EP1549766A1 - Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente - Google Patents

Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente

Info

Publication number
EP1549766A1
EP1549766A1 EP03769374A EP03769374A EP1549766A1 EP 1549766 A1 EP1549766 A1 EP 1549766A1 EP 03769374 A EP03769374 A EP 03769374A EP 03769374 A EP03769374 A EP 03769374A EP 1549766 A1 EP1549766 A1 EP 1549766A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
nucleotides
primers
animals
microsatellites
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03769374A
Other languages
German (de)
English (en)
Inventor
Ernst c/o Inst. für Tierzucht u. Tierhaltung KALM
Norbert c/o FBN REINSCH
Sebastean Schwarz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Forderverein Biotechnologieforschung Der Deutschen Schweineproduktion Ev
Original Assignee
Forderverein Biotechnologieforschung Der Deutschen Schweineproduktion Ev
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forderverein Biotechnologieforschung Der Deutschen Schweineproduktion Ev filed Critical Forderverein Biotechnologieforschung Der Deutschen Schweineproduktion Ev
Priority to EP03769374A priority Critical patent/EP1549766A1/fr
Publication of EP1549766A1 publication Critical patent/EP1549766A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates to the use of a first nucleic acid for determining the predisposition to the expression or inheritance of the phenotype "spreading legs" in a mammal / poultry, the first nucleic acid having a length of at least 8 nucleotides and being identical or essentially identical to a second nucleic acid, which occurs on chromosome 5 of the pig or in a homologous position in the genome of other mammals / poultry, namely in the area of the microsatellites Sw1468, Sw2, Sw1200, Sw2425, Sw995, IGF1, S0005, Sw963, Sw1987, S0018, Sw904, Sw310, Swr1974 , Swr426, Sw1094, Sw986 or Sw1982, or on chromosome 11 of the pig or in a homologous position in the genome of other mammals / poultry, namely in the range of microsatellites S0182, S0071, Sw2008, Sw435, S0009, S0230 or Sw486 furthermore
  • the invention relates to a kit containing at least one pair of primers for the amplification of one of the above-mentioned second nucleic acids, one primer each binding to the + strand and another primer to the - strand of the nucleic acid, or a hybridization probe with a length of at least 8 nucleotides which binds to one of the second nucleic acids mentioned above, or a specific antibody or an antibody fragment which binds to the second nucleic acid disclosed above.
  • Hereditary anomalies represent an economic loss in the production of breeding pigs as well as in piglet production.
  • the economic damage of individual birth defects depends on the frequency of traits in the population as well as the treatment costs resulting from inheritance defects and smaller increases (STIGLER et al., 1991).
  • congenital digging out in the newborn piglet (hereinafter referred to as spreader syndrome) is described as the most frequently occurring dysfunction (PARTLOW et al :, 1993).
  • the anomaly manifests itself as a restricted mobility of the affected animals and a characteristic spread position mostly of the rear extremities, which means that the piglets can hardly reach the teats and escape reactions are delayed.
  • RFLPs restriction fragment length polymorphisms
  • microsatellites Jarne and Lagoda 1996; Montaldo and Herrera-Meza 1998.
  • Most RFLPs are diallelic and, according to Hui Liu (1998), have low PIC (Polymorphism Information Content) values compared to microsatellites.
  • PIC Polymorphism Information Content
  • Microsatellites are numerous and have high PIC values. Around 65,000 to 100,000 microsatellite loci are evenly distributed in the pig genome (Ellegren 1993; Schlötterer 1997; Dounavi 2000). The identification of microsatellites is carried out by various laboratories, the number of identified microsatellites is 1286 (as of March 5, 2001).
  • Genotyping or genome screening procedures determine whether the presence of certain polymorphic sections of DNA or more specific
  • Haplotypes with a phenotype can be used as a diagnostic or prognostic marker, which makes it possible to make statements about the probability of occurrence or about the inheritance of a phenotype. It should be borne in mind here that such prognostic or diagnostic Verification procedures are independent of identification of the phenotype-causing gene. This is important because establishing the molecular basis of a phenotype is often very difficult and time-consuming, especially in connection with multifactorial phenotypes. A small number of features of pigs and other mammals or poultry can be predicted using genetic markers. To date, however, there is no possibility of demonstrating a predisposition to inheritance or the expression of the "spread-legged" phenotype.
  • the present invention is therefore based on the object of providing methods and methods by means of which animals can be identified which are predisposed to the expression of the phenotype "spread-leggedness" or inherit such a predisposition. This object is achieved according to the invention by the provision of the information in the Characterized claims solved embodiments.
  • the invention thus relates to the use of a first nucleic acid for determining the predisposition to the expression or inheritance of the phenotype
  • Mammals / poultry in the area of microsatellites S0182, S0071, Sw2008, Sw435, S0009, S0230 or Sw486.
  • the second nucleic acid disclosed above is preferably genomic DNA or cDNA, but can also be an RNA transcript of this DNA.
  • Genomic DNA and cDNA are mostly double-stranded, but the use according to the invention also includes single-stranded DNA molecules.
  • the first nucleic acid is preferably an oligonucleotide, but can also be a polynucleotide in certain embodiments. It is preferably DNA, but can also be RNA or a DNA or RNA derivative such as PNA.
  • the first nucleic acid mentioned usually has a length of at least 8 nucleotides, preferably at least 15 nucleotides, more preferably at least 18 nucleotides, even more preferably at least 21 nucleotides, most preferably at least 25 nucleotides.
  • the first nucleic acid can also be up to 50 nucleotides, more preferably up to 100 nucleotides, even more preferably up to 1000 nucleotides and most preferably up to 5000 nucleotides long or longer.
  • the first or second nucleic acid comprises whole genes or even groups of genes. In these cases, the first or second nucleic acid has a length of up to 1000 nucleotides, preferably up to 5000 nucleotides, for example up to 25000 nucleotides, such as up to 150,000 nucleotides.
  • Hybridization probes are those nucleic acids that are used in a hybridization and bind to homologous nucleic acids.
  • the hybridization probe is preferably a radioactively labeled nucleic acid or it contains modified nucleotides.
  • the invention also includes such modifications of the nucleic acids claimed here,
  • Hybridization probes and primers that hybridize with the second nucleic acids preferably under stringent conditions.
  • higher or higher stringency hybridization conditions are understood to mean, for example, 0.2-0.5 ⁇ SSC (0.03 M NaCl, 0.003M sodium citrate, pH 7) at 65 ° C.
  • the hybridization temperature is below 65 ° C., for example above 55 ° C., preferably above 50 ° C.
  • Stringent hybridization temperatures depend on the size or length of the nucleic acid and its nucleotide composition and are to be determined by a person skilled in the art by manual tests.
  • the solution used for hybridization contains a detergent such as SDS in a concentration of 0.1% to 0.5% and a collection of non-specific nucleic acids to saturate non-specific binding sites.
  • a detergent such as SDS
  • SDS a concentration of 0.1% to 0.5%
  • a collection of non-specific nucleic acids to saturate non-specific binding sites.
  • the basic principles of hybridization and the requirements for a hybridization probe are Well known to a person skilled in the art. For example, see Maniatis, et al. Molecular Cloning: A laboratory manual, Cold Spring Harbor Press, New York, 1982 or Harnes and Higgins, Nucleic acid hybridization: a practical approach, IRL Press, Oxford 1985.
  • predisposition refers to the presence of a hereditary disposition, which may be inheritance of the hereditary disposition and / or an expression of one
  • microsatellite SW1468 is located at position 97.5 cm, SW2 at position 78.7 cm at Sscr 5, SW1200 at position 114.3 cm at Sscr 5, SW2425 at position 72.3 cm at Sscr 5, SW 995 at Position 125.0 cM on Sscr 5 or IGF1 on position 118.7 cM on Sscr 5.
  • microsatellite loci located on chromosomes 5 and 11 were determined to expand the investigation; For this purpose, a combined length of the non-pseudoautosomal markers was determined using the CRI-MAP program (Green et al., 1990) for the genome under investigation.
  • the integrated positions (cM) of the newly examined marker loci along the combined maps are shown in Example 5 and column 3 of Table 11 and are as follows: S0005 at position 64.4 cm on Sscr 5, Sw963 at position 68.6 cm on Sscr 5 , Sw1987 at position 75.2cM on Sscr 5, S0018 at position 79.5cM on Sscr 5, Sw904 at position 81, 8cM on Sscr 5, Sw310 at position 83.3cM on Sscr 5, Swr1974 at position 83.9cM on Sscr 5, Swr426 at position 84.4cM on Sscr 5, Sw1094 at position 85.5cM on Sscr 5, Sw986 at position 105.3cM on Sscr 5 and Sw1982 at position 107, 1cM on Sscr 5.
  • microsatellite SW1468 on chromosome 5 of the pig denotes a position specific for a population on chromosome 5 and comprises DNA sections 5 cM upstream and / or downstream of the indicated position, preferably up to 10 cM upstream and / or downstream, more preferably up to 20cM upstream and / or downstream and most preferably up to 30cM upstream and / or downstream of the indicated position on the chromosome.
  • the microsatellites If the microsatellite is remote, ie located at the end of the chromosome, in particular less than 30cM from End removed, the upstream or downstream area can also be shorter than 5 cm.
  • the comparative genome maps between different species are based on the mapping of one or more loci in the genome of the species in question.
  • “Homologous position” refers to nucleic acid segments in the genome of other mammals / poultry that have a sequence identity with the second nucleic acid disclosed above, at least preferred, over the entire sequence length or in specific genes located here or at one or more loci or parts thereof with at least 100 nucleotides in length 40%, more preferably at least 50%, even more preferably at least 75% and particularly preferably at least 95%, have sequence identity preferably determined by the FASTA, BLAST (Basic Local Alignment Search Tool) or Bestfit algorithms of the GCG sequence analysis program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Madison, Wl 53711).
  • the parameters are preferably set so that the percentage of identity is calculated over the entire length of the reference sequence and homology gaps of up to 5% of the total number of nucleotides are permitted.
  • the so-called optional parameters are preferably left at their preset values.
  • the term “essentially identical” means that, for example, 7 nucleotides are identical in a range of 8 nucleotides.
  • the invention also includes those embodiments in which 4, 5 or 6 of the 8 nucleotides have the corresponding sequence of the second nucleic acid are identical, and the first nucleic acid can be identical or essentially identical to the + strand or the - strand.
  • a first nucleic acid also includes the fact that more than one (first) nucleic acid can be used in the use according to the invention. These can be, for example, two, three or four nucleic acids.
  • second nucleic acid mean both the + strand and the - strand. If two first nucleic acids are identical or essentially identical to the second nucleic acid, the first nucleic acid can be identical or essentially identical to the + strand, while the other first nucleic acid can be identical or essentially identical to the - strand. In this case, it is preferred that the “alignment” of the first nucleic acid is in opposite directions, which enables PCR to be carried out.
  • nucleic acids are provided for the first time, which enable a targeted molecular-biological diagnosis of the predisposition for the expression of the Allow phenotype "spread legs".
  • the invention disclosed here allows the time of the selection to be shifted significantly forward so that there is no longer any need to wait for the phenotypic expression of the feature.
  • the introduction of molecular biological markers can bring about a significant increase in efficiency of the selection process.
  • This selection process includes the determination of the genotype of the subject / mammal at one or more loci in a region of the above-mentioned second nucleic acids, preferably in two regions, more preferably three, even more preferably four, more preferably five, most preferably in six regions and the assessment of an individual as suitable for breeding or not suitable, including information about the coupling phase between the genotyped marker locus and the genes responsible for the defect expression. For example, the genotypes of suitable and distinguish unsuitable mammals / poultry by a different number of copies of a repetitive nucleotide sequence within the microsatellite locus under consideration.
  • nucleic acid can be represented in a PCR reaction using suitable primers and is reflected in different PCR product sizes and / or different restriction fragment lengths.
  • the tests are usually performed on tissue samples from mammals or poultry, on egg cells, or on samples of body fluids such as sperm, urine, milk, blood, tear fluid and other secretions. These can be taken from the animal before diagnosis.
  • the syndrome spreader can be regarded as a prime example of a complex genetic disease. For this reason, a genome scan of piglets suffering from the syndrome spreader is described in the present patent application. Because of the calculated positions of known marker loci, the unknown disease loci were thus limited to the smallest possible chromosomal area. A number of molecular biological but especially statistical methods were used for this. As the inheritance is not yet known, a non-parametric evaluation was carried out for the statistical analysis, ie no assumptions were made about the inheritance of the characteristic. The aim of statistical methods is to demonstrate the co-segregation of a marker allele with the characteristic in a family. The methods used for this, which are used to map disease-correlated genes, can basically be divided into two categories:
  • Coupling analysis is the classic method for coupling analysis. In the original form, this method is based on observation and
  • the invention further encompasses preferred embodiments, the second nucleic acid disclosed above being a microsatellite or a sequence flanking these microsatellites.
  • the nucleic acid is in the range of microsatellites Sw1468, Sw2, Sw1200, Sw2425, Sw995, IGF1, S0005, Sw963, Sw1987, S0018, Sw904, Sw310, Swr1974, Swr426, Sw1094, Sw986 or Sw1982; or on chromosome 11 of the pig or in a homologous position in the genome of other mammals / poultry, in the region of the microsatellites S0182, S0071, Sw2008, Sw435, S0009, S0230 or Sw486.
  • the flanking sequence lies outside of the repetitive sequences typical of the microsatellite and preferably comprises a range of 1 kB upstream or downstream of the repetitive sequences.
  • the detection of at least one allele takes place, the detection of at least one allele with a length of 153 bp in the range of SW1468 using primers with the sequences of SEQ ID NO: 5 and 6; 154 bp in the range of SW1200 using primers with the sequences of SEQ ID NO: 7 and 8; 141 bp in the range of S0182 using primers with the sequences of SEQ ID NO: 23 and 24; 184 bp in the range of S0071 using primers with the sequences of SEQ ID NO: 15 and 16; 300 bp in the range of S0230 using primers with the sequences of SEQ ID NO: 19 and 20; or 311 bp in the range of S0230 using primers with the sequences of SEQ ID NO: 19 and 20; in pigs of the German Landrace indicates a risk of developing and / or inheriting the phenotype "spread legs".
  • allele is understood by the person skilled in the art to mean a series of two and more variants of a specific chromosomal gene segment.
  • a further preferred embodiment relates to the use of the nucleic acids mentioned above, two or more alleles being detected.
  • the detection can also be carried out with one or more Primer pairs from SEQ ID 25/26, SEQ ID 27/28, SEQ ID 29/30, SEQ ID 31/32, SEQ ID 33/34, SEQ ID 35/36, SEQ ID 37/38, SEQ ID 39/40, SEQ ID 41/42, SEQ ID 43/44, SEQ ID 45/46, SEQ ID 47/48.
  • Another preferred embodiment of the invention relates to the use of two primers, the primers being oriented in opposite directions with respect to the complementary DNA region and thus, for example, enabling PCR amplification.
  • the second nucleic acid is a specific gene or part of a gene. Preferred here the genes selected from the group consisting of IGF1, MYF5, MYF6, MYOD1,.
  • genes of this type can also be surrounded by flanking sequences, which preferably comprise a region of 1 kB upstream or downstream of the genes.
  • the first nucleic acid has a length of at least 8 nucleotides and is identical or essentially identical to a second nucleic acid.
  • the second nucleic acid corresponds to a section of chromosome 5 or
  • nucleic acid mentioned is located on chromosome 5 in the range of microsatellites SW1468 or SW1200 and
  • chromosome 5 of the pig was examined in the
  • alleles from the microsatellite S0182 were identified in the examined population. These alleles are characterized by their specific lengths of 119, 132, 134, 139 and 141 bp. Detection of the allele at 141 correlates with a risk of developing and / or inheriting the phenotype "spread leg". Furthermore, 4 alleles from the microsatellite S0071 were identified in the examined population. These alleles are characterized by their specific lengths of 184, 186, 188 and 191 bp. A detection of the allele with 184 bp correlates with a risk of the expression and / or inheritance of the phenotype "spread leg".
  • At least one allele with a length of 153 bp in the range of SW1468 is detected using primers with the sequences of SEQ ID NO: 5 and 6; 154 bp in the range of SW1200 using primers with the sequences of SEQ ID NO: 7 and 8; 141 bp in the range of S0182 using primers with the sequences of SEQ ID NO: 23 and 24; 184 bp in the range of S0071 using primers with the sequences of SEQ ID NO: 15 and 16; 300bp in the range of S0230 below Use of primers with the sequences of SEQ ID NO: 19 and 20; or 311bp in the range of S0230 using primers with the sequences of SEQ ID NO: 19 and 20 and indicates in pigs of the German Landrace a risk of the expression and / or inheritance of the phenotype "spread leg".
  • two, preferably three, more preferably four, even more preferably five and most preferably six, alleles are detected.
  • the detection can take place in separate reactions or in so-called multiplex reactions, which include the simultaneous detection of alleles.
  • use according to the invention relates to the detection of the disclosed first or second nucleic acids for the selection of domestic, breeding or farm animals with the missing feature “spreading legs”.
  • the domestic, breeding or Farm animals cattle, dog, cat, rabbit, buffalo, camel, alpaca, mink, pig, chicken, duck, goose, turkey, ostrich, goat, sheep, horse, donkey, rat or mouse.
  • the length specifications given above refer to animals of the examined pure breeding line of the German Landrace.
  • the microsatellites can have other alleles that are either shorter or longer.
  • the locus which correlates with the inheritance and / or expression of the characteristic "spread-leggedness” By specifying the locus which correlates with the inheritance and / or expression of the characteristic "spread-leggedness", however, the person skilled in the art has the possibility without unreasonable effort to identify the alleles of the microsatellite markers disclosed in a population.
  • the present invention shows which Ways of identifying marker alleles which correlate with the expression or inheritance of the "spread-legged" phenotype are identified. These can then be used in studies of animals from other populations as markers of the phenotype.
  • sequence analysis programs can be used to identify those nucleic acid segments in the genome of other animal populations which contain a nucleic acid segment which is homologous to the above-mentioned second nucleic acid.
  • the homologous locus identified in this way can then serve as the basis for further examinations are used, with the help of which specific alleles located at this locus can then be identified which associate with the phenotype "spread-leggedness", ie are inherited coupled to this phenotype.
  • a genome screen is carried out on several mammals / poultry of a population.
  • the term "multiple mammals / poultry" includes at least two animals in a population, preferably at least 5 animals, more preferably at least 10 animals, even more preferably at least 20 animals, more preferably at least 50 animals, even more preferably at least 250 animals, most preferably at least 1500 animals.
  • the genome screen examines whether a nucleic acid of up to 5000 nucleotides in length, preferably up to 1000 nucleotides, more preferably up to 350 nucleotides, even more preferably up to 50 nucleotides, most preferably at least 8 nucleotides in length together with the characteristic "spread leg" is inherited.
  • markers are microsatellites on chromosome 5 of the pig or in a homologous position in the genome of other mammals / poultry, in the region of the microsatellites Sw1468, Sw2, Sw1200, Sw2425, Sw995, IGF1, S0005, Sw963, Sw1987, S0018, Sw904, Sw310 , Swr1974, Swr426, Sw1094, Sw986 or Sw1982; or on chromosome 11 of the pig or in a homologous position in the genome of other mammals / poultry, in the region of the microsatellites S0182, S0071, Sw2008, Sw435, S0009, S0230 or
  • nucleic acid sequences can also be used as markers, provided that they are identical or essentially identical in the sense of the invention to the second nucleic acid disclosed in the invention or are in one of the above-mentioned nucleic acid regions.
  • the person skilled in the art can use detection methods for determining the predisposition to expression of the "spreading legs" phenotype without any problems.
  • the invention also discloses methods for determining the predisposition to express the "spreading legs" phenotype in domestic, breeding or farm animals, comprising the animals, their fertilized or unfertilized egg cells, their sperm , Tissue samples or samples of body fluids, such as milk and urine, for the presence, expression or nature of one of the above-mentioned second nucleic acid.
  • test methods are preferably in vitro test methods.
  • Different "forms or textures” of nucleic acids can be caused, for example, by insertions, duplications, deletions, substitutions or translocations. Inserts or deletions, for example, result in a changed nucleic acid length.
  • Duplications are a phenomenon usually observed in the generation of microsatellites. This length polymorphism can, for example are represented in a PCR reaction and is reflected when using suitable flanking primers, for example in the case of insertion in a longer PCR product.
  • the different "expression or nature” can also be, for example, a closely related gene variant, which in extreme cases is only distinguished from the related gene sequence by a single nucleotide exchange.
  • Such different “forms or qualities” of the nucleic acid can optionally be carried out with the aid of RFLP analyzes (restriction fragment length polymorphisms (RFLPs) or through
  • the domestic, breeding or farm animals are cattle, dog, cat, rabbit, buffalo, camel, alpaca, mink, pig, chicken, duck, goose, turkey, ostrich, goat, sheep, horse , Donkey, rat or mouse.
  • the methods according to the invention also relate to other mammals, in particular humans.
  • a PCR amplification with complementary primers with a length of at least 8 nucleotides is carried out, one primer on the + strand and another primer in the opposite orientation on the - strand of the second Nucleic acid binds, or a hybridization is carried out, a hybridization probe with a length of at least 8 nucleotides binding to the second nucleic acid, or sequencing of the second nucleic acid is carried out, or a detection with a specific antibody or antibody fragment or antibody derivative or an aptamer, the antibody or the antibody fragment or the antibody derivative or the aptamer being specifically directed against the second nucleic acid.
  • an antibody is used, for example, which is directed against a specific, first nucleic acid sequence, a second nucleic acid sequence which differs from the first only by at least one mutation but does not bind.
  • the specific, first nucleic acid can therefore be detected with the aid of this antibody, for example after transfer to a nitrocellulose membrane, either by labeling this antibody itself or by making it visible on the membrane with the aid of a second, labeled antibody. A lack of binding to the membrane would indicate the absence of the first nucleic acid sequence.
  • the reaction mixture also contains an excess of deoxynucleoside triphosphates and a DNA polymerase, for example Taq polymerase.
  • a DNA polymerase for example Taq polymerase.
  • the primers bind to the nucleic acid and the DNA polymerase extends the primers based on the nucleotide sequence specified in the nucleic acid.
  • the annealing temperature of a primer is influenced by its adenine + tymine and cytosine + guanine content. 2 ° C are calculated for each adenine and tymin, while 4 ° C is calculated for each cytosine and guanine.
  • the quality of a PCR reaction depends on the primer concentration, the changing amount of dNTP in the PCR mix and the quality of the Taq DNA polymerase.
  • a typical reaction mixture of 12.5 ⁇ l is composed as follows: 0.20 ⁇ M primer, 200 ⁇ M dNTPs, 0.50 U Taq polymerase, 1, 25 ⁇ l 10 x buffer, 1.50 ⁇ l DNA (50ng / ⁇ l) and with H 2 0 to 12.5 ⁇ l.
  • the reaction conditions listed in the method part of this application are preferably selected.
  • Primers are those nucleic acids that are at least 8 nucleotides in length and bind to one of the second nucleic acids disclosed above.
  • Preferred primers have a length of at least 8 nucleotides, preferably at least 15 nucleotides, more preferably at least 20 nucleotides, even more preferably a length of at least 30 nucleotides, most preferably a length of at least 50 nucleotides.
  • the nucleotide sequences of the primers can be combined as desired from the second nucleic acid sequences disclosed above, provided that they have at least 8 consecutive nucleotides.
  • primers with the target sequence within the second nucleic acid can also lead to base mismatches, provided that hybridization occurs under the chosen reaction conditions, which can lead to an elongation reaction.
  • a primer should have 7 identical nucleotides within 8 neighboring nucleotides.
  • the invention also includes those embodiments in which 4, 5 or 6 of the 8 nucleotides are identical to the corresponding sequence of the second nucleic acid.
  • the basic principles of the PCR methodology must be observed, the process steps and reaction conditions of which are state of the art. In detail, however, the method steps may nevertheless require adjustment by a person skilled in the art.
  • Amplification methods have been developed in recent years, further amplification methods, which are also preferred embodiments of the invention.
  • Further amplification methods are, for example, the “Ligase Chain Reaction” (LCR, EP-A 320308), “Cyclic Probe Reaction” (CPR,), “Strand Displacement Amplification” (SDA, Walker et al., Nucleic Acids Res. 1992 (7) : 1691-6.) Or “Transciption-based amplification systems” (TAS, Kwoh et al Proc. Nat. Acad Sei. USA 86: 1173 (1989), Gingeras et al., PCT Application WO 88/10315).
  • hybridization probe is understood to mean a nucleic acid with a length of up to 50 nucleotides, more preferably up to 100 nucleotides, even more preferably up to 200, 300, 400, 500 or 1000 nucleotides, and most preferably up to 5000 nucleotides, which bind to one of the second nucleic acids disclosed above, whereby the specificity of the detection must be tested in preliminary tests, which is a common practice for the person skilled in the art.
  • the first nucleic acid is preferably provided with a detectable label, such as a radioactive or fluorescent label, examples of hybridization methods being dot blot, northern blot, reverse northern blot, in situ hybridization or southern blot (Sambrook et al., 1989, Molecular Cloning, A. Laboratory M tract, Cold Spring Harbor and all subsequent editions).
  • a detectable label such as a radioactive or fluorescent label
  • Another preferred detection method for determining the predisposition to the expression of the phenotype "spread-leggedness" is the sequencing of one of the second nucleic acids disclosed above. Sequencing methods are known from the prior art and require no further explanation for the person skilled in the art. For example, here Sambrook et al. , 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor (and all subsequent editions are referenced), which describes the methods, ⁇ ach Sanger and Maxam / Gilbert.
  • nucleic acids that are at least a length are understood according to the invention 8 nucleotides, preferably at least 15 nucleotides, more preferably at least 18 nucleotides, even more preferably at least 21 nucleotides, most preferably a length of at least 25 nucleotides.
  • the properties shown for the PCR primers apply accordingly to sequencing primers.
  • primers or hybridization probes which are derived from the second nucleic acids mentioned above, are suitable for special detection methods, for example PCR methods, sequencing or hybridization methods, and which are not, or less are suitable.
  • the primers or hybridization probes for use in the invention can also be present, for example, in larger DNA or RNA sequences, for example flanked by restriction sites.
  • nucleic acids, hybridization probes and primers can also be constructed from base derivatives. A number of modifications change the chemistry of the phosphodiester backbone of DNA or RNA, sugars or heterocyclic bases.
  • phosphorothioates Phosphorodithioates, in which both oxygen atoms not involved in hydrogen bonding are replaced by sulfur, phosphoramides, alkylphosphotriesters and / or boranophosphates.
  • Achiral phosphate derivatives include S'-O'- ⁇ '-S phosphorothioates, 3'-S-5'-0-phosphorothioates, 3'-CH2-5'-0-phosphonates and 3'-NH-5'- 0 phosphoroamidates.
  • peptide nucleic acids the entire backbone of the phosphodiester can be replaced by peptide bonds.
  • Sugar modifications are used to change stability or affinity.
  • the A anomer of deoxyribose can be used with the base inverted with respect to the natural B anomer.
  • the 2'-OH group of the ribose can be changed to the corresponding 2'-0-methyl or 2'-0-allyl sugar, whereby a gain in stability is achieved without impairing the binding affinity.
  • Some other useful substitutions include deoxyuridine instead of deoxythymidine; 5-methyl-2 ' ⁇ deoxycytidine and 5-bromo-2'-deoxycytidine instead of deoxycytidine.
  • 5-propyyl-2'-deoxyuridine and 5-Propyyl-2'-deoxycytidine can replace deoxythymidine and deoxycytidine and thus increase affinity and biological activity.
  • the nucleic acids can have a label for detection. Examples of this are radioactive labeling, for example with 35 S, 32 P or 3 H, fluorescent labeling, biotin labeling, digoxigenin labeling, peroxidase labeling or labeling with an alkaline phosphatase.
  • the nucleic acids used in the hybridization or amplification reaction can furthermore be provided with various suitable markers. Suitable markers include fluorochromes, e.g.
  • fluorescein isothiocyanate FITC
  • rhodamine Texas Red
  • phycoerythrin allophycocyanin
  • 6-carboxyfluorescein 6-FAM
  • JOE 6-carboxy-X-rhodamine
  • ROX 6-carboxy-X-rhodamine
  • HEX ⁇ -carboxy ⁇ ''' ⁇ -hexachlorofluorescein
  • 5-carboxyfluorescein 5-FAM) or N, N, N', N'-tetramethyl-6 -Carboxyrhodamine (TAMRA).
  • the label can also be part of a multi-stage system, the nucleic acid being conjugated with biotin, or with a hapten or a similar substance that has a high-affinity binding partner, for example avidin, specific antibodies, etc., in which case the binding partner with a detectable compound is conjugated.
  • the label can be conjugated with a primer and / or the nucleotides in the pool of the amplification reaction can be provided with a suitable label, so that the label is incorporated into the newly formed amplification product.
  • double strands that have arisen in a hybridization reaction can also be detected by DNA double strand specific antibodies. Said antibodies are characterized in that they only bind to double-stranded DNA, but not to single-stranded DNA.
  • Another preferred detection method is the detection of the first or second nucleic acid with a specific antibody or antibody fragment or antibody derivative or an aptamer.
  • This method generates specific antibodies that recognize the first or second nucleic acids.
  • Fragments of antibodies are, for example, Fv, Fab or F (ab ') 2 - fragments derivatives include scFvs, chimeric or humanized antibodies.
  • Aptamers are nucleic acids that are specific to one due to their three-dimensional structure Bind target molecule. Methods for generating specific antibodies are known from the prior art. The specificity of the binding to the genomic nucleic acid can be tested, for example, by competition experiments with radioactively labeled desired target nucleic acid and unwanted, for example randomly selected, nucleic acid.
  • antibodies specifically bind the first or second nucleic acids.
  • the antibody binding can be made visible, for example, by labeling the primary antibodies or is detected with the aid of antibody-binding second antibodies, which in turn are then labeled.
  • the antibodies can be modified, for example, with fluorescent substances, by radioactive labeling or by enzymatic labeling.
  • Immunological detection methods using specific antibodies, as well as the generation of antibodies and fragments or derivatives thereof are, as already mentioned, known from the prior art. Examples include Harlow et al., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press and all subsequent editions.
  • a genome screen is carried out on several mammals and / or poultry of a population.
  • the term several mammals / poultry "comprises at least two animals of a population, preferably at least 5 animals, more preferably at least 10 animals, even more strongly preferably at least 20 animals, more preferably at least 50 animals, even more preferably at least 250 animals, most preferably at least 1500 animals.
  • the genome screen examines whether a nucleic acid of up to 5000 nucleotides in length, preferably up to 1000 nucleotides, more preferably up to 350 nucleotides, even more preferably up to 1000 nucleotides, most preferably up to 50 nucleotides in length, together with the feature “ Spread leg is inherited.
  • nucleic acid amplification methods or hybridization methods which marker allele is inherited together with the characteristic "spread leg".
  • a common inheritance of nucleic acids with the phenotypic expression of the "spread leg” implies a genetic one Coupling of the nucleic acid to the gene controlling the characteristic and also identifies which marker allele is located on the same chromosome as the allele involved in the phenotypic expression of the "spread-leggedness" of the defect gene, ie in which coupling phase there are marker locus and defect locus.
  • markers are microsattelites on Chromosome 5 of the pig or in a homologous position in the genome of other mammals / poultry, specifically in the area of the microsatellites Sw1468, Sw2, Sw1200, Sw2425, Sw995, IGF1, S0005, Sw963, Sw1987, S0018, Sw904, Sw310, Swr1974, Swr426, Sw1094, Sw986 or Sw1982; or on chromosome 11 of the pig or in a homologous position in the genome of other mammals / poultry, namely in the range of microsatellites S0182, S0071, Sw2008, Sw435, S0009, S0230 or Sw486:
  • you can also other nucleic acid sequences can be used as markers, provided that they are identical or essentially in the sense of the invention are identical with the second nucleic acid disclosed in the invention or in one of the above-mentioned nucleic acid regions.
  • the invention further relates to a kit containing at least one pair of primers for the amplification of the second nucleic acid, one primer each binding to the + strand and another primer to the - strand of this nucleic acid; or a hybridization probe with a length of at least 8 nucleotides that binds to the second nucleic acid; or an antibody or an antibody fragment or an antibody derivative or an aptamer that specifically binds the first or second nucleic acid.
  • PCR-based kits contain a pair of primers for the amplification of one of the above-mentioned second nucleic acids.
  • Primers are those nucleic acids that are at least 8 nucleotides in length and bind to one of the second nucleic acids disclosed above.
  • Preferred primers have a length of at least 8 nucleotides, preferably at least 15 nucleotides, more preferably at least 20 nucleotides, even more preferably a length of at least 30 nucleotides, most preferably a length of at least 50 nucleotides.
  • the nucleotide sequences of the primers can be combined as desired from the second nucleic acid sequences disclosed above, provided that they have at least 8 consecutive nucleotides.
  • a primer should have at least 7 nucleotides identical to the target sequence within 8 neighboring nucleotides.
  • the invention also includes those embodiments in which 4, 5 or 6 of the 8 nucleotides are identical to the corresponding sequence of the second nucleic acid.
  • Kits based on hybridization methods contain a hybridization probe.
  • the hybridization probe can be up to 50 nucleotides long, more preferably up to 100 nucleotides, even more preferably up to 1000 nucleotides, and most preferably up to 5000 nucleotides or longer.
  • the hybridization probe is preferably a radioactively labeled nucleic acid or it contains modified nucleotides.
  • Kits for the detection of nucleic acids on ELISA, RIA, RIPA or similar basis contain a specific antibody or an antibody fragment or an antibody derivative or an aptamer. Antibodies or antibody fragments or antibody derivatives or aptamers are specifically directed against the first or second nucleic acid. Common detection methods in which the kits are used are e.g. ELISA or RIPA but also immunofluorescence and other detection methods. Immunological detection methods and methods for generating specific antibodies are known from the prior art.
  • the components of the kit can be packaged in containers such as Vials, optionally also in buffers and / or solutions. Optionally, one or more of the components can be packaged in the same container. Additionally or alternatively, one or more components can be absorbed onto a solid support, e.g. on nitrocellulose filters, nylon membranes, or on the well of a microtiter plate.
  • Figure 1 Female, combined and male coupling map of chromosome 3. The distances between the loci are given in cM (Kosambi).
  • FIG. 2 Female, combined and male coupling map of chromosome 5. The distances between the loci are given in cM (Kosambi).
  • FIG. 3 Female, combined and male coupling map of chromosome 11. The distances between the loci are given in cM (Kosambi).
  • Figure 4 Information content of the marker loci on chromosome Sscr 3.
  • Figure 5 Information content of the marker loci on chromosome Sscr 5.
  • Figure 7 Course of the test statistics (% 2) and the probability of error ( ⁇ - comparisonwise) along the positions in cM (Kosambi) of the chromosome Sscr 3.
  • Figure 10 Course of the test statistics ( ⁇ 2 ) and the probability of error ( ⁇ - comparisonwise) along the positions in cM of chromosome 3
  • Figure 11 Course of the test statistics ( ⁇ 2 ) and the probability of error ( ⁇ - comparisonwise) along the positions in cM of chromosome 5
  • Figure 12 Course of the test statistics ( ⁇ 2 ) and the probability of error ( ⁇ - comparisonwise) along the positions in cM of chromosome 11
  • Example 1 Gender determination and typing results of the microsatellites
  • tissue samples of the sows were in the form of a piece of the ear cartilage with a total weight of approx. 30 mg each. Approx. 1.5 cm long, cropped tail ends were present from the spreader offspring, from which 20 to 30 mg each were separated.
  • the tissue samples were stored in 1.5 ml Eppendorf reaction vessels at 23 ° C.
  • the genomic DNA was extracted from the ear cartilages and tail ends according to a protocol and with the Puregene application package (Gentra Systems). For this purpose, approximately 30 mg of tissue were separated off with a sterile scalpel and 600 ⁇ l of extraction buffer (Gentra Systems) and 1 ⁇ l of proteinase K solution were added to digest the cell membrane and shaken up. The samples were then incubated at 55 ° C. overnight.
  • RNA was eliminated by adding 1 ⁇ l RNAse (10 mg / ⁇ l) with subsequent shaking and a further incubation at 37 ° C. for 30 min.
  • RNAse 10 mg / ⁇ l
  • the supernatant was decanted and swirled into 600 ⁇ l isopropanol (100%) until a DNA pellet became visible.
  • the DNA obtained was assessed qualitatively on a 0.8% agarose gel.
  • the electrophoretic separation was carried out for approx. 30 min at 10 V / cm.
  • the gels were then photographed under UV light and compared with one another.
  • the quality of the DNA isolated was determined by the degree of fragmentation of the bands obtained.
  • the concentration and purity of the DNA was determined photometrically at 260 nm and 280 nm (SAMBROOK et al., 1989). Before the measurement, the DNA was bidistilled. Diluted water 1:50. The concentration was determined using the formula: [(OD260 x 50 ⁇ g / ml) x dilution factor] and the purity using the formula: [OD260 / OD280].
  • the DNA dissolved in Tris-HCl was adjusted to a uniform 100 ng / ⁇ l.
  • the dissolved DNA was stored at 23 ° C. in 1.5 ml Eppendorf reaction vessels.
  • aliquots of the samples were transferred into 96 deepwell plates using a pipetting robot, corresponding to the organization of the samples on the gels, and diluted with Tris-HCl, so that a DNA concentration of 8 ng / ⁇ l was reached.
  • 5 ⁇ l, corresponding to 40 ng DNA were aliquoted per sample from the Deepwell plates into 96-well PCR reaction vessels. This was followed by a desiccation of the dissolved DNA thus presented for about 3 hours at 50 ° C. in a drying cabinet.
  • the dehydrated DNA was stored for about 6 weeks at room temperature.
  • the multiplex PCR for the amplification of the gene products was carried out with 5 ⁇ l of DNA (6 ng / ⁇ l) dissolved in buffer (Tris-HCl, pH 8.5).
  • the reaction started consists in detail of 50 mM KCI, 1, 5 mM MgC ⁇ 2, 10 mM Tris-HCl (pH 9.0), 200 ⁇ M dNTP, 0.1 ⁇ M per primer and 0.8 U Taq polymerase.
  • the PCR was started at 3 ° C at 94 ° C, followed by 35 cycles consisting of 20 seconds at 94 ° C, 40 seconds at 61 ° C and 45 seconds at 72 ° C. An extension was carried out for 10 min at 72 ° C.
  • the fragments were displayed in a 3% agarose gel with 0.5 ⁇ TBE buffer. 10 ⁇ l of the mixture of 10 ⁇ l PCR product and 2 ⁇ l loading buffer were pipetted into each gel pocket. The electrophoresis at 10 V / cm took 35 to 40 minutes. The agarose gels were then photographed on a transilluminator in UV light. The fragment lengths were classified by comparison with a simultaneously separated standard marker (0X174 / H / nfl). Two bands (163 and 445 bp) were seen in each male tested, only the control band (445 bp) in females.
  • PCR polymerase chain reaction
  • the standard reaction batch for the PCR was 10 ⁇ l and consisted of:
  • the indices A, B and C stand for the quantity ratios that are kept variable in the standardized approach.
  • the components contained in the PCR buffer (Pharmacia, USA) are shown under A in simple concentration.
  • the amount of primer (B) and the units of Taq polymerase (C) used also varied; the concentrations and amounts selected are listed in Tables 2 and 3.
  • the optimal PCR conditions with regard to the annealing temperature, the number of cycles, the amount of primer, the amount of PCR buffer used and the required units of Taq polymerase were determined via primer optimization. This was usually done using a test in which three microsatellites were selected with regard to their reaction conditions and each microsatellite was amplified separately. In parallel, these were combined in three duplex reactions and in one triplex reaction. This resulted in a number of seven PCR batches that were processed at the same time, distributed over four DNA templates each and simultaneously amplified in the thermal cycler.
  • Table 2 Multiplex groups and PCR conditions of the microsatellite loci used.
  • Table 3 PCR conditions of separately amplified microsatellite loci
  • urea 18 g were dissolved in 17 ml of water, 12 ml of 5 ⁇ TBE buffer and 7.5 ml of acrylamide / bis solution 30% (29: 1). The solution was then filtered in a cellulose acetate filter and degassed using a water jet pump. The gel was poured immediately after the addition of 20 ⁇ l TEMED and 300 ⁇ l 10% ammonium peroxodisulfate solution, free of air bubbles using a syringe. This was followed by a polymerization time of at least one hour, after which the gel was installed in the sequencer and the buffer chambers were filled with 1 ⁇ TBE buffer.
  • the gels were 0.2 mm thick, the distance between the pockets into which the samples were applied and the detection unit was 36 cm. Before pouring the gel, a gel pocket comb with 96 shark teeth was placed between the glass plates. Thus there were 96 pockets per gel for the application of the samples. PREPARATION OF THE SAMPLES Depending on the combinability of the microsatellites, the products of up to four PCRs, corresponding to up to seven microsatellites, were applied simultaneously. From the PCR products to be determined, 1 to 4 ul with 10 ul loading buffer, which was mixed with internal length standards, mixed and denatured for 4 min at 95 ° C. After the mixture had cooled (RT), the gel was loaded with 1 ⁇ l of the samples per lane with a special eight-fold pipette.
  • the PCR products were separated electrophoretically in denatured form in vertically attached polyacrylamide gels and detected automatically.
  • the ABI PRISM 377 DNA Sequencer was used. If a fluorescence-labeled DNA fragment hits the area of the laser, it is excited to emit fluorescent radiation.
  • the light signals generated are prismatically split in a concave mirror, recorded by a camera and stored as a digital signal.
  • the sequencer offered the possibility to change the temperature control, as well as variable separation systems with different separation distances and running speeds.
  • the parameters used for the electrophoresis were 3000 V, 50 W and 60 mA at a gel temperature of 51 ° C.
  • microsatellite fragments were detected with a laser strength of the argon laser of 40 mW.
  • Four dyes were analyzed simultaneously per lane: 6Fam-, Tet- and Hex-labeled primers.
  • a primer labeled with Tamra was used for the internal standard fragments.
  • the odd gel pockets were first loaded, the electrophoresis was started for 5 min so that the samples could run into the gel, then the even pockets were loaded and the run started.
  • the duration of the electrophoresis varied between 3 and 5 hours depending on the expected size of the fragments.
  • An internal length standard was used to determine the fragment lengths of the applied PCR products. This standard was produced by amplifying fragments of the vector pGEM-4Z at defined lengths by means of the PCR. An external standard was given by an animal that remained unchanged on all gels and was typed with the same markers as the examined population. This so-called - Golden Standardie was used to compare the four family gels with each other.
  • the polyacrylamide gels were evaluated using the GeneScan 3.0 and Genotyper 2.1 (Applied Biosystems) evaluation programs. The GeneScan program made it possible to analyze the entire gel image. It was checked manually whether the detected fragments were assigned to the correct lanes, if necessary a correction was made. Furthermore, traces that run into one another could be excluded from further analysis at an early stage. Electropherograms were generated with the Genotyper 2.1 software and visually evaluated in the form of a table after the data had been output.
  • the sex of the spreading piglets was determined genetically by means of a multiplex-PCR.
  • a Y chromosome-specific product of the SRYB gene was detected in 173 of 246 piglets examined.
  • the gender was subsequently changed from male to female. This was done against the background that when analyzing microsatellites in the non-pseudoautosomal region of the sex chromosomes it was expected a priori that male animals would behave as if they had a zero allele because they only have one X chromosome.
  • For the two offspring from six non-pseudoautosomal markers each four times - a heterozygous genotype was determined at different loci. The change occurred on the basis of this observation.
  • Table 4 Number of typed microsatellites and heterozygous loci per family
  • microsatellites Two microsatellites were typed, for which all eight boars were homozygous. These were Sw749 on Sscr 9 and S0355 on Sscr 15. At nine genotyped microsatellites were excluded from the analysis due to typing errors. No null alleles have appeared on the autosomes in this study. In all six microsatellites in the non-pseudoautosomal region, the males were, as expected, homozygous. Accordingly, the X-chromosomal microsatellites Sw707, Sw980, Sw2470, Sw2476, Sw2534 and Sw2588 were assigned an allele marked by - 10, which was therefore considered to be undetectable. A pedigree check was carried out successively taking into account all typing results. Only seven piglets were identified, which could not be assigned to any of the examined boars and were excluded from further analysis.
  • the fragment lengths were determined partially automatically. After the electronic output in the form of a table, each allele was visually checked. The fragment lengths of the microsatellites were between 71 and 326 bp. The smallest distance between the alleles was 1 bp. The number of alleles on the 133 loci of the autosomes varied between 2 and 11, with an average of 5.2 per microsatellite. Nine microsatellites were typed on the gonosomes, three in the pseudoautosomal region, with an average of 5.3 alleles per locus. The six microsatellites in the non-pseudoautosomal region had an average of 3.1 alleles. The observed degrees of heterozygosity (total Hb, boar, sows), the underlying number of genotyped parents and the number of alleles per locus are shown in Table 5.
  • Table 5 Number of typed parent animals (n), number of alleles and observed degree of heterozygosity (Hb) (Hb boar, sows, total) of the examined microsatellite loci
  • Example 2 Marker cards and information content of the marker loci
  • CRI-MAP uses a maximum likelihood approach and the Kosambi-
  • the co-informative meiosis was derived with the Fortran program - futurejr.
  • the co-informative meiosis always refer to the interval between two neighboring markers.
  • the genetic maps for the chromosomes Sscr 7 and 16 were created approximately because it was not possible to use the CRI-MAP 2.4 program (GREEN et al., 1990) to mark all of these
  • a coupling card for Sscr 7 and 16 was then created from these cards.
  • the eight boars were assigned a hypothetical genotype that corresponded to two non-detectable alleles.
  • the paternal allele was defined as if it behaved like a null allele.
  • the male offspring remained unchanged, since only the maternal allele was detectable anyway.
  • the typified sows also remained unchanged.
  • FIGS. 1, 2 and 3 show the female, combined and male coupling cards of the chromosomes Sscr 3, 5 and 11.
  • Table 6- position (cM) (comb.) Of microsatellites on the combined, which we i bl i chen (female.) And male (male).
  • the information content lies between the values zero and one.
  • the value one implies that the boar of the family under consideration is heterozygous and that the derivation of the paternal allele is clear for all offspring. This ideal case can hardly be achieved under practical conditions.
  • the number of coinformative meiosis shows a dependency of the information content on the number of typed microsatellites, this is particularly reflected in markers that are arranged on the edges of the chromosomes. In these, the number of coinformative meiosis to neighboring markers is lower than for centrally placed markers, so that the information content of the first and last markers on a chromosome is usually lower.
  • Table 7 Chromosome-wide mean, minimum and maximum of the information content on the coupling map
  • a non-parametric maximum likelihood method was used for the analysis of characteristic-associated haplotypes, without assumptions about the inheritance of the characteristic (REINSCH, 2002). The principle of the evaluation is explained in the following. Assuming a paternal half-sibling family and a boar heterozygous at the disease locus (alleles D, d) with two flanking markers, a distinction can be made between four different types of offspring (types 1 to 4), assuming that all offspring are informative. If only a single marker is considered under otherwise identical conditions, two types of offspring (types 5 and 6) can also be distinguished.
  • the probability of error increased continuously on both sides of the region shown for chromosome Sscr 5 in FIG. 7 (positions 25 to 95 cM), the course of the test statistics decreasing.
  • the flanking microsatellites are Sw1468 at position 74.1 cM and Sw1200 mapped at position 88.2 cM of the combined map.
  • the interval between the flanking markers was 19.5 cM.
  • the flanking markers at this position are S0182 at position 18.7 cM and S0071 at position 25.0 cM on the combined map.
  • the flanking marker interval was 6.3 cM.
  • the markers are shown below: Sw1468, Sw1200 for chromosome 5 and S0182, S0071 and S0230 for chromosome 11.
  • the identified alleles are each identified by the letters N, G and R.
  • N neutral
  • H neutral
  • G (healthy) stands for alleles that are more likely not to be affected by the spreader syndrome.
  • R (risk) stands for alleles from which there is an increased risk of being affected by the spreading syndrome.
  • chromosome 5 On chromosome 5, a total of 5 alleles (141, 145, 147, 149 and 153 bp) could be identified for the microsatellite Sw1468 in the examined population. For allele 5 (153 bp), an increased risk of contracting the spreading syndrome can be represented.
  • N neutral allele
  • R risk allele On chromosome 5, a total of 6 alleles (142, 150, 152, 154, 156 and 158 bp) for the microsatellite Sw1200 could be identified in the examined population. For the allele 154 bp, an increased risk of contracting the spreading syndrome can be represented.
  • Chromosome 11 identified a total of 4 alleles (184, 186, 188 and 191 bp) for the microsatellite S0071 in the examined population. Piglets with the first allele (184 bp) carry an increased risk of being affected by the disease "spreader".
  • N : neutral allele
  • R risk parallel
  • Table 9 Multiplex groups and PCR conditions of separately amplified microsatellite loci
  • Table 10 shows the primer sequences used for the 21 microsatellite loci examined. According to the results presented so far, the primers were fluorescently labeled at the 5 'end of the forward primer. The respective marking can be found in Table 9. Table 10: Primer sequences of the examined microsatellite loci
  • Sw310 5 cagaaggatgaatatgcaaaatg gtctttcaggcttggaggg
  • Swr426 5 cctacatatg ccg caggtg gtgtcttgagaagtggggaagggactc
  • Table 12 Chromosome, maximum of the test statistic ( ⁇ 2 ), point-by-point probability of error ( ⁇ -comparisonwise), position (cM) and derived LOD score
  • flanking chromosome area around the marker Sw1200 has a significant influence even after the inclusion of the new typing results.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne l'utilisation d'un premier acide nucléique pour déterminer la prédisposition d'un mammifère/d'une volaille à exprimer ou transmettre le phénotype de l'hypoplasie myofibrillaire. Selon l'invention, ce premier acide présente une longueur d'au moins 8 nucléotides et est identique ou quasi-identique à un second acide nucléique présent sur le chromosome 5 du porc ou dans une position homologue dans le génome d'autres mammifères/volailles, à savoir dans la zone des microsatellites Sw1468, Sw2, Sw1200, Sw2425, Sw995, IGF1, S0005, Sw963, Sw1987, S0018, Sw904, Sw310, Swr1974, Swr426, Sw1094, Sw986 ou Sw1982, ou sur le chromosome 11 du porc ou dans une position homologue dans le génome d'autres mammifères/volailles, à savoir dans la zone des microsatellites S0182, S0071, Sw2008, Sw435, S0009, S0230 ou Sw486. Cette invention se rapporte en outre à un procédé permettant de déterminer la prédisposition de mammifères/volailles à exprimer ou transmettre le phénotype de l'hypoplasie myofibrillaire.
EP03769374A 2002-10-11 2003-10-10 Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente Withdrawn EP1549766A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP03769374A EP1549766A1 (fr) 2002-10-11 2003-10-10 Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP02022810 2002-10-11
EP02022810 2002-10-11
PCT/EP2003/011269 WO2004035820A1 (fr) 2002-10-11 2003-10-10 Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente
EP03769374A EP1549766A1 (fr) 2002-10-11 2003-10-10 Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente

Publications (1)

Publication Number Publication Date
EP1549766A1 true EP1549766A1 (fr) 2005-07-06

Family

ID=32103879

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03769374A Withdrawn EP1549766A1 (fr) 2002-10-11 2003-10-10 Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente

Country Status (3)

Country Link
EP (1) EP1549766A1 (fr)
AU (1) AU2003278069A1 (fr)
WO (1) WO2004035820A1 (fr)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0012860D0 (en) * 2000-05-27 2000-07-19 Roslin Inst Edinburgh Assay

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ROHRER G A ET AL.: "A comprehensive map of the porcine genome", PCR METHODS AND APPLICATIONS, vol. 6, 1996, COLD SPRING HARBOR, NY, US, pages 371 - 391, XP002193166 *
ROHRER G A ET AL.: "A MICROSATELLITE LINKAGE MAP OF THE PORCINE GENOME", GENETICS, vol. 136, 1994, AUSTIN, TX, US, pages 231 - 245, XP000601919 *
See also references of WO2004035820A1 *

Also Published As

Publication number Publication date
WO2004035820A1 (fr) 2004-04-29
AU2003278069A1 (en) 2004-05-04

Similar Documents

Publication Publication Date Title
DE69434314T2 (de) Polymorphismus von mononukleotiden und ihre verwendung in der genanalyse
DE69620791T2 (de) Verfahren zur auswertung polymorpher genetischer sequenzen, und dessen gebrauch zur bestimmung von hla-typen
DE69105959T2 (de) Verfahren zur unterscheidung von nukleinsäuren auf basis von nukleotidverschiedenheiten.
AU581582B2 (en) Dna probes to fingerprint genomes at hypervariable or minisatellite regions
DE3789679T2 (de) Genetische Sonden.
DE68926784T2 (de) Verfahren zur charakterisierung von hla dp
US9856531B2 (en) Methods and compositions for genetically detecting improved milk production traits in cattle
DE69003477T2 (de) Verfahren zum Nachweis von Nucleinsäuren.
DE69231615T2 (de) Genetische marker für die grösse eines ferkelwurfes
DE19911130A1 (de) Verfahren zur Identifikation chromosomaler Regionen und Gene
DE602005002496T2 (de) Identifizierung des Gens und der Mutation für die fortschreitende Degenerierung der Sinneszellen (Stäbchen und Zapfen) in der Netzhaut von Hunden und Testmethoden
KR102124652B1 (ko) 개의 불안장애 조기 예측 또는 진단용 조성물
US5674687A (en) Method for identifying the species origin of a DNA sample
DE102017124998B3 (de) Verfahren und Vorrichtung zur Bestimmung der Blutgruppe einer Katze im AB-Blutgruppensystem
EP1960537A1 (fr) Procede de determination du genotype a partir d'un echantillon biologique qui contient des acides nucleiques provenant de differents individus
DE10105056A1 (de) Verfahren und Kit zur tierartspezifischen DNA-Indifikation in einer Probe
EP0342717A2 (fr) Sondes polynucléotides
EP1549766A1 (fr) Marqueurs genetiques servant a diagnostiquer l'expresion du phenotype de l'hypoplasie myofibrillaire chez des animaux domestiques, des animaux de reproduction et des animaux de rente
EP1537246B1 (fr) Procédé d'amplification d'informations génétiques utilisant des oligonucléotides se liant aux sites multiples dans le génome
DE69608462T2 (de) Mikrosatellitensequenzen zur bestimmung des genotyps von hunden
EP1630236A2 (fr) Régions génétiques associées aux hernies inguinales ou scrotales
EP3103882B1 (fr) Procédé de diagnostic génétique d'un risque de dyslexie
Bredbacka et al. Microsatellite panels suggested for parentage testing in cattle: informativeness revealed in Finnish Ayrshire and Holstein-Friesian populations (Research Note)
Mahrous et al. Genetic variations between horse breeds using RAPD markers
WO2004020663A2 (fr) Marqueurs genetiques permettant de diagnostiquer la predisposition a l'heredite ou a l'expression du phenotype d'imperforation de l'anus chez des animaux de compagnie, domestiques et d'elevage

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050202

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20061221

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20091007