EP1592784A1 - Verfahren zur gentechnischen veränderung von organismen der gattung blakeslea, entsprechende organismen und deren verwendung - Google Patents
Verfahren zur gentechnischen veränderung von organismen der gattung blakeslea, entsprechende organismen und deren verwendungInfo
- Publication number
- EP1592784A1 EP1592784A1 EP04700993A EP04700993A EP1592784A1 EP 1592784 A1 EP1592784 A1 EP 1592784A1 EP 04700993 A EP04700993 A EP 04700993A EP 04700993 A EP04700993 A EP 04700993A EP 1592784 A1 EP1592784 A1 EP 1592784A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- transformation
- vector
- blakeslea
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/179—Colouring agents, e.g. pigmenting or dyeing agents
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L31/00—Edible extracts or preparations of fungi; Preparation or treatment thereof
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/105—Plant extracts, their artificial duplicates or their derivatives
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
- A23L5/40—Colouring or decolouring of foods
- A23L5/42—Addition of dyes or pigments, e.g. in combination with optical brighteners
- A23L5/43—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives
- A23L5/44—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives using carotenoids or xanthophylls
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
Definitions
- the invention relates to a method for the genetic modification of organisms of the genus Blakeslea, corresponding organisms and their use.
- Blakeslea mushrooms are known as production organisms. So z. B. Blakeslea trispora is used as a production organism for ⁇ -carotene (Ciegler, 1965, Adv Appl Microbiol. 7: 1) and lycopene (EP 1201762, EP 1184464, WO 03/038064). Blakeslea can also be used to produce other lipophilic substances such as other carotenoids and their precursors, phospholipids, triacylglycerides, steroids, waxes, fat-soluble vitamins, provitamins and cofactors or for the production of hydrophilic substances such as e.g. Proteins, amino acids, nucleotides and water-soluble vitamins, provitamins and cofactors.
- hydrophilic substances such as e.g. Proteins, amino acids, nucleotides and water-soluble vitamins, provitamins and cofactors.
- Carotenoids are used in animal feed, food,
- the carotenoids mainly serve as pigments for coloring. Be next to it the antioxidant effects of carotenoids and other properties of these substances are used.
- the carotenoids are divided into the pure hydrocarbons, the carotenes and the oxygenated hydrocarbons, the xanthophylls. Xanthophylls such as canthaxanthin and astaxanthin are used, for example, to pigment chicken eggs and fish (Britton et al. 1998, Carotenoids, Vol 3, Biosynthesis and Metabolism).
- the carotenes ß-carotene and lycopene are mainly used in human nutrition.
- ⁇ -carotene is used, for example, as a beverage dye.
- Lycopene has a disease preventive effect (Argwal and Rao, 2000, CMAJ 163: 739-744; Rao and Argwal 1999, Nutrition Research 19: 305-323).
- the colorless carotenoid precursor phytoene is particularly suitable for applications as an antioxidant.
- the chemical synthesis is multi-stage, technically very complex and causes high manufacturing costs.
- fermentative processes are technically relatively simple and are based on inexpensive starting materials. Fermentative processes for the production of carotenoids can be economically attractive and competitive for chemical synthesis if the productivity of the previous fermentative processes would be increased or new carotenoids could be produced on the basis of the known production organisms.
- a method for the genetic modification of Blakeslea trispora is necessary especially if Blakeslea is to be used for the production of xanthophylls because these compounds are not naturally synthesized by Blakeslea.
- various DNA sequences from Blakeslea trispora are known, in particular the DNA sequence which codes for the genes of carotenoid biosynthesis from geranylgeranyl pyrophosphate to ⁇ -carotene (WO 03/027293).
- the Agrobacterium-mediated transformation was successfully used as a method for producing genetically modified fungi. So z. B. by the following organisms
- Agrobacteria have been transformed: Saccharomyces cerevisiae (Bundock et al., 1995, EMBO Journal, 14: 3206-3214), Aspergillus awamori,
- a transformation mediated by Agrobacterium and subsequent homologous recombination of the transferred DNA has so far been detected in the following organisms: Aspergillus awamori (Gouka et al. 1999, Nature Biotech 17: 598-601), Glarea lozoyensis (Zhang et al., 2003, Mol. Gen Genomics 268: 645-655), Mycosphaerella graminicola (Zwiers et al. 2001, Curr. Genet. 39: 388-393).
- Electroporation is known as another method for transforming fungi.
- the integrative transformation of yeast by electroporation was developed by Hill, Nucl. Acids. Res. 17: 8011.
- the transformation by Chakaborty and Kapoor was described (1990, Nucl. Acids. Res. 18: 6737).
- a "biolistic” method i.e. the transfer of DNA by bombarding cells with DNA-loaded particles, has been described, for example, for Trichoderma harzianum and Gliocladium virens (Lorito et al. 1993, Curr. Genet. 24: 349-356).
- a particular difficulty in the production of specifically genetically modified Blakeslea and Blakeslea trispora is the fact that their cells are multinucleated at all stages of the sexual and vegetative cell cycle.
- the genetic modification is usually only present in one or a few nuclei, i.e. the cells are heterokaryotic.
- the genetically modified Blakeslea species in particular Blakeslea trispora
- the strains must therefore be homokaryotic with regard to the genetic modification.
- a recessive selection marker for Phycomyces blakesleanus is e.g. Dar + strains take up the toxic riboflavin analogue 5-carbon-5-deazariboflavin; Dar ⁇ strains, however, do not (Delbrück et al. 1979, Genetics 92:27). Recessive mutants are selected by adding 5-carbon-5-deazariboflavin (DARF).
- DARF 5-carbon-5-deazariboflavin
- the object of the present invention is to provide a method with which a genetic modification of Blakeslea strains, Blakeslea trispora in particular is possible.
- This object is achieved comprehensively by a method for producing a genetically modified organism of the Blakeslea genus
- the method according to the invention it is possible to specifically and stably genetically modify multinuclear cells of the Blakeslea fungi in order to obtain mycelium from cells with uniform nuclei. It is preferably cells from Blakeslea trispora fungi.
- Transformation is understood to mean the transmission of genetic information into the organism, in particular fungus. This should include all possibilities known to the person skilled in the art for introducing the information, in particular DNA, e.g. B. bombardment with DNA-loaded particles, transformation by means of protoplasts, microinjection of DNA, electroporation, conjugation or transformation of competent cells, chemicals or agrobacteria mediated transformation.
- a genetic section, a gene or several are considered as genetic information Genes understood.
- the genetic information can e.g. B. with the help of a vector or as free nucleic acid (z. B. DNA, RNA) and otherwise introduced into the cells and either incorporated into the host genome by recombination or present in the cell in free form. Homologous recombination is particularly preferred.
- the preferred transformation method is the Agrobacterium tumefaciens-mediated transformation.
- the donor DNA to be transferred is first inserted into a vector which (i) has the T-DNA ends flanking the DNA to be transferred, which (ii) contains a selection marker and (iii) optionally promoters and terminators for has the gene expression of the donor DNA.
- This vector is transferred to an Agrobacterium tumefaciens strain which contains a Ti plasmid with the vir genes. vir genes are responsible for DNA transfer in Blakeslea.
- This two-vector system is used to transfer Agrobacterium's DNA into Blakeslea.
- the agrobacteria are first incubated in the presence of acetosyringones.
- Acetosyringone induces the vir genes. Then Blakeslea trispora spores are incubated together with the induced cells from Agrobacterium tumefaciens on medium containing acetosyringone and then transferred to medium which allows selection of the transformants, i.e. which enables genetically modified strains of Blakeslea.
- vector is used in the present application as a name for a DNA molecule which is used for introducing and possibly for multiplying foreign DNA into a cell (see also "Vector” in Römpp Lexikon Chemie - CDROM Version 2.0, Stuttgart / New York: Georg Thieme Verlag 1999).
- vector should be understood to mean plasmids, cosmids, etc., which serve this purpose.
- expression is understood to mean the transfer of genetic information starting from DNA or RNA into a gene product (here preferably carotenoids) and is also intended to include the term overexpression, which means increased expression, so that an expression already in the untransformed cell (wild-type) manufactured product is increasingly produced or makes up a large part of the total content of the cell.
- a gene product here preferably carotenoids
- Genetic modification is understood to mean the introduction of genetic information into a recipient organism so that it is stably expressed and passed on during cell division. Thereafter, homokaryontization is carried out if necessary, i.e. the production of cells containing only uniform nuclei, d. H. Cores with the same genetic information content.
- a selection of the mononuclear spores is preferably carried out for homokaryotization.
- a small proportion of Blakeslea trispora spores are mononuclear, so that these may be identified by specific labeling, e.g. B.
- FACS Fluorescence Activated Cell Sorting
- a core reduction can first be carried out for homokaryotization.
- a mutagenic agent can be used for this, in particular N-methyl-N'-nitro-nitrosoguanidine (MNNG) acts.
- MNNG N-methyl-N'-nitro-nitrosoguanidine
- high-energy rays such as UV or X-rays
- the FACS procedure or recessive selection markers can then be used for selection.
- Selection means the selection of cells whose nuclei contain the same genetic information, i. H. Cells that have the same properties as resistance or the manufacture or increased manufacture of a product.
- 5-carbon-5-deazariboflavin may
- hygromycin hyg
- ⁇ '-fluororotate uracil
- the vector used in transformation (i) can be designed in such a way that the genetic information contained in the vector is integrated into the genome of at least one cell. Genetic information in the cell can be switched off.
- the vector used in the transformation (i) can also be designed such that the genetic information contained in the vector is expressed in the cell, i. H. genetic information is inserted which is not present in the corresponding wild type or which is amplified or overexpressed by the transformation.
- the vector can contain any genetic information on the genetic changes of organisms of the genus Blakeslea.
- “Genetic information” is preferably understood to mean nucleic acids, the introduction of which into the organism of the Blakeslea genus leads to a genetic change in organisms of the Blakeslea genus, that is to say, for example, to cause, increase or reduce enzyme activities compared to the starting organism.
- the vector can contain, for example, genetic information for the production of lipophilic substances such as carotenoids and their precursors, phospholipids, triacylglycerides, steroids, waxes, fat-soluble vitamins, provitamins and cofactors or genetic information for the production of hydrophilic substances such as proteins, amino acids, nucleotides and water-soluble vitamins, Provitamins and cofactors.
- the vector used preferably contains genetic information for the production of carotenoids or xanthophylls or their precursors.
- the vector preferably contains genetic information which causes the carotenoid biosynthesis enzymes to be localized in the cell compartment in which the carotenoid biosynthesis takes place.
- Genetic information for the production of astaxanthin, zeaxanthin, echinenone, ⁇ -cryptoxanthin, andonixanthin, adonirubin, canthaxanthin, 3- and 3'-hydroxyechinenone, lycopene, lutein, ⁇ -carotene, phytoene or phytofluene is particularly preferred.
- Genetic information for the production of phytoene, bixin, lycopene, zeaxanthin, canthaxanthin and astaxanthin is very particularly preferred.
- organisms are produced and cultivated which have an increased synthesis rate for intermediates in carotenoid biosynthesis and consequently have an increased productivity for end products in carotenoid biosynthesis.
- the activities of the enzymes 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase, Isopentenyl pyrophosphate isomerase and geranyl pyrophosphate synthase increased.
- organisms are produced and cultivated which have an increased HMG-CoA reductase activity compared to the wild type.
- HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).
- HMG-CoA reductase is understood to mean a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A into mevalonate.
- HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme A converted or amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.
- the HMG-CoA reductase activity is increased compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the formed amount of mevalonate increased.
- This increase in HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type HMG-CoA reductase activity.
- the HMG-CoA reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.
- the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase into the organism, the expression of which in the organism compared with the wild type, is subject to reduced regulation.
- a reduced regulation compared to the wild type means a regulation which is reduced compared to the wild type defined above, preferably no regulation at the expression or protein level.
- the reduced regulation can preferably be achieved by a promoter which is functionally linked to the coding sequence in the nucleic acid construct and which is subject to a reduced regulation in the organism compared to the wild-type promoter.
- promoters ptefl from Blakeslea trispora and pgpdA from Aspergillus nidulans are subject to only a reduced regulation and are therefore particularly preferred as promoters.
- the reduced regulation can be achieved by using as nucleic acid encoding an HMG-CoA reductase uses a nucleic acid, the expression of which in the organism is subject to reduced regulation compared to the organism's own orthologic nucleic acid.
- nucleic acid which encodes only the catalytic region of the HMG-CoA reductase (truncated (t-) HMG-CoA reductase) is particularly preferred.
- the membrane domain responsible for regulation is missing.
- the nucleic acid used is therefore subject to reduced regulation and leads to an increase in the gene expression of the HMG-CoA reductase.
- nucleic acids are introduced into Blakeslea trispora which have the sequence SEQ ID. NO. 75 included.
- HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the sequences from databases with homology the SEQ ID. NO. 75 easy to find.
- HMG-CoA reductases and thus also for the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can furthermore be started, for example, from the sequence SEQ ID. NO. 75 from various organisms whose genomic sequence is not known, can be easily found in a manner known per se by hybridization and PCR techniques.
- the reduced regulation is achieved by encoding a nucleic acid
- HMG-CoA reductase uses a nucleic acid whose expression in the organism is subject to a reduced regulation compared to the organism's own orthologic nucleic acid and uses a promoter which is subject to a reduced regulation in the organism compared to the wild-type promoter.
- the gene expression of the phytoendesaturase is switched off by the transformation, so that the phytoene produced by the organisms can be obtained.
- the vector used in transformation (i) therefore preferably comprises a sequence coding for a fragment of the phytoendesaturase gene, in particular carB from Blakeslea trispora with SEQ ID NO: 69.
- the gene expression of the lycopene cyclase is switched off by transformation, so that the lycopene produced by the organisms can be obtained.
- the vector used in the transformation therefore preferably comprises a sequence coding for a fragment of the gene of lycopene cyclase, in particular carR from Blakeslea trisporas. (WO 03/027293).
- the organisms of the Blakeslea genus are, for example, enabled to produce xanthophylls, such as zeaxanthin or astaxanthin, by the genetically modified organisms of the Blakeslea genus having a hydroxylase activity and / or a ketolase activity compared to the wild type.
- the vector used in the transformation (i) thus contains genetic information which, after expression, has a ketolase and / or hydroxylase activity unfold so that the organisms produce zeaxanthin or astaxanthin.
- Ketolase activity means the enzyme activity of a ketolase.
- a ketolase is understood to mean a protein which has the enzymatic activity of introducing a keto group on the optionally substituted ⁇ -ionone ring of carotenoids.
- a ketolase is understood to be a protein which has the enzymatic activity to convert ⁇ -carotene into canthaxanthin.
- ketolase activity is understood to mean the amount of ⁇ -carotene or amount of canthaxanthin formed by the protein ketolase in a certain time.
- wild type is understood to mean the corresponding non-genetically modified starting organism of the Blakesleaa genus.
- organism can be understood to mean the starting organism (wild type) of the Blakesleaa genus or a genetically modified organism of the Blakesleaa genus according to the invention, or both.
- Wild type is preferably understood to mean a reference organism in each case for causing the ketolase activity and for causing the hydroxylase activity.
- This reference organism of the genus Blakeslea is Blakeslea trispora ATCC 14271 or ATCC 14272, which differ only in the mating type.
- ketolase activity in genetically modified organisms of the genus Blakesleaa according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
- the determination of the ketolase activity in organisms of the genus Blakeslea is based on the method of Fraser et al., (J. Biol. Chem. 272 (10): 6128-6135, 1997).
- the ketolase activity in extracts is determined with the substrates beta-carotene and canthaxanthin in the presence of lipid (soy lecithin) and detergent (sodium cholate).
- Substrate / product ratios from the ketolase assays are determined by means of HPLC.
- the genetically modified organism of the genus Blakesleaa according to the invention has ketolase activity in comparison to the genetically unmodified wild type and is therefore preferably able to transgenically express a ketolase.
- the ketolase activity in the organisms of the genus Blakesleaa is caused by gene expression of a nucleic acid encoding a ketolase.
- the gene expression of a nucleic acid encoding a ketolase is preferably caused by introducing nucleic acids which encode ketolases into the starting organism of the Blakesleaa genus.
- any ketolase gene that is to say any nucleic acids encoding a ketolase, can be used for this.
- nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.
- nucleic acid sequences such as that which have already been processed to use corresponding cDNAs.
- nucleic acids encoding a ketolase and the corresponding ketolases that can be used in the method according to the invention are, for example, sequences from:
- Haematoccus pluvialis especially from Haematoccus pluvialis Flotow em. Wille (Accession NO: X86782; nucleic acid: SEQ ID NO: 11, protein SEQ ID NO: 12),
- Agrobacterium aurantiacum (Accession NO: D58420; nucleic acid: SEQ ID NO: 15, protein SEQ ID NO: 16),
- Alicaligenes spec. (Accession NO: D58422; nucleic acid: SEQ ID NO: 17, protein SEQ ID NO: 18), Paracoccus marcusii (Accession NO: Y15112; nucleic acid: SEQ ID NO: 19, protein SEQ ID NO: 20),
- Synechocystis sp. Strain PC6803 (Accession NO: NP442491; nucleic acid: SEQ ID NO: 21, protein SEQ ID NO: 22),
- Bradyrhizobium sp. (Accession NO: AF218415; nucleic acid: SEQ ID NO: 23, protein SEQ ID NO: 24),
- Nostoc punctiforme ATTC 29133 nucleic acid: Acc.-No. NZ_AABC01000195, base pair 55.604 to 55.392 (SEQ ID NO: 27); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 28) (annotated as putative protein) or
- Nostoc punctiforme ATTC 29133 nucleic acid: Acc.-No. NZ_AABC01000196, base pair 140.571 to 139.810 (SEQ ID NO: 29), protein: (SEQ ID NO: 30) (not annotated).
- ketolases and ketolase genes which can be used in the method according to the invention can be obtained, for example, from different organisms, the genomic sequence of which is known, by comparing the identity of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the sequences described above and in particular with easily find the sequences SEQ ID NO: 12 and / or 26 and / or 30.
- ketolases and ketolase genes can also be derived from the nucleic acid sequences described above, in particular from the sequences SEQ ID NO: 12 and / or 26 and / or 30 from various organisms, the genomic sequence of which is not known, by hybridization techniques easy to find in a manner known per se.
- the hybridization can take place under moderate (low stringency) or preferably under stringent (high stringency) conditions.
- the conditions during the washing step can be selected from the range of conditions limited by those with low stringency (with 2X SSC at 50 ° C.) and those with high stringency (with 0.2X SSC at 50 ° C., preferably at 65 ° C. ) (20X SSC: 0.3 M sodium citrate, 3 M sodium chloride, pH 7.0).
- the temperature during the washing step can be raised from moderate conditions at room temperature, 22 ° C, to stringent conditions at 65 ° C.
- Both parameters, salt concentration and temperature, can be varied simultaneously, one of the two parameters can be kept constant and only the other can be varied.
- Denaturing agents such as formamide or SDS can also be used during hybridization be used. In the presence of 50% formamide, the hybridization is preferably carried out at 42 ° C.
- Hybridization conditions with, for example, (i) 4X SSC at 65 ° C, or
- Salmon sperm DNA at 68 ° C, or (v) 6XSSC, 0.5% SDS, 100 mg / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C, or (vi) 50% formamide, 4X SSC at 42 ° C, or
- nucleic acids are encoded which encode a protein containing the amino acid sequence SEQ ID NO: 12 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and which have an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% at the amino acid level with the sequence z SEQ ID NO: 12 and has the enzymatic property of a ketolase.
- This can be a natural ketolase sequence which can be found as described above by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which can be started from the sequence SEQ ID NO: 12 by artificial variation, for example by substitution , Insertion or deletion of amino acids has been modified.
- nucleic acids which encode a protein are introduced, comprising the amino acid sequence SEQ ID NO: 26 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90% in particular 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% at the amino acid level with the sequence SEQ ID NO: 26 and has the enzymatic property of a ketolase.
- This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms or an artificial ketolase sequence which, starting from the sequence SEQ ID NO: 26, can be found by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.
- nucleic acids which encode a protein are introduced, containing the amino acid sequence SEQ ID NO: 30 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids and having an identity of at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99% at the amino acid level with the sequence SEQ ID NO: 30 and has the enzymatic property of a ketolase.
- This can be a natural ketolase sequence which, as described above, can be found by comparing the identity of the sequences from other organisms, or an artificial ketolase sequence which can be derived from the sequence SEQ ID NO: 30 by artificial variation, for example was modified by substitution, insertion or deletion of amino acids.
- substitution is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid is similar Has property like the original amino acid, e.g. replacement of Glu by Asp, Gin by Asn, Val by He, Leu by Ile, Ser by Thr.
- Deletion is the replacement of an amino acid with a direct link.
- Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.
- Inserts are insertions of amino acids into the polypeptide chain, with a direct bond being formally replaced by one or more amino acids.
- Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) using the following parameters becomes:
- a protein that has an identity of at least 20% at the amino acid level with the sequence SEQ ID NO: 12 or 26 or 30 is accordingly understood to mean a protein which, when comparing its sequence with the sequence SEQ ID NO: 12 or 26 or 30, in particular according to the above program logarithm with the above parameter set, has an identity of at least 20%, preferably 80%, 85%, particularly 90%, in particular 95%.
- Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
- codon usage can easily be determined on the basis of computer evaluations of other known genes from organisms of the Blakesleaa genus.
- a nucleic acid containing the sequence SEQ ID NO: 11 is introduced into the organism of the genus.
- a nucleic acid containing the sequence SEQ ID NO: 25 is introduced into the organism of the genus.
- a nucleic acid containing the sequence SEQ ID NO: 29 is introduced into the organism of the genus.
- ketolase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
- the Chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pp. 896-897).
- the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
- the vector used in transformation (i) therefore preferably comprises a sequence coding for a ketolase, in particular the ketolase Nostoc punctiforme from with SEQ ID NO: 72.
- Hydroxylase activity means the enzyme activity of a hydroxylase.
- a hydroxylase is understood to mean a protein which has the enzymatic activity of introducing a hydroxyl group on the optionally substituted ⁇ -ionone ring of carotenoids.
- a hydroxylase is understood to mean a protein which has the enzymatic activity to convert ⁇ -carotene into zeaxanthin or cantaxanthin into astaxanthin.
- hydroxyase activity is understood to mean the amount of ⁇ -carotene or cantaxanthin converted or the amount of zeaxanthin or astaxanthin formed in a certain time by the protein hydroxylase. If the hydroxylase activity is higher than that of the wild type, the amount of ⁇ -carotene or canthaxantine or the amount of zeaxanthin or astaxanthin formed is increased by the protein hydroxylase in a certain time compared to the wild type.
- This increase in the hydroxylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the hydroxylase activity of the wild type.
- hydroxylase activity in genetically modified organisms according to the invention and in wild-type or reference organisms is preferably determined under the following conditions:
- the activity of the hydroxylase is according to Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro. Ferredoxin, ferredoxin-NADP oxidoreductase, catalase, NADPH and beta-carotene with mono- and digalactosylglycerides are added to a certain amount of organism extract.
- the hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, Keller, d'Harlingue and Camara (Xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L .; Biochim. Biophys. Acta 1391 (1998 ), 320-328):
- the in vitro assay is carried out in a volume of 0.250 ml volume.
- the mixture contains 50 mM potassium phosphate (pH 7.6), 0.025 mg ferredoxin from spinach, 0.5 units ferredoxin-NADP +
- the hydroxylase activity is particularly preferably determined under the following conditions according to Bouvier, d'Harlingue and Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346 (1) (1997) 53-64):
- the in vitro assay is carried out in a volume of 250 ⁇ l volume.
- the mixture contains 50 mM potassium phosphate (pH 7.6), different amounts of organism extract, 20 nM lycopene, 250 ⁇ g of chromoplastid stromal protein from paprika, 0.2 mM NADP +, 0.2 mM NADPH and 1 mM ATP.
- NADP / NADPH and ATP are dissolved in 10 ml ethanol with 1 mg Tween 80 immediately before adding to the incubation medium. After a reaction time of 60 minutes at 30 ° C., the reaction is terminated by adding chloroform / methanol (2: 1). The reaction products extracted in chloroform are analyzed by HPLC.
- the hydroxylase activity can be increased in various ways, for example by switching off inhibitory ones
- the increase in the gene expression of the nucleic acids encoding a hydroxylase compared to the wild type can also be achieved in various ways, for example by inducing the hydroxylase gene by activators or by introducing one or more hydroxylase gene copies, i.e. by introducing at least one nucleic acid encoding a hydroxylase into the thief Organism of the genus Blakesleaa.
- the gene expression of a nucleic acid encoding a hydroxylase is increased by introducing at least one nucleic acid encoding a hydroxylase into the organism of the genus Blakesleaa.
- any hydroxylase gene that is to say any nucleic acid which codes for a hydroxylase, can be used for this purpose.
- nucleic acid sequences which have already been processed such as the corresponding cDNAs, are preferred to use.
- a hydroxylase gene is a nucleic acid encoding a hydroxylase from Haematococcus pluvialis with the accession no. AX038729 (WO 0061764; nucleic acid: SEQ ID NO: 31, protein: SEQ ID NO: 32), from Erwinia uredovora 20D3 (ATCC 19321, Accession No. D90087; nucleic acid: SEQ ID NO: 33, protein: SEQ ID NO: 34 ) or Hydroxylase from Thermus thermophilus (DE 102 34 126.5) encoded by the sequence with SEQ ID NO 76.
- Additional hydroxylases are encoded by the nucleic acids with the following accession numbers
- the genetically modified organism has, for example, at least one exogenous nucleic acid encoding a hydroxylase.
- nucleic acids encoding proteins are preferably used which contain the amino acid sequence SEQ ID NO: 32, 34 or encoded by the sequence with SEQ ID NO 76 or one of these sequences by substitution, insertion or deletion Sequence derived from amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, more preferably at least 80%, most preferably at least 90%, in particular 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, 99% Amino acid level with the sequence SEQ. ID. NO: 32, 34 or encoded by the sequence with SEQ ID NO 76 and which have the enzymatic property of a hydroxylase.
- hydroxylases and hydroxylase genes can be obtained, for example, from various organisms whose genomic sequence is known, as described above, by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ ID. NO: 31, 33 or 76 easy to find.
- hydroxylases and hydroxylase genes can also be obtained, for example, starting from the sequence SEQ ID NO: 31, 33 or 76 from various organisms whose genomic sequence is not known, as described above, by hybridization and PCR techniques in a manner known per se Easy to find.
- nucleic acids are introduced into organisms which encode proteins, containing the amino acid sequence of the hydroxylase of the sequence SEQ ID NO: 32, 34 or encoded by the sequence with the SEQ ID NO 76.
- Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
- Those codons which are frequently used in accordance with the organism-specific codon usage are preferably used for this.
- the codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms concerned.
- a nucleic acid containing the sequence SEQ is brought. ID. NO: 31, 33 or 76 in the organism.
- All of the above-mentioned hydroxylase genes can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
- the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, 2nd edition, Wiley Press New York, pages 896-897).
- the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
- the vector used in the transformation (i) therefore preferably comprises a sequence coding for a hydroxlase, in particular a hydroxlase from Haematococcus pluvialis with the SEQ ID NO: 70 or a hydroxlase from Erwinia uredova with the SEQ ID NO: 71 or a hydroxylase from Thermus thermophilus encoded by the sequence with SEQ ID NO 76.
- the vector used in transformation (i) preferably also contains expression-regulating and supporting areas, in particular promoters and terminators.
- the vector used in transformation (i) preferably contains the gpd and / or the ptefl promoter and / or the trpC terminator. This have proven particularly useful for transforming blakeslea.
- the use of "inverted repeats" IR, Römpp Lexikon der Biotechnologie 1992, Thieme Verlag Stuttgart, page 407 "Inverse repetitive sequences" for regulating expression or transcription is also within the scope of the invention.
- the gpd promoter used in the vector advantageously has the sequence SEQ ID NO: 1.
- the trpC terminator used in the vector advantageously has the sequence SEQ ID NO: 2.
- the ptefl promoter used in the vector advantageously has the sequence SEQ ID NO: 35.
- the gpd promoter and the trpC terminator from Aspergillus nidulans and the ptefl promoter from Blakeslea trispora are used.
- the vector used in transformation (i) contains a resistance gene. It is preferably a hygromycin resistance gene (hph), in particular that from E. coli. This resistance gene has proven to be particularly suitable for the detection of the transformation and selection of the cells.
- hph hygromycin resistance gene
- P-gpdA the promoter of glyceraldehyde-3-phosphate dehydrogenase from Aspergillus nidulans, is therefore preferably used as the promoter for hph.
- the terminator for hph is preferably t-trpC, the terminator of the trpC gene, coding for anthranilate synthase components from Aspergillus nidulans.
- Descendants of the pBinAHyg vector have proven to be particularly suitable as vectors.
- the vector used for the transformation therefore preferably comprises SEQ ID NO: 3.
- the vectors therefore comprise the sequence SEQ ID NO: 69 coding for the phytoendesaturase.
- the vectors further comprise the sequence SEQ ID NO: 72 coding for a ketolase.
- the vectors further comprise the sequence SEQ ID NO: 70 or 71 or 76 coding for a hydoxylase.
- the vector thus encompasses both a sequence SEQ ID NO: 72 coding for a ketolase and the sequence SEQ ID NO: 70 or 71 or 76 coding for a hydoxylase and thus enables the production of astaxanthin.
- vectors selected from the group consisting of SEQ ID NO: 37 to 51 and 62 can be used in the context of the invention.
- the genetically modified organisms can be used to produce carotenoids, xanthophylls or their precursors, in particular phytoene, bixion, astaxanthin, zeaxanthin and canthaxanthin.
- New carotenoids that do not naturally occur in the wild type can also be generated by introducing the appropriate genetic information from the specifically genetically modified cells or the mycelium formed by them and then isolated. It is preferably possible to obtain carotenoids or their precursors with the specifically genetically modified cells or the mycelium formed by them.
- the genetic modification is only carried out in cells of one of the mating types that occur (in Blakeslea trispora (+) or (-)), the corresponding other, unaltered mating type is added for cultivation, since this ensures good production of the carotenoids or their precursors due to the can be achieved from the second, unchanged mating type of substances released (e.g. trisporic acids).
- the genetic modification is advantageously carried out in cells of both mating types and these are cultivated together. As a result, particularly good growth and optimal production of the carotenoids or their precursors are achieved. (Artificial) addition of trisporic acids is also possible and useful.
- Trisporic acids are sex hormones in Mucorales mushrooms, such as Blakeslea, which stimulate the formation of zygophores and the production of ß-carotene (van den Ende 1968, J. Bacteriol. 96: 1298-1303, Austin et al. 1969, Nature 223: 1178 - 1179, Reschke Tetrahedron Lett. 29: 3435-3439, van den late 1970, J. Bacteriol. 101: 423-428).
- Agrobacterium tumefaciens LBA4404 was grown according to Hoekema et al. (1983, Nature 303: 179-180) at 28 ° C for 24 h in Agrobacteria Minimal Medium (AMM): 10 mM K 2 HP0 4 , 10 mM KH 2 P0 4 , 10 mM glucose, MM salts (2, 5mM NaCl, 2mM MgS0 4 , 700 ⁇ M CaCl 2 , 9 ⁇ M FeS0 4 , 4mM (NH 4 ) 2 S0 4 ).
- Agrobacteria Minimal Medium 10 mM K 2 HP0 4 , 10 mM KH 2 P0 4 , 10 mM glucose, MM salts (2, 5mM NaCl, 2mM MgS0 4 , 700 ⁇ M CaCl 2 , 9 ⁇ M FeS0 4 , 4mM (NH 4 ) 2 S0 4 ).
- the plasmid pBinAHyg was electroporated into the Agrobacterium strain LBA 4404 (Hoekema et al., 1983, Nature 303: 179-180) (Mozo and Hooykaas, 1991, Plant Mol. Biol. 16: 917-918).
- the following antibiotics were used for the selection of agrobacteria: rifampicin 50 mg / l (selection for the A. tumefaciens chromosome), streptomycin 30 mg / l (selection for the helper plasmid) and kanamycin 100 mg / l (selection for the binary vector).
- agrobacteria were grown after 24 h in AMM to an OD 60 o of 0.15 in induction medium (IM: MM salts, 40 mM MES (pH 5.6), 5 mM glucose, 2 mM phosphate, 0.5 % Glycerol, 200 ⁇ M acetosyringone) and again grown overnight in IM to an OD ⁇ oo of approximately 0.6.
- IM induction medium
- IM MM salts, 40 mM MES (pH 5.6), 5 mM glucose, 2 mM phosphate, 0.5 % Glycerol, 200 ⁇ M acetosyringone
- the medium contained hygromycin in a concentration of 100 mg / l for selection for transformed Blakeslea cells and 100 mg / l cefotaxime for selection against agrobacteria.
- the incubation was carried out at 26 ° C. for about 7 days. The mycelium was then transferred to fresh selection plates.
- spores formed were rinsed off with 0.9% NaCl and on CM 17-1 agar (3 g / l glucose, 200 mg / l L-asparagine, 50 mg / l MgSO 4 ⁇ 7H 2 0, 150 mg / l KH 2 P0 4 , 25 ⁇ g / l thiamineHCI, 100 mg / l yeast extract, 100 mg / l Na-deoxycholate, 100 mg / L hygromycin, 100 mg / L cefotaxime, pH 5.5.18 g / l agar).
- the spores were individually deposited on selective medium using a BectonDickson FACS device (model Vantage + Diva Option).
- the gpdA-hph-trpC cassette was isolated as a BglII / HindIII fragment from the plasmid pANsCosI (FIG. 1, Osiewacz, 1994, Curr. Genet. 26: 87-90, SEQ ID NO: 4) and inserted into the BamHI / HindIII fragment. Hindlll opened binary plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12: 8711-8721) ligated. The vector thus obtained was designated pBinAHyg (FIG. 2, SEQ ID NO: 3) and contained the E.
- the plasmid pBinAHyg was electroporated into the agrobacterial strain LBA 4404 (Hoekema et al., 1983, Nature 303: 179-180) (Mozo and Hooykaas, 1991, Plant Mol. Biol. 16: 917-918).
- the following antibiotics were used for the selection of agrobacteria: rifampicin 50 mg / l (selection for the A. tumefaciens chromosome), streptomycin 30 mg / l (selection for the helper plasmid) and kanamycin 100 mg / l (selection for the binary vector).
- agrobacteria were grown after 24 h in AMM to an OD6 60 of 0.15 in induction medium (IM: MM salts, 40 mM MES (pH 5.6), 5 mM Glucose, 2 mM phosphate, 0.5% glycerol, 200 ⁇ M acetosyringone) and diluted again overnight in IM to an OD 660 of approximately 0.6.
- IM MM salts, 40 mM MES (pH 5.6), 5 mM Glucose, 2 mM phosphate, 0.5% glycerol, 200 ⁇ M acetosyringone
- the medium contained hygromycin in a concentration of 100 mg / l for selection for transformed Blakeslea cells and 100 mg / l cefotaxime for selection against agrobacteria.
- the incubation was carried out at 26 ° C. for about 7 days. The mycelium was then transferred to fresh selection plates.
- CM 17-1 agar 3 g / l glucose, 200 mg / l L-asparagine, 50 mg / l MgSO 4 ⁇ 7H 2 0, 150 mg / l KH2P04, 25 ⁇ g / l thiamine-HCl, 100 mg / l yeast extract, 100 mg / l Na deoxycholate, pH 5.5, 100 mg / l cefotaxime, 100 mg / l hygromycin, 18 g / l agar). The transfer of spores to fresh selection plates was repeated three times. The transformant Blakeslea trispora GVO 3005 was isolated in this way.
- the spores were deposited individually using the BectonDickinson FacsVantage + Diva Option on CM-17 agar with 100 mg / l cefotaxime, 100 mg / l hygromycin. In this case, fungal mycelium was only formed where the spores were genetically modified.
- the primers hph-forward (5'-CGATGTAGGAGGGCGTGGATA, SEQ ID NO: 5) and hph-reverse (5'-GCTTCTGCGGGCGATTTGTGT, SEQ ID NO: 6) were used to detect the hygromycin resistance gene (hph).
- the expected fragment of hph was 800 bp in length.
- nptlll-forward (5'-TGAGAATATCACCGGAATTG, SEQ ID NO: 7)
- nptlll-reverse 5'-AGCTCGACATACTGTTCTTCC, SEQ ID NO: 8
- the expected fragment of nptlll was 700 bp in length.
- GTGAATGGAAATCCCATCGCTGTC SEQ ID NO: 9
- MAT293 5'-AGTGGGTACTCTAAAGGCCATACC, SEQ ID NO: 10.
- hygromycin resistance gene hph
- glyceraldehyde-3-phosphate dehydrogenase gene gpdl
- GMOs genetically modified organisms
- the aim is to obtain strains of Blakeslea with the insertion of the foreign DNA in all nuclei, i.e.
- the goal is a homonucleate recombinant fungal mycelium.
- a small proportion of the Blakeslea trispora spores or the genetically modified strains of Blakeslea trispora are naturally single-core.
- the mononuclear spores were sorted out by FACS and analyzed for MEP (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l Agar) with 100 mg / l cefotaxime and 100 mg / l hygromycin plated.
- the mycelia formed here were homonucleate.
- the spores of a 3-day-old smear were washed away with 10 ml Tris-HCI 50mMol + 0.1% Span20 per agar plate.
- the spore concentration was 0.5 to 0.8 x 10 7 spores per ml.
- 1 ml of DMSO and 10 ⁇ l of Syto 11 were added to 9 ml of spore suspension.
- the dyeing was then carried out at 30 ° C. for 2 hours. Selection and storage was carried out using a FacsVantage + Diva Option device from Becton Dickinson.
- MNNG N-methyl-N'-nitro-N-nitrosoguanidine
- a spore suspension with 1 x 10 7 spores / ml in Tris / HCl buffer, pH 7.0 was first prepared.
- MNNG was added to the spore suspension at a final concentration of 100 ⁇ g / ml.
- the time of incubation in MNNG was chosen so that the survival rate of the spores was approx. 5%.
- the spores were washed three times with 1 g / l Span 20 in 50 mM phosphate buffer pH 7.0 and sorted or selected according to the method described under 1).
- X-rays and UV rays could also be used to reduce the number of nuclei in the spores, as described by Cerdä-Olmedo and Patricia Reau in Mutation Res., 9 (1970), 369-384.
- the recessive selection marker pyrG can be used as a recessive selection marker for the selection of homonucleater mycelia.
- Wild-type strains of Blakeslea trispora are pyrG + . These strains cannot grow in the presence of the pyrimidine analog 5-fluororotate (FOA) because they convert FOA to lethal metabolites through the orotidine-5'-monophosphate decarboxylase.
- Genetically modified Blakesleaa which are homonucleate pyrG " , lack the enzyme activity orotidine-5'-monophosphate decarboxylase. As a result, these pyrG " strains cannot use 5-fluororotate. The strains therefore grow in the presence of FOA and uracil. In the case of the coupling of the mutation pyrG " and the insertion of foreign DNA on the core of a mononuclear spore, homonucleates recombinant fungal mycelium can be formed from this spore
- Homonucleate GMOs from Blakeslea trispora with the phenotype pyrG " were selected as follows.
- MEP (30 g / l malt extract, 3 g / l peptone, pH 5.5, 18 g / l) was used as described above.
- l agar plated with 100 mg / l cefotaxime and 100 mg / l hygromycin Transformants were washed off with 10 ml Tris-HCl 50mM + 0.1% Span20 per agar plate. The spore concentration was 0.5 to 0.8 x 10 7 spores per ml.
- the spores were then plated on FOA medium with 100 mg / l cefotaxime and 100 mg / l hygromycin.
- FOA medium contained 20 g glucose, 1 g FOA, 50 mg uracil, 200 ml citrate buffer (0.5 M, pH 4.5) and 40 ml trace salt solution according to Sutter, 1975, PNAS, 72: 127 per liter.
- Homonucleate pyrG " mutants showed growth on the uracil-containing FOA medium, but no growth when plated on FOA medium without uracil.
- homonucleate GMOs were produced from the Blakeslea trispora GMOs described below for the production of xanthophylls.
- Exemplary embodiments for the production of genetically modified organisms of Blakeslea trispora for the production of carotenoids and carotenoid precursors were generated by the "overlap-extension PCR” method and by subsequent insertion of the amplification products into the plasmid pBinAHyg.
- the "overlap-method” extension PCR was carried out as in Innis et al. (Eds.) PCR protocols: a guide to methods and applications, Academic Press, San Diego.
- the transformation of the pBinAHyg derivatives and the production Homonucleating of genetically modified strains of Blakeslea trispora was carried out as described above.
- plasmids (descendants of pBinAHyg) were used for the genetic engineering of Blakeslea trispora for the production of zeaxanthin.
- BTpcarRA-HPcrtZ SEQ ID NO: 38, FIG. 6
- p-carB-HPcrtZ containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarB promoter from Blakeslea trispora (Seq. PBinAHygBTpcarB-ID NOcr : 39, Fig. 7)
- p-carRA-HPcrtZ-TAG-3'carA-IR containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora.
- An inverted repeat structure is located downstream of the hydroxylase gene, which originates from the 3 ′ end of carA and the region located downstream of carA (IR, SEQ ID NO: 74, inverted repeat V approx. 350 bp from carA, then about 200 bp, loop 'and then about 350 bp inverted repeat 2') (Seq. pBinAHyg-BTpcarRA-HPcrtZ-TAG-3'carA-IR, SEQ ID NO: 40, Fig.
- p-carRA-HPcrtZ-GCG-3'carA-IR containing gene of the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 under the control of the pcarRA promoter from Blakeslea trispora.
- the hydroxylase gene is fused to an inverted repeat structure derived from the 3 'end of carA and the region downstream of carA (IR, SEQ ID NO: 74, inverted repeat 1' approx. 350 bp from carA , then approx. 200 bp, loop 'and then approx. 350 bp inverted repeat 2').
- the derived fusion protein consequently consists of the hydroxylase from Haematococcus pluvialis and the carboxy terminus from CarA from Blakeslea trispora (Seq. PBinAHyg-
- BTpcarRA-HPcrtZ-GCG-3'carA-IR SEQ ID NO: 41, Fig. 9
- p-tef1-EUcrtZ containing gene of the hydroxylase EUcrtZ (SEQ ID NO: 71) from Erwinia uredova 20D3 (Accession No. D90087) under the control of the ptefl promoter (Seq. pBinAHygBTpTEFI -EUcrtZ, SEQ ID NO: 42, Fig.
- p-carRA-EUcrtZ containing gene of the hydroxylase EUcrtZ from Erwinia uredova 20D3 under the control of the promoter pcarRA from Blakeslea trispora (Seq. pBinAHygBTpcarRA-EUcrtZ, SEQ ID NO:
- p-gpdA-BTcarR-HPcrtZ-BTcarA containing gene fusion from genes of the lycopene cyclase carR from Blakeslea trispora, the hydroxylase HPcrtZ from Haematococcus pluvialis Flotow NIES-144 and the phytoene synthase carA from Blakeslea trispora under control of the gpdAllin promoter - carR_crtZ_carA, SEQ ID NO: 46, Fig. 14);
- Blakeslea trispora (Seq. PBinAHygBTpTEFI-NpucrtW, SEQ ID NO: 47, Fig. 15); p-carRA-NPcrtW, containing the gene of the ketolase NPcrtW from Nostoc punctiform PCC73102 under the control of the pcarRA promoter from Blakeslea trispora (Seq. pBinAHygBTpcarRA-NpucrtW,
- p-carB-NPcrtW containing the kostolase NPcrtW gene from Nostoc punctiform PCC73102 under the control of the pcarB promoter from Blakeslea trispora (Seq. pBinAHygBTpcarB-NpucrtW, SEQ ID NO: 49, Fig. 17);
- plasmids (descendants of pBinAHyg) were used to modify Blakeslea trispora for production used by Astaxanthin, encode for hydroxylases (crtZ) and
- PCC73102 (ORF148, Accesion No. NZ_AABC01000196) both under the control of the pcarRA promoter from Blakeslea trispora (Seq. PBinAHygBTpcarRA-HPcrtZ-BTpcarRA-NpucrtW, SEQ ID NO: 50, Fig. 18); - p-carRA-EUcrtZ-pcarRA-NPcrtW, containing the gene of
- the cloning of p-tef from Blakeslea trispora was based on a sequence of the structural gene for the translation elongation factor 1- ⁇ from Blakeslea trispora already published in GenBank (AF157235). Starting from the sequence entry AF157235, primers for the inverse PCR were selected in order to amplify and sequence the promoter region located upstream of the structural gene.
- a 3000 bp fragment was obtained in the following approach: template DNA (1 ⁇ g genomic DNA from Blakeslea trispora ATCC 14272) primer MAT344 5'- GGCGTACTTGAAGGAACCCTTACCG-3 '(SEQ ID NO: 63) and MAT 345 5'-ATTGATGCTCCCGGTCACCGTGATT-3' (SEQ ID NO: 64) each 0.25 ⁇ M, 100 ⁇ M dNTP, 10 ⁇ l Herculase polymerase buffer 10x, 5 U Herculase (addition at 85 ° C), H 2 0 ad 100 ⁇ l.
- the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 60 ° C, 30 s. 72 ° C, 60 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle).
- the sequence section which lies upstream of the putative start codon of the gene tefl within 3000 bp fragment was designated as promoter ptefl.
- a 315 bp DNA probe was produced by the following PCR.
- Reaction mixture 1 ⁇ g of genomic DNA from Blakeslea trispora ATCC 14272, primer MAT314 5'- CCGATGGCGACGACGGAAGGTTGTT-3 '[SEQ ID NO 79] and MAT315 5'-CATGTTCATGCCCATTGCATCACCT-3' [SEQ ID NO 80] each 0.25 ⁇ M dNTP, 10 ⁇ l Herculase polymerase buffer 10x, 5 U Herculase (Addition at 85 ° C), H 2 0 ad 100 ul.
- the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 58 ° C, 30 s. 72 ° C, 30 s, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle).
- the cosmid library was screened with this DNA probe. A clone was identified, the cosmid of which hybridized with the DNA probe. The insertion of this cosmid was sequenced. The DNA sequence contained a section which was assigned to the gene of an HMG-CoA reductase [SEQ ID NO 75].
- the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 40 ° C, 30 s, 72 ° C, 30 s, 95 ° C, 30 s (35 cycles); 72 ° C, 10 min (1 cycle).
- the PCR profile was 95 ° C, 10 min (1 cycle); 85 ° C, 5 min (1 cycle); 60 ° C, 30 s, 72 ° C, 3 min, 95 ° C, 30 s (30 cycles); 72 ° C, 10 min (1 cycle);
- the cloned sequence section is shown schematically in FIG. 20 [SEQ ID NO 77]. Sequencing was carried out in the strand and counter-strand direction with the cloned fragments and with the PCR products. The sequence of the cloned sequence section is shown in Fig. 21 [SEQ ID NO 78].
- Gap Weight 8 Length Weight: 2
- Phaffia rhodozyma 50.460
- Neurospora crassa 47.943
- Neurospora crassa 51, 896
- Neurospora crassa 42.130
- Neurospora crassa 60.230
- the Blakeslea trispora genomic DNA identified three exons which, when combined, result in a coding region whose derived gene product has 72.7% identical aminoacyl residues over the entire length with the Phytoendesaturase CarB from Phycomyces blakesieeanus. This sequence section from three possible exons and two possible introns was therefore referred to as the carB gene.
- the coding sequence of carB from Blakeslea trispora was determined by PCR with cDNA from Blakeslea trispora as a template and with the primers Bol1425 5'-AGAGAGGGATCCTTAAATGCGAATATCGTTGC-3 '(SEQ ID 56) and Bol1426 ⁇ '-AGATAGAGAAT (AGATAGAGAGAT) SEQ ID 57). The DNA fragment obtained was sequenced. The location of exons and introns was confirmed by comparison of the cDNA with the genomic DNA of carB.
- the coding sequence of carB is shown schematically in FIG.
- the Ndel cleavage site in carB was first removed by the overlap extension PCR method, and a Ndel cleavage site was inserted at the 5 end of the gene and a BamHI cleavage site at the 3 'end.
- the DNA fragment obtained was ligated to the vector pJOE2702.
- the plasmid obtained was designated pBT4 and cloned together with pCAR-AE in Escherichia coli XL1-Blue. Expression was carried out by induction with rhamnose. Enzyme activity was demonstrated by detecting lycopene synthesis via HPLC. The cloning steps are described below: PCR 1.1:
- PCR 2 was carried out to produce the coding sequence for carB from Blakeslea trispora for cloning in pJOE2702:
- CarB The gene product derived from carB was called CarB. Based on the peptide sequence analysis, CarB has the following properties:
- the plasmids pCAR-AE and pBT4 were therefore transferred to Escherichia coli. After growth in liquid culture, the carotenoids were extracted from the cells and characterized (see above). It was demonstrated by HPLC analysis that the Escherichia coli XL1-Blue (pCAR-AE) strain produces phytoene and the Escherichia coli XL1-Blue (pCAR-AE) (pBT4) strain produces lycopene. CarB consequently shows the enzyme activity of a phytoendesaturase.
- pBinAHyg ⁇ carB SEQ. ID. NO: 62, Fig. 22
- the precursor of pBinAHyg ⁇ carB is pBinAHyg (SEQ. ID. NO: 3, Fig. 2).
- pBinAHyg was constructed as follows:
- the gpdA-hph cassette was isolated as a BglII / HindIII fragment from the plasmid pANsCosI (SEQ. ID. NO: 4, Fig. 1, Osiewacz, 1994, Curr. Genet. 26: 87-90) and opened in the BamHI / HindIII fragment binary plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12: 8711-8721) ligated.
- the vector obtained in this way was designated pBinAHyg and contains the E.
- coli hygromycin resistance gene (hph) under the control of the gpd promoter and the trpC terrminator from Aspergillus nidulans and the corresponding border sequences which are necessary for the DNA transfer from Agrobacterium.
- the amplification of the coding sequence of carB with the primers MAT350 and MAT353 by means of PCR was carried out with the following parameters: 50 ng pBT4 with 0.25 ⁇ M MAT350 ( ⁇ '-ACTTTATTGGATCCTTAAAT-GCGAATATCGTTGCTGC-3 '; SEQ ID NO 58), 0, 25 ⁇ M MAT353 (5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3 '; SEQ ID NO 61), 100 ⁇ M dNTP, 10 ⁇ L Pfu polymerase buffer, 2.5 U Pfu polymerase (addition at 85 ° C., “hot start”) and ad 100 ⁇ L H 2 0 temperature profile: 1.
- the plasmid pBinAHyg ⁇ carB was transferred into the agrobacterial strain LBA 4404, for example by electroporation (see above).
- the plasmid from Agrobacterium tumefaciens LBA 4404 was then transferred into Blakeslea trispora ATCC 14272 and in Blakeslea trispora ATCC 14271 (see above)
- the successful detection of the gene transfer in Blakesleslea trispora was carried out via polymerase chain reaction according to the following protocol:
- shake flasks were inoculated with spore suspensions of (+) and (-) strains of the Blakeslea trispora GMO.
- the shake flasks were incubated at 26 ° C at 250 rpm for 7 days.
- trisporic acids were added to mixtures of the strains after 4 days and incubated for a further 3 days.
- the final concentration of trisporic acids was 300 - 400 ⁇ g / ml.
- Eluent A 50 mM NaH 2 PO 4 , pH 2.5 with perchloric acid
- Extracts from the fermentation broths were used as the matrix. Before the HPLC, each sample was filtered through a 0.22 ⁇ m filter. The samples were kept cool and protected from light. For the calibration, 50-1000 mg / l were weighed out and dissolved in THF. Phytoene was used as standard, which under the given conditions had a retention time of 7.7 min. having.
- Extracts from the fermentation broths were used as the matrix. Before the HPLC, each sample was filtered through a 0.22 ⁇ m filter. The samples were kept cool and protected from light. For the calibration, 10 mg were weighed out and dissolved in 100 ml of THF. The following carotenoids with the following retention times were used as standard: ⁇ -carotene (12.5 min), lycopene (11.7 min), echinenone (10.9 min), cryptoxanthin (10.5 min), canthaxanthin (8.7 min) , Zeaxanthin (7.6 min) and astaxanthin (6.4 min) [s. Fig 23].
- GMOs genetically modified organisms
- the vector pBinAHygBTpTEFI -HPcrtZ was transferred into Blakeslea trispora by agrobacterium-mediated transformation (see above).
- a hygromycin-resistant clone was isolated and transferred to a potato-glucose agar plate (Merck KGaA, Darmstadt). After three days of incubation at 26 ° C, a spore suspension was prepared from this plate.
- a 250 ml Erlenmeyer flask without baffles with 50 ml growth medium (corn flour 47 g / l, soy flour 23 g / l, KH 2 P0 4 0.5 g / l, thiamine-HCl 2.0 mg / l, pH with NaOH sterilization set to 6.2-6.7) was inoculated with 1x10 5 spores. This preculture incubated for 48 hours at 26 ° C and 250 rpm.
- a 250 ml Erlenmeyer flask without baffle was used for the main culture containing 40 ml of production medium inoculated with 4 ml of the preculture and incubated for 8 days at 26 ° C. and 150 rpm.
- the production medium contained 50 g / l glucose, casein acid hydrolyzates 2 g / l, yeast extract 1 g / l, L-asparagine 2 g / l, KH 2 P0 4 1.5 g / l, MgS0 4 x 7 H 2 0 0 , 5 g / l, thiamine-HCl 5 mg / l, Span20 10 g / l, Tween 80 1 g / l, linoleic acid 20 g / l, corn steep liquor 80 g / l. After 72 hours, kerosene was added at a final concentration of 40 g / l kerosene.
- the remaining approximately 35 ml of culture are made up to 40 ml with water.
- the cells are then disrupted 3 times at 1500 bar in a high-pressure homogenizer, type Micron Lab 40, from APV Gaulin.
- the suspension with the disrupted cells was mixed with 35 ml of THF and shaken for 60 min at RT in the dark at 250 rpm. Then 2 g of NaCl were added and the mixture was shaken again. The extraction batch was then centrifuged at 5000 x g for 10 min. The colored THF phase was removed and the cell mass was completely decolorized.
- the THF phase was concentrated to 1 ml on a rotary evaporator at 30 mbar and 30 ° C. and then again taken up in 1 ml of THF. After centrifugation at 20,000 x g for 5 min, an aliquot of the upper phase was removed and analyzed by HPLC (FIG. 24, FIG. 23).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Polymers & Plastics (AREA)
- Mycology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Food Science & Technology (AREA)
- Nutrition Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Animal Husbandry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Verfahren zur gentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren Verwendung Zusammenfassung Verfahren zur Herstellung eines gentechnisch veränderten Organismus der Gattung Blakeslea umfassend (i) Transformation mindestens einer der Zellen, (ii) ggf. Homokaryotisierung der aus (i) erhaltenen Zellen, so dass Zellen entstehen, in denen die Kerne in einem oder mehreren genetischen Merkmalen alle gleichartig verändert sind und diese gentechnische Veränderung zur Ausprägung bringen, und (iii) Selektion und Anzucht der gentechnisch veränderten Zelle oder Zellen.
Description
Verfahren zur qentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren
Verwendung
Die Erfindung betrifft ein Verfahren zur gentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren Verwendung.
Pilze der Gattung Blakeslea sind als Produktionsorganismen bekannt. So wird z. B. Blakeslea trispora als Produktionsorganismus für ß-Carotin (Ciegler, 1965, Adv Appl Microbiol. 7:1) und Lycopin verwendet (EP 1201762, EP 1184464, WO 03/038064). Daneben kommt Blakeslea zur Produktion anderer lipophiler Substanzen in Frage wie z.B. andere Carotinoide und deren Vorstufen, Phospholipide, Triacylglyceride, Steroide, Wachse, fettlösliche Vitamine, Provitamine und Cofaktoren oder zur Produktion hydrophiler Substanzen wie z.B. Eiweiße, Aminosäuren, Nukleotide und wasserlösliche Vitamine, Provitamine und Cofaktoren.
Die hohen Produktivitäten für ß-Carotin und Lycopin machen Blakeslea, insbesondere Blakeslea trispora attraktiv für die wirtschaftliche fermentative Herstellung von Carotinoiden und deren Vorstufen.
Allerdings ist es auch von Interesse, die Produktivitäten der bisher natürlicherweise produzierten Carotine und deren Vorstufen weiter zu steigern und die Herstellung weiterer Carotinoide, wie z. B. Xanthophylle zu ermöglichen, die von Blakeslea bisher nicht oder nur in sehr geringem Maße gebildet und isoliert werden können.
Carotinoide werden Futtermitteln, Nahrungsmitteln,
Nahrungsergänzungsmitteln, Kosmetika und Arzneimitteln zugesetzt. Die Carotinoide dienen vor allem als Pigmente zur Färbung. Daneben werden
die antioxidative Wirkung der Carotinoide und andere Eigenschaften dieser Substanzen genutzt. Man unterteilt die Carotinoide in die reinen Kohlenwasserstoffe, die Carotine und die sauerstoffhaltigen Kohlenwasserstoffe, die Xanthophylle. Xanthophylle wie Canthaxanthin und Astaxanthin werden beispielsweise zur Pigmentierung von Hühnereiern und Fischen eingesetzt (Britton et al. 1998, Carotinoids, Vol 3, Biosynthesis and Metabolism). Die Carotine ß-Carotin und Lycopin werden vor allem in der Humanernährung eingesetzt. ß-Carotin wird beispielsweise als Getränkefarbstoff verwendet. Lycopin hat eine krankheitsvorbeugende Wirkung (Argwal und Rao, 2000, CMAJ 163:739- 744; Rao und Argwal 1999, Nutrition Research 19:305-323). Die farblose Carotinoidvorstufe Phytoen kommt vor allem für Anwendungen als Antioxidans in Frage.
Der überwiegende Teil der Carotinoide und deren Vorstufen, die als Zusatzstoffe für die oben genannten Anwendungen eingesetzt werden, wird durch chemische Synthese hergestellt. Die chemische Synthese ist mehrstufig, technisch sehr aufwendig und verursacht hohe Herstell kosten. Fermentative Verfahren sind demgegenüber technisch verhältnismäßig einfach und basieren auf kostengünstigen Einsatzstoffen. Fermentative Verfahren zur Herstellung von Carotinoiden können dann wirtschaftlich attraktiv und wettbewerbsfähig zur chemischen Synthese sein, wenn die Produktivität der bisherigen fermentativen Verfahren gesteigert würde oder neue Carotinoide auf Basis der bekannten Produktionsorganismen hergestellt werden könnten.
Ein Verfahren zur gentechnischen Veränderung von Blakeslea trispora ist erforderlich insbesondere, wenn Blakeslea zur Herstellung von Xanthophyllen genutzt werden soll, weil diese Verbindungen natürlicherweise von Blakeslea nicht synthetisiert werden.
Von Blakeslea trispora sind bisher verschiedene DNA-Sequenzen bekannt insbesondere die DNA-Sequenz, die für die Gene der Carotinoidbiosynthese von Geranylgeranylpyrophosphat bis ß-Carotin codiert (WO 03/027293).
Allerdings sind bisher keine Methoden zur gentechnischen Veränderung von Blakeslea, insbesondere Blakeslea trispora bekannt.
Als Methode zur Herstellung von gentechnischen veränderten Pilzen wurde in einigen Fällen die Agrobacterium-vermittelte Transformation erfolgreich eingesetzt. So sind z. B. folgende Organismen durch
Agrobakterien transformiert worden: Saccharomyces cerevisiae (Bundock et al., 1995, EMBO Journal, 14:3206-3214), Aspergillus awamori,
Aspergilius nidulans, Aspergillus niger, Colletotrichum gloeosporioides, Fusarium solani pisi, Neurospora crassa, Trichoderma reesei, Pleurotus ostreatus, Fusarium graminearum (van der Toorren et al., 1997, EP
870835), Agraricus bisporus, Fusarium venenatum (de Groot et al., 1998,
Nature Biotechnol. 16:839-842), Mycosphaerella graminicola (Zwiers et al.
2001 , Curr. Genet. 39:388-393), Glarea lozoyensis (Zhang et al., 2003, Mol. Gen. Genomics 268:645-655), Mucor miehei (Monfort et al. 2003,
FEMS Microbiology Lett. 244:101 - 106).
Von Interesse ist besonders eine homologe Rekombination, bei der zwischen der einzuführenden DNA und der Zeil-DNA möglichst viele Sequenzhomologien bestehen, so dass eine ortsspezifische Einführung bzw. Ausschaltung von genetischer Information im Genom des Empfängerorganismus möglich ist. Andernfalls wird die Spender-DNA durch illegitime bzw. nicht-homologe Rekombination ins Genom des Empfängerorganismus integriert, was nicht ortsspezifisch erfolgt.
Eine durch Agrobacterium vermittelte Transformation und anschließende homologe Rekombination der transferierten DNA wurde bisher bei folgenden Organismen nachgewiesen: Aspergillus awamori (Gouka et al. 1999, Nature Biotech 17:598-601), Glarea lozoyensis (Zhang et al., 2003, Mol. Gen. Genomics 268:645-655), Mycosphaerella graminicola (Zwiers et al. 2001, Curr. Genet. 39:388-393).
Als weitere Methode zur Transformation von Pilzen ist die Elektroporation bekannt. Die integrative Transformation von Hefe durch Elektroporation wurde von Hill, Nucl. Acids. Res. 17:8011 gezeigt. Für filamentöse Pilze wurde die Transformation durch Chakaborty und Kapoor beschrieben (1990, Nucl. Acids. Res. 18:6737).
Eine „biolistische" Methode, d.h. die Übertragung von DNA durch Beschuss von Zellen mit DNA-beladenen Partikeln wurde beispielsweise für Trichoderma harzianum und Gliocladium virens beschrieben (Lorito et al. 1993, Curr. Genet. 24:349-356).
Diese Methoden konnten bisher jedoch nicht erfolgreich zur gezielten genetischen Veränderung von Blakeslea und insbesondere Blakeslea trispora eingesetzt werden.
Eine besondere Schwierigkeit bei der Herstellung von gezielt genetisch veränderten Blakeslea und Blakeslea trispora ist die Tatsache, dass deren Zellen in allen Stadien des sexuellen und des vegetativen Zelizyklus mehrkernig sind. In Sporen von Blakeslea trispora Stamm NRRL2456 und NRRL2457 wurden z. B. im Durchschnitt 4,5 Kerne pro Spore nachgewiesen (Metha und Cerdä-Olmedo, 1995, Appl. . Microbiol. Biotechnol. 42:836-838). Dies hat zur Folge, dass die gentechnische Veränderung in aller Regel nur in einem oder wenigen Kernen vorliegt, die Zellen also heterokaryotisch sind.
Sollen die genetisch veränderten Blakeslea-Arten, insbesondere Blakeslea trispora zur Produktion eingesetzt werden, so ist es insbesondere bei einer Gendeletion wichtig, dass in den Produktionsstämmen die gentechnische Veränderung in allen Kernen vorliegt, so dass eine stabile und hohe Syntheseleistung ohne Nebenprodukte möglich wird. Die Stämme müssen folglich in Bezug auf die gentechnische Veränderung homokaryotisch sein.
Lediglich für Phycomyces blakesleeanus ist ein Verfahren beschrieben worden, um homokaryotische Zellen zu erzeugen (Roncero et al., 1984, Mutat. Res. 125:195). Durch Zugabe des mutagenen Agens MNNG (N- Methyl-N'-nitro-N-nitrosoguanidin) werden nach dem dort beschriebenen Verfahren Kerne in den Zellen eliminiert, so dass statistisch eine gewisse Anzahl von Zellen mit nur noch einem funktionellem Kern vorliegt. Die Zellen werden dann einer Selektion unterzogen, in der nur einkernige Zellen mit einem rezessiven Selektionsmarker zu einem Mycel auswachsen können. Die Nachkommen dieser selektierten Zellen sind mehrkernig und homokaryotisch. Ein rezessiver Selektionsmarker für Phycomyces blakesleanus ist z. B. dar. Dar+-Stämme nehmen das toxische Riboflavin-Analog 5-Carbon-5-deazariboflavin auf; Dar^-Stämme dagegen nicht (Delbrück et al. 1979, Genetics 92:27). Die Selektion von rezessiven Mutanten erfolgt durch Zugabe von 5-Carbon-5-deazariboflavin (DARF).
Allerdings ist dieses Verfahren nicht für Blakeslea, insbesondere Blakeslea trispora bekannt und insbesondere nicht mit im Zusammenhang mit einer Transformation beschrieben worden.
Aufgabe der vorliegenden Erfindung ist es, ein Verfahren bereitzustellen, mit dem eine gentechnische Veränderung von Blakeslea-Stämmen,
insbesondere Blakeslea trispora möglich ist. Darüber hinaus ist es Aufgabe der Erfindung ein Verfahren bereitzustellen, das die Herstellung homokaryotischer genetisch veränderter Stämme erlaubt. Ferner ist es eine Aufgabe der Erfindung entsprechend gentechnisch veränderte Zellen bereitzustellen.
Diese Aufgabe wird durch ein Verfahren zur Herstellung eines gentechnisch veränderten Organismus der Gattung Blakeslea gelöst, umfassend
(i) Transformation mindestens einer der Zellen,
(ii) ggf. Homokaryotisierung der aus (i) erhaltenen Zellen, so dass Zellen entstehen, in denen die Kerne in einem oder in mehreren genetischen Merkmalen alle gleichartig verändert sind und diese genetische Veränderung zur Ausprägung bringen, und
(iii) Selektion der gentechnisch veränderten Zelle oder Zellen.
Mit der erfindungsgemäßen Methode ist es möglich, mehrkernige Zellen der Pilze Blakeslea gezielt und stabil genetisch zu verändern, um so Mycel aus Zellen mit einheitlichen Kernen zu gewinnen. Vorzugsweise handelt es sich Zellen von Pilzen der Art Blakeslea trispora.
Unter Transformation wird die Übertragung einer genetischen Information in den Organismus, insbesondere Pilz verstanden. Darunter sollen alle dem Fachmann bekannten Möglichkeiten zur Einschleusung der Information, insbesondere DNA fallen, z. B. Beschuss mit DNA-beladenen Partikeln, Transformation mittels Protoplasten, Mikroinjektion von DNA, Elektroporation, Konjugation oder Transformation kompetenter Zellen, Chemikalien oder Agrobakterien vermittelte Transformation. Als genetische Information werden ein Genabschnitt, ein Gen oder mehrere
Gene verstanden. Die genetische Information kann z. B. mit Hilfe eines Vectors oder als freie Nukleinsäure (z. B. DNA, RNA) und auf sonstige Weise in die Zellen eingebracht und entweder durch Rekombination ins Wirtsgenom eingebaut oder in freier Form in der Zelle vorliegen. Besonders bevorzugt ist hierbei die homologe Rekombination.
Bevorzugte Transformationsmethode ist die Agrobacterium tumefaciens- vermittelte Transformation. Hierzu wird zunächst die zu transferierende Spender-DNA in einen Vektor eingefügt, der (i) flankierend zu der zu transferierenden DNA die T-DNA-Enden trägt, der (ii) einen Selektionsmarker enthält und der (iii) ggf. Promotoren und Terminatoren für die Genexpression der Spender-DNA aufweist. Dieser Vektor wird in einen Agrobacterium-tumefaciens-Stamm übertragen, der ein Ti-Plasmid mit den vir-Genen enthält. vir-Gene sind für den DNA-Transfer in Blakeslea verantwortlich. Mit diesem Zwei-Vektor-System wird die DNA von Agrobacterium in Blakeslea übertragen. Hierzu werden die Agrobakterien zunächst in Gegenwart von Acetosyringone inkubiert. Acetosyringone induziert die vir-Gene. Anschließend werden Sporen von Blakeslea trispora zusammen mit den induzierten Zellen von Agrobacterium tumefaciens auf Acetosyringone-haltigem Medium inkubiert und dann auf Medium übertragen, das eine Selektion der Transformanten, d.h. der gentechnisch veränderten Stämme von Blakeslea ermöglicht.
Der Begriff Vector wird in der vorliegenden Anmeldung als eine Bezeichnung für ein DNA-Molekül verwendet, das zum Einschleusen und ggf. zur Vermehrung von Fremd-DNA in eine Zelle dient (siehe auch "Vector" in Römpp Lexikon Chemie - CDROM Version 2.0, Stuttgart/New York: Georg Thieme Verlag 1999). In der vorliegenden Anmeldung sollen unter dem Begriff "Vector" Plasmide, Cosmide usw. verstanden werden, die diesem Zweck dienen.
Unter Expression wird in der vorliegenden Anmeldung die Übertragung einer genetischen Information ausgehend von DNA oder RNA in ein Gen- Produkt (hier vorzugsweise Carotinoide) verstanden und soll auch den Begriff der Überexpression beinhalten, womit eine verstärkte Expression gemeint ist, so dass ein bereits in der nicht transformierten Zelle (Wildtyp) hergestelltes Produkt verstärkt produziert wird oder einen großen Teil des gesamten Gehaltes der Zelle ausmacht.
Unter gentechnischer Veränderung soll die Einschleusung genetischer Information in einen Empfängerorganismus, so dass diese stabil exprimiert und bei der Zellteilung weitergegeben wird, verstanden werden. Danach wird gegebenenfalls die Homokaryontisierung durchgeführt, d.h. die Herstellung von Zellen, die nur einheitliche Kerne enthalten, d. h. Kerne mit gleichem genetischem Informationsgehalt.
Diese Homokaryotisierung ist insbesondere notwendig, wenn die durch Transformation eingeführte genetische Information rezessiv vorliegt, d. h. nicht zur Ausprägung gelangt. Führt die Transformation aber zu einem dominanten Vorliegen der genetischen Information, d. h. wird sie ausgeprägt, so ist eine Homokaryotisierung nicht unbedingt nötig.
Vorzugsweise wird zur Homokaryotisierung eine Selektion der einkernigen Sporen durchgeführt. Von Natur aus ist ein geringer Anteil der Sporen von Blakeslea trispora einkernig, so dass sich diese ggf. nach spezifischer Markierung z. B. Färbung der Zellkerne aussortieren lassen. Dies wird bevorzugterweise mittels FACS (Fluorescence Activated Cell Sorting) anhand der geringeren Fluoreszenz der einkernigen Zellen durchgeführt.
Alternativ kann zur Homokaryotisierung zunächst eine Kernreduktion durchgeführt werden. Hierzu kann ein mutagenes Agens eingesetzt werden, wobei es sich insbesondere um N-Methyl-N'-nitro-nitrosoguanidin
(MNNG) handelt. Auch die Verwendung von energiereichen Strahlen, wie UV- oder Röntgen-Strahlen zur Kernreduktion ist möglich. Anschließend kann zur Selektion auf das FACS Verfahren oder rezessive Selektionsmarker zurückgegriffen werden.
Unter Selektion wird die Auswahl von Zellen verstanden, deren Kerne dieselbe genetische Information beinhalten, d. h. Zellen die die gleichen Eigenschaften aufweisen, wie Resistenzen oder die Herstellung bzw. vermehrte Herstellung eines Produktes. In der Selektion werden neben der FACS Methode bevorzugt 5-Carbon-5-deazariboflavin (darf) und Hygromycin (hyg) oder δ'-Fluororotat (FOA) und Uracil eingesetzt.
Der in der Transformation (i) eingesetzte Vector kann derart gestaltet sein, dass die im Vector enthaltene genetische Information in das Genom mindestens einer Zelle integriert wird. Dabei kann genetische Information in der Zelle ausgeschaltet werden.
Der in der Transformation (i) eingesetzte Vector kann aber auch derart ausgestaltet sein, dass die im Vector enthaltene genetische Information in der Zelle exprimiert wird, d. h. genetische Information eingefügt wird, die im korrespondierenden Wildtyp nicht vorhanden ist oder die durch die Transformation verstärkt bzw. überexprimiert wird.
Der Vector kann beliebige genetische Informationen zur genetischen Veränderungen von Organismen der Gattung Blakeslea enthalten.
Unter „genetischer Information" werden vorzugsweise Nukleinsäuren verstanden, deren Einbringung in den Organismus der Gattung Blakeslea zu einer genetischen Veränderung in Organismen der Gattung Blakeslea, also beispielsweise zu einer Verursachung, Erhöhung oder Reduzierung von Enzymaktivitäten im Vergleich zum Ausgangsorganismus führen.
Der Vector kann beispielsweise genetische Information zur Herstellung lipophiler Substanzen enthalten wie z.B. Carotinoide und deren Vorstufen, Phospholipide, Triacylglyceride, Steroide, Wachse, fettlösliche Vitamine, Provitamine und Cofaktoren oder genetische Information zur Herstellung hydrophiler Substanzen wie z.B. Eiweiße, Aminosäuren, Nukleotide und wasserlösliche Vitaminen, Provitamine und Cofaktoren.
Bevorzugterweise enthält der eingesetzte Vector genetische Informationen zur Herstellung von Carotinoiden oder Xanthophyllen oder deren Vorstufen.
Bevorzugterweise enthält der Vektor genetische Information, die eine Lokalisierung der Carotinoidbiosynthese-Enzyme in dem Zellkompartiment bewirkt, in dem die Carotinoidbiosynthese stattfindet.
Besonders bevorzugt sind genetische Informationen zur Herstellung von Astaxanthin, Zeaxanthin, Echinenon, ß-Cryptoxanthin, Andonixanthin, Adonirubin, Canthaxanthin, 3- und 3'-Hydroxyechinenon, Lycopin, Lutein, ß-Carotin, Phytoen oder Phytofluen. Ganz besonders bevorzugt sind genetische Informationen zur Herstellung von Phytoen, Bixin, Lycopin, Zeaxanthin, Canthaxanthin und Astaxanthin.
Entsprechend werden in einer bevorzugten Variante der Erfindung Organismen hergestellt und kultiviert, die über eine erhöhte Syntheserate für Zwischenprodukte der Carotinoidbiosynthese verfügen und folglich eine erhöhte Produktivität für Endprodukte der Carotinoidbiosynthese aufweisen. Zur Erhöhung der Syntheserate für Zwischenprodukte der Carotinoidbiosynthese werden insbesondere die Aktivitäten der Enzyme 3- Hydroxy-3-Methyl-Glutaryl-Coenzym-A-Reduktase,
Isopentenylpyrophosphat-Isomerase und Geranylpyrophosphatsynthase gesteigert.
Entsprechend werden in einer besonders bevorzugten Variante der Erfindung Organismen hergestellt und kultiviert, die gegenüber dem Wildtyp eine erhöhte HMG-CoA-Reduktase-Aktivität aufweisen.
Unter HMG-CoA-Reduktase-Aktivität wird die Enzymaktivität einer HMG- CoA-Reduktase (3-Hydroxy-3-Methyl-Glutaryl-Coenzym-A-Reduktase) verstanden.
Unter einer HMG-CoA-Reduktase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, 3-Hydroxy-3-Methyl-Glutaryl- Coenzym-A in Mevalonat umzuwandeln.
Dementsprechend wird unter HMG-CoA-Reduktase-Aktivität die in einer bestimmten Zeit durch das Protein HMG-CoA-Reduktase umgesetzte Menge 3-Hydroxy-3-Methyl-Glutaryl-Coenzym-A bzw. gebildete Menge Mevalonat verstanden.
Bei einer erhöhten HMG-CoA-Reduktase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein HMG-CoA-Reduktase die umgesetzte Menge 3-Hydroxy-3-Methyl- Glutaryl-Coenzym-A bzw. die gebildete Menge Mevalonat erhöht.
Vorzugsweise beträgt diese Erhöhung der HMG-CoA-Reduktase-Aktivität mindestens 5%, weiter bevorzugt mindestens 20%, weiter bevorzugt mindestens 50%, weiter bevorzugt mindestens 100%, bevorzugter mindestens 300%, noch bevorzugter mindestens 500%, insbesondere mindestens 600% der HMG-CoA-Reduktase-Aktivität des Wildtyps.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der HMG- CoA-Reduktase-Aktivität gegenüber dem Wildtyp durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine HMG-CoA-Reduktase.
In einer besonders bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine HMG-CoA-Reduktase indem man ein Nukleinsäurekonstrukt, enthaltend eine Nukleinsäure codierend eine HMG-CoA-Reduktase in den Organismus einbringt, deren Expression in dem Organismus, verglichen mit dem Wildtyp, einer reduzierten Regulation unterliegt.
Unter einer reduzierten Regulation verglichen mit dem Wildtyp, wird eine im Vergleich zum vorstehend definierten Wildtyp verringerte, vorzugsweise keine Regulation auf Expressions- oder Proteinebene verstanden.
Die reduzierte Regulation kann vorzugsweise durch einen im Nukleinsäurekonstrukt mit der kodierenden Sequenz funktionell verknüpften Promotor erreicht werden, der in dem Organismus verglichen mit dem Wildtyp-Promoter einer reduzierten Regulation unterliegt.
Beispielsweise unterliegen die Promotoren ptefl aus Blakeslea trispora und pgpdA aus Aspergillus nidulans nur einer reduzierten Regulation und sind daher insbesondere als Promotoren bevorzugt.
Diese Promotoren zeigen eine annähernd konstitutive Expression in Blakeslea trispora, so dass die transkriptioneile Regulation nicht mehr über die Intermediate der Carotinoidbiosynthese abläuft.
Die reduzierte Regulation kann in einer weiteren bevorzugten Ausführungsform dadurch erreicht werden, dass man als Nukleinsäure
codierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, deren Expression in dem Organismus, verglichen mit der Organismus eigenen, orthologen Nukleinsäure, einer reduzierten Regulation unterliegt.
Besonders bevorzugt ist die Verwendung einer Nukleinsäure, die nur den katalytischen Bereich der HMG-CoA-Reduktase kodiert (trunkierte (t- )HMG-CoA-Reduktase). Die für die Regulation verantwortliche Membran- Domäne fehlt. Die verwendete Nukleinsäure unterliegt somit einer reduzierten Regulation und führt zu einer Erhöhung der Genexpression der HMG-CoA-Reduktase.
In einer besonders bevorzugten Ausführungsform bringt man Nukleinsäuren in Blakeslea trispora ein, welche die Sequenz SEQ ID. NO. 75 enthalten.
Weitere Beispiele für HMG-CoA-Reduktasen und damit auch für die auf den katalytischen Bereich reduzierten t-HMG-CoA-Reduktasen bzw. die kodierenden Gene lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, durch Homologievergleiche der Sequenzen aus Datenbanken mit der SEQ ID. NO. 75 leicht auffinden.
Weitere Beispiele für HMG-CoA-Reduktasen und damit auch für die auf den katalytischen Bereich reduzierten t-HMG-CoA-Reduktasen bzw. die kodierenden Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ ID. NO. 75 aus verschiedenen Organismen deren genomische Sequenz nicht bekannt ist, durch Hybridisierungs- und PCR- Techniken in an sich bekannter Weise leicht auffinden.
In einer besonders bevorzugten Ausführungsform wird die reduzierte Regulation dadurch erreicht, dass man als Nukleinsäure codierend eine
HMG-CoA-Reduktase eine Nukleinsäure verwendet, deren Expression in
dem Organismus, verglichen mit der Organismus eigenen, orthologen Nukleinsäure, einer reduzierten Regulation unterliegt und einen Promotor verwendet, der in dem Organismus, verglichen mit dem Wildtyp-Promoter einer reduzierten Regulation unterliegt.
Entsprechend wird in einer bevorzugten Variante der Erfindung durch die Transformation die Genexpression der Phytoendesaturase ausgeschaltet, so dass das von den Organismen produzierte Phytoen gewonnen werden kann. Der in der Transformation (i) eingesetzte Vector umfasst daher in einer Ausführungsform der Erfindung bevorzugterweise eine Sequenz codierend für ein Fragment des Gens der Phytoendesaturase, insbesondere carB aus Blakeslea trispora mit der SEQ ID NO: 69.
Entsprechend wird in einer bevorzugten Variante der Erfindung durch Transformation die Genexpression der Lycopincyclase ausgeschaltet, so dass das von den Organismen produzierte Lycopin gewonnen werden kann. Der in der Transformation eingesetzte Vektor umfasst daher in einer Ausführungsform der Erfindung bevorzugterweise eine Sequenz codierend für ein Fragment des Gens der Lycopincyclase, insbesondere carR aus Blakeslea trispora s. (WO 03/027293).
In einer weiteren bevorzugten Ausführungsform werden die Organismen der Gattung Blakeslea beispielsweise in die Lage versetzt Xanthophylle, wie beispielsweise Zeaxanthin oder Astaxanthin herzustellen, indem die genetisch veränderten Organismen der Gattung Blakeslea im Vergleich zum Wildtyp eine Hydroxylase-Aktivität und/oder eine Ketolase-Aktivität besitzen.
Der in der Transformation (i) eingesetzte Vector enthält also in einer weiteren, bevorzugten Variante der Erfindung genetische Informationen, die nach Expression eine Ketolase- und/oder Hydroxylase-Aktivität
entfalten, so dass die Organismen Zeaxanthin oder Astaxanthin produzieren.
Unter Ketolase-Aktivität wird die Enzymaktivität einer Ketolase verstanden.
Unter einer Ketolase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, am, gegebenenfalls substituierten, ß-lonon-Ring von Carotinoiden eine Keto-Gruppe einzuführen.
Insbesondere wird unter einer Ketolase ein Protein verstanden, das die enzymatische Aktivität aufweist, ß-Carotin in Canthaxanthin umzuwandeln.
Dementsprechend wird unter Ketolase-Aktivität die in einer bestimmten Zeit durch das Protein Ketolase umgesetzte Menge ß-Carotin bzw. gebildete Menge Canthaxanthin verstanden.
Unter dem Begriff "Wildtyp" wird erfindungsgemäß der entsprechende nicht genetisch veränderte Ausgangsorganismus der Gattung Blakesleaa verstanden.
Je nach Zusammenhang kann unter dem Begriff "Organismus" der Ausgangsorganismus (Wildtyp) der Gattung Blakesleaa oder ein erfindungsgemäßer, genetisch veränderter Organismus der Gattung Blakesleaa oder beides verstanden werden.
Vorzugsweise wird unter "Wildtyp" für die Verursachung der Ketolase- Aktivität und für die Verursachung der Hydroxylase-Aktivität jeweils ein Referenzorganismus verstanden.
Dieser Referenzorganismus der Gattung Blakeslea ist Blakeslea trispora ATCC 14271 oder ATCC 14272, die sich lediglich im Paarungstyp unterscheiden.
Die Bestimmung der Ketolase-Aktivität in erfindungsgemäßen genetisch veränderten Organismen der Gattung Blakesleaa und in Wildtyp- bzw. Referenzorganismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Bestimmung der Ketolase-Aktivität in Organismen der Gattung Blakeslea erfolgt in Anlehnung an die Methode von Fräser et al., (J. Biol. Chem. 272(10): 6128-6135, 1997). Die Ketolase-Aktivität in Extrakten wird mit den Substraten beta-Carotin und Canthaxanthin in Gegenwart von Lipid (Sojalecithin) und Detergens (Natriumcholat) bestimmt. Substrat/Produkt-Verhältnisse aus den Ketolase-Assays werden mittels HPLC ermittelt.
Der erfindungsgemäße genetisch veränderte Organismus der Gattung Blakesleaa weist in dieser, bevorzugten Ausführungsform im Vergleich zum genetisch nicht veränderten Wildtyp eine Ketolase-Aktivität auf und ist somit vorzugsweise in der Lage, transgen eine Ketolase zu exprimieren.
In einer weiter bevorzugten Ausführungsform erfolgt die Verursachung der Ketolase-Aktivität in den Organismen der Gattung Blakesleaa durch Genexpression einer Nukleinsäure kodierend eine Ketolase.
In dieser bevorzugten Ausführungsform erfolgt die Verursachung der Genexpression einer Nukleinsäure kodierend eine Ketolase vorzugsweise durch Einbringen von Nukleinsäuren, die Ketolasen kodieren in die Ausgangsorganismus der Gattung Blakesleaa.
Dazu kann prinzipiell jedes Ketolase-Gen, also jede Nukleinsäuren die eine Ketolase codiert verwendet werden.
Alle in der Beschreibung erwähnten Nukleinsäuren können beispielsweise eine RNA-, DNA- oder cDNA-Sequenz sein.
Bei genomischen Ketolase-Sequenzen aus eukaryontischen Quellen, die Introns enthalten, sind für den Fall das der Wirtsorganismus der Gattung Blakesleaa nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Ketolase zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen, wie die entsprechenden cDNAs zu verwenden.
Beispiele für Nukleinsäuren, kodierend eine Ketolase und die entsprechenden Ketolasen, die im erfindungsgemäßen Verfahren verwendet werden können sind beispielsweise Sequenzen aus:
Haematoccus pluvialis, insbesondere aus Haematoccus pluvialis Flotow em. Wille (Accession NO: X86782; Nukleinsäure: SEQ ID NO: 11 , Protein SEQ ID NO: 12),
Haematoccus pluvialis, NIES-144 (Accession NO: D45881; Nukleinsäure: SEQ ID NO: 13, Protein SEQ ID NO: 14),
Agrobacterium aurantiacum (Accession NO: D58420; Nukleinsäure: SEQ ID NO: 15, Protein SEQ ID NO: 16),
Alicaligenes spec. (Accession NO: D58422; Nukleinsäure: SEQ ID NO: 17, Protein SEQ ID NO: 18),
Paracoccus marcusii (Accession NO: Y15112; Nukleinsäure: SEQ ID NO: 19, Protein SEQ ID NO: 20),
Synechocystis sp. Strain PC6803 (Accession NO: NP442491 ; Nukleinsäure: SEQ ID NO: 21, Protein SEQ ID NO: 22),
Bradyrhizobium sp. (Accession NO: AF218415; Nukleinsäure: SEQ ID NO: 23, Protein SEQ ID NO: 24),
Nostoc sp. Strain PCC7120 (Accession NO: AP003592, BAB74888; Nukleinsäure: SEQ ID NO: 25, Protein SEQ ID NO: 26),
Nostoc punctiforme ATTC 29133, Nukleinsäure: Acc.-No. NZ_AABC01000195, Basenpaar 55,604 bis 55,392 (SEQ ID NO: 27); Protein: Acc.-No. ZP_00111258 (SEQ ID NO: 28) (als putatives Protein annotiert) oder
Nostoc punctiforme ATTC 29133, Nukleinsäure: Acc.-No. NZ_AABC01000196, Basenpaar 140,571 bis 139,810 (SEQ ID NO: 29), Protein: (SEQ ID NO: 30) (nicht annotiert).
Weitere natürliche Beispiele für Ketolasen und Ketolase-Gene, die im erfindungsgemäßen Verfahren verwendet werden können, lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, durch Identitätsvergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit den vorstehend beschriebenen Sequenzen und insbesondere mit den Sequenzen SEQ ID NO: 12 und/oder 26 und/oder 30 leicht auffinden.
Weitere natürliche Beispiele für Ketolasen und Ketolase-Gene lassen sich weiterhin ausgehend von den vorstehend beschriebenen Nukleinsäuresequenzen, insbesondere ausgehend von den Sequenzen SEQ ID NO: 12 und/oder 26 und/oder 30 aus verschiedenen Organismen, deren genomische Sequenz nicht bekannt ist, durch Hybridisierungstechniken in an sich bekannter Weise leicht auffinden.
Die Hybridisierung kann unter moderaten (geringe Stringenz) oder vorzugsweise unter stringenten (hohe Stringenz) Bedingungen erfolgen.
Solche Hybridisierungsbedingungen sind beispielsweise bei Sambrook, J., Fritsch, E.F., Maniatis, T., in: Molecular Cloning (A Laboratory Manual), 2. Auflage, Cold Spring Harbor Laboratory Press, 1989, Seiten 9.31-9.57 oder in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6 beschrieben.
Beispielhaft können die Bedingungen während des Waschschrittes ausgewählt sein aus dem Bereich von Bedingungen begrenzt von solchen mit geringer Stringenz (mit 2X SSC bei 50°C) und solchen mit hoher Stringenz (mit 0,2X SSC bei 50°C, bevorzugt bei 65°C) (20X SSC: 0,3 M Natriumeitrat, 3 M Natriumchlorid, pH 7.0).
Darüberhinaus kann die Temperatur während des Waschschrittes von moderaten Bedingungen bei Raumtemperatur, 22°C, bis zu stringenten Bedingungen bei 65°C angehoben werden.
Beide Parameter, Salzkonzentration und Temperatur, können gleichzeitig variiert werden, auch kann einer der beiden Parameter konstant gehalten und nur der andere variiert werden. Während der Hybridisierung können auch denaturierende Agenzien wie zum Beispiel Formamid oder SDS
eingesetzt werden. In Gegenwart von 50 % Formamid wird die Hybridisierung bevorzugt bei 42°C ausgeführt.
Einige beispielhafte Bedingungen für Hybridisierung und Waschschritt sind infolge gegeben:
(1) Hybridiserungsbedingungen mit zum Beispiel (i) 4X SSC bei 65°C, oder
(ii) 6X SSC bei 45°C, oder (iii) 6X SSC bei 68°C, 100 mg/ml denaturierter Fischsperma-DNA, oder (iv) 6X SSC, 0,5 % SDS, 100 mg/ml denaturierte, fragmentierte
Lachssperma-DNA bei 68°C, oder (v) 6XSSC, 0,5 % SDS, 100 mg/ml denaturierte, fragmentierte Lachssperma-DNA, 50 % Formamid bei 42°C, oder (vi) 50 % Formamid, 4X SSC bei 42°C, oder
(vii) 50 % (vol/vol) Formamid, 0,1 % Rinderserumalbumin, 0,1 % Ficoll, 0.1 % Polyvinylpyrrolidon, 50 mM Natriumphosphatpuffer pH 6,5, 750 mM NaCI, 75 mM Natriumeitrat bei 42°C, oder (viii) 2X oder 4X SSC bei 50°C (moderate Bedingungen), oder (ix) 30 bis 40 % Formamid, 2X oder 4X SSC bei 42°C (moderate Bedingungen).
(2) Waschschritte für jeweils 10 Minuten mit zum Beispiel
(i) 0,015 M NaCI/0,0015 M Natriumcitrat/0,1 % SDS bei 50°C, oder (ii) 0.1X SSC bei 65°C, oder
(iii) 0, 1 X SSC, 0,5 % SDS bei 68°C, oder
(iv) 0,1X SSC, 0,5 % SDS, 50 % Formamid bei 42°C, oder
(v) 0,2X SSC, 0,1 % SDS bei 42°C, oder
(vi) 2X SSC bei 65°C (moderate Bedingungen).
In einer bevorzugten Ausführungsform der erfindungsgemäßen genetisch veränderten Organismen der Gattung Blakeslea bringt man Nukleinsäuren ein, die ein Protein kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 12 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 %, vorzugsweise mindestens 30 %, bevorzugter mindestens 40 %, bevorzugter mindestens 50 %, bevorzugter mindestens 60 %, bevorzugter mindestens 70 %, bevorzugter mindestens 80 %, besonders bevorzugt mindestens 90 %, insbesondere 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% auf Aminosäureebene mit der Sequenz z SEQ ID NO: 12 und die enzymatische Eigenschaft einer Ketolase aufweist.
Dabei kann es sich um eine natürliche Ketolase-Sequenz handeln, die wie vorstehend beschrieben durch Identitätsvergleich der Sequenzen aus anderen Organismen gefunden werden kann oder um eine künstliche Ketolase-Sequenz die ausgehend von der Sequenz SEQ ID NO: 12 durch künstliche Variation, beispielsweise durch Substitution, Insertion oder Deletion von Aminosäuren abgewandelt wurde.
In einer weiteren, bevorzugten Ausführungsform der erfindungsgemäßen Verfahren bringt man Nukleinsäuren ein die ein Protein kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 26 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 %, vorzugsweise mindestens 30 %, bevorzugter mindestens 40 %, bevorzugter mindestens 50 %, bevorzugter mindestens 60 %, bevorzugter mindestens 70 %, bevorzugter mindestens 80 %, besonders bevorzugt mindestens 90 % insbesondere 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% auf Aminosäureebene mit der Sequenz SEQ ID NO: 26 und die enzymatische Eigenschaft einer Ketolase aufweist.
Dabei kann es sich um eine natürliche Ketolase-Sequenz handeln, die, wie vorstehend beschrieben, durch Identitätsvergleich der Sequenzen aus anderen Organismen gefunden werden kann oder um eine künstliche Ketolase-Sequenz die ausgehend von der Sequenz SEQ ID NO: 26 durch künstliche Variation, beispielsweise durch Substitution, Insertion oder Deletion von Aminosäuren abgewandelt wurde.
In einer weiteren, bevorzugten Ausführungsform der erfindungsgemäßen Verfahren bringt man Nukleinsäuren ein die ein Protein kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 30 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 20 %, vorzugsweise mindestens 30 %, bevorzugter mindestens 40 %, bevorzugter mindestens 50 %, bevorzugter mindestens 60 %, bevorzugter mindestens 70 %, bevorzugter mindestens 80 %, besonders bevorzugt mindestens 90 %, insbesondere 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% auf Aminosäureebene mit der Sequenz SEQ ID NO: 30 und die enzymatische Eigenschaft einer Ketolase aufweist.
Dabei kann es sich um eine natürliche Ketolase-Sequenz handeln, die, wie vorstehend beschrieben, durch Identitätsvergleich der Sequenzen aus anderen Organismen gefunden werden kann oder um eine künstliche Ketolase-Sequenz die ausgehend von der Sequenz SEQ ID NO: 30 durch künstliche Variation, beispielsweise durch Substitution, Insertion oder Deletion von Aminosäuren abgewandelt wurde.
Unter dem Begriff "Substitution" ist in der Beschreibung der Austausch einer oder mehrerer Aminosäuren durch eine oder mehrere Aminosäuren zu verstehen. Bevorzugt werden sog. konservative Austausche durchgeführt, bei denen die ersetzte Aminosäure eine ähnliche
Eigenschaft hat wie die ursprüngliche Aminosäure, beispielsweise Austausch von Glu durch Asp, Gin durch Asn, Val durch He, Leu durch lle, Ser durch Thr.
Deletion ist das Ersetzen einer Aminosäure durch eine direkte Bindung. Bevorzugte Positionen für Deletionen sind die Termini des Polypeptids und die Verknüpfungen zwischen den einzelnen Proteindomänen.
Insertionen sind Einfügungen von Aminosäuren in die Polypeptidkette, wobei formal eine direkte Bindung durch ein oder mehrere Aminosäuren ersetzt wird.
Unter Identität zwischen zwei Proteinen wird die Identität der Aminosäuren über die jeweils gesamte Proteinlänge verstanden, insbesondere die Identität die durch Vergleich mit Hilfe der Lasergene Software der Firma DNASTAR, ine. Madison, Wisconsin (USA) unter Anwendung der Clustal Methode (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr;5(2):151- 1) unter Einstellung folgender Parameter berechnet wird:
Multiple alignment parameter:
Gap penalty 10
Gap length penalty 10
Pairwise alignment parameter: K-tuple 1
Gap penalty 3
Window 5
Diagonale saved 5
Unter einem Protein, das eine Identität von mindestens 20 % auf Aminosäureebene mit der Sequenz SEQ ID NO: 12 oder 26 oder 30
aufweist, wird dementsprechend ein Protein verstanden, das bei einem Vergleich seiner Sequenz mit der Sequenz SEQ ID NO: 12 oder 26 oder 30, insbesondere nach obigen Programmlogarithmus mit obigem Parametersatz eine Identität von mindestens 20 %, bevorzugt 80,%, 85%, besonders 90%, insbesondere 95% aufweist.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der Blakesleaaspezifischen codon usage häufig verwendet werden. Die codon usage lässt sich anhand von Computerauswertungen anderer, bekannter Gene von Organismen der Gattung Blakesleaa leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ ID NO: 11 in die Organismus der Gattung ein.
In einer weiteren, besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ ID NO: 25 in die Organismus der Gattung ein.
In einer weiteren, besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ ID NO: 29 in die Organismus der Gattung ein.
Alle vorstehend erwähnten Ketolase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die
chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, S. 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Der in der Transformation (i) eingesetzte Vector umfasst daher in einer Ausführungsform der Erfindung bevorzugterweise eine Sequenz codierend für eine Ketolase, insbesondere der Ketolase Nostoc punctiforme aus mit der SEQ ID NO: 72.
Unter Hydroxylase-Aktivität die Enzymaktivität einer Hydroxylase verstanden.
Unter einer Hydroxylase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, am, gegebenenfalls substituierten, ß- lonon-Ring von Carotinoiden eine Hydroxy-Gruppe einzuführen.
Insbesondere wird unter einer Hydroxylase ein Protein verstanden, das die enzymatische Aktivität aufweist, ß-Carotin in Zeaxanthin oder Cantaxanthin in Astaxanthin umzuwandeln.
Dementsprechend wird unter Hydroxyase-Aktivität die in einer bestimmten Zeit durch das Protein Hydroxylase umgesetzte Menge ß-Carotin oder Cantaxanthin bzw. gebildete Menge Zeaxanthin oder Astaxanthin verstanden.
Bei einer erhöhten Hydroxylase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Hydroxylase die umgesetzte Menge ß-Carotin oder Canthaxantin bzw. die gebildete Menge Zeaxanthin oder Astaxanthin erhöht.
Vorzugsweise beträgt diese Erhöhung der Hydroxylase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der Hydroxylase-Aktivität des Wildtyps.
Die Bestimmung der Hydroxylase-Aktivität in erfindungsgemäßen genetisch veränderten Organismen und in Wildtyp- bzw. Referenz- Organismen erfolgt vorzugsweise unter folgenden Bedingungen:
Die Aktivität der Hydroxylase wird nach Bouvier et al. (Biochim. Biophys. Acta 1391 (1998), 320-328) in vitro bestimmt. Es wird zu einer bestimmten Menge an Organismenextrakt Ferredoxin, Ferredoxin-NADP Oxidoreductase, Katalase, NADPH sowie beta-Carotin mit Mono- und Digalaktosylglyzeriden zugegeben.
Besonders bevorzugt erfolgt die Bestimmung der Hydroxylase-Aktivität unter folgenden Bedingungen nach Bouvier, Keller, d'Harlingue und Camara (Xanthophyll biosynthesis: molecular and functional characterization of carotenoid hydroxylases from pepper fruits (Capsicum annuum L.; Biochim. Biophys. Acta 1391 (1998), 320-328):
Der in-vitro Assay wird in einem Volumen von 0,250 ml Volumen durchgeführt. Der Ansatz enthält 50 mM Kaliumphosphat (pH 7,6), 0,025 mg Ferredoxin von Spinat, 0,5 Einheiten Ferredoxin-NADP+
Oxidoreduktase von Spinat, 0,25 mM NADPH, 0,010 mg beta-Carotin (in
0,1 mg Tween 80 emulgiert), 0,05 mM einer Mischung von Mono- und Digalaktosylglyzeriden (1 :1), 1 Einheit Katalyse, 200 Mono- und Digalaktosylglyzeriden, (1 :1), 0,2 mg Rinderserumalbumin und Organismenextrakt in unterschiedlichem Volumen. Die Reaktionsmischung wird 2 Stunden bei 30°C inkubiert. Die Reaktionsprodukte werden mit organischem Lösungsmittel wie THF, Aceton oder Chloroform/Methanol (2:1) * extrahiert und mittels HPLC bestimmt.
Besonders bevorzugt erfolgt die Bestimmung der Hydroxylase-Aktivität unter folgenden Bedingungen nach Bouvier, d'Harlingue und Camara (Molecular Analysis of carotenoid cyclae inhibition; Arch. Biochem. Biophys. 346(1) (1997) 53-64):
Der in-vitro Assay wird in einem Volumen von 250 μl Volumen durchgeführt. Der Ansatz enthält 50 mM Kaliumphosphat (pH 7,6), unterschiedliche Mengen an Organismenextrakt, 20 nM Lycopin, 250 μg an chromoplastidärem Stromaprotein aus Paprika, 0,2 mM NADP+, 0.2 mM NADPH und 1 mM ATP. NADP/NADPH und ATP werden in 10 ml Ethanol mit 1 mg Tween 80 unmittelbar vor der Zugabe zum Inkubationsmedium gelöst. Nach einer Reaktionszeit von 60 Minuten bei 30°C wird die Reaktion durch Zugabe von Chloroform/Methanol (2:1) beendet. Die in Chloroform extrahierten Reaktionsprodukte werden mittels HPLC analysiert.
Ein alternativer Assay mit radioaktivem Substrat ist beschrieben in Fräser und Sandmann (Biochem. Biophys. Res. Comm. 185(1) (1992) 9-15).
Die Erhöhung der Hydroxylase-Aktivität kann durch verschiedene Wege erfolgen, beispielsweise durch Ausschalten von hemmenden
Regulationsmechanismen auf Expressions- und Proteinebene oder durch
Erhöhung der Genexpression von Nukleinsäuren kodierend eine Hydroxylase gegenüber dem Wildtyp.
Die Erhöhung der Genexpression der Nukleinsäuren kodierend eine Hydroxylase gegenüber dem Wildtyp kann ebenfalls durch verschiedene Wege erfolgen, beispielsweise durch Induzierung des Hydroxylase-Gens durch Aktivatoren oder durch Einbringen von einer oder mehrerer Hydroxylase-Genkopien, also durch Einbringen mindestens einer Nukleinsäure kodierend eine Hydroxylase in denb Organismus der Gattung Blakesleaa.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure kodierend eine Hydroxylase durch Einbringen von mindestens einer Nukleinsäure kodierend eine Hydroxylase in den Organismus der Gattung Blakesleaa.
Dazu kann prinzipiell jedes Hydroxylase-Gen, also jede Nukleinsäure, die eine Hydroxylase codiert, verwendet werden.
Bei genomischen Hydroxylase-Sequenzen aus eukaryontischen Quellen, die Introns enthalten, sind für den Fall, dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechende Hydroxylase zu exprimieren, bevorzugt bereits prozessierte Nukleinsäuresequenzen, wie die entsprechenden cDNAs zu verwenden.
Ein Beispiel für ein Hydroxylase-Gen ist eine Nukleinsäure, kodierend eine Hydroxylase aus Haematococcus pluvialis mit der Accession No. AX038729 (WO 0061764; Nukleinsäure: SEQ ID NO: 31, Protein: SEQ ID NO: 32), aus Erwinia uredovora 20D3 (ATCC 19321, Accession No. D90087; Nukleinsäure: SEQ ID NO: 33, Protein: SEQ ID NO: 34) oder
Hydroxylase aus Thermus thermophilus (DE 102 34 126.5) kodiert durch die Sequenz mit der SEQ ID NO 76.
Weitere Hydroxylasen werden von den Nukleinsäuren mit den folgenden Accession Nummern kodiert
|emb|CAB55626.1, CAA70427.1, CAA70888.1, CAB55625.1, AF499108 1, AF315289_1, AF296158J, AAC49443.1, NP_194300.1, NP_200070.1, AAG10430.1, CAC06712.1, AAM88619.1, CAC95130.1, AAL80006.1, AF162276 , AA053295.1, AAN85601.1, CRTZ_ERWHE, CRTZ_PANAN, BAB79605.1, CRTZ_ALCSP, CRTZ_AGRAU, CAB56060.1, ZP_00094836.1, AAC44852.1, BAC77670.1, NP_745389.1, NP_344225.1, NP_849490.1, ZP_00087019.1, NP_503072.1, NP_852012.1, NP_115929.1, ZP_00013255.1
In den erfindungsgemäßen bevorzugten transgenen Organismen der Gattung Blakeslea liegt also in dieser bevorzugten Ausführungsform gegenüber dem Wildtyp mindestens ein Hydroxylase-Gen vor.
In dieser bevorzugten Ausführungsform weist der genetisch veränderte Organismus beispielsweise mindestens eine exogene Nukleinsäure, kodierend eine Hydroxylase auf.
Bevorzugt verwendet man in vorstehend beschriebener bevorzugter Ausführungsform als Hydroxylase-Gene Nukleinsäuren, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ ID NO: 32, 34 oder kodiert durch die Sequenz mit der SEQ ID NO 76 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70%, noch bevorzugter mindestens 80 %, am bevorzugtesten mindestens 90%, insbesondere 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% auf
Aminosäureebene mit der Sequenz SEQ. ID. NO: 32, 34 oder kodiert durch die Sequenz mit der SEQ ID NO 76 und die die enzymatische Eigenschaft einer Hydroxylase aufweisen.
Weitere Beispiele für Hydroxylasen und Hydroxylase-Gene lassen sich beispielsweise aus verschiedenen Organismen, deren genomische Sequenz bekannt ist, wie vorstehend beschrieben, durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ ID. NO: 31 , 33 oder 76 leicht auffinden.
Weitere Beispiele für Hydroxylasen und Hydroxylase-Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ ID NO: 31, 33 oder 76 aus verschiedenen Organismen deren genomische Sequenz nicht bekannt ist, wie vorstehend beschrieben, durch Hybridisierungs- und PCR-Techniken in an sich bekannter Weise leicht auffinden.
In einer weiter besonders bevorzugten Ausführungsform werden zur Erhöhung der Hydroxylase-Aktivität Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der Hydroxylase der Sequenz SEQ ID NO: 32, 34 oder kodiert durch die Sequenz mit der SEQ ID NO 76.
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der Organismenspezifischen codon usage häufig verwendet werden. Die codon usage lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO: 31, 33 oder 76 in den Organismus ein.
Alle vorstehend erwähnten Hydroxylase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, 2. Auflage, Wiley Press New York, Seite 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Der in der Transformation (i) eingesetzte Vector umfasst daher in weiteren Ausführungsformen der Erfindung bevorzugterweise eine Sequenz codierend für eine Hydroxlase, insbesondere eine Hydroxlase aus Haematococcus pluvialis mit der SEQ ID NO: 70 oder eine Hydroxlase aus Erwinia uredova mit der SEQ ID NO: 71. oder eine Hydroxylase aus Thermus thermophilus kodiert durch die Sequenz mit der SEQ ID NO 76.
Der in der Transformation (i) eingesetzte Vector enthält vorzugsweise ferner die Expression regelnde und unterstützende Bereiche, insbesondere Promotoren und Terminatoren.
Der in der Transformation (i) eingesetzte Vector enthält vorzugsweise den gpd und/oder den ptefl Promotor und/oder den trpC Terminator. Diese
haben sich zur Transformation der Blakeslea besonders bewährt. Auch der Einsatz von dem Fachmann geläufigen "inverted repeats" (IR, Römpp Lexikon der Biotechnologie 1992, Thieme Verlag Stuttgart, Seite 407 "Invers repetitive Sequenzen") zur Regelung der Expression bzw. Transkription liegt im Rahmen der Erfindung.
Vorteilhafterweise weist der im Vector eingesetzte gpd Promotor die Sequenz SEQ ID NO: 1 auf. Vorteilhafterweise weist der im Vector eingesetzte trpC Terminator die Sequenz SEQ ID NO: 2 auf. Vorteilhafterweise weist der im Vector eingesetzte ptefl Promotor die Sequenz SEQ ID NO: 35 auf.
Insbesondere werden dabei der gpd Promotor und der trpC Terminator aus Aspergillus nidulans und der ptefl Promotor aus Blakeslea trispora eingesetzt.
Insbesondere enthält der in der Transformation (i) eingesetzte Vector ein Resistenzgen. Bevorzugterweise handelt es sich um ein Hygromycin- Resistenzgen (hph), insbesondere das aus E. coli. Dieses Resistenzgen hat sich bei dem Nachweis der Transformation und Selektion der Zellen als besonders geeignet herausgestellt.
Als Promotor für hph wird also bevorzugt p-gpdA, der Promotor der Glycerinaldehyd-3-phosphatdehydrogenase aus Aspergillus nidulans genutzt. Als Terminator für hph wird bevorzugt t-trpC, der Terminator des Gens trpC, codierend für Anthranilatsynthasekomponenten aus Aspergillus nidulans genutzt.
Als Vectoren haben sich Abkömmlinge des pBinAHyg Vectors als besonders geeignet herausgestellt. Der zur Transformation eingesetzte Vector umfasst also bevorzugterweise die SEQ ID NO: 3.
Hinzu kommen je nach gewünschtem Carotinoid oder dessen Vorstufe eine Sequenz codierend für eine Hydroxylase, Ketolase, Phytoendesaturase usw. wie diese zuvor beschrieben wurden. Die Vectoren umfassen also in einer Ausführugsform der Erfndung die Sequenz SEQ ID NO: 69 codierend für die Phytoendesaturase. Die Vectoren umfassen ferner in einer weiteren Ausführugsform der Erfndung die Sequenz SEQ ID NO: 72 codierend für eine Ketolase. Die Vectoren umfassen weiter in einer weiteren Ausführugsform der Erfndung die Sequenz SEQ ID NO: 70 oder 71 oder 76 codierend für eine Hydoxylase. Entsprechende Kombinationen der zuvorgenannten Sequenzen liegen ebenso im Rahmen der Erfindung. So umfasst der Vector in einer Ausführungsform sowohl eine Sequenz SEQ ID NO: 72 codierend für eine Ketolase als auch die Sequenz SEQ ID NO: 70 oder 71 oder 76 codierend für eine Hydoxylase und ermöglicht so die Herstellung von Astaxanthin.
Insbesondere sind Vectoren ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 37 bis 51 und 62 im Rahmen der Erfindung einsetzbar.
Mit dem erfindungsgemäßen Verfahren sind gentechnisch veränderte Organismen Blakeslea, insbesondere der Art Blakeslea trispora bzw. aus ihnen gebildetes Mycel erhältlich.
Die genetisch veränderten Organismen können zur Produktion von Carotinoiden, Xanthophyllen oder deren Vorstufen, insbesondere Phytoen, Bixion, Astaxanthin, Zeaxanthin und Canthaxanthin verwendet werden. Auch können neue, im Wildtyp natürlicherweise nicht vorkommende Carotinoide durch Einbringung der entsprechenden genetischen Information von den gezielt genetisch veränderten Zellen bzw. dem durch sie gebildeten Mycel erzeugt und anschließend isoliert werden.
Bevorzugterweise ist die Gewinnung von Carotinoiden oder deren Vorstufen mit den gezielt genetisch veränderten Zellen bzw. das durch sie gebildete Mycel möglich.
Wird die gentechnische Veränderung nur in Zellen eines der vorkommenden Paarungstypen (bei Blakeslea trispora (+) oder (-)) durchgeführt, so wird zur Kultivierung der entsprechend andere, nicht veränderte Paarungstyp zugesetzt, da so eine gute Produktion der Carotinoide oder deren Vorstufen aufgrund der von dem zweiten, nicht veränderten Paarungstyp abgegebenen Substanzen (z. B. Trisporsäuren) zu erreichen ist. Vorteilhafterweise wird jedoch die gentechnische Veränderung in Zellen beider Paarungstypen vorgenommen und diese zusammen kultiviert. Hierdurch wird ein besonders gutes Wachstum und eine optimale Produktion der Carotinoiden oder deren Vorstufen erreicht. Auch eine (künstliche) Zugabe der Trisporsäuren ist möglich und sinnvoll.
Trisporsäuren sind Sexualhormone in Mucorales Pilzen, wie Blakeslea, welche die Bildung von Zygophoren und die Produktion von ß-Carotin stimulieren (van den Ende 1968, J. Bacteriol. 96:1298 - 1303, Austin et al. 1969, Nature 223:1178 - 1179, Reschke Tetrahedron Lett. 29:3435 - 3439, van den Ende 1970, J. Bacteriol. 101:423 - 428).
Die Erfindung wird nachfolgend an Hand von Beispielen näher ausgeführt.
Material und Methoden
Molekulargenetische Arbeiten wurden, wenn nicht anders beschrieben, nach den Methoden in Current Protocols in Molecular Biology (Ausubel et al., 1999, John Wiley & Sons) durchgeführt.
Stämme und Wachstumsbedingungen
Die Blakeslea trispora Stämme ATCC 14271 (Paarungstyp(+)) und ATCC14272 (Paarungstyp (-)) wurden von der American Type Culture Collection erhalten. Die Anzucht von B. trispora erfolgte in MEP-Medium (Malzextrakt-Pepton-Medium): 30 g/l Malzextrakt (Difco), 3 g/l Pepton (Soytone, Difco), 20 g/l Agar, Einstellung pH 5,5, ad 1000 ml mit H20 bei 28 °C.
Die Anzucht von Agrobacterium tumefaciens LBA4404 erfolgte nach Hoekema et al. (1983, Nature 303:179-180) bei 28 °C für 24 h in Agrobacterien-Minimal Medium (AMM): 10 mM K2HP04, 10 mM KH2P04, 10 mM Glucose, MM-Salze (2,5 mM NaCI, 2 mM MgS04, 700 μM CaCI2, 9 μM FeS04, 4 mM (NH4)2S04).
Transformation von Agrobacterium tumefaciens Das Plasmid pBinAHyg wurde in den Agrobakterienstamm LBA 4404 (Hoekema et al., 1983, Nature 303:179-180) elektroporiert (Mozo and Hooykaas, 1991 , Plant Mol. Biol. 16:917-918). Zur Selektion wurden bei der Agrobakterienanzucht folgende Antibiotika verwendet: Rifampicin 50 mg/l (Selektion auf das A. tumefaciens Chromosom), Streptomycin 30 mg/l (Selektion auf das Helferplasmid) und Kanamycin 100 mg/l (Selektion auf den binären Vektor).
Transformation von Blakeslea trispora
Zur Transformation wurden die Agrobakterien nach 24 h Anzucht in AMM auf eine OD60o von 0,15 in Induktionsmedium (IM: MM-Salze, 40 mM MES (pH 5,6), 5 mM Glucose, 2 mM Phosphat, 0,5% Glycerol, 200 μM Acetosyringone) verdünnt und erneut über Nacht in IM bis zu einer ODβoo von ca. 0,6 angezogen.
Zur Co-Inkubation von Blakeslea ATCC 14271 bzw. ATCC14272 und Agrobacterium wurden 100 μl Agrobakteriensuspension mit 100 μl
Blakeslea Sporensuspension (107 Sporen/ml in 0,9% NaCI) gemischt und steril auf einer Nylon Membran (Hybond N, Amersham) auf IM-Agarose Platten (IM + 18 g/l Agar) verteilt. Nach 3 Tagen Inkubation bei 26 °C wurde die Membran auf eine MEP-Agarplatte (30 g/l Malzextrakt, 3 g/l Pepton, pH 5,5, 18 g/l Agar) überführt. Zur Selektion auf transformierte Blakesleazellen enthielt das Medium Hygromycin in einer Konzentration von 100 mg/l sowie zur Selektion gegen Agrobakterien 100 mg/l Cefotaxim. Die Inkubation erfolgte für ca. 7 Tage bei 26 °C. Anschließend erfolgte der Transfer von Mycel auf frische Selektionsplatten. Gebildete Sporen wurden mit 0,9% NaCI abgespült und auf CM 17-1 -Agar (3 g/l Glucose, 200 mg/l L-Asparagin, 50 mg/l MgS04 x 7H20, 150 mg/l KH2P04, 25 μg/l ThiaminHCI, 100 mg/l Yeast Extract, 100 mg/l Na-desoxycholat, 100 mg/L Hygromycin, 100 mg/L Cefotaxim, pH 5,5,18 g/l Agar) ausplattiert. Zur Isolierung einzelner gentechnisch veränderter Sporen wurden die Sporen durch ein FACS Gerät der Fa. BectonDickson (Modell Vantage+Diva Option) einzeln auf Selektivmedium abgelegt.
Herstellung genetisch veränderter Blakeslea trispora durch Agrobacterium-vermittelte Transformation Herstellung des rekombinanten Plasmids pBinAHyg
Aus dem Plasmid pANsCosI (Fig.1 , Osiewacz, 1994, Curr. Genet. 26:87- 90, SEQ ID NO: 4) wurde die gpdA-hph-trpC-Kassette als Bglll/Hindlll Fragment isoliert und in das mit BamHI/Hindlll geöffnete binäre Plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12:8711-8721) ligiert. Der so erhaltene Vektor wurde als pBinAHyg bezeichnet (Fig. 2, SEQ ID NO: 3) und enthielt das E. coli Hygromycin-Resistenzgen (hph) unter Kontrolle des gpd Promotors (SEQ ID NO: 1) und des trpC Terminators (SEQ ID NO: 2) aus Aspergillus nidulans sowie die entsprechenden Bordersequenzen, die für den DNA-Transfer von Agrobacterium notwendig sind. Die in den weiter unten beschriebenen
Ausführungsbeispielen genannten Vektoren sind Abkömmlinge von pBinAHyg.
Übertragung von pBinAHyg und Abkömmlingen von pBinAHyg in Agrobacterium tumefaciens
Nachfolgend wird beispielhaft die Übertragung des Plasmids pBinAHyg in Agrobacterien beschrieben. Die Übertragung der Abkömmlinge erfolgte analog.
Das Plasmid pBinAHyg wurde in den Agrobakterienstamm LBA 4404 (Hoekema et al., 1983, Nature 303:179-180) elektroporiert (Mozo and Hooykaas, 1991 , Plant Mol. Biol. 16:917-918). Zur Selektion wurden bei der Agrobakterienanzucht folgende Antibiotika verwendet: Rifampicin 50 mg/l (Selektion auf das A. tumefaciens Chromosom), Streptomycin 30 mg/l (Selektion auf das Helferplasmid) und Kanamycin 100 mg/l (Selektion auf den binären Vektor).
Übertragung von pBinAHyg und Abkömmlingen von pBinAHyg in Blakeslea trispora Zur Transformation wurden die Agrobakterien nach 24 h Anzucht in AMM auf eine OD660 von 0,15 in Induktionsmedium (IM: MM-Salze, 40 mM MES (pH 5,6), 5 mM Glucose, 2 mM Phosphat, 0,5% Glycerol, 200 μM Acetosyringone) verdünnt und erneut über Nacht in IM bis zu einer OD660 von ca. 0,6 angezogen.
Zur Co-Inkubation von Blakeslea trispora (B.t.) und Agrobacterium tumefaciens (A.t.) wurden 100 μl Agrobakteriensuspension mit 100 μl Blakeslea Sporensuspension (107 Sporen/ml in 0,9% NaCI) gemischt und steril auf einer Nylon Membran (Hybond N, Amersham) auf IM-Agarose Platten (IM + 18 g/l Agar) verteilt. Nach 3 Tagen Inkubation bei 26 °C
wurde die Membran auf eine MEP-Agarplatte (30 g/l Malzextrakt, 3 g/l Pepton, pH 5,5, 18 g/l Agar) überführt.
Zur Selektion auf transformierte Blakeslea-Zellen enthielt das Medium Hygromycin in einer Konzentration von 100 mg/l sowie zur Selektion gegen Agrobakterien 100 mg/l Cefotaxim. Die Inkubation erfolgte für ca. 7 Tage bei 26 °C. Anschließend erfolgte der Transfer von Mycel auf frische Selektionsplatten. Gebildete Sporen wurden mit 0,9% NaCI abgespült und auf CM 17-1 -Agar (3 g/l Glucose, 200 mg/l L-Asparagin, 50 mg/l MgS04 x 7H20, 150 mg/l KH2P04, 25 μg/l Thiamin-HCI, 100 mg/l Yeast Extract, 100 mg/l Na-desoxycholat, pH 5,5, 100 mg/l Cefotaxim, 100 mg/l Hygromycin, 18 g/l Agar) ausplattiert. Die Übertragung von Sporen auf frische Selektionsplatten wurde dreimal wiederholt. Auf diese Weise wurde die Transformante Blakeslea trispora GVO 3005 isoliert. Alternativ erfolgte zur Selektion der GVO (gentechnisch veränderten Organismen) die Einzelablage der Sporen durch den BectonDickinson FacsVantage+Diva Option auf CM-17 Agar mit 100 mg/l Cefotaxim, 100 mg/l Hygromycin. In diesem Fall wurde nur dort Pilzmycel gebildet, wo die Sporen gentechnisch verändert waren.
Nachweis der genetischen Veränderung durch Übertragung von pBinAHyg und Abkömmlingen von pBinAHyg in Blakeslea trispora
Nachfolgend wird beispielhaft der Nachweis der Übertragung für pBinAHyg in Blakeslea trispora beschrieben. Der Nachweis der Übertragung der Abkömmlinge erfolgte analog.
200 ml MEP-Medium (30 g/l Malzextrakt, 3 g/l Pepton, pH 5,5) wurden mit 105 bis 107 Sporen der Transformante Blakeslea trispora GVO 3005 beimpft und 7 Tage bei 26 °C mit 200 Upm auf einem Rundschüttler inkubiert. Zum Nachweis der erfolgreichen Transformation wurde DNA aus dem Mycel isoliert (Peqlab Fungal . DNA Mini Kit) und in einer PCR
(Programm: 94 °C 1 min, dann 30 Zyklen mit 1 min. 94°C, 1 min. 58 °C, 1 min. 72 °C) eingesetzt.
Zum Nachweis des Hygromycinresistenzgens (hph) wurden die Primer hph-forward (5'-CGATGTAGGAGGGCGTGGATA, SEQ ID NO: 5) und hph-reverse (5'-GCTTCTGCGGGCGATTTGTGT, SEQ ID NO: 6) verwendet. Das erwartete Fragment von hph wies eine Länge von 800 bp auf.
Zur Amplifikation des Kanamycinresistenzgens nptlll und damit als Kontrolle auf Agrobakterien wurden die Primer nptlll-forward (5'- TGAGAATATCACCGGAATTG, SEQ ID NO: 7) und nptlll-reverse (5'- AGCTCGACATACTGTTCTTCC, . SEQ ID NO: 8) verwendet. Das erwartete Fragment von nptlll wies eine Länge von 700 bp auf.
Zur Amplifikation eines Fragmentes des Glycerinaldehyd-3- phosphatdehydrogenasegens gpdl und damit als Kontrolle auf Blakeslea trispora wurden die Primer MAT292 (5'-
GTGAATGGAAATCCCATCGCTGTC, SEQ ID NO: 9) und MAT293 (5'- AGTGGGTACTCTAAAGGCCATACC, SEQ ID NO: 10) verwendet. Das erwartete Fragment von gpdl wies eine Länge von 500 bp auf.
Das Ergebnis der PCR der Blakeslea trispora DNA ist in Fig. 3 anhand eines Standard-Gels gezeigt. Die Spuren des Gels wurden folgendermaßen belegt:
1) 100 bp Größenmarker (100 bp - 1 kb)
2) B.t. GVO 3005 primer nptlll-for / nptlll-rev
3) B.t. GVO 3005 primer hph-for / hph-rev 4) B.t. GVO 3005 primer MAT292 / MAT293 (gpd)
5) A.t. mit Plasmid pBinAHyg primer nptlll-for / nptlll-rev
6) A.t. mit Plasmid pBinAHyg primer hph-for / hph-rev
7) B.t. 14272 WT primer nptlll-for / nptlll-rev
8) B.t. 14272 WT primer hph-for / hph-rev
9) B.t. 14272 WT primer MAT292 / MAT293 (gpd)
In der DNA von Blakeslea trispora wurde das Hygromycinresistenzgens (hph) und als Positivkontrolle Glycerinaldehyd-3- phosphatdehydrogenasegen (gpdl) nachgewiesen, nptlll konnte demgegenüber nicht nachgewiesen werden.
Somit wurde die genetische Veränderung von Blakeslea trispora durch Agrobacterium-vermittelte Transformation nachgewiesen.
Isolierung homokaryotischer GVO von Blakeslea trispora: Durch erfolgreichen Transfer des Vectors pBinAHyg und Abkömmlingen von pBinAHyg in Blakeslea trispora entstehen genetisch veränderte Organismen (GVO) von Blakeslea trispora. Jedoch liegen in Blakeslea in allen Stadien des vegetativen und des sexuellen Zelizyklus mehrkernige Zellen vor. Daher erfolgt die Insertion der Fremd-DNA in der Regel nur in einem Kern. Ziel ist es, Stämme von Blakeslea zu erhalten, bei denen die Insertion der Fremd-DNA in allen Kernen vorliegt, d.h. Ziel ist ein homonukleates rekombinantes Pilzmycel.
1) Herstellung homonukleater rekombinanter Stämme durch FACS (fluorescence-activated cell sorting)
Ein geringer Anteil der Sporen von Blakeslea trispora bzw. der gentechnisch veränderten Stämme von Blakeslea trispora ist von Natur aus einkernig. Zur Herstellung homonukleater rekombinanter Stämme, die Fremd-DNA von pBinAHyg oder pBinAHyg-Abkömmlingen enthielten, wurden die einkernigen Sporen durch FACS aussortiert und auf MEP (30 g/l Malzextrakt, 3 g/l Pepton, pH 5,5, 18 g/l Agar) mit 100 mg/l Cefotaxim
und 100 mg/l Hygromycin plattiert. Die hier gebildten Mycelien waren homonukleat. Zur Sortierung mit FACS wurden die Sporen eines 3 Tage alten Ausstriches mit 10 ml Tris-HCI 50mMol + 0,1% Span20 pro Agar- Platte abgeschwemmt. Die Sporenkonzentration betrug 0,5 bis 0,8 x 107 Sporen pro ml. Zu 9 ml Sporensuspension wurden 1ml DMSO und 10 μl Syto 11 (Farbstoff-Stammlösung in DMSO Molecular Probes Nr.S-7573) zugegeben. Danach wurde 2 h bei 30°C gefärbt. Selektion und Ablage erfolgten mittels eines Gerätes vom Typ FacsVantage+Diva Option Fa. Becton Dickinson. Die Selektion erfolgte zuerst nach Größe, um einzelne Sporen von Aggregaten und Verunreinigungen zu trennen. Dann wurden diese Sporen nach ihrer Fluoreszenz (Anregung = 488nm; Emission = 530 nm) sortiert abgelegt. Die linke Schulter der Gauß-Kurve der Fluoreszenzhäufigkeitsverteilung enthielt die einkernigen Sporen.
2) Herstellung homonukleater Stämme durch Kernreduktion und Selektion mit FACS
Zur Reduzierung der Anzahl von Kernen pro Spore wurde vor der Selektion eine Behandlung von Sporensuspensionen mit MNNG (N- Methyl-N'-nitro-N-nitrosoguanidin) durchgeführt, und so durch chemische Mutagenese eine Kernreduktion erzielt.
Hierfür wurde zunächst eine Sporensuspension mit 1 x 107 Sporen/ml in Tris/HCI-Puffer, pH 7,0 hergestellt. Der Sporensuspension wurde MNNG in einer Endkonzentration von 100 μg/ml zugegeben. Die Zeit der Inkubation in MNNG wurde so gewählt, dass die Überlebensrate der Sporen ca. 5% betrug. Nach Inkubation mit MNNG wurden die Sporen dreimal mit 1g/l Span 20 in 50 mM Phosphatpuffer pH 7,0 gewaschen und nach der unter 1) beschriebenen Methode sortiert bzw. selektiert.
Alternativ konnten zur Reduktion der Kernzahl in den Sporen auch Röntgen - und UV-Strahlen eingesetzt werden, wie es von Cerdä-Olmedo und Patricia Reau in Mutation Res., 9 (1970), 369-384 beschrieben wurde.
3) Herstellung homonukleater Stämme durch Selektion auf rezessive Selektionsmarker
Als rezessiver Selektionsmarker zur Selektion homonukleater Mycelien kommt beispielsweise der rezessive Selektionsmarker pyrG in Frage. Wildtyp-Stämme von Blakeslea trispora sind pyrG+. Diese Stämme können nicht in Gegenwart des Pyrimidin-Analogs 5-Fluororotat (FOA) wachsen, weil sie FOA durch die Orotidin-5'-monophosphatdecarboxylase zu lethalen Metaboliten umsetzen. Gentechnisch veränderte Blakesleaa, die homonukleat pyrG" sind, fehlt die Enzymaktivität Orotidin-5'- monophosphatdecarboxylase. Folglich können diese pyrG"-Stämme 5- Fluororotat nicht verwerten. Die Stämme wachsen daher in Gegenwart von FOA und Uracil. Im Fall der Kopplung der Mutation pyrG" und der Insertion von Fremd-DNA auf dem Kern einer einkernigen Spore, kann aus dieser Spore homonukleates rekombinantes Pilzmycel gebildet werden.
Zunächst wurde durch Insertion eines Fragmentes von pyrG (SEQ ID NO: 65) aus Blakeslea trispora in pBinAHyg das Plasmid pBinAHygBTpyrG- SCO (SEQ ID NO: 36, Fig. 4) erzeugt. Dieses Plasmid wurde in Blakelea trispora transformiert und führte dort durch homologe Rekombination zur Disruption von pyrG.
Homonukleate GVO von Blakeslea trispora mit dem Phänotyp pyrG" wurden folgendermaßen selektiert. Zur Agrobakterium-vermittelten Transformation von pBinAHygBTpyrG-SCO wurde wie oben beschrieben auf MEP (30 g/l Malzextrakt, 3 g/l Pepton, pH 5,5, 18 g/l Agar) mit 100 mg/l Cefotaxim und 100 mg/l Hygromycin plattiert. Die Sporen der
Transformanten wurden mit 10 ml Tris-HCI 50mM + 0,1% Span20 pro Agar-Platte abgeschwemmt. Die Sporenkonzentration betrug 0,5 bis 0,8 x 107 Sporen pro ml. Die Sporen wurden anschließend auf FOA-Medium mit 100 mg/l Cefotaxim und 100 mg/l Hygromycin ausplattiert. FOA-Medium enthielt pro Liter 20 g Glucose, 1 g FOA, 50 mg Uracil, 200 ml Citrat-Puffer (0,5 M, pH 4,5) und 40 ml Spurensalzlösung nach Sutter, 1975, PNAS, 72:127). Homonukleate pyrG"-Mutanten zeigten Wachstum auf dem Uracil-haltigen FOA-Medium; aber kein Wachstum bei Plattierung auf FOA-Medium ohne Uracil. Auf die gleiche Weise wurden aus den im folgenden beschriebenen GVO von Blakeslea trispora zur Herstellung von Xanthophyllen homonukleate GVO hergestellt.
Alternativ ist es möglich die Sporen analog zur Vorschrift von Roncero et al. auf Medium mit 5-Carbon-5-deazariboflavin zu plattieren, das zusätzlich Hygromycin enthält (Roncero et al., 1984, Mutation Research, 125: 195 - 204). Hierdurch werden homokaryonte Zellen des Genotyps hygR und dar" selektiert. Nach diesem Prinzip werden homokaryonte Stämme von Blakeslea trispora mit dem Phänotyp hygR und dar" erzeugt.
Ausführungsbeispiele zur Herstellung von gentechnisch veränderten Organismen von Blakeslea trispora für die Herstellung von Carotinoiden und Carotinoidvorstufen Die Erzeugung der im folgenden genannten Plasmide erfolgte durch die Methode „overlap-extension PCR" und durch anschließende Insertion der Amplifikationsprodukte in das Plasmid pBinAHyg. Die Methode „overlap- extension PCR" erfolgte wie in Innis et al. (Eds.) PCR protocols: a guide to methods and applications, Academic Press, San Diego beschrieben. Die Transformation der pBinAHyg-Abkömmiinge und die Herstellung
homonukleater gentechnisch veränderter Stämme von Blakeslea trispora erfolgte wie oben beschrieben.
Gentechnisch veränderte Stämme von Blakeslea trispora zur Herstellung von Zeaxanthin
Folgende Plasmide (Abkömmlinge von pBinAHyg) wurden zur gentechnischen Veränderung von Blakeslea trispora für die Herstellung von Zeaxanthin verwendet, codieren also u.a. Hydroxylasen (crtZ): p-tef1-HPcrtZ, enthaltend Gen der Hydroxylase HPcrtZ (SEQ ID NO: 70) aus Haematococcus pluvialis Flotow NIES-144 (Accession
No. AF162276) unter Kontrolle des ptefl Promotors aus Blakeslea trispora (Seq. pBinAHygBTpTEFI -HPcrtZ, SEQ ID NO: 37, Fig. 5); p-carRA-HPcrtZ, enthaltend Gen der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 unter Kontrolle des Promotors pcarRA aus Blakeslea trispora (Seq. pBinAHyg-
BTpcarRA-HPcrtZ, SEQ ID NO: 38, Fig. 6) p-carB-HPcrtZ, enthaltend Gen der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 unter Kontrolle des Promotors pcarB aus Blakeslea trispora (Seq. pBinAHygBTpcarB- HPcrtZ, SEQ ID NO: 39, Fig. 7) p-carRA-HPcrtZ-TAG-3'carA-IR, enthaltend Gen der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 unter Kontrolle des Promotors pcarRA aus Blakeslea trispora. Stromabwärts des Gens der Hydroxylase ist eine Inverted-Repeat- Struktur lokalisiert, die aus dem 3'-Ende von carA und der stromabwärts von carA gelegenen Region stammt (IR, SEQ ID NO: 74, Jnverted Repeat V ca. 350 bp von carA, dann ca. 200 bp ,Loop' und anschließend ca. 350 bp Jnverted Repeat 2') (Seq. pBinAHyg- BTpcarRA-HPcrtZ-TAG-3'carA-IR, SEQ ID NO: 40, Fig. 8);
p-carRA-HPcrtZ-GCG-3'carA-IR, enthaltend Gen der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 unter Kontrolle des Promotors pcarRA aus Blakeslea trispora. Das Gen der Hydroxylase ist mit einer Inverted-Repeat-Struktur fusioniert, die aus dem 3'-Ende von carA und der stromabwärts von carA gelegenen Region stammt (IR, SEQ ID NO: 74, Jnverted Repeat 1' ca. 350 bp von carA, dann ca. 200 bp ,Loop' und anschließend ca. 350 bp Jnverted Repeat 2'). Das abgeleitete Fusionsprotein besteht folglich aus der Hydroxylase von Haematococcus pluvialis und dem Carboxyterminus von CarA aus Blakeslea trispora (Seq. pBinAHyg-
BTpcarRA-HPcrtZ-GCG-3'carA-IR, SEQ ID NO: 41, Fig. 9); p-tef1-EUcrtZ, enthaltend Gen der Hydroxylase EUcrtZ (SEQ ID NO: 71) aus Erwinia uredova 20D3 (Accession No. D90087) unter Kontrolle des ptefl Promotors (Seq. pBinAHygBTpTEFI -EUcrtZ, SEQ ID NO: 42, Fig. 10); p-carRA-EUcrtZ, enthaltend Gen der Hydroxylase EUcrtZ aus Erwinia uredova 20D3 unter Kontrolle des Promotors pcarRA aus Blakeslea trispora (Seq. pBinAHygBTpcarRA-EUcrtZ, SEQ ID NO:
43, Fig. 11); p-carB-EUcrtZ, enthaltend Gen der Hydroxylase EUcrtZ aus
Erwinia uredova 20D3 unter Kontrolle des Promotors pcarB aus Blakeslea trispora (Seq. pBinAHygBTpcarB-EUcrtZ, SEQ ID NO:
44, Fig. 12); p-gpdA-HPcrtZ-t-crtZ, enthaltend Gen der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 unter Kontrolle des gpdA Promotors und des Terminators t-crtZ; d.h. des stromabwärts von crtZ aus Haematococcus pluvialis Flotow NIES-144 gelegenen Sequenzabschnitts (SEQ ID NO: 73) (Seq. pBinAHyg-gpdA-HPcrtZ- tcrtZ, SEQ ID NO: 45, Fig. 13).
p-gpdA-BTcarR-HPcrtZ-BTcarA, enthaltend Genfusion aus Genen der Lycopincyclase carR aus Blakeslea trispora, der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 und der Phytoensynthase carA aus Blakeslea trispora unter Kontrolle des gpdA Promotors aus Aspergillus nidulans (Seq. pBinAHyg- carR_crtZ_carA, SEQ ID NO: 46, Fig. 14);
Herstellung gentechnisch veränderter Stämme von Blakeslea trispora zur Herstellung von Canthaxanthin Folgende Plasmide (Abkömmlinge von pBinAHyg) wurden zur gentechnischen Veränderung von Blakeslea trispora für die Herstellung von Canthaxanthin verwendet, codieren also u.a. Ketolasen (crtW): p-tef1-NPcrtW, enthaltend das Gen der Ketolase NPcrtW (SEQ ID NO: 72) aus Nostoc punctiforme PCC73102 (ORF148, Accesion No. NZ_AABC01000196) unter Kontrolle des ptefl Promotors aus
Blakeslea trispora (Seq. pBinAHygBTpTEFI-NpucrtW, SEQ ID NO: 47, Fig. 15); p-carRA-NPcrtW, enthaltend das Gen der Ketolase NPcrtW aus Nostoc punctiforme PCC73102 unter der Kontrolle des Promotors pcarRA aus Blakeslea trispora (Seq. pBinAHygBTpcarRA-NpucrtW,
SEQ ID NO: 48, Fig. 16); p-carB-NPcrtW, enthaltend das Gen der Ketolase NPcrtW aus Nostoc punctiforme PCC73102 unter der Kontrolle des Promotors pcarB aus Blakeslea trispora (Seq. pBinAHygBTpcarB-NpucrtW, SEQ ID NO: 49, Fig. 17);
Herstellung gentechnisch veränderter Stämme von Blakeslea trispora zur Herstellung von Astaxanthin
Folgende Plasmide (Abkömmlinge von pBinAHyg) wurden zur gentechnischen Veränderung von Blakeslea trispora für die Herstellung
von Astaxanthin verwendet, codieren also u.a. für Hydroxylasen (crtZ) und
Ketolasen (crtW): p-carRA-HPcrtZ-pcarRA-NPcrtW, enthaltend das Gen der Hydroxylase HPcrtZ aus Haematococcus pluvialis Flotow NIES-144 und das Gen der Ketolase NPcrtW aus Nostoc punctiforme
PCC73102 (ORF148, Accesion No. NZ_AABC01000196) beide jeweils unter Kontrolle des Promotors pcarRA aus Blakeslea trispora (Seq. pBinAHygBTpcarRA-HPcrtZ-BTpcarRA-NpucrtW, SEQ ID NO: 50, Fig. 18); - p-carRA-EUcrtZ-pcarRA-NPcrtW, enthaltend das Gen der
Hydroxylase EUcrtZ aus Erwinia uredova20D3 (Accession No. D90087) und das Gen der Ketolase NPcrtW aus Nostoc punctiforme PCC73102 beide jeweils unter Kontrolle des Promotors pcarRA aus Blakeslea trispora (Seq. pBinAHygBTpcarRA-EUcrtZ- BTpcarRA-NpucrtW, SEQ ID NO: 51 , Fig. 19);
Klonierung und Sequenzanalyse von Genen und Promotoren, die beispielhaft für die gentechnische Veränderung von Blakeslea trispora genutzt werden können. Nachfolgend werden beispielhaft die Klonierung und Sequenzierung verschiedener Gene und Promotoren aus Blakeslea trispora beschrieben.
Klonierung und Sequenzanalyse ptefl
Die Klonierung von p-tef aus Blakeslea trispora erfolgte auf der Grundlage einer bereits in GenBank veröffentlichten Sequenz des Strukturgens für den Translations-Elongationsfaktor 1-α aus Blakeslea trispora (AF157235). Ausgehend von dem Sequenzeintrag AF157235 wurden Primer für die inverse PCR ausgewählt, um die stromaufwärts des Strukturgens gelegene Promotoregion zu amplifizieren und zu sequenzieren.
In der inversen nested PCR an 200 ng Xhol-gespaltener und zirkularisierter genomischer DNA von Blakeslea trispora ATCC14272 wurde ein 3000-bp-Fragment in folgendem Ansatz erhalten: Matrizen-DNA (1 μg genomische DNA von Blakeslea trispora ATCC 14272) Primer MAT344 5'-GGCGTACTTGAAGGAACCCTTACCG-3' (SEQ ID NO: 63) und MAT 345 5'-ATTGATGCTCCCGGTCACCGTGATT-3' (SEQ ID NO: 64) je 0,25 μM, 100 μM dNTP, 10 μl Herculase-Polymerasepuffer 10x, 5 U Herculase (Zugabe bei 85 °C), H20 ad 100 μl. Das PCR-Profil war 95 °C, 10 min (1 Zyklus); 85 °C, 5 min (1 Zyklus); 60 °C, 30 s. 72 °C, 60 s, 95 °C, 30 s (30 Zyklen); 72 °C, 10 min (1 Zyklus). Der Sequenzabschnitt, der stromaufwärts des vermutlichen Startcodons des Gens tefl innerhalb 3000-bp-Fragmentes liegt, wurde als Promotor ptefl bezeichnet.
Klonierung Sequenzanalyse des Gens der HMG-CoA-Reduktase aus Blakeslea trispora
Zunächst wurde mit dem Cosmidvektor pANsCosI eine Genbank von Blakeslea trispora ATCC 14272, Mating Type (-) hergestellt. Der Vektor wurde durch Spaltung mit Xbal linearisiert und anschließend dephosphoryliert. Eine weitere Spaltung mit mit BamHI schuf die Insertionsstelle, in welche die mit Sau3AI partiell gespaltene und dephosphorylierte genomische DNA von Blakeslea trispora ligiert wurde. Die derart gebildeten Cosmide wurden anschließend in vitro verpackt und in Escherichia coli übertragen. Auf der Grundlage der bekannten Sequenz eines Fragmentes des HMG- CoA-Reduktase codierenden Gens aus Blakeslea trispora (Eur. J. Biochem 220, 403-408 (1994)) wurde eine 315-bp-DNA-Sonde durch folgende PCR hergestellt. Reaktionsansatz: 1 μg genomische DNA von Blakeslea trispora ATCC 14272, Primer MAT314 5'- CCGATGGCGACGACGGAAGGTTGTT-3' [SEQ ID NO 79] und MAT315 5'-CATGTTCATGCCCATTGCATCACCT-3' [SEQ ID NO 80] je 0,25 μM, 100 μM dNTP, 10 μl Herculase-Polymerasepuffer 10x, 5 U Herculase
(Zugabe bei 85 °C), H20 ad 100 μl. Das PCR-Profil war 95 °C, 10 min (1 Zyklus); 85 °C, 5 min (1 Zyklus); 58 °C, 30 s. 72 °C, 30 s, 95 °C, 30 s (30 Zyklen); 72 °C, 10 min (1 Zyklus).
Mit dieser DNA-Sonde wurde die Cosmid-Genbank durchmustert. Es wurde ein Klon identifiziert, dessen Cosmid mit der DNA-Sonde hybridisierte. Die Insertion dieses Cosmids wurde sequenziert. Die DNA- Sequenz enthielt einen Abschnitt, der dem Gen einer HMG-CoA- Reduktase zugeordnet wurde [SEQ ID NO 75].
Klonierung und Sequenzanalyse carB
(carB = Gen der Phytoendesaturase aus Blakeslea trispora) Aus dem Sequenzvergleich der Peptidsequenzen von Phytoendesaturasen und dem Vergleich der zugehörigen DNA- Sequenzen von Phycomyces blakesleeanus, Cercospora nicotianae, Phaffia rhodozyma und Neurospora crassa wurden die degenerierten Primer MAT182 5'-GCNGARGGNATHTGGTA-3' (SEQ ID 52) und MAT192 5'-TCNGCNAGRAADATRTTRTG-3' (SEQ ID 53) abgeleitet. Die PCR wurde in 100 μl Ansätzen durchgeführt. Diese enthielten 200 ng genomische DNA von Blakeslea trispora ATCC14272, 1 μM MAT182, 1 μM MAT192, 100 μM dNTP, 10 μl Pfu-Polymerasepuffer 10x, 2,5 U Pfu- Polymerase (Zugabe bei 85 °C), H20 ad 100 μl.
Das PCR-Profil war 95 °C, 10 min (1 Zyklus); 85 °C, 5 min (1 Zyklus); 40 °C, 30 s, 72 °C, 30 s, 95 °C, 30 s (35 Zyklen); 72 °C, 10 min (1 Zyklus).
Hiermit wurde ein 358-bp-Fragment erhalten, dessen abgeleitete Peptidsequenz Ähnlichkeit zu den Sequenzen der Phytoendesaturasen aufwies. Durch die Methode der inversen PCR (Innis et al. in PCR protocols: a guide to methods and applications. 1990. S. 219-227) wurden nach dem Prinzip des Chromosome-Walking die Genregionen
stromaufwärts und stromabwärts des 350-bp-Fragmentes folgendermaßen amplifiziert, kloniert und sequenziert:
(i) ein 1 ,1-kbp-Fragment durch PCR mit den Primern MAT219 5'- AAGTGACACCGGTTACACGCTTGTCTT-31 (SEQ ID 54) und MAT 220 5'-GCTTATCACCATCTGTTACCTCCTTGC-3' (SEQ ID 55) erhalten aus 200 ng EcoRI-gespaltener und zirkularisierter genomischer DNA von Blakeslea trispora ATCC14272, 0,25 μM MAT219, 0,25 μM MAT220, 100 μM dNTP, 10 μl Herculase- Polymerasepuffer 10x, 5 U Herculase (Zugabe bei 85 °C), H20 ad 100 μl. Das PCR-Profil war 95 °C, 10 min (1 Zyklus); 85 °C, 5 min
(1 Zyklus); 60 °C, 30 s. 72 °C, 60 s, 95 °C, 30 s (30 Zyklen); 72 °C, 10 min (1 Zyklus), (ii) ein 2,9-kbp-Fragment durch PCR mit den Primern MAT219 und MAT220 erhalten aus 200 ng Xbal-gespaltener und zirkularisierter genomischer DNA von Blakeslea trispora ATCC14272, 0,25 μM
MAT219, 0,25 μM MAT220, 100 μM dNTP, 10 μl Herculase- Polymerasepuffer 10x, 5 U Herculase (Zugabe bei 85 °C), H20 ad 100 μl. Das PCR-Profil war 95 °C, 10 min (1 Zyklus); 85 °C, 5 min (1 Zyklus); 60 °C, 30 s, 72 °C, 3 min, 95 °C, 30 s (30 Zyklen); 72 °C, 10 min (1 Zyklus);
Der klonierte Sequenzabschnitt ist schematisch in Fig. 20 [SEQ ID NO 77] dargestellt. Die Sequenzierung erfolgte in Strang- und Gegenstrangrichtung mit den klonierten Fragmenten sowie mit den PCR- Produkten. Die Sequenz des klonierten Sequenzabschnitts ist in Fig. 21 [SEQ ID NO 78] gezeigt.
Sequenzvergleiche
Die Nukleotidsequenz von carB und die Peptidsequenz des abgeleiteten Proteins CarB wurden mit den bekannten Sequenzen verwandter Proteine verglichen. Zum Sequenzvergleich wurden die Programme GAP und BESTFIT eingesetzt.
CarB - Identische Aminoacylreste nach GAP
Programmeinstellungen:
Gap Weight: 8 Length Weight: 2
Average Match: 2.912
Average Mismatch: -2.003
Dabei wurde folgende Werte für die Übereinstimmung der Aminosäuren zu
CarB aus Blakeslea trispora ATCC14272 in % gefunden: Phycomyces blakesleeanus: 72,491
Phaffia rhodozyma: 50,460
Neurospora crassa: 47,943
Cercospora nicotianae: 47,740
CarB -Identische Aminoacylreste nach BESTFIT
Programmeinstellungen:
Gap Weight: 8
Length Weight: 2 Average Match: 2.912
Average Mismatch: -2.003
Dabei wurde folgende Werte für die Übereinstimmung der Aminosäuren zu
CarB aus Blakeslea trispora ATCC14272 in % gefunden:
Phycomyces blakesleeanus: 73,380 Phaffia rhodozyma: 53,175
Neurospora crassa: 51 ,896
Cercospora nicotianae: 50,791
carB - Identische Basen nach GAP Programmeinstellungen: Gap Weight: 50
Length Weight: 3 Average Match: 10.000 Average Mismatch: 0.000
Dabei wurde folgende Werte für die Übereinstimmung der Basen zu CarB aus Blakeslea trispora ATCC14272 in % gefunden: Phycomyces blakesleeanus: 64,853 Cercospora nicotianae: 50,143 Phaffia rhodozyma: 43,179
Neurospora crassa: 42,130
carB -Identische Basen nach BESTFIT
Programmeinstellungen:
Gap Weight: 50
Length Weight: 3 Average Match: 10.000
Average Mismatch: -9.000
Dabei wurde folgende Werte für die Übereinstimmung der Basen zu CarB aus Blakeslea trispora ATCC14272 in % gefunden:
Phycomyces blakesleeanus: 68,926 Phaffia rhodozyma: 62,403
Neurospora crassa: 60,230
Cercospora nicotianae: 56,884
Klonierung zur Expression von carB Zur Klonierung und Expression von carB aus Blakeslea trispora wurden von dem oben beschriebenen klonierten Sequenzabschnitt aus Blakeslea trispora in sechs Leserastern die möglichen Proteinsequenzen abgeleitet. Diese Proteinsequenzen wurden mit den Sequenzen der Phytoendesaturasen aus Phycomyces blakesleeanus, Phaffia rhodozyma, Neurospora crassa, Cercospora nicotianae verglichen. Auf der Grundlage des Sequenzvergleiches wurden im klonierten Sequenzabschnitt der
genomischen DNA von Blakeslea trispora drei Exons identifiziert, die zusammengefügt eine codierende Region ergeben, deren abgeleitetes Genprodukt über die gesamte Länge 72,7% identische Aminoacylreste mit der Phytoendesaturase CarB aus Phycomyces blakesieeanus aufweist. Dieser Sequenzabschnitt aus drei möglichen Exons und zwei möglichen Introns wurde daher als Gen carB bezeichnet. Zur Überprüfung der vorhergesagten Genstruktur wurde die codierende Sequenz von carB aus Blakeslea trispora durch PCR mit cDNA von Blakeslea trispora als Matrize und mit den Primern Bol1425 5'- AGAGAGGGATCCTTAAATGCGAATATCGTTGC-3' (SEQ ID 56) und Bol1426 δ'-AGAGAGGGATCCATGTCTGATCAAAAGAAGCA-S' (SEQ ID 57) erzeugt. Das erhaltene DNA-Fragment wurde sequenziert. Die Lokalisation von Exons und Introns wurde durch Vergleich der cDNA mit der genomischen DNA von carB bestätigt. In Fig. 21 ist die codierende Sequenz von carB schematisch dargestellt. Zur Expression von carB in Escherichia coli wurde zunächst die Ndel-Schnittstelle in carB durch die Methode overlap extension PCR entfernt sowie am 5 -Ende des Gens eine Ndel-Schnittstelle und am 3'-Ende eine BamHI-Schnittstelle eingefügt. Das erhaltene DNA-Fragment wurde mit dem Vektor pJOE2702 ligiert. Das erhaltene Plasmid wurde als pBT4 bezeichnet und zusammen mit pCAR-AE in Escherichia coli XL1-Blue Moniert. Die Expression erfolgte durch Induktion mit Rhamnose. Der Nachweis der Enzymaktivität erfolgte durch Nachweis der Lycopinsynthese via HPLC. Die Klonierungsschritte sind im folgenden beschrieben: PCR 1.1:
Ca. 0,5 μg cDNA von Blakeslea trispora, 0,25 μM MAT350 5'- ACTTTATTGGATCCTTAAATGCGAATATCGTTGCTGC-3' (SEQ ID 58), 0,25 μM MAT244 5'-
GTTCCAATTGGCCACATGAAGAGTAAGACAGGAAACAG-3' (SEQ ID 59), 100 μM dNTP, 10 μl Pfu-Polymerase-Puffer (lOx), 2,5 U Pfu- Polymerase (Zugabe bei 85 °C, "hot start") und H20 ad 100μL.
Temperaturprofil:
1. 95 °C 10 min, 2. 85 °C 5 min, 3. 40 °C 30s, 4. 72 °C 1 min 30 s, 5. 95
°C 30 s, 6. 50 °C 30 s, 7. 72 °C 1 min 30 s, 8. 95 °C 30 s, 9. 72 °C 10min
Zyklen: (1-2.) 1x, (3-5.) 5x, (6-8.) 25x, (9.) 1x
PCR1.2:
Ca. 0,5 μg cDNA von Blakeslea trispora, 0,25 μM MAT243 5'-
CCTGTCTTACTCTTCATGTGGCCAATTGGAACCAACAC-3' (SEQ ID
60), 0,25 μM MAT353 5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3' (SEQ ID 61),
100 μM dNTP, 10 μl Pfu-Polymerase-Puffer (lOx), 2,5 U Pfu-Polymerase
(Zugabe bei 85 °C, "hot start") und H20 ad 100 μL.
Temperaturprofil:
1. 95 °C 10 min, 2. 85 °C 5 min, 3. 40 °C 30s, 4. 72 °C 1 min 30 s, 5. 95 °C 30 s, 6. 50 °C 30 s, 7. 72 °C 1 min 30 s, 8. 95 °C 30s, 9. 72 °C 10min
Zyklen: (1 -2.) 1x, (3-5.) 5x, (6-8.) 25x, (9.) 1x
Reinigung der PCR-Fragmente aus PCR 1.1, 1.2
Dazu wurde PCR 2 zur Herstellung der codierenden Sequenz von carB aus Blakeslea trispora für die Klonierung in pJOE2702 durchgeführt:
Ca. 50 ng Produkt aus PCR 1.1 und ca. 50 ng Produkt aus PCR1.2 mit 0,25 μM MAT350 (5'-
ACTTTATTGGATCCTTAAATGCGAATATCGTTGCTGC-S' SEQ ID NO 58), 0,25 μM MAT353 (5'- CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3' SEQ ID NO 61), 100 μM dNTP, 10 μL Pfu-Polymerase-Puffer (lOx), 2,5 U Pfu- Polymerase (Zugabe bei 85 °C, "hot start") und H20 ad 100 μL. Temperaturprofil:
1. 95°C 10 min, 2. 85 °C 5 min, 3. 59 °C 30 s, 4. 72 °C 2 min, 5. 95 °C 30 s, 6.72°C 10 min
Zyklen: (1-2.) 1x, (3-5.) 22x, (6.) 1x
Anschließend erfolgte eine Reinigung des erhaltenen Fragmentes (~ 1,7 kbp), eine Ligation in Vektor pPCR-Script-Amp, eine Klonierung in Escherichia coli XL1-Blue, Sequenzierung der Insertion, Spaltung mit Ndel und BamHI sowie eine Ligation in pJOE2702. Das erhaltene Plasmid wurde als pBT4 bezeichnet.
Charakterisierung und Nachweis der Enzymaktivität von CarB (Phytoendesaturase)
Das von carB abgeleitete Genprodukt wurde als CarB bezeichnet. CarB weist auf Grundlage der Peptidsequenzanalyse folgende Eigenschaften auf:
Länge: 582 Aminoacylreste
Molekulare Masse: 66470
Isoelektrische Punkt: 6,7 Katalytische Aktivität: Phytoendesaturase
Edukt: Phytoen
Produkt: Lycopin
EC-Nummer: EC 1.14.99-
Der Nachweis der Enzymaktivität erfolgte in vivo. Wenn das Plasmid (pCAR-AE) in Escherichia coli XL1-Blue übertragen wird, entsteht der Stamm Escherichia coli XL1-Blue (pCAR-AE). Dieser Stamm synthetisiert Phytoen. Wenn zusätzlich das Plasmid pBT4 in Escherichia coli XL1-Blue übertragen wird, entsteht der Stamm Escherichia coli XL1-Blue (pCAR- AE)(pBT4). Da ausgehend von carB eine enzymatisch aktive Phytoendesaturase gebildet wird, produziert dieser Stamm Lycopin.
Die Plasmide pCAR-AE und pBT4 wurden daher in Escherichia coli übertragen. Nach Wachstum in Flüssigkultur wurden die Carotinoide aus den Zellen extrahiert und charakterisiert (vgl. oben).
Durch HPLC Analyse wurde nachgewiesen, daß der Stamm Escherichia coli XL1-Blue (pCAR-AE) Phytoen und der Stamm Escherichia coli XL1- Blue (pCAR-AE)(pBT4) Lycopin produziert. CarB weist folglich die Enzymaktivität einer Phytoendesaturase auf.
Herstellung gentechnisch veränderter Stämme von Blakeslea trispora zur Herstellung von Phytoen
Nachfolgend werden beispielhaft die Herstellung von gentechnisch veränderten Organismen zur Herstellung von Phytoen beschrieben.
Vector pBinAHygΔcarB zur Erzeugung von carB" -Mutanten von Blakeslea trispora
Für die Deletion von carB in Blakeslea trispora wurde der Vektor pBinAHygΔcarB (SEQ. ID. NO:62, Fig. 22) konstruiert. Der Vorläufer von pBinAHygΔcarB ist pBinAHyg (SEQ. ID. NO:3, Fig. 2). pBinAHyg wurde folgendermaßen konstruiert:
Aus dem Plasmid pANsCosI (SEQ. ID. NO:4, Fig. 1, Osiewacz, 1994, Curr. Genet. 26:87-90) wurde die gpdA-hph Kassette als Bglll/Hindlll Fragment isoliert und in das BamHI/Hindlll geöffnete binäre Plasmid pBin19 (Bevan, 1984, Nucleic Acids Res. 12:8711-8721) ligiert. Der so erhaltene Vektor wurde als pBinAHyg bezeichnet und enthält das E. coli Hygromycin-Resistenzgen (hph) unter Kontrolle des gpd Promotors und des trpC Terrminators aus Aspergillus nidulans sowie die entsprechenden Bordersequenzen, die für den DNA-Transfer von Agrobacterium notwendig sind.
Die Amplifikation der codierenden Sequenz von carB mit den Primern MAT350 und MAT353 mittels PCR wurde mit den folgenden Parametern durchgeführt: 50 ng pBT4 mit 0,25 μM MAT350 (δ'-ACTTTATTGGATCCTTAAAT- GCGAATATCGTTGCTGC-3'; SEQ ID NO 58), 0,25 μM MAT353 (5'-
CTATTTTAATCATATGTCTGATCAAAAGAAGCATATTG-3'; SEQ ID NO 61), 100 μM dNTP, 10 μL Pfu-Polymerase-Puffer, 2,5 U Pfu-Polymerase (Zugabe bei 85 °C, "hot start") und ad 100 μL H20 Temperaturprofil: 1. 95 °C 10 min, 2. 85 °C 5 min, 3. 58 °C 30s, 4. 72°C 2 min, 5. 95 °C 30s, 6. 72 °C 10 min. Zyklen: (1.-2.) 1x, (3-5.) 30x, (6.) 1x
Anschließend erfolgte eine Reinigung des erhaltenen Fragmentes (~ 1,7 kbp), eine Spaltung mit Hindlll, eine weitere Reinigung des 364-bp-Hindlll- Fragments-carB, gefolgt von einer Spaltung von pBinAHyg mit Hindlll, eine Ligation von 364-bp-Hindlll-Fragments-carB in pBinAHyg, eine Transformation des Vektors in Escherichia coli und eine Isolierung des Konstruktes und Bezeichnung als pBinAHygΔcarB wie oben beschrieben. Alternativ erfolgte eine partielle Spaltung mit Hindlll und die Klonierung eines größeren Hindill-Fragmentes aus carB in pBinAHyg zur Herstellung von pBinAHygΔcarB.
Erzeugung von carB" -Mutanten von Blakeslea trispora Zunächst wurde das Plasmid pBinAHygΔcarB in den Agrobakterienstamm LBA 4404 übertragen, z. B. durch Elektroporation (vgl. oben). Anschließend wurde das Plasmid von Agrobacterium tumefaciens LBA 4404 in Blakeslea trispora ATCC 14272 und in Blakeslea trispora ATCC 14271 übertragen (vgl. oben). Der erfolgreiche Nachweis des Gentransfers in Blakesleslea trispora erfolgte über Polymerase- Kettenreaktion nach folgendem Protokoll:
Ca. 0,5 ug DNA aus Blakeslea trispora ATCC 14272 carB" bzw. ATCC 14271 carB- wurden mit 0,25 μM Primer hph forward (5'- CGATGTAGGAGGGCGTGGATA-3'; SEQ ID NO 5), 0,25 μM Primer hph reverse (5'-GCTTCTGCGGGCGATTTGTGT-3'; SEQ ID NO 6), 100 μM
dNTP, 10 μL Herculase-Polymerase-Puffer, 2,5 U Herculase-DNA- Polymerase (Zugabe bei 85 °C, "hot start") und ad 100 μl H20 umgesetzt. Temperaturprofil:
1. 95°C 10 min, 2. 85 °C 5 min, 3. 58 °C 1 min, 4. 72 °C 1 min, 5. 94 °C 1 min, 6.72°C 10 min.
Zyklen: (1.-2.) 1x, (3-5.) 30x, (6.) 1x
Als Negativkontrolle wurde eine Amplifikation des Kanamycinresistenzgens aus Agrobacterium versucht. Dazu wurden folgende PCR-Bedingungen verwendet:
Ca. 0,5 μg DNA aus Blakesiea trispora ATCC 14272 carB" bzw. ATCC 14271 carB' wurden mit 0,25 μM Primer nptlll forward (5'- TGAGAATATCACCGGAATTG-3'; SEQ ID NO 7), 0,25 μM Primer nptlll reverse (AGCTCGACATACTGTTCTTCC-3'; SEQ ID NO 8), 100 μM dNTP, 10 μL Herculase-Polymerase-Puffer, 2,5 U Herculase-DNA- Polymerase (Zugabe bei 85 °C, "hot start") und ad 100 μL H20 umgesetzt. Temperaturprofil:
1. 95 °C 10 min, 2. 85 °C 5 min, 3. 58 °C 1 min, 4. 72 °C 1 min, 5. 94 °C 1 min, 6. 72 °C 10 min- Zyklen: (1-2.) 1x, (3-5.) 30x, (6.) 1x
Produktion von Carotinoiden und Carotinoidvorstufen mit Blakeslea trispora Zur Produktion der Carotinoide Zeaxanthin, Canthaxanthin, Astaxanthin und Phytoen wurden die entsprechenden gentechnisch veränderten Blakeslea trispora (+) und (-) Stämme fermentiert, das produzierte Carotinoid mittels HPLC Analyse nachgewiesen und isoliert.
Das Flüssigmedium zur Produktion von Carotinoiden enthielt pro Liter: 19 g Maismehl, 44 g Sojamehl, 0,55 g KH2P04, 0,002 g Thiaminhydochlorid, 10 % Sonnenblumenöl. Der pH wurde mit KOH auf 7,5 eingestellt.
Zur Herstellung der Carotinoiden wurden Schüttelkolben mit Sporensuspensionen von (+) und (-) Stämmen der GVO von Blakeslea trispora beimpft. Die Schüttelkolben wurden bei 26 °C mit 250 rpm für 7 Tage inkubiert. Alternativ wurde zu Mischungen der Stämme nach 4 Tagen Trisporsäuren zugegeben und weitere 3 Tage inkubiert. Die Endkonzentration der Trisporsäuren betrug 300 - 400 μg/ml.
Extraktion und Analytik Extraktion:
1. Entnahme von 10 ml Kultursuspension 2. Zentrifugation, 10 min, 5.000 x g
3. Verwerfen des Überstandes
4. Resuspendierung des Pellets in 1 ml Tetrahydrofuran (THF) durch Vortexen
5. Zentrifugation, 5 min, 5.000 x g 6. Abnahme der THF-Phase
7. Wiederholung der Schritte 4.-6. (2 x)
8. Vereinigung der THF-Phasen
9. Zentrifugation der vereinigten THF-Phasen 5 min bei 20.000 x g, um Reste der wäßrigen Phase abzutrennen
Analytik
Messung von Phytoen mittels HPLC
Säule: ZORBAX Eclipse XDB-C8, 5 um, 150*4,6 mm
Temperatur: 40 °C Flußrate: 0,5 ml/min lnjektionsvolumen:10 μl
Detektion: UV 220 nm
Stoppzeit: 12 min
Nachlaufzeit: 0 min
Maximaldruck: 350 bar
Eluent A: 50 mM NaH2P04, pH 2,5 mit Perchlorsäure
Eluent B: Acetonitril
Gradient:
Zeit [min] A [%] B 170 Fluß [ml/min]
0 50 50 0,5
12 50 50 0,5
Als Matrix wurden Extrakte der Fermentationsbrühen verwendet. Vor der HPLC wurde jede Probe wird durch ein 0,22 μm Filter filtriert. Die Proben wurden kühl gehalten und vor Licht geschützt. Zur Kalibrierung wurden jeweils 50 - 1000 mg/l eingewogen und in THF gelöst. Als Standard wurde Phytoen verwendet, welches unter den gegebenen Bedingungen eine Retentionszeit von 7,7 min. aufweist.
Messung von Lycopin, ß-Carotin, Echinenon, Canthaxanthin, Cryptoxanthin, Zeaxanthin und Astaxanthin mittels HPLC
Säule: Nucleosil 100-7 C18, 250*4,0 mm (Macherey & Nagel)
Temperatur: 25 °C
Flußrate: 1 ,3 ml/min
Injektionsvolumen: 10 μl
Detektion: 450 nm
Stoppzeit: 15min
Nachlaufzeit: 2 min
Maximaldruck: 250 bar
Eluent A: 10% Aceton, 90% H2O
Eluent B: Aceton
Gradient:
Zeit [min] A [%] B [%] Fluß [ml/min]
0 30 70 1 ,3
10 5 95 1 ,3
12 5 95 1,3 13 30 70 1,3
Als Matrix wurden Extrakte der Fermentationsbrühen verwendet. Vor der HPLC wurde jede Probe wird durch ein 0,22 μm Filter filtriert. Die Proben wurden kühl gehalten und vor Licht geschützt. Zur Kalibrierung wurden jeweils 10 mg eingewogen und in 100 ml THF gelöst. Als Standard wurden folgende Carotinoide mit folgenden Retentionszeiten eingesetzt ß-Carotin (12,5 min), Lycopin (11 ,7 min), Echinenon (10,9 min), Cryptoxanthin (10,5 min), Canthaxanthin (8,7 min), Zeaxanthin (7,6 min) und Astaxanthin (6,4 min) [s. Fig 23].
Produktion von Zeaxanthin mit gentechnisch veränderten Stämmen von Blakeslea trispora
Nachfolgend wird beispielhaft die Herstellung von Zeaxanthin mit gentechnisch veränderten Organismen (GVO) von Blakeslea trispora beschrieben.
Durch Agrobakterium-vermittelte Transformation wurde der Vektor pBinAHygBTpTEFI -HPcrtZ in Blakeslea trispora übertragen (s.o.). Ein Hygromycin-resistenter Klon wurde isoliert und auf eine Kartoffel-Glucose- Agarplatte (Merck KGaA, Darmstadt) übertragen. Nach drei Tagen Inkubation bei 26°C wurde ausgehend von dieser Platte ein Sporensuspension hergestellt. Ein 250-ml-Erlenmeyerkolben ohne Schikanen mit 50 ml Growth-Medium (Maismehl 47 g/l, Sojamehl 23 g/l, KH2P040,5 g/l, Thiamin-HCI 2.0 mg/l, pH mit NaOH vor der Sterilisation auf 6,2-6,7 eingestellt) wurde mit 1x105 Sporen beimpft. Diese Vorkultur inkubierte 48 Stunden bei 26 °C und 250 upm. Für die Hauptkultur wurde ein 250-ml-Erlenmeyerkolben ohne Schikane
enthaltend 40 ml Produktionsmedium mit 4 ml der Vorkultur beimpft und 8 Tage bei 26 °C und 150 upm inkubiert. Das Produktionsmedium enthielt Glucose 50 g/l, Casein Acid Hydrolisate 2 g/l, Hefeextrakt 1 g/l, L- Asparagin 2 g/l, KH2P04 1,5 g/l, MgS04 x 7 H20 0,5 g/l, Thiamin-HCI 5 mg/l, Span20 10 g/l, Tween 80 1 g/l, Linolsäure 20 g/l, Maisquellwasser 80 g/l. Nach 72 Stunden erfolgte die Zugabe von Kerosin in einer Endkonzentration von 40 g/l Kerosin.
Nach der Ernte der Kulturen werden die verbliebenen ungefähr 35 ml Kultur mit Wasser auf 40 ml aufgefüllt. Anschließend werden die Zellen im Hochdruckhomogenisator, Typ Micron Lab 40, Fa. APV Gaulin, 3 x bei 1500 bar aufgeschlossen.
Die Suspension mit den aufgeschlossenen Zellen wurde mit 35 ml THF versetzt und 60 min bei RT im Dunkeln bei 250 upm geschüttelt. Danach wurden 2 g NaCI zugegeben und das Gemisch nochmals geschüttelt. Der Extraktionsansatz wurde dann 10 min bei 5000 x g zentrifugiert. Die gefärbte THF-Phase wurde abgenommen, die Zellmasse war vollständig entfärbt.
Die THF-Phase wurde am Rotationsverdampfer bei 30 mbar und 30 °C auf 1 ml eingeengt und danach nochmals in 1 ml THF aufgenommen. Nach Zentrifugation 5 min bei 20 000 x g wurde ein Aliquot der oberen Phase entnommen und durch HPLC analysiert (Fig. 24, Fig. 23).
Claims
1. Verfahren zur Herstellung eines gentechnisch veränderten Organismus der Gattung Blakeslea umfassend
(i) Transformation mindestens einer der Zellen,
(ii) ggf. Homokaryotisierung der aus (i) erhaltenen Zellen, so dass Zellen entstehen, in denen die Kerne in einem oder mehreren genetischen Merkmalen alle gleichartig verändert sind und diese gentechnische Veränderung zur Ausprägung bringen, und
(iii) Selektion und Anzucht der gentechnisch veränderten Zelle oder
Zellen.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass es sich um Zellen von Pilzen der Art Blakeslea trispora handelt.
3. Verfahren nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass in der Transformation (i) ein Vector oder freie Nukleinsäuren verwendet werden.
4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector in das Genom mindestens einer der Zellen integriert wird.
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector einen Promotor und/oder einen Terminator enthält.
6. Verfahren nach einem der vorhergehenden Ansprüche 3 bis 5, dadurch gekennzeichnet, dass in der Transformation (i) ein Vector enthaltend den gpd, pcarB, pcarRA und/oder ptefl Promotor und/oder den trpC Terminator eingesetzt wird.
7. Verfahren nach einem der vorhergehenden Ansprüche 3 bis 6, dadurch gekennzeichnet, dass in der Transformation (i) ein Vector enthaltend ein Resistenzgen eingesetzt wird.
8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector ein Hygromycin- Resistenzgen (hph), insbesondere aus E. coli enthält.
9. Verfahren nach einem der vorhergehenden Ansprüche 5 - 8, dadurch gekennzeichnet, dass der gpd Promotor die Sequenz SEQ ID NO: 1 aufweist.
10.Verfahren nach einem der vorhergehenden Ansprüche 5 - 8, dadurch gekennzeichnet, dass der trpC Terminator die Sequenz SEQ ID NO: 2 aufweist.
11.Verfahren nach einem der vorhergehenden Ansprüche 5 - 8, dadurch gekennzeichnet, dass der tefl Promotor die Sequenz SEQ ID NO: 35 aufweist.
12. Verfahren nach einem der Ansprüche 6 bis 11, dadurch gekennzeichnet, dass der gpd Promotor und der trpC Terminator aus Aspergillus nidulans stammen.
13. Verfahren nach einem Ansprüche 3 bis 12, dadurch gekennzeichnet, dass der Vector die SEQ ID NO: 3 umfasst.
14. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die Transformation (i) mittels Agrobakterien,
Konjugation, Chemikalien, Elektroporation, Beschuss mit DNA- beladenen Partikeln, Protoplasten oder Mikroinjektion durchgeführt wird.
15. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass in der Homokaryontisierung (ii) ein mutagenes Agens eingesetzt wird.
16. Verfahren nach Anspruch 15, dadurch gekennzeichnet, dass als mutagenes Agens N-Methyl-N'-nitro-nitrosoguanidin (MNNG), UV- Strahlung oder Röntgenstrahlung eingesetzt wird.
17. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die Selektion durch Markierung und/oder Auswahl der einkernigen Zellen erfolgt.
18. Verfahren nach einem der vorhergehenden Ansprüche 1 - 17, dadurch gekennzeichnet, dass in der Selektion 5-Carbon-5-deazariboflavin (darf) und Hygromycin (hyg) oder 5-Fluororotat (FOA) und Uracil und Hygromycin eingesetzt werden.
19. Verfahren nach einem der Ansprüche 3 bis 18, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector genetische Informationen zur Herstellung von Carotinoiden oder deren Vorstufen enthält.
20. Verfahren nach einem der Ansprüche 3 bis 19, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector genetische Informationen zur Herstellung von Carotinen oder
Xanthophyllen enthält.
21. Verfahren nach einem der Ansprüche 3 bis 20, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector genetische Informationen zur Herstellung von Astaxanthin, Zeaxanthin, Echinenon, ß-Cryptoxanthin, Andonixanthin, Adonirubin,
Canthaxanthin, 3-Hydroxyechinenon, 3'-Hydroxyechinenon, Lycopin, ß- Carotin, α-Carotin, Lutein, Bixin, Phytofluen oder Phytoen enthält.
22. Verfahren nach einem der Ansprüche 3 bis 21, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector derart gestaltet ist, dass die im Vector enthaltene genetische Information in das Genom von Blakeslea trispora eingeführt wird
23. Verfahren nach einem der Ansprüche 3 bis 22, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector genetische Informationen enthält, die nach Expression eine Ketolase- und/oder Hydroxylase-Aktivität entfalten.
24. Verfahren nach Anspruch 23, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector die SEQ ID NO: 70 oder 71 oder 76 und/oder 72 umfasst.
25. Verfahren nach Anspruch 23 oder 24, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector eine Sequenz aus der Gruppe bestehend aus den SEQ ID NO: 37 - 51 aufweist.
26. Verfahren nach einem der Ansprüche 3 bis 21 , dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector derart gestaltet ist, dass die im Vector enthaltene genetische Information in der Zelle ausgeschaltet wird.
27. Verfahren nach einem der Ansprüche 3 bis 21 oder 25, dadurch gekennzeichnet, dass durch die Transformation (i) das Gen der
Phytoendesaturase ausgeschaltet wird.
28. Verfahren nach Anspruch 27, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector die SEQ ID NO: 69 umfasst.
29. Verfahren nach Anspruch 27 oder 28, dadurch gekennzeichnet, dass der in der Transformation (i) eingesetzte Vector die Sequenz SEQ ID
NO: 62 aufweist.
30. Verfahren nach einem der Ansprüche 3 bis 21 , dadurch gekennzeichnet, dass durch die Transformation das Gen der Lycopincyclase ausgeschaltet wird.
31. Genetisch veränderte mehrkernige Zellen der zur Gattung Blakeslea gehörenden Pilze, insbesondere Blakeslea trispora erhältlich nach einem der vorhergehenden Ansprüche.
32. Verwendung der Zellen nach Anspruch 30 oder eines aus ihnen gebildeten Mycels zur Herstellung von Carotinoiden oder deren Vorstufen.
33. Verwendung nach Anspruch 30 oder 31 zur Herstellung von Carotinen oder Xanthophyllen.
34. Verwendung nach einem der Ansprüche 30 bis 32 zur Herstellung von Astaxanthin, Zeaxanthin, Echinenon, ß-Cryptoxanthin, Andonixanthin, Adonirubin, Canthaxanthin, 3-Hydroxyechinenon, 3'- Hydroxyechinenon, Lycopin, ß-Carotin, α-Carotin, Lutein, Bixin,
Phytofluen oder Phytoen.
35. Promotor mit der Sequenz SEQ ID NO: 1 oder 35 zur Verwendung in dem Verfahren nach einem der Ansprüche 1 - 29.
36. Terminator mit der Sequenz SEQ ID NO: 2 zur Verwendung in dem Verfahren nach einem der Ansprüche 1 - 29.
37. Vector umfassend die SEQ ID NO: 3 zur Verwendung in dem Verfahren nach einem der Ansprüche 1 - 29.
38. Vector nach Anspruch 36 zur Verwendung in dem Verfahren nach einem der Ansprüche 1 - 29 umfassend die SEQ ID NO: 69 und/oder die SEQ ID NO: 70 oder 71 und/oder 72 oder 76.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10300649 | 2003-01-09 | ||
| DE10300649A DE10300649A1 (de) | 2003-01-09 | 2003-01-09 | Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen |
| DE10341272 | 2003-09-08 | ||
| DE2003141272 DE10341272A1 (de) | 2003-09-08 | 2003-09-08 | Verfahren zur gentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren Verwendung |
| PCT/EP2004/000100 WO2004063358A1 (de) | 2003-01-09 | 2004-01-09 | Verfahren zur gentechnischen veränderung von organismen der gattung blakeslea, entsprechende organismen und deren verwendung |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1592784A1 true EP1592784A1 (de) | 2005-11-09 |
Family
ID=32714778
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP04700993A Ceased EP1592784A1 (de) | 2003-01-09 | 2004-01-09 | Verfahren zur gentechnischen veränderung von organismen der gattung blakeslea, entsprechende organismen und deren verwendung |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20060099670A1 (de) |
| EP (1) | EP1592784A1 (de) |
| JP (1) | JP2006513729A (de) |
| KR (1) | KR20050092740A (de) |
| RU (1) | RU2005125073A (de) |
| WO (1) | WO2004063358A1 (de) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20050092739A (ko) * | 2003-01-09 | 2005-09-22 | 바스프 악티엔게젤샤프트 | 유전자 변형된 블라케슬레아 속 유기체를 이용한카로티노이드 또는 그의 전구체의 생산 방법, 이 방법에의해 생산된 카로티노이드 또는 그의 전구체, 및 이들의용도 |
| WO2004074490A2 (en) * | 2003-02-24 | 2004-09-02 | Genoclipp Biotechnology B.V. | Method for transforming blakeslea strains |
| CN103589650A (zh) | 2005-03-18 | 2014-02-19 | 米克罗比亚公司 | 产油酵母和真菌中类胡萝卜素的产生 |
| WO2008042338A2 (en) | 2006-09-28 | 2008-04-10 | Microbia, Inc. | Production of carotenoids in oleaginous yeast and fungi |
| US8907165B2 (en) | 2009-04-22 | 2014-12-09 | Medicine In Need Corporation | Production of provitamin A carotenoids in mushrooms and uses thereof |
| CN105308180A (zh) * | 2012-12-20 | 2016-02-03 | 帝斯曼知识产权资产管理有限公司 | 胡萝卜素羟化酶及其用于产生类胡萝卜素的用途 |
| KR101844726B1 (ko) * | 2017-12-11 | 2018-04-02 | 이태영 | 건축물 감리용 드론 및 이를 이용한 건축물 감리방법 |
| EP3794017A4 (de) | 2018-05-17 | 2022-03-09 | Lumen Bioscience, Inc. | Orale arthrospira-platensis-impfstoffabgabeplattform |
| US12252513B2 (en) | 2018-07-16 | 2025-03-18 | Lumen Bioscience, Inc. | Thermostable phycobiliproteins produced from recombinant arthrospira |
| CA3143735A1 (en) | 2019-07-03 | 2021-01-07 | Lumen Bioscience, Inc. | Arthrospira platensis non-parenteral therapeutic delivery platform |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1184464A2 (de) * | 1999-06-09 | 2002-03-06 | Vitatene, S.A. | Herstellungsverfahren für lycopen |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5466599A (en) * | 1993-04-19 | 1995-11-14 | Universal Foods Corporation | Astaxanthin over-producing strains of phaffia rhodozyma |
| JP5303084B2 (ja) * | 1997-04-11 | 2013-10-02 | コニンクリーケ デーエスエム ナムローゼ フェンノートシャップ | 工業的組み換え生物を溝築するための手段としての遺伝子変換 |
| EP1238068A1 (de) * | 1999-12-08 | 2002-09-11 | California Institute Of Technology | Zielgerichtete evolution von biosynthese- und abbauwegen |
-
2004
- 2004-01-09 KR KR1020057012818A patent/KR20050092740A/ko not_active Withdrawn
- 2004-01-09 WO PCT/EP2004/000100 patent/WO2004063358A1/de not_active Ceased
- 2004-01-09 EP EP04700993A patent/EP1592784A1/de not_active Ceased
- 2004-01-09 US US10/541,993 patent/US20060099670A1/en not_active Abandoned
- 2004-01-09 JP JP2005518517A patent/JP2006513729A/ja active Pending
- 2004-01-09 RU RU2005125073/13A patent/RU2005125073A/ru not_active Application Discontinuation
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1184464A2 (de) * | 1999-06-09 | 2002-03-06 | Vitatene, S.A. | Herstellungsverfahren für lycopen |
Non-Patent Citations (4)
| Title |
|---|
| Mehta et al. (1995) Appl. Microbiol. Biotechnol. 42, 836-838. * |
| Mehta et al. (1997) Appl. Environ. Microbiol. 63, 3657-3661. * |
| Murillo et al. (1976) Mol. Gen Genet. 148, 19-24. * |
| Roncerro et al. (1984) Mut. Res. 125, 195-204. * |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2005125073A (ru) | 2006-06-10 |
| JP2006513729A (ja) | 2006-04-27 |
| US20060099670A1 (en) | 2006-05-11 |
| WO2004063358A1 (de) | 2004-07-29 |
| KR20050092740A (ko) | 2005-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1592783A2 (de) | Verfahren zur herstellung von carotinoiden oder deren vorstufen mittels gentechnisch veränderter organismen der gattung blakeslea, mit dem verfahren hergestellte carotinoide oder deren vorstufen und deren verwendung | |
| DE69631924T2 (de) | Fermentative Herstellung von Carotenoiden | |
| DE69132769T2 (de) | Biosynthese von carotinoiden in genetisch hergestellten wirtszellen | |
| Verdoes et al. | Isolation and functional characterisation of a novel type of carotenoid biosynthetic gene from Xanthophyllomyces dendrorhous | |
| Verdoes et al. | Metabolic engineering of the carotenoid biosynthetic pathway in the yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma) | |
| DE69722766T2 (de) | Verbesserte fermentative Herstellung von Carotenoide | |
| DE69433969T2 (de) | Dna - kette zur synthese von xanthophyll und prozess zur herstellung von xanthophyll | |
| EP1531683B1 (de) | Verwendung von astaxanthinhaltigen pflanzen oder pflanzenteilen der gattung tagetes als futtermittel | |
| EP1471151B1 (de) | Verbessertes verfahren zur herstellung von lycopin durch fermentation ausgewählter stämme von blakeslea trispora. | |
| US20050003474A1 (en) | Carotenoid biosynthesis | |
| DE10300649A1 (de) | Verfahren zur Herstellung von Ketocarotinoiden durch Kultivierung von genetisch veränderten Organismen | |
| EP1592784A1 (de) | Verfahren zur gentechnischen veränderung von organismen der gattung blakeslea, entsprechende organismen und deren verwendung | |
| DE60005871T2 (de) | Astaxanthin Synthetase | |
| DE19916140A1 (de) | Carotinhydroxylase und Verfahren zur Herstellung von Xanthophyllderivaten | |
| US20180105839A1 (en) | Compositions and methods of biosynthesizing xanthophylls | |
| JP2005522193A (ja) | キサントフィロミセス・デンドロロウス(Xanthophyllomycesdendrorhous)の選択された株の発酵によるアスタキサンチンの製造法 | |
| US7252964B2 (en) | Isolated carotenoid biosynthesis gene cluster involved in canthaxanthin production and applications thereof | |
| EP1893769B1 (de) | Biologische produktion von zeaxanthin | |
| DE10341271A1 (de) | Verfahren zur Herstellung von Carotinoiden oder deren Vorstufen mittels gentechnisch veränderter Organismen der Gattung Blakeslea, mit dem Verfahren hergestellte Carotinoide oder deren Vorstufen und deren Verwendung | |
| DE10341272A1 (de) | Verfahren zur gentechnischen Veränderung von Organismen der Gattung Blakeslea, entsprechende Organismen und deren Verwendung | |
| DE102014210308A1 (de) | Hefestamm zur Produktion von Carotinoiden | |
| US20060141557A1 (en) | Production of canthaxanthin by phaffia | |
| US20250109422A1 (en) | Yarrowia production process | |
| DE10258971A1 (de) | Verwendung von astaxanthinhaltigen Pflanzen oder Pflanzenteilen der Gattung Tagetes als Futtermittel | |
| CN108779451A (zh) | 解脂耶氏酵母的交配型转换 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20050809 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: BASF SE |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED |
|
| 18R | Application refused |
Effective date: 20091101 |