hoekema et al., 1983, Nature 303: 179-180) (Mozo and Hooykaas, 1991, Plant Mol. Biol. 16: 917-918). The following antibiotics were used for the selection of agrobacteria: rifampicin 50 mg / l (selection for the A. tumefaciens chromosome), streptomycin 30 mg / l (selection for the helper plasmid) and kanamycin 100 mg / l (selection for the binary vector).

Blakeslea trispora transformation

For transformation, the agrobacteria were grown after 24 h in AMM to an OD ₆₀ o of 0.15 in induction medium (IM: MM salts, 40 mM MES (pH 5.6), 5 mM glucose, 2 mM phosphate, 0.5 % Glycerol, 200 μM acetosyringone) and again grown overnight in IM to an ODβoo of approximately 0.6.

For the co-incubation of Blakeslea ATCC 14271 or ATCC14272 and Agrobacterium, 100 μl agrobacterial suspension with 100 μl Blakeslea spore suspension (10 ⁷ spores / ml in 0.9% NaCI) mixed and sterile distributed on a nylon membrane (Hybond N, Amersham) on IM agarose plates (IM + 18 g / l agar). After 3 days of incubation at 26 ° C., the membrane was transferred to an MEP agar plate (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l agar). The medium contained hygromycin in a concentration of 100 mg / l for selection for transformed Blakeslea cells and 100 mg / l cefotaxime for selection against agrobacteria. The incubation was carried out at 26 ° C. for about 7 days. The mycelium was then transferred to fresh selection plates. Spores formed were rinsed off with 0.9% NaCl and on CM 17-1 agar (3 g / l glucose, 200 mg / l L-asparagine, 50 mg / l MgSO ₄ × 7H ₂ 0, 150 mg / l KH ₂ P0 ₄ , 25 μg / l thiamineHCI, 100 mg / l yeast extract, 100 mg / l Na-deoxycholate, 100 mg / L hygromycin, 100 mg / L cefotaxime, pH 5.5.18 g / l agar). To isolate individual genetically modified spores, the spores were individually deposited on selective medium using a BectonDickson FACS device (model Vantage + Diva Option).

Production of genetically modified Blakeslea trispora by Agrobacterium -mediated transformation Production of the recombinant plasmid pBinAHyg

The gpdA-hph-trpC cassette was isolated as a BglII / HindIII fragment from the plasmid pANsCosI (FIG. 1, Osiewacz, 1994, Curr. Genet. 26: 87-90, SEQ ID NO: 4) and inserted into the BamHI / HindIII fragment. Hindlll opened binary plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12: 8711-8721) ligated. The vector thus obtained was designated pBinAHyg (FIG. 2, SEQ ID NO: 3) and contained the E. coli hygromycin resistance gene (hph) under the control of the gpd promoter (SEQ ID NO: 1) and the trpC terminator (SEQ ID NO: 2) from Aspergillus nidulans and the corresponding border sequences necessary for the DNA transfer from Agrobacterium. The ones described below Vectors mentioned as exemplary embodiments are descendants of pBinAHyg.

Transfer of pBinAHyg and descendants of pBinAHyg into Agrobacterium tumefaciens

The transfer of the plasmid pBinAHyg in Agrobacteria is described below as an example. The descendants were transferred analogously.

The plasmid pBinAHyg was electroporated into the agrobacterial strain LBA 4404 (Hoekema et al., 1983, Nature 303: 179-180) (Mozo and Hooykaas, 1991, Plant Mol. Biol. 16: 917-918). The following antibiotics were used for the selection of agrobacteria: rifampicin 50 mg / l (selection for the A. tumefaciens chromosome), streptomycin 30 mg / l (selection for the helper plasmid) and kanamycin 100 mg / l (selection for the binary vector).

Transfer of pBinAHyg and descendants of pBinAHyg in Blakeslea trispora For transformation, the agrobacteria were grown after 24 h in AMM to an OD6 ₆₀ of 0.15 in induction medium (IM: MM salts, 40 mM MES (pH 5.6), 5 mM Glucose, 2 mM phosphate, 0.5% glycerol, 200 μM acetosyringone) and diluted again overnight in IM to an OD ₆₆₀ of approximately 0.6.

For the co-incubation of Blakeslea trispora (Bt) and Agrobacterium tumefaciens (At), 100 μl agrobacterial suspension were mixed with 100 μl Blakeslea spore suspension (10 ⁷ spores / ml in 0.9% NaCI) and sterile on a nylon membrane (Hybond N, Amersham ) distributed on IM agarose plates (IM + 18 g / l agar). After 3 days incubation at 26 ° C the membrane was transferred to an MEP agar plate (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l agar).

The medium contained hygromycin in a concentration of 100 mg / l for selection for transformed Blakeslea cells and 100 mg / l cefotaxime for selection against agrobacteria. The incubation was carried out at 26 ° C. for about 7 days. The mycelium was then transferred to fresh selection plates. Spores formed were rinsed off with 0.9% NaCl and applied to CM 17-1 agar (3 g / l glucose, 200 mg / l L-asparagine, 50 mg / l MgSO ₄ × 7H ₂ 0, 150 mg / l KH2P04, 25 μg / l thiamine-HCl, 100 mg / l yeast extract, 100 mg / l Na deoxycholate, pH 5.5, 100 mg / l cefotaxime, 100 mg / l hygromycin, 18 g / l agar). The transfer of spores to fresh selection plates was repeated three times. The transformant Blakeslea trispora GVO 3005 was isolated in this way. As an alternative to the selection of GMOs (genetically modified organisms), the spores were deposited individually using the BectonDickinson FacsVantage + Diva Option on CM-17 agar with 100 mg / l cefotaxime, 100 mg / l hygromycin. In this case, fungal mycelium was only formed where the spores were genetically modified.

Evidence of genetic modification through transmission of pBinAHyg and descendants of pBinAHyg in Blakeslea trispora

The proof of the transmission for pBinAHyg in Blakeslea trispora is described below as an example. The proof of the transfer of the descendants was made analogously.

200 ml of MEP medium (30 g / l malt extract, 3 g / l peptone, pH 5.5) were inoculated with 10 ⁵ to 10 ⁷ spores of the transformant Blakeslea trispora GVO 3005 and 7 days at 26 ° C. at 200 rpm on one Rotary shaker incubated. To prove the successful transformation, DNA was isolated from the mycelium (Peqlab Fungal. DNA Mini Kit) and in a PCR (Program: 94 ° C for 1 min, then 30 cycles with 1 min. 94 ° C, 1 min. 58 ° C, 1 min. 72 ° C).

The primers hph-forward (5'-CGATGTAGGAGGGCGTGGATA, SEQ ID NO: 5) and hph-reverse (5'-GCTTCTGCGGGCGATTTGTGT, SEQ ID NO: 6) were used to detect the hygromycin resistance gene (hph). The expected fragment of hph was 800 bp in length.

The primers nptlll-forward (5'-TGAGAATATCACCGGAATTG, SEQ ID NO: 7) and nptlll-reverse (5'-AGCTCGACATACTGTTCTTCC,. SEQ ID NO: 8) were used to amplify the kanamycin resistance gene nptlll and thus as a control for agrobacteria. The expected fragment of nptlll was 700 bp in length.

To amplify a fragment of the glyceraldehyde-3-phosphate dehydrogenase gene gpdl and thus as a control for Blakeslea trispora, the primers MAT292 (5'-

GTGAATGGAAATCCCATCGCTGTC, SEQ ID NO: 9) and MAT293 (5'-AGTGGGTACTCTAAAGGCCATACC, SEQ ID NO: 10) were used. The expected fragment of gpdl was 500 bp in length.

The result of the PCR of the Blakeslea trispora DNA is shown in FIG. 3 using a standard gel. The traces of the gel were documented as follows:

1) 100 bp size marker (100 bp - 1 kb)

2) B.t. GVO 3005 primer nptlll-for / nptlll-rev

3) B.t. GVO 3005 primer hph-for / hph-rev 4) B.t. GVO 3005 primer MAT292 / MAT293 (gpd)

5) At with plasmid pBinAHyg primer nptlll-for / nptlll-rev 6) At with plasmid pBinAHyg primer hph-for / hph-rev

7) B.t. 14272 WT primer nptlll-for / nptlll-rev

8) B.t. 14272 WT primer hph-for / hph-rev

9) B.t. 14272 WT primer MAT292 / MAT293 (gpd)

The hygromycin resistance gene (hph) and, as a positive control, glyceraldehyde-3-phosphate dehydrogenase gene (gpdl) were detected in the Blakeslea trispora DNA, but nptlll could not be detected.

Thus, the genetic modification of Blakeslea trispora by Agrobacterium-mediated transformation was demonstrated.

Isolation of homokaryotic GMOs from Blakeslea trispora: The successful transfer of the vector pBinAHyg and descendants of pBinAHyg to Blakeslea trispora creates genetically modified organisms (GMOs) from Blakeslea trispora. However, multinuclear cells are present in Blakeslea in all stages of the vegetative and sexual cell cycle. Therefore, the insertion of the foreign DNA is usually only in one core. The aim is to obtain strains of Blakeslea with the insertion of the foreign DNA in all nuclei, i.e. The goal is a homonucleate recombinant fungal mycelium.

1) Production of homonucleates of recombinant strains by FACS (fluorescence-activated cell sorting)

A small proportion of the Blakeslea trispora spores or the genetically modified strains of Blakeslea trispora are naturally single-core. To produce homonucleates of recombinant strains that contained foreign DNA from pBinAHyg or pBinAHyg descendants, the mononuclear spores were sorted out by FACS and analyzed for MEP (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l Agar) with 100 mg / l cefotaxime and 100 mg / l hygromycin plated. The mycelia formed here were homonucleate. For sorting with FACS, the spores of a 3-day-old smear were washed away with 10 ml Tris-HCI 50mMol + 0.1% Span20 per agar plate. The spore concentration was 0.5 to 0.8 x 10 ⁷ spores per ml. 1 ml of DMSO and 10 μl of Syto 11 (dye stock solution in DMSO Molecular Probes No. S-7573) were added to 9 ml of spore suspension. The dyeing was then carried out at 30 ° C. for 2 hours. Selection and storage was carried out using a FacsVantage + Diva Option device from Becton Dickinson. The selection was first made by size in order to separate individual spores from aggregates and impurities. Then these spores were deposited according to their fluorescence (excitation = 488 nm; emission = 530 nm). The left shoulder of the Gaussian curve of the fluorescence frequency distribution contained the mononuclear spores.

2) Production of homonucleated strains by core reduction and selection with FACS

To reduce the number of nuclei per spore, treatment of spore suspensions with MNNG (N-methyl-N'-nitro-N-nitrosoguanidine) was carried out before the selection, and a core reduction was achieved by chemical mutagenesis.

For this purpose, a spore suspension with 1 x 10 ⁷ spores / ml in Tris / HCl buffer, pH 7.0 was first prepared. MNNG was added to the spore suspension at a final concentration of 100 μg / ml. The time of incubation in MNNG was chosen so that the survival rate of the spores was approx. 5%. After incubation with MNNG, the spores were washed three times with 1 g / l Span 20 in 50 mM phosphate buffer pH 7.0 and sorted or selected according to the method described under 1). Alternatively, X-rays and UV rays could also be used to reduce the number of nuclei in the spores, as described by Cerdä-Olmedo and Patricia Reau in Mutation Res., 9 (1970), 369-384.

3) Production of homonucleated strains by selection on recessive selection markers

The recessive selection marker pyrG can be used as a recessive selection marker for the selection of homonucleater mycelia. Wild-type strains of Blakeslea trispora are pyrG ⁺ . These strains cannot grow in the presence of the pyrimidine analog 5-fluororotate (FOA) because they convert FOA to lethal metabolites through the orotidine-5'-monophosphate decarboxylase. Genetically modified Blakesleaa, which are homonucleate pyrG ^" , lack the enzyme activity orotidine-5'-monophosphate decarboxylase. As a result, these pyrG ^" strains cannot use 5-fluororotate. The strains therefore grow in the presence of FOA and uracil. In the case of the coupling of the mutation pyrG ^" and the insertion of foreign DNA on the core of a mononuclear spore, homonucleates recombinant fungal mycelium can be formed from this spore.

First, by inserting a fragment of pyrG (SEQ ID NO: 65) from Blakeslea trispora into pBinAHyg, the plasmid pBinAHygBTpyrG-SCO (SEQ ID NO: 36, Fig. 4) was generated. This plasmid was transformed into Blakelea trispora and there led to the disruption of pyrG by homologous recombination.

Homonucleate GMOs from Blakeslea trispora with the phenotype pyrG ^" were selected as follows. For the agrobacterium-mediated transformation of pBinAHygBTpyrG-SCO, MEP (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l) was used as described above. l agar) plated with 100 mg / l cefotaxime and 100 mg / l hygromycin Transformants were washed off with 10 ml Tris-HCl 50mM + 0.1% Span20 per agar plate. The spore concentration was 0.5 to 0.8 x 10 ⁷ spores per ml. The spores were then plated on FOA medium with 100 mg / l cefotaxime and 100 mg / l hygromycin. FOA medium contained 20 g glucose, 1 g FOA, 50 mg uracil, 200 ml citrate buffer (0.5 M, pH 4.5) and 40 ml trace salt solution according to Sutter, 1975, PNAS, 72: 127 per liter. Homonucleate pyrG ^" mutants showed growth on the uracil-containing FOA medium, but no growth when plated on FOA medium without uracil. In the same way, homonucleate GMOs were produced from the Blakeslea trispora GMOs described below for the production of xanthophylls.

Alternatively, it is possible to use spores analogous to the Roncero et al. to be plated on medium with 5-carbon-5-deazariboflavin which additionally contains hygromycin (Roncero et al., 1984, Mutation Research, 125: 195-204). In this way, homokaryotic cells of the hyg ^R and dar ^" genotype are selected. According to this principle, homokaryotic Blakeslea trispora strains with the hyg ^R and dar ^" phenotype are generated.

Exemplary embodiments for the production of genetically modified organisms of Blakeslea trispora for the production of carotenoids and carotenoid precursors. The plasmids mentioned below were generated by the "overlap-extension PCR" method and by subsequent insertion of the amplification products into the plasmid pBinAHyg. The "overlap-method" extension PCR "was carried out as in Innis et al. (Eds.) PCR protocols: a guide to methods and applications, Academic Press, San Diego. The transformation of the pBinAHyg derivatives and the production Homonucleating of genetically modified strains of Blakeslea trispora was carried out as described above.

Genetically modified strains of Blakeslea trispora for the production of zeaxanthin

The following plasmids (descendants of pBinAHyg) were used for the genetic engineering of Blakeslea trispora for the production of zeaxanthin. Hydroxylases (crtZ): p-tef1-HPcrtZ, containing gene of the hydroxylase HPcrtZ (SEQ ID NO: 70) from Haematococcus pluvialis Flotow NIES-144 (Accession

No. AF162276) under control of the ptefl promoter from Blakeslea trispora (Seq. PBinAHygBTpTEFI -HPcrtZ, SEQ ID NO: 37, Fig. 5); p-carRA-HPcrtZ, containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora (Seq. pBinAHyg-

BTpcarRA-HPcrtZ, SEQ ID NO: 38, FIG. 6) p-carB-HPcrtZ, containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarB promoter from Blakeslea trispora (Seq. PBinAHygBTpcarB-ID NOcr : 39, Fig. 7) p-carRA-HPcrtZ-TAG-3'carA-IR, containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora. An inverted repeat structure is located downstream of the hydroxylase gene, which originates from the 3 ′ end of carA and the region located downstream of carA (IR, SEQ ID NO: 74, inverted repeat V approx. 350 bp from carA, then about 200 bp, loop 'and then about 350 bp inverted repeat 2') (Seq. pBinAHyg-BTpcarRA-HPcrtZ-TAG-3'carA-IR, SEQ ID NO: 40, Fig. 8); p-carRA-HPcrtZ-GCG-3'carA-IR, containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora. The hydroxylase gene is fused to an inverted repeat structure derived from the 3 'end of carA and the region downstream of carA (IR, SEQ ID NO: 74, inverted repeat 1' approx. 350 bp from carA , then approx. 200 bp, loop 'and then approx. 350 bp inverted repeat 2'). The derived fusion protein consequently consists of the hydroxylase from Haematococcus pluvialis and the carboxy terminus from CarA from Blakeslea trispora (Seq. PBinAHyg-

BTpcarRA-HPcrtZ-GCG-3'carA-IR, SEQ ID NO: 41, Fig. 9); p-tef1-EUcrtZ, containing gene of the hydroxylase EUcrtZ (SEQ ID NO: 71) from Erwinia uredova 20D3 (Accession No. D90087) under the control of the ptefl promoter (Seq. pBinAHygBTpTEFI -EUcrtZ, SEQ ID NO: 42, Fig. 10) ; p-carRA-EUcrtZ, containing gene of the hydroxylase EUcrtZ from Erwinia uredova 20D3 under the control of the promoter pcarRA from Blakeslea trispora (Seq. pBinAHygBTpcarRA-EUcrtZ, SEQ ID NO:

43, Fig. 11); p-carB-EUcrtZ, containing gene from the hydroxylase EUcrtZ

Erwinia uredova 20D3 under the control of the pcarB promoter from Blakeslea trispora (Seq. PBinAHygBTpcarB-EUcrtZ, SEQ ID NO:

44, Fig. 12); p-gpdA-HPcrtZ-t-crtZ containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under control of the gpdA promoter and the terminator t-crtZ; ie the sequence section located downstream of crtZ from Haematococcus pluvialis Flotow NIES-144 (SEQ ID NO: 73) (Seq. pBinAHyg-gpdA-HPcrtZ-tcrtZ, SEQ ID NO: 45, Fig. 13). p-gpdA-BTcarR-HPcrtZ-BTcarA, containing gene fusion from genes of the lycopene cyclase carR from Blakeslea trispora, the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 and the phytoene synthase carA from Blakeslea trispora under control of the gpdAllin promoter - carR_crtZ_carA, SEQ ID NO: 46, Fig. 14);

Production of genetically modified strains of Blakeslea trispora for the production of canthaxanthin The following plasmids (descendants of pBinAHyg) were used for the genetic modification of Blakeslea trispora for the production of canthaxanthin, i.e. encode, among other things. Ketolases (crtW): p-tef1-NPcrtW, containing the gene of the ketolase NPcrtW (SEQ ID NO: 72) from Nostoc punctiforme PCC73102 (ORF148, Accesion No. NZ_AABC01000196) under the control of the ptefl promoter

Blakeslea trispora (Seq. PBinAHygBTpTEFI-NpucrtW, SEQ ID NO: 47, Fig. 15); p-carRA-NPcrtW, containing the gene of the ketolase NPcrtW from Nostoc punctiform PCC73102 under the control of the pcarRA promoter from Blakeslea trispora (Seq. pBinAHygBTpcarRA-NpucrtW,

SEQ ID NO: 48, Fig. 16); p-carB-NPcrtW, containing the kostolase NPcrtW gene from Nostoc punctiform PCC73102 under the control of the pcarB promoter from Blakeslea trispora (Seq. pBinAHygBTpcarB-NpucrtW, SEQ ID NO: 49, Fig. 17);

Production of genetically modified strains of Blakeslea trispora for the production of astaxanthin

The following plasmids (descendants of pBinAHyg) were used to modify Blakeslea trispora for production used by Astaxanthin, encode for hydroxylases (crtZ) and

Ketolases (crtW): p-carRA-HPcrtZ-pcarRA-NPcrtW, containing the gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 and the gene of the ketolase NPcrtW from Nostoc punctiforme

PCC73102 (ORF148, Accesion No. NZ_AABC01000196) both under the control of the pcarRA promoter from Blakeslea trispora (Seq. PBinAHygBTpcarRA-HPcrtZ-BTpcarRA-NpucrtW, SEQ ID NO: 50, Fig. 18); - p-carRA-EUcrtZ-pcarRA-NPcrtW, containing the gene of

Hydroxylase EUcrtZ from Erwinia uredova20D3 (Accession No. D90087) and the gene of the ketolase NPcrtW from Nostoc punctiforme PCC73102 both under the control of the pcarRA promoter from Blakeslea trispora (Seq. 19);

Cloning and sequence analysis of genes and promoters, which can be used as an example for the genetic engineering of Blakeslea trispora. The cloning and sequencing of various genes and promoters from Blakeslea trispora are described below by way of example.

Cloning and sequence analysis ptefl

The cloning of p-tef from Blakeslea trispora was based on a sequence of the structural gene for the translation elongation factor 1-α from Blakeslea trispora already published in GenBank (AF157235). Starting from the sequence entry AF157235, primers for the inverse PCR were selected in order to amplify and sequence the promoter region located upstream of the structural gene. In the inverse nested PCR to 200 ng Xhol-cleaved and circularized genomic DNA from Blakeslea trispora ATCC14272, a 3000 bp fragment was obtained in the following approach: template DNA (1 μg genomic DNA from Blakeslea trispora ATCC 14272) primer MAT344 5'- GGCGTACTTGAAGGAACCCTTACCG-3 '(SEQ ID NO: 63) and MAT 345 5'-ATTGATGCTCCCGGTCACCGTGATT-3' (SEQ ID NO: 64) each 0.25 μM, 100 μM dNTP, 10 μl Herculase polymerase buffer 10x, 5 U Herculase (addition at 85 ° C), H ₂ 0 ad 100 μl. The PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 60 ° C, 30 s. 72 ° C, 60 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle). The sequence section which lies upstream of the putative start codon of the gene tefl within 3000 bp fragment was designated as promoter ptefl.

Cloning sequence analysis of the gene of HMG-CoA reductase from Blakeslea trispora

First, a gene bank from Blakeslea trispora ATCC 14272, Mating Type (-) was produced with the cosmid vector pANsCosI. The vector was linearized by cleavage with Xbal and then dephosphorylated. A further cleavage with BamHI created the insertion site into which the Blakeslea trispora genomic DNA partially digested and dephosphorylated with Sau3AI was ligated. The cosmids formed in this way were then packaged in vitro and transferred to Escherichia coli. On the basis of the known sequence of a fragment of the gene coding for HMG-CoA reductase from Blakeslea trispora (Eur. J. Biochem 220, 403-408 (1994)), a 315 bp DNA probe was produced by the following PCR. Reaction mixture: 1 μg of genomic DNA from Blakeslea trispora ATCC 14272, primer MAT314 5'- CCGATGGCGACGACGGAAGGTTGTT-3 '[SEQ ID NO 79] and MAT315 5'-CATGTTCATGCCCATTGCATCACCT-3' [SEQ ID NO 80] each 0.25 μM dNTP, 10 µl Herculase polymerase buffer 10x, 5 U Herculase (Addition at 85 ° C), H ₂ 0 ad 100 ul. The PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 58 ° C, 30 s. 72 ° C, 30 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle).

The cosmid library was screened with this DNA probe. A clone was identified, the cosmid of which hybridized with the DNA probe. The insertion of this cosmid was sequenced. The DNA sequence contained a section which was assigned to the gene of an HMG-CoA reductase [SEQ ID NO 75].

Cloning and sequence analysis carB

(carB = gene of the phytoendesaturase from Blakeslea trispora) The degenerate primers MATNG3GGN (MATNHGGGGNAT) SEQ ID 52) and MAT192 5'-TCNGCNAGRAADATRTTRTG-3 ^' (SEQ ID 53). The PCR was carried out in 100 μl batches. These contained 200 ng of genomic DNA from Blakeslea trispora ATCC14272, 1 μM MAT182, 1 μM MAT192, 100 μM dNTP, 10 μl Pfu polymerase buffer 10 ×, 2.5 U Pfu polymerase (addition at 85 ° C.), H ₂ 0 ad 100 ul.

The PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 40 ° C, 30 s, 72 ° C, 30 s, 95 ° C, 30 s (35 cycles); 72 ° C, 10 min (1 cycle).

A 358 bp fragment was thus obtained, the derived peptide sequence of which was similar to the sequences of the phytoendesaturases. Using the inverse PCR method (Innis et al. In PCR protocols: a guide to methods and applications. 1990. pp. 219-227), the gene regions were identified according to the principle of chromosome walking Amplified, cloned and sequenced upstream and downstream of the 350 bp fragment as follows:

(i) a 1.1 kbp fragment by PCR with the primers MAT219 5'-AAGTGACACCGGTTACACGCTTGTCTT-3 ¹ (SEQ ID 54) and MAT 220 5'-GCTTATCACCATCTGTTACCTCCTTGC-3 '(SEQ ID 55) obtained from 200 ng EcoRI- cleaved and circularized genomic DNA from Blakeslea trispora ATCC14272, 0.25 μM MAT219, 0.25 μM MAT220, 100 μM dNTP, 10 μl Herculase polymerase buffer 10 ×, 5 U Herculase (addition at 85 ° C.), H ₂ 0 ad 100 μl , The PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min

(1 cycle); 60 ° C, 30 s. 72 ° C, 60 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle), (ii) a 2.9 kbp fragment by PCR with the primers MAT219 and MAT220 obtained from 200 ng Xbal-cleaved and circularized genomic DNA from Blakeslea trispora ATCC14272, 0.25 μM

MAT219, 0.25 μM MAT220, 100 μM dNTP, 10 μl Herculase polymerase buffer 10 ×, 5 U Herculase (addition at 85 ° C.), H ₂ 0 ad 100 μl. The PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 60 ° C, 30 s, 72 ° C, 3 min, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle);

The cloned sequence section is shown schematically in FIG. 20 [SEQ ID NO 77]. Sequencing was carried out in the strand and counter-strand direction with the cloned fragments and with the PCR products. The sequence of the cloned sequence section is shown in Fig. 21 [SEQ ID NO 78].

sequence comparisons

The nucleotide sequence of carB and the peptide sequence of the derived protein CarB were compared with the known sequences of related proteins. The programs GAP and BESTFIT were used to compare the sequences. CarB - Identical amino acyl residues according to GAP

Program settings:

Gap Weight: 8 Length Weight: 2

Average match: 2,912

Average mismatch: -2,003

The following values were obtained for the agreement of the amino acids

CarB from Blakeslea trispora ATCC14272 found in%: Phycomyces blakesleeanus: 72.491

Phaffia rhodozyma: 50.460

Neurospora crassa: 47.943

Cercospora nicotianae: 47.740

CarB -identical aminoacyl residues according to BESTFIT

Program settings:

Gap Weight: 8

Length Weight: 2 Average Match: 2,912

Average mismatch: -2,003

The following values were obtained for the agreement of the amino acids

CarB from Blakeslea trispora ATCC14272 found in%:

Phycomyces blakesleeanus: 73.380 Phaffia rhodozyma: 53.175

Neurospora crassa: 51, 896

Cercospora nicotianae: 50.791

carB - Identical bases according to GAP program settings: Gap Weight: 50 Length Weight: 3 Average Match: 10,000 Average Mismatch: 0,000

The following values were found for the agreement of the bases to CarB from Blakeslea trispora ATCC14272 in%: Phycomyces blakesleeanus: 64.853 Cercospora nicotianae: 50.143 Phaffia rhodozyma: 43.179

Neurospora crassa: 42.130

carB -identical bases according to BESTFIT

Program settings:

Gap Weight: 50

Length Weight: 3 Average Match: 10,000

Average mismatch: -9,000

The following values for the agreement of the bases to CarB from Blakeslea trispora ATCC14272 were found in%:

Phycomyces blakesleeanus: 68.926 Phaffia rhodozyma: 62.403

Neurospora crassa: 60.230

Cercospora nicotianae: 56.884

Cloning for expression of carB For cloning and expression of carB from Blakeslea trispora, the possible protein sequences were derived in six reading frames from the cloned sequence section from Blakeslea trispora described above. These protein sequences were compared with the sequences of the phytoendesaturases from Phycomyces blakesleeanus, Phaffia rhodozyma, Neurospora crassa and Cercospora nicotianae. On the basis of the sequence comparison, the Blakeslea trispora genomic DNA identified three exons which, when combined, result in a coding region whose derived gene product has 72.7% identical aminoacyl residues over the entire length with the Phytoendesaturase CarB from Phycomyces blakesieeanus. This sequence section from three possible exons and two possible introns was therefore referred to as the carB gene. To check the predicted gene structure, the coding sequence of carB from Blakeslea trispora was determined by PCR with cDNA from Blakeslea trispora as a template and with the primers Bol1425 5'-AGAGAGGGATCCTTAAATGCGAATATCGTTGC-3 '(SEQ ID 56) and Bol1426 δ'-AGATAGAGAAT (AGATAGAGAGAT) SEQ ID 57). The DNA fragment obtained was sequenced. The location of exons and introns was confirmed by comparison of the cDNA with the genomic DNA of carB. The coding sequence of carB is shown schematically in FIG. To express carB in Escherichia coli, the Ndel cleavage site in carB was first removed by the overlap extension PCR method, and a Ndel cleavage site was inserted at the 5 end of the gene and a BamHI cleavage site at the 3 'end. The DNA fragment obtained was ligated to the vector pJOE2702. The plasmid obtained was designated pBT4 and cloned together with pCAR-AE in Escherichia coli XL1-Blue. Expression was carried out by induction with rhamnose. Enzyme activity was demonstrated by detecting lycopene synthesis via HPLC. The cloning steps are described below: PCR 1.1:

Approximately 0.5 µg Blakeslea trispora cDNA, 0.25 µM MAT350 5'- ACTTTATTGGATCCTTAAATGCGAATATCGTTGCTGC-3 '(SEQ ID 58), 0.25 µM MAT244 5'-

GTTCCAATTGGCCACATGAAGAGTAAGACAGGAAACAG-3 '(SEQ ID 59), 100 μM dNTP, 10 μl Pfu polymerase buffer (lOx), 2.5 U Pfu polymerase (addition at 85 ° C., "hot start") and H ₂ 0 ad 100 μL , Temperature profile:

1. 95 ° C 10 min, 2. 85 ° C 5 min, 3. 40 ° C 30s, 4. 72 ° C 1 min 30 s, 5. 95

° C 30 s, 6. 50 ° C 30 s, 7. 72 ° C 1 min 30 s, 8. 95 ° C 30 s, 9. 72 ° C 10min

Cycles: (1-2.) 1x, (3-5.) 5x, (6-8.) 25x, (9.) 1x

PCR1.2:

Approximately 0.5 µg Blakeslea trispora cDNA, 0.25 µM MAT243 5'-

CCTGTCTTACTCTTCATGTGGCCAATTGGAACCAACAC-3 '(SEQ ID

60), 0.25 μM MAT353 5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3 '(SEQ ID 61),

100 µM dNTP, 10 µl Pfu polymerase buffer (10x), 2.5 U Pfu polymerase

(Addition at 85 ° C, "hot start") and H ₂ 0 ad 100 μL.

Temperature profile:

1. 95 ° C 10 min, 2. 85 ° C 5 min, 3. 40 ° C 30s, 4. 72 ° C 1 min 30 s, 5. 95 ° C 30 s, 6. 50 ° C 30 s, 7 . 72 ° C 1 min 30 s, 8. 95 ° C 30s, 9. 72 ° C 10min

Cycles: (1 -2.) 1x, (3-5.) 5x, (6-8.) 25x, (9.) 1x

Purification of the PCR fragments from PCR 1.1, 1.2

For this, PCR 2 was carried out to produce the coding sequence for carB from Blakeslea trispora for cloning in pJOE2702:

Approximately 50 ng product from PCR 1.1 and approx. 50 ng product from PCR1.2 with 0.25 μM MAT350 (5'-

ACTTTATTGGATCCTTAAATGCGAATATCGTTGCTGC-S 'SEQ ID NO 58), 0.25 μM MAT353 (5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3' SEQ ID NO 61), 100 μM dNTP, 10 μL Pfu polymerase buffer (lOx) Polymerase (addition at 85 ° C, "hot start") and H ₂ 0 ad 100 μL. Temperature profile:

1. 95 ° C 10 min, 2. 85 ° C 5 min, 3. 59 ° C 30 s, 4. 72 ° C 2 min, 5. 95 ° C 30 s, 6.72 ° C 10 min

Cycles: (1-2.) 1x, (3-5.) 22x, (6.) 1x This was followed by purification of the fragment obtained (~ 1.7 kbp), ligation in vector pPCR-Script-Amp, cloning in Escherichia coli XL1-Blue, sequencing of the insertion, cleavage with Ndel and BamHI and ligation in pJOE2702. The plasmid obtained was named pBT4.

Characterization and detection of the enzyme activity of CarB (phytoendesaturase)

The gene product derived from carB was called CarB. Based on the peptide sequence analysis, CarB has the following properties:

Length: 582 aminoacyl residues

Molecular mass: 66470

Isoelectric point: 6.7 Catalytic activity: phytoendesaturase

Educt: phytoene

Product: Lycopene

EC number: EC 1.14.99-

Enzyme activity was demonstrated in vivo. When the plasmid (pCAR-AE) is transferred into Escherichia coli XL1-Blue, the strain Escherichia coli XL1-Blue (pCAR-AE) is formed. This strain synthesizes phytoene. If the plasmid pBT4 is additionally transferred into Escherichia coli XL1-Blue, the strain Escherichia coli XL1-Blue (pCAR-AE) (pBT4) is formed. Since an enzymatically active phytoendesaturase is formed from carB, this strain produces lycopene.

The plasmids pCAR-AE and pBT4 were therefore transferred to Escherichia coli. After growth in liquid culture, the carotenoids were extracted from the cells and characterized (see above). It was demonstrated by HPLC analysis that the Escherichia coli XL1-Blue (pCAR-AE) strain produces phytoene and the Escherichia coli XL1-Blue (pCAR-AE) (pBT4) strain produces lycopene. CarB consequently shows the enzyme activity of a phytoendesaturase.

Production of genetically modified strains of Blakeslea trispora for the production of phytoene

The production of genetically modified organisms for the production of phytoene is described below as an example.

Vector pBinAHygΔcarB for generating carB mutants from Blakeslea trispora

For the deletion of carB in Blakeslea trispora, the vector pBinAHygΔcarB (SEQ. ID. NO: 62, Fig. 22) was constructed. The precursor of pBinAHygΔcarB is pBinAHyg (SEQ. ID. NO: 3, Fig. 2). pBinAHyg was constructed as follows:

The gpdA-hph cassette was isolated as a BglII / HindIII fragment from the plasmid pANsCosI (SEQ. ID. NO: 4, Fig. 1, Osiewacz, 1994, Curr. Genet. 26: 87-90) and opened in the BamHI / HindIII fragment binary plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12: 8711-8721) ligated. The vector obtained in this way was designated pBinAHyg and contains the E. coli hygromycin resistance gene (hph) under the control of the gpd promoter and the trpC terrminator from Aspergillus nidulans and the corresponding border sequences which are necessary for the DNA transfer from Agrobacterium.

The amplification of the coding sequence of carB with the primers MAT350 and MAT353 by means of PCR was carried out with the following parameters: 50 ng pBT4 with 0.25 μM MAT350 (δ'-ACTTTATTGGATCCTTAAAT-GCGAATATCGTTGCTGC-3 '; SEQ ID NO 58), 0, 25 μM MAT353 (5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3 '; SEQ ID NO 61), 100 μM dNTP, 10 μL Pfu polymerase buffer, 2.5 U Pfu polymerase (addition at 85 ° C., “hot start”) and ad 100 μL H ₂ 0 temperature profile: 1. 95 ° C 10 min, 2. 85 ° C 5 min, 3. 58 ° C 30s, 4. 72 ° C 2 min, 5. 95 ° C 30s, 6. 72 ° C 10 min. Cycles: (1st-2nd) 1x, (3-5th) 30x, (6th) 1x

This was followed by purification of the fragment obtained (~ 1.7 kbp), cleavage with Hindlll, further purification of the 364-bp Hindlll fragment-carB, followed by cleavage of pBinAHyg with Hindlll, ligation of 364-bp- Hindlll fragments-carB in pBinAHyg, a transformation of the vector in Escherichia coli and isolation of the construct and designation as pBinAHygΔcarB as described above. Alternatively, a partial cleavage with HindIII and the cloning of a larger HindIII fragment from carB in pBinAHyg was used to produce pBinAHygΔcarB.

Generation of carB "mutants from Blakeslea trispora First, the plasmid pBinAHygΔcarB was transferred into the agrobacterial strain LBA 4404, for example by electroporation (see above). The plasmid from Agrobacterium tumefaciens LBA 4404 was then transferred into Blakeslea trispora ATCC 14272 and in Blakeslea trispora ATCC 14271 (see above) The successful detection of the gene transfer in Blakesleslea trispora was carried out via polymerase chain reaction according to the following protocol:

Approximately 0.5 µg of DNA from Blakeslea trispora ATCC 14272 carB "or ATCC 14271 carB- were with 0.25 μM primer hph forward (5'- CGATGTAGGAGGGCGTGGATA-3 '; SEQ ID NO 5), 0.25 μM primer hph reverse ( 5'-GCTTCTGCGGGCGATTTGTGT-3 '; SEQ ID NO 6), 100 µM dNTP, 10 μL Herculase polymerase buffer, 2.5 U Herculase DNA polymerase (addition at 85 ° C., “hot start”) and ad 100 μl H ₂ 0 implemented. Temperature profile:

1. 95 ° C 10 min, 2. 85 ° C 5 min, 3. 58 ° C 1 min, 4. 72 ° C 1 min, 5. 94 ° C 1 min, 6.72 ° C 10 min.

Cycles: (1st-2nd) 1x, (3-5th) 30x, (6th) 1x

An amplification of the Kanamycin resistance gene from Agrobacterium was attempted as a negative control. The following PCR conditions were used for this:

Approximately 0.5 μg DNA from Blakesiea trispora ATCC 14272 carB "or ATCC 14271 carB 'were with 0.25 μM primer nptlll forward (5'- TGAGAATATCACCGGAATTG-3'; SEQ ID NO 7), 0.25 μM primer nptlll reverse ( AGCTCGACATACTGTTCTTCC-3 '; SEQ ID NO 8), 100 μM dNTP, 10 μL Herculase polymerase buffer, 2.5 U Herculase DNA polymerase (addition at 85 ° C., "hot start") and ad 100 μL H ₂ 0 implemented.

1. 95 ° C 10 min, 2. 85 ° C 5 min, 3. 58 ° C 1 min, 4. 72 ° C 1 min, 5. 94 ° C 1 min, 6. 72 ° C 10 min- cycles: (1-2.) 1x, (3-5.) 30x, (6.) 1x

Production of carotenoids and carotenoid precursors with Blakeslea trispora To produce the carotenoids zeaxanthin, canthaxanthin, astaxanthin and phytoene, the corresponding genetically modified Blakeslea trispora (+) and (-) strains were fermented, and the carotenoid produced was detected and isolated using HPLC analysis. The liquid medium for the production of carotenoids contained per liter: 19 g corn flour, 44 g soy flour, 0.55 g KH ₂ P0 ₄ , 0.002 g thiamine hydrochloride, 10% sunflower oil. The pH was adjusted to 7.5 with KOH.

To produce the carotenoids, shake flasks were inoculated with spore suspensions of (+) and (-) strains of the Blakeslea trispora GMO. The shake flasks were incubated at 26 ° C at 250 rpm for 7 days. Alternatively, trisporic acids were added to mixtures of the strains after 4 days and incubated for a further 3 days. The final concentration of trisporic acids was 300 - 400 μg / ml.

Extraction and analytics extraction:

1. Withdrawal of 10 ml of culture suspension 2. Centrifugation, 10 min, 5,000 x g

3. Discard the supernatant

4. Resuspend the pellet in 1 ml of tetrahydrofuran (THF) by vortexing

5. Centrifugation, 5 min, 5,000 x g 6. Decrease in the THF phase

7. Repeat steps 4-6. (2 x)

8. Combining the THF phases

9. Centrifugation of the combined THF phases at 20,000 x g for 5 min in order to separate residues of the aqueous phase

analytics

Measurement of phytoene using HPLC

Column: ZORBAX Eclipse XDB-C8, 5 µm, 150 * 4.6 mm

Temperature: 40 ° C Flow rate: 0.5 ml / min Injection volume: 10 μl Detection: UV 220 nm

Stop time: 12 min

Follow-up time: 0 min

Maximum pressure: 350 bar

Eluent A: 50 mM NaH ₂ PO ₄ , pH 2.5 with perchloric acid

Eluent B: acetonitrile

Gradient:

Time [min] A [%] B 170 flow [ml / min]

0 50 50 0.5

12 50 50 0.5

Extracts from the fermentation broths were used as the matrix. Before the HPLC, each sample was filtered through a 0.22 μm filter. The samples were kept cool and protected from light. For the calibration, 50-1000 mg / l were weighed out and dissolved in THF. Phytoene was used as standard, which under the given conditions had a retention time of 7.7 min. having.

Measurement of lycopene, ß-carotene, echinenone, canthaxanthin, cryptoxanthin, zeaxanthin and astaxanthin using HPLC

Column: Nucleosil 100-7 C18, 250 * 4.0 mm (Macherey & Nagel)

Temperature: 25 ° C

Flow rate: 1.3 ml / min

Injection volume: 10 μl

Detection: 450 nm

Stop time: 15min

Follow-up time: 2 min

Maximum pressure: 250 bar

Eluent A: 10% acetone, 90% H ₂ O

Eluent B: acetone

Gradient: Time [min] A [%] B [%] flow [ml / min]

0 30 70 1, 3

10 5 95 1, 3

12 5 95 1.3 13 30 70 1.3

Extracts from the fermentation broths were used as the matrix. Before the HPLC, each sample was filtered through a 0.22 μm filter. The samples were kept cool and protected from light. For the calibration, 10 mg were weighed out and dissolved in 100 ml of THF. The following carotenoids with the following retention times were used as standard: β-carotene (12.5 min), lycopene (11.7 min), echinenone (10.9 min), cryptoxanthin (10.5 min), canthaxanthin (8.7 min) , Zeaxanthin (7.6 min) and astaxanthin (6.4 min) [s. Fig 23].

Production of zeaxanthin with genetically modified strains of Blakeslea trispora

The following is an example of the production of zeaxanthin with genetically modified organisms (GMOs) from Blakeslea trispora.

The vector pBinAHygBTpTEFI -HPcrtZ was transferred into Blakeslea trispora by agrobacterium-mediated transformation (see above). A hygromycin-resistant clone was isolated and transferred to a potato-glucose agar plate (Merck KGaA, Darmstadt). After three days of incubation at 26 ° C, a spore suspension was prepared from this plate. A 250 ml Erlenmeyer flask without baffles with 50 ml growth medium (corn flour 47 g / l, soy flour 23 g / l, KH ₂ P0 ₄ 0.5 g / l, thiamine-HCl 2.0 mg / l, pH with NaOH sterilization set to 6.2-6.7) was inoculated with 1x10 ⁵ spores. This preculture incubated for 48 hours at 26 ° C and 250 rpm. A 250 ml Erlenmeyer flask without baffle was used for the main culture containing 40 ml of production medium inoculated with 4 ml of the preculture and incubated for 8 days at 26 ° C. and 150 rpm. The production medium contained 50 g / l glucose, casein acid hydrolyzates 2 g / l, yeast extract 1 g / l, L-asparagine 2 g / l, KH ₂ P0 ₄ 1.5 g / l, MgS0 ₄ x 7 H ₂ 0 0 , 5 g / l, thiamine-HCl 5 mg / l, Span20 10 g / l, Tween 80 1 g / l, linoleic acid 20 g / l, corn steep liquor 80 g / l. After 72 hours, kerosene was added at a final concentration of 40 g / l kerosene.

After harvesting the cultures, the remaining approximately 35 ml of culture are made up to 40 ml with water. The cells are then disrupted 3 times at 1500 bar in a high-pressure homogenizer, type Micron Lab 40, from APV Gaulin.

The suspension with the disrupted cells was mixed with 35 ml of THF and shaken for 60 min at RT in the dark at 250 rpm. Then 2 g of NaCl were added and the mixture was shaken again. The extraction batch was then centrifuged at 5000 x g for 10 min. The colored THF phase was removed and the cell mass was completely decolorized.

The THF phase was concentrated to 1 ml on a rotary evaporator at 30 mbar and 30 ° C. and then again taken up in 1 ml of THF. After centrifugation at 20,000 x g for 5 min, an aliquot of the upper phase was removed and analyzed by HPLC (FIG. 24, FIG. 23).

Claims

claims

1. A method for producing a genetically modified organism of the genus Blakeslea comprising

(i) transforming at least one of the cells,

(ii) if necessary, homokaryotization of the cells obtained from (i), so that cells are formed in which the nuclei are all modified in the same way in one or more genetic traits and bring about this genetic modification, and

(iii) selection and cultivation of the genetically modified cell or

Cells.

2. The method according to claim 1, characterized in that it is cells of fungi of the Blakeslea trispora type.

3. The method according to claim 1 or 2, characterized in that a vector or free nucleic acids are used in the transformation (i).

4. The method according to claim 3, characterized in that the vector used in the transformation (i) is integrated into the genome of at least one of the cells.

5. The method according to claim 4, characterized in that the vector used in the transformation (i) contains a promoter and / or a terminator.

6. The method according to any one of the preceding claims 3 to 5, characterized in that a vector containing the gpd, pcarB, pcarRA and / or ptefl promoter and / or the trpC terminator is used in the transformation (i).

7. The method according to any one of the preceding claims 3 to 6, characterized in that a vector containing a resistance gene is used in the transformation (i).

8. The method according to claim 7, characterized in that the vector used in the transformation (i) contains a hygromycin resistance gene (hph), in particular from E. coli.

9. The method according to any one of the preceding claims 5-8, characterized in that the gpd promoter has the sequence SEQ ID NO: 1.

10. The method according to any one of the preceding claims 5-8, characterized in that the trpC terminator has the sequence SEQ ID NO: 2.

11. The method according to any one of the preceding claims 5-8, characterized in that the tefl promoter has the sequence SEQ ID NO: 35.

12. The method according to any one of claims 6 to 11, characterized in that the gpd promoter and the trpC terminator come from Aspergillus nidulans.

13. The method according to any one of claims 3 to 12, characterized in that the vector comprises SEQ ID NO: 3.

14. The method according to any one of the preceding claims, characterized in that the transformation (i) by means of agrobacteria,

Conjugation, chemicals, electroporation, bombardment with DNA-loaded particles, protoplasts or microinjection is carried out.

15. The method according to any one of the preceding claims, characterized in that a mutagenic agent is used in the homokaryontization (ii).

16. The method according to claim 15, characterized in that the mutagenic agent used is N-methyl-N'-nitro-nitrosoguanidine (MNNG), UV radiation or X-rays.

17. The method according to any one of the preceding claims, characterized in that the selection is carried out by marking and / or selection of the mononuclear cells.

18. The method according to any one of the preceding claims 1-17, characterized in that 5-carbon-5-deazariboflavin (may) and hygromycin (hyg) or 5-fluororotate (FOA) and uracil and hygromycin are used in the selection.

19. The method according to any one of claims 3 to 18, characterized in that the vector used in the transformation (i) contains genetic information for the production of carotenoids or their precursors.

20. The method according to any one of claims 3 to 19, characterized in that the vector used in the transformation (i) genetic information for the production of carotenes or

Contains xanthophylls.

21. The method according to any one of claims 3 to 20, characterized in that the vector used in the transformation (i) genetic information for the production of astaxanthin, zeaxanthin, echinenone, β-cryptoxanthin, andonixanthin, adonirubin,

Contains canthaxanthin, 3-hydroxyechinenone, 3'-hydroxyechinenone, lycopene, β-carotene, α-carotene, lutein, bixin, phytofluene or phytoene.

22. The method according to any one of claims 3 to 21, characterized in that the vector used in the transformation (i) is designed such that the genetic information contained in the vector is introduced into the genome of Blakeslea trispora

23. The method according to any one of claims 3 to 22, characterized in that the vector used in the transformation (i) contains genetic information which, after expression, develop a ketolase and / or hydroxylase activity.

24. The method according to claim 23, characterized in that the vector used in the transformation (i) comprises SEQ ID NO: 70 or 71 or 76 and / or 72.

25. The method according to claim 23 or 24, characterized in that the vector used in the transformation (i) has a sequence from the group consisting of SEQ ID NO: 37-51.

26. The method according to any one of claims 3 to 21, characterized in that the vector used in the transformation (i) is designed such that the genetic information contained in the vector is switched off in the cell.

27. The method according to any one of claims 3 to 21 or 25, characterized in that the gene of the transformation (i)

Phytoendesaturase is switched off.

28. The method according to claim 27, characterized in that the vector used in the transformation (i) comprises SEQ ID NO: 69.

29. The method according to claim 27 or 28, characterized in that the vector used in the transformation (i) has the sequence SEQ ID

NO: 62.

30. The method according to any one of claims 3 to 21, characterized in that the gene of the lycopene cyclase is switched off by the transformation.

31. Genetically modified multinucleated cells of the fungi belonging to the genus Blakeslea, in particular Blakeslea trispora obtainable according to one of the preceding claims.

32. Use of the cells according to claim 30 or a mycelium formed from them for the production of carotenoids or their precursors.

33. Use according to claim 30 or 31 for the production of carotenes or xanthophylls.

34. Use according to one of claims 30 to 32 for the production of astaxanthin, zeaxanthin, echinenone, ß-cryptoxanthin, andonixanthin, adonirubin, canthaxanthin, 3-hydroxyechinenone, 3'-hydroxyechinenone, lycopene, ß-carotene, α-carotene, lutein, bixin,

Phytofluen or Phytoen.

35. Promoter with the sequence SEQ ID NO: 1 or 35 for use in the method according to any one of claims 1-29.

36. Terminator with the sequence SEQ ID NO: 2 for use in the method according to any one of claims 1-29.

37. Vector comprising SEQ ID NO: 3 for use in the method according to any one of claims 1-29.

38. Vector according to claim 36 for use in the method according to one of claims 1-29, comprising SEQ ID NO: 69 and / or SEQ ID NO: 70 or 71 and / or 72 or 76.