EP1539957A1 - Nouvelles methodes de diagnostic et de therapie et reactifs correspondants - Google Patents

Nouvelles methodes de diagnostic et de therapie et reactifs correspondants

Info

Publication number
EP1539957A1
EP1539957A1 EP03793494A EP03793494A EP1539957A1 EP 1539957 A1 EP1539957 A1 EP 1539957A1 EP 03793494 A EP03793494 A EP 03793494A EP 03793494 A EP03793494 A EP 03793494A EP 1539957 A1 EP1539957 A1 EP 1539957A1
Authority
EP
European Patent Office
Prior art keywords
protein
edd
complex
seq
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03793494A
Other languages
German (de)
English (en)
Other versions
EP1539957A4 (fr
Inventor
Colin Watts
Darren Saunders
Michelle Henderson
Jennifer Clancy
Susan Henshall
Robert Sutherland
Philippa O'brien
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Garvan Institute of Medical Research
Original Assignee
Garvan Institute of Medical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2002951346A external-priority patent/AU2002951346A0/en
Application filed by Garvan Institute of Medical Research filed Critical Garvan Institute of Medical Research
Publication of EP1539957A1 publication Critical patent/EP1539957A1/fr
Publication of EP1539957A4 publication Critical patent/EP1539957A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93—Ligases (6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/9015—Ligases (6)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • This invention relates to novel methods of detecting or treating aberrant cell cycle regulation associated with expression of a nuclear protein encoded by a gene that is linked to map position 8q22.3 of the human genome, and to novel reagents that are useful therefor. More particularly, the invention relates to novel nucleic acid and proteinaceous probes, including antibodies, for detecting a gene that is linked to map position 8q22.3 of the human genome or the expression products thereof, wherein expression or elevated expression of said gene is associated with the appearance or occurrence of tumors associated with cancer, DNA damage and progesterone-receptor-mediated effects on cells. The invention also relates to reagents and methods for targeting the expression products (e.g.
  • the invention relates to reagents and methods for detecting or modulating the expression products (e.g. mRNA, protein, or protein- protein complexes) of the gene, such as, for example, in the diagnosis or treatment of cancer, DNA damage or progesterone receptor-mediated effects on cells.
  • this invention relates to a variant of a gene that is linked to map position 8q22.3 of the human genome and to novel reagents and methods for detecting said variant.
  • nucleotide and amino acid sequence information prepared using Patentln Version 3.1 , presented herein after the claims.
  • Each nucleotide sequence is identified in the sequence listing by the numeric indicator ⁇ 210> followed by the sequence identifier (e.g. ⁇ 210>1 , ⁇ 210>2, ⁇ 210>3, etc).
  • the length and type of sequence (DNA, protein (PRT), etc), and source organism for each nucleotide sequence are indicated by information provided in the numeric indicator fields ⁇ 211>, ⁇ 212> and ⁇ 213>, respectively.
  • Nucleotide sequences referred to in the specification are defined by the term "SEQ ID NO:", followed by the sequence identifier (eg. SEQ ID NO: 1 refers to the sequence in the sequence listing designated as ⁇ 400>1 ).
  • nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.
  • derived from shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.
  • hyperproliferative disorders involve unregulated cell division, suggesting an association with aberrant cell cycle regulation.
  • Aberrant signal transduction is associated with aberrant cell cycle regulation and the occurrence of hyperproliferative disorders such as cancer, and DNA damage.
  • cell cycle progression is halted through the control of critical cell cycle regulators.
  • Genomic damage if left unrepaired, can lead to malignant transformation, or cell death by senescence (aging), necrosis or apoptosis.
  • steroid hormones generally involves signal transduction cascades involving translocation of hormone receptors from the cytoplasm to the nucleus, thereby effecting many cellular and tissue functions.
  • Progesterone a 4- pregnene-3,20-dione derived from cholesterol, is a critical component of the female reproductive cycle, wherein oscillations in the serum plasma levels of progesterone during each cycle of ovulation help to mediate biochemical and molecular activity in target tissues and result in anatomical and morphological changes.
  • the molecular target of progesterone is the intracellular progesterone receptor (PR).
  • PR is present in the cytoplasm in a heterocomplex comprising several other proteins and factors termed the PR heterocomplex (PRC).
  • the PR is maintained in an inactive form by molecular chaperones, immunophillins, and heat shock proteins (hsp70, hsp90, hsp27, and p59 (hsp56), p48 and p23; Johnson et al., Mol Cell Biol 14, 1956-1963, 1994).
  • Active PR binds progesterone and translocates to the nucleus where it binds as a transcription factor to canonical DNA transcriptional elements present in progesterone-regulated genes.
  • Progesterone-regulated genes have also been implicated in differentiation and in the cell cycle (Moutsatsou and Sekeris, Ann NY Acad Sci 816, 99-115, 1997) and certain cancers.
  • the assembly of the PRC in vitro involves an ordered interaction between PR and at least eight components.
  • hsp70 binds to the PR and prevents interaction with its ligand; and hsp90 prevents intranuclear translocation by PR in the absence of progesterone (Kang et al., Proc Natl Acad Sci 91, 340-344, 1994).
  • Chemical modification of hsp70 and hsp90 causes release of PR.
  • Other signals may affect the interactions of hsp90 with p23.
  • Arrest of PRC assembly in vitro may be blocked by the selective hsp90 binding agent geldanamycin (GA).
  • Ubiquitin-mediated proteoloysis is required for the regulation of many key cellular pathways including the control of cell cycle progression (King et al., Science 274,
  • proteins having the HECT domain of E6-AP and related proteins form a sub-class of ubiquitin-protein ligases (E3 enzymes) that are involved in the ubiquitinylation cascade that catalyzes the covalent attachment of ubiquitin to a substrate protein, thereby targeting the substrate protein for proteolytic degradation.
  • E3 enzymes ubiquitin-protein ligases
  • the enzymes comprising a HECT domain reversibly bind ubiquitin via a consented cysteine residue within the HECT domain, and directly transfer ubiquitin to the substrate protein (Scheffner et al., Nature 373, 81-83, 1995).
  • ⁇ dd' a progestin- induced gene that is linked to map position 8q22.3 of the human genome
  • EDD protein The biochemical properties of in vitro translated EDD protein provide evidence that it is a human E3 enzyme (Callaghan et al, Oncogene 17, 3479-3491 , 1998) however there are no defined cellular substrates for the protein. The sub-cellular location of the EDD protein is also unknown. Notwithstanding that the progestin- responsiveness of Edd gene expression indicates a general role for EDD protein in progestin-mediated signal transduction pathways or progestin-responsive tumorigenesis, no clear indication of specific proteins that bind to EDD in such pathways has emerged. Nor has there been any indication of specific expression patterns of the Edd gene, or mutations at the Edd locus, that might be involved in mediating such effects. Nor has the Edd gene been implicated in non-progestin mediated cellular effects.
  • the inventors sought to elucidate the role of the EDD protein by looking at the expression patterns of the Edd gene in various tumors, and by determining substrates for the EDD protein in cells, and by targeting Edd gene expression in a murine model and by using inhibitory RNA approaches in human cell lines.
  • elevated Edd gene expression is associated with tumorigenesis in progestin-responsive and progestin-non-responsive tumorigenesis, and that, by reducing or inhibiting Edd gene expression, cellular is inhibited.
  • this effect on proliferation is an effect on apoptosis. Effects on cell proliferation and apototic effects on cells as mediated by EDD are closely linked.
  • the inventors have also identified many nuclear protein substrates of the EDD protein using yeast two hybrid screens which are involved in progesterone- mediated signal transduction, tumor suppression or DNA damage. Given the key role of the Edd gene expression in the control of cellular proliferation, these data provide highly specific means for identifying aberrant cell cycle regulation and downstream effects such as hyperproliferative disorders. The protein-protein interactions also provide highly specific means for determining compounds that modulate the cell cycle.
  • one aspect of this invention provides methods for detecting a cancer cell in a subject, said method comprising determining the level of nucleic acid that is linked to map position 8q22.3 of the human genome or an expression product thereof in a sample of said subject, wherein elevated levels of said nucleic acid or said polypeptide are indicative of cancer in the subject.
  • the present invention provides a method for detecting a cancer cell in a subject, said method comprising:
  • the invention provides a method for detecting allelic imbalance in a region of the human genome comprising hybridizing a nucleic acid probe or primer to genomic DNA and detecting the hybridization, wherein the probe or primer comprises a nucleotide sequence selected from the group consisting of: (i) the sequence set forth in SEQ ID NO: 5; (ii) the sequence set forth in SEQ ID NO: 6; (iii) the sequence set forth in SEQ ID NO: 7;
  • the present invention provides a method for detecting a cancer cell in a subject, said method comprising:
  • the present invention provides a method for diagnosing a cancer or predicting recurrence of a cancer in a subject comprising determining the level of mRNA or protein encoded by nucleic acid linked to map position 8q22.3 of the human genome in a sample of said subject, wherein an elevated level of said mRNA or protein is indicative of relapse of a cancer in said subject.
  • the mRNA encoded by a nucleic acid linked to map position 8q22.3 of the human genome encodes an EDD protein.
  • the mRNA comprises the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3 or a fragment thereof.
  • the mRNA encodes a protein comprising the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or a fragement thereof.
  • the protein encoded by a nucleic acid linked to map position 8q22.3 of the human genome is an EDD protein.
  • the protein encoded by a nucleic acid linked to map position 8q22.3 of the human genome comprises the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or a fragment thereof.
  • a further aspect of the present invention relates to novel nucleic acid probes for detecting a cancer in accordance with the embodiments described herein.
  • a further aspect of the present invention provides an isolated or recombinant protein complex comprising:
  • a nuclear protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein, and a protein associated with vascularization or a portion of said protein sufficient to bind to said EDD protein or said portion of an EDD protein.
  • Additional embodiments of the present invention provides isolated peptides, polypeptides, antibodies and other ligands that bind to an EDD-containing protein complex of the invention, and kits comprising same for producing the protein complex, or for identifying a modulator of a biological interaction between EDD or a portion of EDD and one or more other polypeptides selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein, and a protein associated with vascularization, or a portion thereof.
  • Another embodiment of the present invention provides methods for isolating a EDD binding protein or a complex comprising same from a suitable cellular source.
  • the invention provides methods for producing a protein complex described herein by recombinant means.
  • a protein-encoding nucleotide sequence is placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in a cell-free system or cellular system.
  • Another embodiment of the present invention provides prognostic and diagnostic methods for determining a predisposition for disease, or a disease state, said methods comprising detecting a protein complex comprising: (i) an EDD protein; and
  • a nuclear protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein, and a protein associated with vascularization.
  • a further embodiment of the present invention provides methods for determining a modulator of the activity, formation or stability of an isolated or recombinant protein complex comprising:
  • an EDD protein or a portion of an EDD protein sufficient to bind to a protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein, and a protein associated with vascularization; and (ii) a nuclear protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein, and a protein associated with vascularization or a portion of said protein sufficient to bind to said EDD protein or said portion of an EDD protein.
  • the present invention provides a method for treating a condition associated with elevated expression of an EDD protein in a cell, said method comprising administering an amount of a compound effective to reduce the level of EDD expression or the level of an EDD expression product (e.g. a protein complex comprising an EDD protein) in a cell.
  • a compound effective to reduce the level of EDD expression or the level of an EDD expression product (e.g. a protein complex comprising an EDD protein) in a cell.
  • this invention relates to a variant of a gene that is linked to map position 8q22.3 of the human genome and to novel reagents and methods for detecting said variant.
  • FIG. 1 A. Allelic imbalance in several cancer types showing Al at the EDD locus (8q22.3) but not extending continuously to 8q24. Key: • allelic imbalance, probable • allelic imbalance, Oheterozygote, Duninformative homozygote, gap denotes no data available. Position of polymorphic microsatellites were identified from the Genome Data Base (GDB) (http://gdbwww.gdb.org/). Microsatellites CEDD and 586F18b are encoded in introns of EDD. The EDD gene is located at 8q22.3 (Callaghan et al, Oncogene 14, 3479-3491 , 1998) and MYC at 8q24.12 (GDB). B.
  • GDB Genome Data Base
  • Figure 3 mRNA expression of EDD in breast cancers, normal breast tissue and breast epithelial cell lines.
  • FIG. 4 EDD protein expression in breast and ovarian cancers. Tissues were stained with a polyclonal EDD antibody and counterstained with haematoxylin.
  • A negative control, neural tissue from an EDD-null mouse embryo (neural epithelium [NE], neural mesenchyme [NM]).
  • FIG. 1 Schematic diagram of EDD and its derivatives used for mammalian expression, yeast two hybrid analysis or in vitro translation.
  • the UBA domain, three putative nuclear localisation sequences (NLS), a HECT domain and domains with homology to N-recognin zinc finger (zf-UBR1 ) or the carboxy region of polyA-binding protein (PABP-C) are indicated.
  • the positions of potential steroid receptor binding motifs (LXXLL) are indicated by asterisks. Numbers indicate amino acid positions of fragment breakpoints.
  • the conserved cysteine within the HECT domain (Cys 2768) is mutated to alanine (X) in fragments EDDM, EDD3M and EDD5M.
  • a cysteine-rich domain shows similarity to D.melanogaster Calossin (dCALO) and Arabidopsis thaliana BIG proteins and has a similar arrangement of conserved cysteine and histidine residues (boxed) as the zinc finger region first identified in N-recognin.
  • N-recognin sequences shown are from yeast (scUBRI) and mouse (mUBR1). Identical residues are designated by dark shading and conservative substitutions by lighter shading.
  • A Interaction of EDD with importin ⁇ 5 in a yeast two-hybrid assay.
  • the entire coding sequence of EDD was fused in-frame with the yeast GAL4 DBD.
  • This construct or control vector pAS2.1 was co-expressed with either control vector (pACT2) or the GAL4 AD-importin ⁇ constructs encoding aa 1-538 (Imp ⁇ ) or 229- 538 (Imp ⁇ -C) in diploid yeast strain CG1945/Y187.
  • Protein extracts were prepared from cultures of 6 independent colonies and assayed in duplicate for ⁇ - galactosidase activity (expressed as fold increase over pAS2.1 vector control).
  • B-C In vitro interaction of importin ⁇ with EDD and mapping of interaction.
  • EDD In vitro translated 35 S-labelled EDD
  • C EDD fragments
  • B In vitro translated 35 S-labelled EDD
  • C EDD fragments
  • D Interaction of EDD with importin ⁇ in HEK 293 and T-47D cells.
  • HEK 293 cells were stably transfected with a plasmid encoding full length EDD protein (293/EDD).
  • Extracts from these cells or T-47D cells were subjected to immunoprecipitation with anti-importin ⁇ 5 antibody (middle panel) or incubated with either GST or GST-importin ⁇ 5 fusion protein bound to glutathione- Sepharose beads (right panel). Bound proteins from both procedures were separated by SDS-PAGE and western blotted for EDD.
  • E Mapping interaction between importin ⁇ and individual NLSs of EDD. In vitro translated 35 S-Iabelled EDD derivatives from the N-terminal region were incubated with GST-importin ⁇ 5 or with GST alone bound to glutathione- Sepharose beads. Bound EDD was detected by SDSPAGE and autoradiography.
  • EDD is a nuclear protein.
  • EDD-GFP EDD-GFP in mammalian cell lines (x40 magnification).
  • EDD cDNA was fused to the amino-terminus of green fluorescent protein (GFP) and transiently transfected into HEK 293 (left panel) or MCF-7 cells (right panel). Transfected cells are indicated by arrowheads on bright field images. While diffuse cellular staining was observed with GFP alone, strong nuclear GFP fluorescence was observed for EDD-GFP in both cell lines.
  • GFP green fluorescent protein
  • FIG. 9 Enhancement of nuclear receptor transactivation activity by EDD. Luciferase activity was corrected for cell number and transfection efficiency where appropriate (see methods) and graphed relative to the value for liganded receptor alone, which was set at 100%.
  • EDD enhances PR B transactivation activity.
  • Reporter assays were carried out using either HEK 293 (left ) or COS7 (right) cells in the presence of EDD, SRC1 or empty vector, transfection control plasmid (pGFP20) and either 1 nM of the synthetic progestin ORG2058 or equivalent ethanol vehicle (EtOH).
  • EDD enhances PR reporter gene expression in a dose dependent manner.
  • HEK 293 cells were transfected for a standard reporter assay along with increasing amounts of a constitutive expression vector for either EDD or empty vector (0) in the presence of 1 nM ORG2058. The amount of DNA transfected was normalised to 1.2 ⁇ g with empty vector. Cell number was monitored using proliferation assay and transfection efficiency by co-transfection with pRLTK followed by Renilla luciferase assay.
  • D Effect of EDD on response to the synthetic progestin ORG2058.
  • HEK 293 cells were transfected for reporter assay along with a transfection control plasmid (pRL-TK).
  • E Enhancement of VDR reporter gene expression by EDD.
  • HEK 293 cells were transfected with a constitutive expression vector for VDR and a VDRE- containing luciferase reporter vector along with a constitutive expression vector for EDD or empty vector and a transfection control plasmid (pRL-TK). Cells were harvested for luciferase assay following 24h treatment with 10nM 1 ,25- dihydroxyvitamin D 3 .
  • F EDD does not enhance ER reporter gene expression.
  • HEK 293 cells were transfected with a constitutive expression vector for ER and an ERE-containing luciferase reporter vector along with either a constitutive expression vector for EDD, SRC1 or empty vector and a transfection control plasmid (pGFP20). Cells were harvested for luciferase assay following 24h treatment with 100nM 17 ⁇ -estradiol.
  • HEK 293 cells overexpressing mutant EDD were transfected with a plasmid encoding Flag- tagged CIB or empty vector (vec). Extracts from these cells were subjected to immunoprecipitation using anti-FLAG Ab M2.
  • nuclear extracts prepared from MCF-7 cells following treatment with DNA damage agents phleomycin (Phleo) or hydroxyurea (HU) were incubated with either GST or GST-CIB fusion protein bound to glutathione-Sepharose beads. Bound proteins from both procedures were analysed by SDS-PAGE and western blotted for EDD and amounts bound are indicated as percentages relative to input.
  • E Potential regulation of CIB by the proteasome.
  • HEK 293 cells were treated with the proteasome inhibitor MG132 (20 ⁇ M) or vehicle (DMSO) for six hours and whole cell extracts analysed by SDS PAGE. Proteins were transferred to nitrocellulose and western blotted for importin ⁇ 5, CIB and the proteasomal target protein, p27.
  • EDD EDD
  • UBA ubiquitin-associated domain
  • NLS nuclear localisation sequences
  • HECT homologous to E6-AP carboxy terminus
  • PABP-C carboxy region of polyA-binding protein
  • LXXLL potential steroid receptor binding motifs
  • the conserved cysteine within the HECT domain (Cys 2768) is mutated to alanine (X) in fragments EDDM and EDD3M.
  • X alanine
  • SQ/TQ domain rich in ATM family kinase sites the forkhead associated (FHA) domain and kinase domain are indicated along with key residues for chk2 function. Domain boundaries are also indicated as numbers below the diagram. Also indicated is the fragment of chk2 used in pull down assays (GSTchk2-N).
  • EDD interacts with chk2-N in nuclear extracts.
  • Nuclear extracts from MCF-7 cells were incubated with either GST or GSTchk2-N fusion protein bound to glutathione-Sepharose beads. Following extensive washing, bound proteins were separated by SDS-PAGE and western blotted for EDD.
  • EDD and chk2 associate in vivo.
  • Cell lysates from HEK 293 or MCF-7 cells were subjected to immunoprecipitation with polyclonal chk2 antibody (N17). Following precipitation of immune complexes and extensive washing, bound proteins were separated by SDS-PAGE and western blotted for EDD.
  • EDD interacts with chk2 FHA domain.
  • EDD is phosphorylated in vivo.
  • HEK293 cells stably transfected with Ecdysone receptor were transfected with a vector for inducible expression of Flag- tagged EDD.
  • Expression of EDD was induced (+) by addition of ponasterone for 24 h.
  • Medium was replaced with phosphate free medium containing 32 P-labelled orthophosphate and labelling of cellular proteins allowed to proceed. Lysates were made from cells expressing (+) or not expressing (-) Flag-tagged EDD and immunoprecipitation carried out using anti-Flag antisera.
  • Radiolabelled (ie phosphorylated) EDD was detected by SDS-PAGE and autoradiography (upper panel).
  • HEK293 or MCF-7 extracts were incubated in the presence (+) or absence (-) of lambda protein phosphatase. Samples were separated by SDS-PAGE on 4.2% gels and western blotted for EDD. Removal of phosphates was indicated by a shift in the mobility of the EDD protein.
  • D The phosphopeptide-binding interface of the chk2 FHA domain is required for EDD binding.
  • In vitro translated 35 S-labelled EDD derivative EDDF5 (aa 889- 2799) was incubated with GSTchk2-N or GSTchk2-N derivatives containing R117A or I157T substitutions, or with GST alone bound to glutathione-Sepharose beads.
  • F Immunoprecipitation with CHK2 antibody from nuclear extracts of cells deficient in ATM (FTpEBS7) and a matched ATM-complemented cell line (FTYZ5). Cells were incubated in the presence or absence of phleomycin (20 ⁇ g per ml) for 4 hours, ensuring T68 phosphorylation in an ATM-dependent fashion (lower panel).
  • A MCF-7 cells were transfected with short interfering RNAs directed against GFP or EDD for 96 h. Cells were then exposed to 12 Gy ionizing radiation (IR) and harvested following 90 min recovery at 37°C. Equal amounts of protein from whole cell lysates were separated by SDS-PAGE and analysed by immunoblotting for EDD, activated CHK2 (P-T68) and total CHK2.
  • B Kinase assay of CHK2 immunoprecipitated from irradiated cell lysates using GST-cdc25C subfragment as a substrate.
  • EDD siRNA EDD siRNA
  • IR ionising radiation
  • Figure 16 The phosphopeptide-binding interface of the CHK2 FHA domain is required for EDD binding.
  • EDD and BRCA2 interact in cells. Extracts from HEK293 cells expressing Histagged EDD were subjected to immunoprecipitation with EDD antibody (AbPEPI). Following precipitation of immune complexes and extensive washing, bound proteins were separated by SDS-PAGE and western blotted for EDD (left panel) and BRCA2 (right panel).
  • B Interactions between EDD, BRCA2 and chk2 are modified in response to DNA damaging agents. Nuclear extracts from MCF-7 cells that had been cultured in the presence of the radiomimetic phleomycin or the UV mimic hydroxyurea (HU), or from control MCF-7 cells, were subjected to immunoprecipitation with polyclonal chk2 antibody (N17). Following precipitation of immune complexes and extensive washing, bound proteins were separated by SDS-PAGE and western blotted for EDD, BRCA2 or chk2.
  • FIG. 18 Targeted disruption of mouse Edd.
  • A Structure of the wild-type Edd locus (top), targeting vector (middle) and the mutated locus following homologous recombination (bottom). Edd exon 1 is indicated as a black box with the position of the ATG codon shown. BamHI restriction sites are denoted by B. Genotyping was performed by PCR using primers, 1 , 2 and 3, (arrowheads), and by Southern blot analysis with a 3' probe as shown (probe). Expected sizes of PCR products and BamHI fragments that hybridise with the probe on Southern analysis are indicated.
  • B Southern blot and PCR analysis of genomic DNA from targeted ES ceil clones.
  • E Immunohistochemistry was performed on E9.5 wild-type (left panel) and E9.5 knockout (-/-, right panel) embryo sections with a region of neural epithelium shown. Immunohistochemstry was performed with an anti-EDD antibody. .
  • FIG. 19 Morphology of wild-type and knockout (Edd ' ' ' ) embryos at E7.5 - E10.5. Photographs showing freshly dissected WT embryos (+/+) and Edd ' ' ' embryos (-/- ). As early as E7.5, Edd' ' embryos display slightly delayed development while by E8.5, clear growth retardation is obvious in Edd '1' embryos compared to WT. From E9.5 onwards the most obvious developmental defect is the small size of Edd ' ' ' embryos and the absence of turning which occurs in WT embryos around E9. In addition, many Edd' ' embryos display a bulbous allantois (a) indicating failure of placentation. Many Edd ' ' ' embryos were also observed with pericardial effusion (p).
  • Figure 20 Edd expression in developing mouse embryo. Immunohistochemical analysis of Edd expression in wt d10.5 embryo. Inset shows predominantly nuclear expression under higher magnification.
  • FIG. 21 Cell proliferation in WT and Edd ' ' embryos at E8.5 - E10.5.
  • FIG. 22 Apoptosis in WT and Edd ' ' ' embryos at E8.5 - E10.5.
  • Apoptosis was measured in embryo sections using the TUNEL assay with TUNEL positive nuclei stained brown. At E8.5, similar levels of staining can be seen in both WT (+/+) and Edd ' ' ' (-/-) embryos. At E9.5 and 10.5, Edd' ' embryos show dramatically increased levels of TUNEL staining compared to WT embryos which have very few TUNEL stained cells.
  • Active Caspase-3 staining was also performed on embryo sections to confirm TUNEL results. Percentage of caspase positive cells are shown in the corner of each panel.
  • FIG. 23 Defective vascularisation in Edd ' ' ' yolk sacs.
  • A Morphology of E9.5 - E10.5 WT (+/+) and Edd' ⁇ (-l-) yolk sacs. Ec/ ⁇ " A yolk sacs display significantly less vascularisation than their WT littermates suggesting a defect in yolk sac circulation. In addition blood pooling can be seen within Edd' ' embryos at E10.5 (b);
  • FIG. 24 High magnification view of histological sections from WT and Edd' ' yolk sacs at E9.5. Distinct vascular channels containing blood cells (b) are visible in WT yolk sac, whereas EDD-null yolk sacs display enlarged channels with unusual separation of mesoderm (m) and endoderm (e) and few blood cells.
  • FIG. 25 Western blot analysis of EDD protein expression after anti-EDD (R) or anti-GFP (C) (control) small interfering RNA transfection in MCF-7 and HEK-293 cell lines. Time after transfection is shown in hours at the bottom of the figure.
  • FIG 26 Cell morphology after RNA interference.
  • HMEC 184 cells are shown 5 days after RNA interference (left) control cells and (right) cells transfected with EDD siRNA. Cell shape has altered after depletion of EDD, cells make fewer contacts and cell organisation is disturbed. (Original magnification 100x)
  • FIG. 27 Immunofluorescence microscopy of ⁇ -catenin in HMEC 184 cells. Whereas ⁇ -catenin staining in control cells (left) was even along cell-cell contacts, cells transfected with EDD siRNA showed more patchy staining and decreased levels of ⁇ -catenin (right). Furthermore, a reduction in the number of cell-cell contacts was observed in cells transfected with EDD siRNA.
  • FIG. 28 Relocalization of ⁇ catenin after EDD RNAi transfection. Immunofluorescence microscopy of ⁇ -catenin in HMEC 184 cells shows that EDD RNAi causes ⁇ -catenin to move from the cell periphery (left, control cells) to the cell nucleus (right).
  • FIG. 29 Immunofluorescence microscopy of actin in HMEC 184 cells. Actin filaments (in control cells (left) were coordinated and continuously organised from cell to cell. Cells transfected with EDD siRNA (right) showed disorganised actin filaments, where the actin from one cell was not connected to the actin of its neighbouring cells.
  • One embodiment of this invention provides methods for detecting a cancer cell in a subject, said method comprising determining the level of nucleic acid that is linked to map position 8q22.3 of the human genome or an expression product thereof in a sample of said subject, wherein elevated levels of said nucleic acid or said polypeptide are indicative of cancer in the subject.
  • cancer cell includes any biological specimen or sample comprising a cancer cell irrespective of its degree of isolation or purity, such as, for example, tissues, organs, cell lines, bodily fluids, or histology specimens that comprise a cell in the early stages of transformation or having been transformed. Bodily fluids shall be taken to include whole blood, serum, peripheral blood mononuclear cells (PBMC), or buffy coat fraction.
  • PBMC peripheral blood mononuclear cells
  • the isolated nucleic acid inked to map position 8q22.3 of the human genome or an expression product thereof is present at elevated levels in cancer cells compared to non-cancer cells.
  • cancer cell is not to be limited by the stage of a cancer in the subject from which said cancer cell is derived (ie. whether or not the patient is in remission or undergoing disease recurrence or whether or not the cancer is a primary tumor or the consequence of metastases). Nor is the term “cancer cell” to be limited by the stage of the cell cycle of said cancer cell.
  • the cancer cell is epithelial in origin (i.e. a carcinoma).
  • the cancer cell is from a cancer selected from the group consisting of ovarian cancer, melanoma, metastatic melanoma, squamous cell carcinoma of the head and neck, squamous cell carcinoma of the tongue, hepatocellular carcinoma, breast cancer, a metastases of ovarian cancer, a metastases of melanoma, a metastases of metastatic melanoma, a metastases of squamous cell carcinoma of the head and neck, a metastases of squamous cell carcinoma of the tongue, a metastases of hepatocellular carcinoma and a metastases of breast cancer.
  • ovarian cancer shall be taken to refer any one or more of a number of cancers of epithelial origin, such as, for example, serous, mucinous, endometrioid, clear cell, papillary serous, Brenner cell or undifferentiated adenocarcinoma.
  • breast cancer shall be taken to refer to a ductal carcinoma or lobular carcinoma.
  • hepatocellular carcinoma will be understood to mean any carcinoma arising from the hepatocytes, as distinct from other types of hepatic cancer that may consist of liver metastases.
  • melanoma and “squamous cell carcinoma” will be understood to be epithelial skin cancers of the melanocytes and squamous cells, respectively.
  • Metalstatic melanoma is the most advanced stage of melanoma arising in the melanocytes and metastasizing in the lymph nodes and other organs of the body.
  • allelic imbalance in this region of the human genome was found by the inventors in 14 of 37 tumors, said allelic imbalance comprising discrete regions of imbalance comprising 8q22.3 and more extensive 8q aberrations.
  • Allelic imbalance was found by the inventors to be frequent in cases of ovarian cancer (e.g. serous subtype), hepatocellular carcinoma, squamous cell carcinoma of the tongue, breast cancer and metastatic melanoma.
  • EDD-encoding mRNA is frequently elevated in cancers such as breast cancer.
  • elevated expression of the Edd gene was associated with amplification of the Edd locus.
  • a closely linked gene in this region of the genome i.e. encoding p53 ribonucleotide reductase (p53R2), was also shown by the inventors to be overexpressed and amplified in cancer cell lines. Accordingly, this embodiment of the invention is not limited to the detection of EDD-encoding nucleic acid.
  • map position 8q22.3 of the human genome shall be taken to refer to the region of the human genome that comprises a genomic gene encoding an EDD protein and preferably having a centromeric orientation on chromosome 8 with its first exon position at about 8q23.
  • a “genomic gene” includes both protein-encoding regions (i.e. exons) and non-coding regions (i.e. 5'-upstream regulatory regions such as the promoter and 5'-untranslated region, intervening sequences or introns, and 3'- untranslated region). Accordingly, a genomic gene encoding an EDD protein includes all such features and not merely the protein-encoding portion thereof.
  • EDD protein is meant a polypeptide that comprises an amino acid sequence having at least about 80% identity to the sequence set forth herein as SEQ ID NO: 1
  • amino acid sequence set forth in SEQ ID NO: 2 relates to a first EDD protein encoded by the nucleotide sequence of SEQ ID NO: 1 as disclosed in published International Patent
  • SEQ ID NO: 4 relates to a novel EDD polypeptide encoded by a splice variant wherein 18 nucleotides of SEQ ID NO: 1 have been deleted. Accordingly, the amino acid sequence of SEQ ID No: 4 differs by the deletion of six amino acids comprising the sequence VLLLPL from SEQ ID NO: 2. Preferably, the percentage identity to
  • SEQ ID NO: 2 or 4 is at least about 90%, more preferably at least about 95%, or at least about 99%.
  • SEQ ID NO: 2 or 4 is at least about 90%, more preferably at least about 95%, or at least about 99%.
  • amino acid identities and similarities are calculated using the GAP program of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States of America (Devereaux et al, Nucl. Acids Res. 12, 387-395,1984), which utilizes the algorithm of Needleman and Wunsch J. Mol. Biol. 48, 443-453, 1970, or alternatively, the CLUSTAL W algorithm of Thompson et al., Nucl. Acids Res. 22, 4673-4680, 1994, for multiple alignments, to maximize the number of identical/similar amino acids and to minimize the number and/or length of sequence gaps in the alignment.
  • nucleic acid that is "linked to" map position 8q22.3 of the human genome will therefore be sufficiently close to a genomic gene encoding an EDD protein for the frequency of recombination between said nucleic acid and said genomic gene to indicate linkage.
  • the frequency of recombination between two markers on DNA will increase as the markers are spaced further apart until the association between the markers in a segregating population is random, at which point they are considered to be unlinked.
  • the nucleic acid that is linked to map position 8q22.3 will be tightly linked such that there is only a low degree of recombination between the nucleic acid and the genomic gene encoding an EDD polypeptide.
  • the nucleic acid will itself map to a region of the human chromosome between 8q22.3 and 8q24.13, at least comprising the genomic Edd and p53R2 genes or a portion thereof.
  • the expression product of any nucleic acid that is linked to map position 8q22.3 of the human genome is useful for the diagnosis of cancer within the context of the present invention, including the expression products of an Edd gene, or the expression product of a p53R2 gene.
  • the term "expression product” shall be taken to refer to any transcription product of a genomic gene, such as unprocessed or processed mRNA including a splice variant, or any translation product encoded by a genomic gene, such as a precursor polypeptide, processed polypeptide or a complex involving said polypeptide.
  • a protein-protein complex or DNA- protein complex comprising an EDD polypeptide is clearly within the scope of the term “expression product of an Edd gene” or similar term as used herein.
  • a protein-protein complex or DNA-protein complex comprising a p53R2 polypeptide is clearly within the scope of the term "expression product of an p53R2 gene” or similar term as used herein.
  • the diagnostic methods provided by the present invention involve a degree of quantification to determine, on the one hand, the level of nucleic acid linked to map position 8q22.3 of the human genome in tissue that is suspected of comprising a cancer cell, or, on the other hand, the level of an expression product of said nucleic acid.
  • quantification can be readily provided by the inclusion of appropriate reference samples in the assays described below, derived from healthy or normal individuals.
  • the reference sample comprises cells or tissue from the same subject taken at a time point when the individual was healthy or in remission from disease.
  • the reference sample comprises cells or tissues from a healthy or normal individual.
  • the reference sample and the test sample are both processed, albeit not necessarily at the same time, and data obtained for both samples are compared.
  • the reference sample may be derived from an established data set that has been generated from healthy or normal individuals. Accordingly, in one embodiment, the reference sample comprises data from a sample population study of healthy individuals, such as, for example, statistically significant data for the healthy range of the integer being tested.
  • the comparison of reference and test sample is performed following the analysis of the test sample and comprises a comparison of data obtained for the test sample to data obtained for the sample population.
  • the term "healthy individual” shall be taken to mean an individual who is known not to suffer from cancer, such knowledge being derived from clinical data on the individual, including, but not limited to, a different cancer assay to that described herein.
  • the present invention is particularly useful for the early detection of cancer, it is preferred that the healthy individual is asymptomatic with respect to the early symptoms associated with a particular cancer.
  • early detection using well-known procedures is difficult, however reduced urinary frequency, rectal pressure, and abdominal bloating and swelling, are associated with the disease in its early stages, and, as a consequence, healthy individuals should not have any of these symptoms. It is also preferred for such "healthy subjects" to not have a large number of risk factors associated with these diseases.
  • Indicators of the early stages of primary breast cancer or a susceptibility for developing breast cancer include, for example, familial history, atypical hyperplasia, the occurrence of benign conditions of the breast, enhanced breast density particularly in women aged 45 years and older, radiation exposure, and abnormal breast appearance.
  • Indicators of the eariy stages of primary hepatocellular carcinoma or a susceptibility for the disease include, for example, liver cirrhosis, chronic hepatitis B or hepatitis C infection, a diet high in aflatoxins, adenomatous hyperplasia, abdominal (hepatic) pain or swelling, ascites, enlargement of the spleen, hemochromatosis, alpha-1-antitrypsin deficiency, glycogen storage disease, and tyrosinemia. .
  • Indicators of the early stages of primary melanoma or squamous cell carcinoma or a susceptibility for these diseases include, for example, changes to the appearance of the skin, especially in association with prolonged exposure to the sun or radiation damage, a history of smoking or chewing tobacco, actinic keratosis, and leukoplakia.
  • subjects suffering from later symptoms associated with any one or more of these cancers such as, for example, metastases in the skin, oral cavity, pharynx, omentum, abdomen, abdominal fluid, lymph nodes, lung, liver, brain, or bone, and subjects suffering from spinal cord compression, abdominal pain or swelling, elevated calcium level, elevated serum alpha-fetoprotein level, changes in BRCA1 or BRCA2 genes or gene expression, chronic pain, or pleural effusion, should also be avoided from the "healthy individual" data set.
  • normal individual shall be taken to mean an individual having a normal level of an Edd gene expression product in a particular sample derived from said individual.
  • data obtained from a sufficiently large sample of the population will normalize, allowing the generation of a data set for determining the average level of a particular parameter.
  • the level of expression of an Ecfc/ gene product can be determined for any population of individuals, and for any sample derived from said individual, for subsequent comparison to levels of the expression product determined for a sample being assayed.
  • internal controls are preferably included in each assay conducted to control for variation.
  • the present invention provides a method for detecting a cancer cell in a subject, said method comprising: (i) determining the level of nucleic acid linked to map position 8q22.3 of the human genome in a test sample from said subject; and (ii) comparing the level of the nucleic acid at (i) to the level of the nucleic acid in a reference sample from a healthy or normal individual, wherein a level of the nucleic acid at (i) that is enhanced in the test sample relative to the reference sample from the normal or healthy individual is indicative of the presence of a cancer cell in said subject.
  • the sample comprises cells from a tissue or tissue selected from the group consisting of skin, an oral cavity tissue, breast, liver, spleen, ovary, prostate, kidney, uterus, placenta, cervix, omentum, rectum, brain, bone, lung, lymph, urine, semen, blood, abdominal fluid, and serum.
  • Cell preparations or nucleic acid preparation derived from such tissues or cells are not to be excluded.
  • the sample can be prepared on a solid matrix for histological analyses, or alternatively, in a suitable solution such as, for example, an extraction buffer or suspension buffer, and the present invention clearly extends to the testing of biological solutions thus prepared.
  • the nucleic acid that is determined according to this embodiment is genomic DNA.
  • This embodiment of the invention is therefore particularly suited to determining allelic imbalance in this region of the human genome as a diagnostic for cancer.
  • nucleic acid hybridization-based or amplification-based approaches such as, for example, microsatellite analysis, are readily adaptable to microarray technology.
  • the level of nucleic acid is determined by hybridizing a nucleic acid probe to genomic DNA encoding an EDD protein in the test sample under at least low stringency hybridization conditions and detecting the hybridization using a detection means.
  • the level of genomic DNA encoding an EDD protein in the reference sample from the healthy or normal individual is preferably determined by hybridizing the probe to genomic EDD- encoding DNA in said reference sample under at least low stringency hybridization conditions and detecting the hybridization using a detection means.
  • shorter probes are hybridized at lower stringency hybridization (ie. reduced temperature and/or higher salt concentration and/or higher detergent concentration) than longer nucleic acid probes.
  • hybridization is carried out well below the calculated melting temperature (Tm) of a DNA duplex comprising the probe.
  • Tm melting temperature
  • the oligonucleotide probes exemplified herein have calculated Tm values in the range of about 55°C to about 60°C, suggesting that hybridization involving such probes should be carried out at a temperature in the range of ambient temperature to about 45°C, and more preferably between about 40°C to about 45°C (ie. low stringency to moderate stringency conditions). This contrasts with standard hybridization temperatures of about 65°C for nucleic acid probes of about 100 nucleotides or longer (ie. moderate to high stringency hybridization conditions).
  • a low stringency is defined herein as being a hybridization and/or a wash carried out in 6xSSC buffer, 0.1% (w/v) SDS at 28°C, or equivalent conditions.
  • a moderate stringency is defined herein as being a hybridization and/or washing carried out in 2xSSC buffer, 0.1 % (w/v) SDS at a temperature in the range 45°C to 65°C, or equivalent conditions.
  • a high stringency is defined herein as being a hybridization and/or wash carried out in O.lxSSC buffer, 0.1% (w/v) SDS, or lower salt concentration, and at a temperature of at least 65°C, or equivalent conditions.
  • Reference herein to a particular level of stringency encompasses equivalent conditions using wash/hybridization solutions other than SSC known to those skilled in the art.
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridization and/or wash.
  • concentration of SSC buffer and/or increasing the concentration of SDS and/or increasing the temperature of the hybridization and/or wash.
  • the conditions for hybridization and/or wash may vary depending upon the nature of the hybridization matrix used to support the sample DNA, or the type of hybridization probe used.
  • the sample or the probe is immobilized on a solid matrix or surface (e.g., nitrocellulose).
  • a solid matrix or surface e.g., nitrocellulose
  • the sample or probe will generally comprise an array of nucleic acids on glass or other solid matrix, such as, for example, as described in WO 96/17958.
  • Techniques for producing high density arrays are described, for example, by Fodor et al., Science 767-773, 1991 , and in U.S. Pat. No. 5,143,854. Typical protocols for other assay formats can be found, for example in Current Protocols In Molecular Biology, Unit 2 (Northern Blotting), Unit 4 (Southern Blotting), and Unit 18 (PCR Analysis), Frederick M. Ausubul et al. (ed)., 1995.
  • the detection means according to this aspect of the invention may be any nucleic acid-based detection means such as, for example, nucleic acid hybridization or amplification reaction (eg. PCR), a nucleic acid sequence-based amplification (NASBA) system, inverse polymerase chain reaction (iPCR), or in situ polymerase chain reaction.
  • nucleic acid hybridization or amplification reaction eg. PCR
  • NASBA nucleic acid sequence-based amplification
  • iPCR inverse polymerase chain reaction
  • in situ polymerase chain reaction in situ polymerase chain reaction.
  • the probe can be labelled with a reporter molecule capable of producing an identifiable signal (e.g., a radioisotope such as 32 P or 35 S, or a fluorescent or biotinylated molecule, or a coloured dye e.g. TAMRA, FAM, ROC, etc).
  • a reporter molecule capable of producing an identifiable signal
  • a radioisotope such as 32 P or 35 S
  • a fluorescent or biotinylated molecule e.g. TAMRA, FAM, ROC, etc.
  • a coloured dye e.g. TAMRA, FAM, ROC, etc.
  • the detection means is an amplification reaction such as, for example, a polymerase chain reaction or a nucleic acid sequence-based amplification (NASBA) system or a variant thereof, one or more nucleic acid probes molecules of at least about 20 contiguous nucleotides in length is hybridized to genomic DNA and nucleic acid copies of the template are enzymically-amplified.
  • amplification reaction such as, for example, a polymerase chain reaction or a nucleic acid sequence-based amplification (NASBA) system or a variant thereof
  • NASBA nucleic acid sequence-based amplification
  • the stringency conditions can be selected to promote hybridization.
  • PCR provides for the hybridization of non-complementary probes to different strands of a double-stranded nucleic acid template molecule (ie. a DNA/DNA template), such that the hybridized probes are positioned to facilitate the 5'-to 3' synthesis of nucleic acid in the intervening region, under the control of a thermostable DNA polymerase enzyme.
  • a double-stranded nucleic acid template molecule ie. a DNA/DNA template
  • one sense probe and one antisense probe as described herein is used.
  • the probe detects non-coding nucleic acid (i.e. an intron, 5'- upstream region or 3'-untranslated region).
  • non-coding nucleic acid i.e. an intron, 5'- upstream region or 3'-untranslated region.
  • the nucleotide sequences set forth in SEQ ID NOs: 5 and 6 are used to amplify nucleic acid comprising a microsatellite designated "CEDD" that successfully detects allelic imbalance at the region of the human genome between map positions 8q22.3 and 8q24.13 associated with ovarian cancer, hepatocellular carcinoma, breast cancer, squamous cell carcinoma and metastatic melanoma.
  • the microsatellite CEDD also successfully distinguishes serous ovarian cancer from other ovarian cancers of epithelial origin.
  • nucleotide sequence of the amplification product comprising the microsatellite CEDD is set forth in SEQ ID NO: 7 and, as will be known to those skilled in the art this amplified fragment is also useful for directly hybridizing to genomic DNA of a subject in the assay formats described herein for the purpose of diagnosing the cancers supra, particularly ovarian cancer.
  • the present invention clearly provides nucleic acid primers and amplified probes for detecting allelic imbalance at this region of the human genome for the detection of breast cancer (e.g. SEQ ID Nos: 24 and 25) which amplify an intron region of the gene encoding an EDD protein.
  • SEQ ID Nos: 24 and 25 the nucleic acid that is amplified using the primers set forth in SEQ ID Nos: 24 and 25 is also useful as a hybridization probe and the present invention clearly encompasses such a use.
  • the amplification reaction detection means described supra is further coupled to a classical hybridization reaction detection means to further enhance sensitivity and specificity of the inventive method, such as by hybridizing the amplified DNA with a probe which is different from any of the probes used in the amplification reaction.
  • the hybridization reaction detection means described supra is further coupled to a second hybridization step employing a probe which is different from the probe used in the first hybridization reaction.
  • the comparison to be performed in accordance with the present invention may be a visual comparison of the signal generated by the probe, or alternatively, a comparison of data integrated from the signal, such as, for example, data that have been corrected or normalized to allow for variation between samples. Such comparisons can be readily performed by those skilled in the art.
  • the method supra further comprises isolating the test sample and/or the reference sample from one or more suitable subjects (i.e. the individual being tested and/or one or more other subjects who are suitable to provide a reference sample).
  • the reference sample and the test sample prefferably, to be isolated from the same subject at different time points, or alternatively, from different tissues of the same subject.
  • the test sample and the reference sample are from the same tissue type, or a tissue comprising cells of the same type.
  • test sample and/or the reference sample(s) has/have been obtained previously from the subject(s).
  • the present invention provides a method for diagnosing a cancer or predicting recurrence of a cancer in a subject comprising determining the level of mRNA or protein encoded by nucleic acid linked to map position 8q22.3 of the human genome in a sample of said subject, wherein an elevated level of said mRNA or protein is indicative of relapse of a cancer in said subject.
  • the mRNA encoded by a nucleic acid linked to map position 8q22.3 of the human genome encodes an EDD protein.
  • the mRNA comprises the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3 or a fragment thereof.
  • the mRNA encodes a protein comprising the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or a fragment thereof.
  • the protein encoded by a nucleic acid linked to map position 8q22.3 of the human genome is an EDD protein.
  • the protein encoded by a nucleic acid linked to map position 8q22.3 of the human genome comprises the sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4 or a fragment thereof.
  • EDD mRNA and EDD protein As exemplified herein, the level of expression of EDD mRNA and EDD protein is
  • recurrence or “relapse” shall be understood to mean that, following treatment for a cancer, a subject has developed a further cancer.
  • the cancer that has redeveloped may be the same form of cancer for which the patient received treatment or a different form of cancer, for example in the case of a cancer that has metastasized.
  • the invention provides a method for detecting allelic imbalance in a region of the human genome comprising hybridizing a nucleic acid probe or primer to genomic DNA and detecting the hybridization, wherein the probe or primer comprises a nucleotide sequence selected from the group consisting of:
  • nucleic acid detection is to be applied mutatis mutandis to this embodiment of the invention.
  • the hybridization is detected by amplifying nucleic acid using said probe or primer in a PCR reaction, or alternatively, by labelling the probe with a suitable reporter molecule and detecting the signal generated by the reporter molecule.
  • the present invention provides a method for detecting a cancer cell in a subject, said method comprising:
  • the mRNA encodes an EDD - protein. In an alternative embodiment, the mRNA encodes a p53R2 protein.
  • mRNA encoding an EDD protein is meant mRNA encoding a EDD polypeptide that has at least about 80% identity to SEQ ID NO: 2 or 4, and, more particularly, mRNA comprising a nucleotide sequence that has at least about 80% identity, more preferably at least about 95% identity, and still more preferably at least about 99% identity to the nucleotide sequence set forth in SEQ ID NO: 1 or 3.
  • tissue samples, general hybridization and amplification methods, and detection and analysis methods described supra for detecting allelic imbalance in this region of the human genome are applied mutatis mutandis to the detection of mRNA without any undue experimentation.
  • the level of mRNA encoding an EDD protein or p53R2 protein in a patient sample is analyzed by a variations on these procedures that are well known in the art such as, for example, in situ hybridization to mRNA, northern blotting techniques, or RT-PCR analysis (such as, for example, performed on laser capture microdissected samples).
  • Microarray technology is readily applied to such embodiments for high throughput screening of samples.
  • RNA/RNA duplexes are more stable than RNA/DNA duplexes.
  • the conditions for RNA/DNA or RNA/RNA hybridization and/or wash will vary depending upon the nature of the hybridization matrix used to support the sample RNA, or the type of hybridization probe used.
  • one or more nucleic acid probes molecules of at least about 20 contiguous nucleotides in length is hybridized to cDNA or cRNA that has been reverse-transcribed from the target mRNA, and nucleic acid copies of the template are enzymically-amplified using nucleic acid primers.
  • RT-PCR is particularly useful when it is desirable to determine gene expression levels. It is also known to those skilled in the art to use mRNA/DNA hybrid molecules as a template for such amplification reactions, and, as a consequence, first strand cDNA synthesis is all that is required to be performed prior to the amplification reaction.
  • the method supra further comprises isolating the test sample and/or the reference sample from one or more suitable subjects (i.e. the individual being tested and/or one or more other subjects who are suitable to provide a reference sample).
  • the reference sample and the test sample prefferably, to be isolated from the same subject at different time points, or alternatively, from different tissues of the same subject.
  • the test sample and the reference sample are from the same tissue type, or a tissue comprising cells of the same type.
  • test sample and/or the reference sample(s) has/have been obtained previously from the subject(s).
  • probes and primers having the nucleotide sequences set forth in any one of SEQ ID Nos: 26 to 30, 33 or 34, 37, 38, or 40 are used to detect breast cancer cells.
  • the nucleic acid primers set forth in any one of SEQ ID Nos: 26 to 30, 33 or 34, 37, 38, or 40 can also be used as a probe to detect nucleic acid directly.
  • nucleic acid that has been amplified with any one of SEQ ID Nos: 26 to 30, 33 or 34, 37, 38, or 40 is also useful as a hybridization probe and the present invention clearly encompasses such a use.
  • a further embodiment of the present invention relates to nucleic acid probes for detecting a cancer in accordance with the embodiments described supra.
  • the present invention provides an isolated nucleic acid molecule for detecting a cancer cell comprising a nucleotide sequence selected from the group consisting of:
  • nucleic acid shall be taken to mean any single-stranded or double-stranded RNA, DNA, cDNA, cRNA, or synthetic oligonucleotide, or alternatively, an analog of RNA, DNA, cDNA, cRNA, or a synthetic oligonucleotide.
  • Nucleic acid also includes any genomic gene equivalents of a cDNA molecule.
  • the isolated nucleic acid of the invention will hybridize to nucleic acid from a human or a non-human mammal.
  • Protein complexes comprising an EDD protein and diagnostic uses therefor
  • each of said expression products consists of a protein-protein interaction involving the EDD protein with a protein selected from the group consisting of a protein having tumor suppressor activity or cell cycle modulatory activity or DNA repair activity, a progesterone receptor protein, a nuclear targeting protein and a calcium/integrin binding protein (CIB).
  • a protein having tumor suppressor activity or cell cycle modulatory activity or DNA repair activity a progesterone receptor protein
  • a nuclear targeting protein a calcium/integrin binding protein (CIB).
  • CICB calcium/integrin binding protein
  • novel protein-protein complexes are also useful for producing diagnostic reagents such as, for example, antibodies. As will be known to those skilled in the art, antibodies are also useful for therapeutic applications. Additionally, the novel protein-protein complexes form the bases of assays for identifying modulatory compounds, including small molecule agonists or antagonists of the protein- protein interactions, such as for the treatment of hyperproliferative disorders, preventing cell proliferation or enhancing repair to damaged DNA, or for targeting cells having damaged DNA and/or that are tumor cells.
  • one embodiment of the present invention provides an isolated or recombinant protein complex comprising:
  • an EDD protein or a portion of an EDD protein sufficient to bind to a protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein and a protein associated with vascularization; and (ii) a nuclear protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein and a protein associated with vascularization or a portion of said protein sufficient to bind to said EDD protein or said portion of an EDD protein.
  • protein having tumor suppressor activity shall be taken to mean any protein or polypeptide that is known or thought to be involved repressing or reducing or preventing tumorigenesis or tumor growth, such as, for example, by activating a cellular response to DNA damage, assisting DNA repair, restoring survival after DNA damage (e.g. by interacting with and phosphorylating BRCA1 or BRCA2, thereby allowing BRCA1 or BRCA2 to restore survival after DNA damage), or preventing cellular proliferation of tumor cells (e.g. by stabilizing a tumor suppressor protein such as p53, thereby leading to cell cycle arrest in G1).
  • a tumor suppressor protein such as p53
  • the protein having tumor suppressor activity will be a nuclear protein.
  • Exemplary proteins having tumor suppressor activity in the present context include a member of the CDS1 subfamily of serine/threonine protein kinases, p53 (TP53), TNF-alpha, HSP70, estrogen receptor, androgen receptor, progesterone receptor, HRAS1-VNTR, CHK2, BRCA1 , BRCA2, AIB1 , NAT1 , NAT2, XRCC1 , XRCC2, XRCC5, CIB, importin alpha-1 , importin alpha-3, and importin alpha-5.
  • TP53 p53
  • TNF-alpha TNF-alpha
  • HSP70 estrogen receptor
  • androgen receptor progesterone receptor
  • HRAS1-VNTR CHK2, BRCA1 , BRCA2, AIB1 , NAT1 , NAT2, XRCC1 , XRCC2, XRCC5, CIB, importin alpha-1 , importin alpha-3, and importin alpha-5.
  • the protein having tumor suppressor activity will comprise an amino acid sequence having at least about 80% identity to a sequence set forth in any one of SEQ ID NOs: 9, 11 , 13, 15, 17, 19, 21 , or 23.
  • the amino acid sequence set forth in SEQ ID NO: 9 consists of a human importin alpha-1 protein (i.e. karyopherin alpha-2) which is encoded by nucleotides 133 to 1722 of the nucleotide sequence set forth in SEQ ID NO: 8.
  • the amino acid sequence set forth in SEQ ID NO: 11 consists of a human importin alpha-3 protein (i.e. karyopherin alpha-4) which is encoded by nucleotides 10 to 1575 of the nucleotide sequence set forth in SEQ ID NO: 10.
  • the amino acid sequence set forth in SEQ ID NO: 13 consists of a human importin alpha-5 protein (i.e.
  • the amino acid sequence set forth in SEQ ID NO: 15 consists of a human progesterone receptor protein (PR) which is encoded by nucleotides 176 to 2977 of the nucleotide sequence set forth in SEQ ID NO: 14.
  • the amino acid sequence set forth in SEQ ID NO: 17 consists of a human CIB/KIP protein which is encoded by nucleotides 67 to 642 of the nucleotide sequence set forth in SEQ ID NO: 16.
  • the amino acid sequence set forth in SEQ ID NO: 19 consists of a human CHK2 protein (i.e.
  • transcript variant 1 which is encoded by nucleotides 762 to 2393 of the nucleotide sequence set forth in SEQ ID NO: 18.
  • the amino acid sequence set forth in SEQ ID NO: 21 consists of a human CHK2 protein (i.e. transcript variant 2) which is encoded by nucleotides 762 to 2306 of the nucleotide sequence set forth in SEQ ID NO: 20.
  • the amino acid sequence set forth in SEQ ID NO: 23 consists of a human BRCA2 protein which is encoded by nucleotides 229 to 10,485 of the nucleotide sequence set forth in SEQ ID NO: 22.
  • a protein having tumor suppressor activity will comprise an amino acid sequence having at least about 80% identity to a sequence set forth in any one of SEQ ID NOs: 19, 21 , or 23 (i.e. at least 80% identity to a human CHK2 protein or a human BRCA2 protein) or a portion thereof sufficient to bind an EDD protein.
  • CHK2 is a nuclear cell cycle checkpoint regulatory protein of the CDS1 subfamily of serine/threonine protein kinases, having DNA repair function.
  • CHK2 contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis.
  • CHK2 also interacts with BRCA1 protein, causing BRCA1 to be phosphorylated, thereby allowing BRCA1 to restore survival after DNA damage.
  • CHK2 also has a putative tumor suppressor activity by virtue of stabilizing the tumor suppressor protein p53 (TP53), leading to cell cycle arrest in the G1 phase.
  • TP53 tumor suppressor protein p53
  • BRCA2 is a tumor suppressor protein by virtue of mutations, typically microdeletions, in the BRCA2-encoding gene being linked to an elevated risk of young onset breast cancer.
  • BRCA2 is also associated with the activation of double-strand break repair and/or homologous recombination.
  • the amino acid sequences of BRCA1 and BRCA2 comprise transcriptional activation protein domains.
  • protein having cell cycle modulatory activity is meant that the protein functions either solus or in cooperation with one or more other proteins or nucleic acid, to enhance cell cycle progression or to inhibit progression from one stage of the cell cycle to another.
  • Preferred cell cycle modulatory proteins will modulate the progression of cells from the G1 into the G2 phase, or the entry of cells into mitosis.
  • Such a functional assignment is readily determined in the art by examining the effects of mutations in genes encoding the protein having cell cycle modulatory activity, or alternatively, by empirical data showing a direct effect on cell cycle progression, or by analysing protein-protein interactions with known cell cycle modulatory proteins.
  • the protein having cell cycle modulatory activity will be a nuclear protein.
  • Exemplary proteins having cell cycle modulatory activity in the present context include a member of the CDS1 subfamily of serine/threonine protein kinases, Cdc25, CDC2a, cyclin-dependent kinase (CDK), CDK inhibitor, a mitogenic cyclin (e.g., cyclin A, cyclin B, cyclin D, etc), p53 (TP53), and CHK2.
  • CDS1 subfamily of serine/threonine protein kinases Cdc25, CDC2a
  • CDK cyclin-dependent kinase
  • CDK inhibitor e.g., a mitogenic cyclin (e.g., cyclin A, cyclin B, cyclin D, etc), p53 (TP53), and CHK2.
  • the protein having tumor suppressor activity will comprise an amino acid sequence having at least about 80% identity to a sequence set forth in any one of SEQ ID NOs: 19 or 21.
  • the Cdc25, CHK2 and TP53 proteins act as cell cycle modulatory proteins in the present context.
  • the protein having cell cycle modulatory activity is CHK2 (SEQ ID Nos: 19 or 21) or a portion thereof sufficient to bind an EDD protein.
  • protein associated with DNA repair or damage is meant a nuclear protein that functions in modulating DNA repair, is activated by DNA damage or otherwise activates double-strand break repair, DNA mismatch repair, homologous recombination or DNA end-ligation events in a cell or in vitro.
  • a functional assignment is readily determined in the art by examining the effects of mutations in genes encoding the protein, or alternatively, by empirical data showing a direct effect on the ability of a cell to respond to DNA damage and/or to undergo DNA repair and/or to activate homologous recombination or DNA end-ligation.
  • Exemplary proteins associated with DNA repair or damage in the present context include a member of the CDS1 subfamily of serine/threonine protein kinases, BRCA1 , BRCA2, CIB/KIP, TP53, MLH1 , MSH2, ATM, CHK2, XRCC1 , XRCC2, XRCC5 and importin alpha-5.
  • the protein associated with DNA damage or repair will comprise an amino acid sequence having at least about 80% identity to a sequence set forth in any one of SEQ ID NOs: 13, 17, 19, 21 , or 23.
  • the protein associated with DNA damage or repair is selected from the group consisting of a CHK2 protein (SEQ ID Nos: 19 or 21), a BRCA2 protein (SEQ ID NO: 23), a CIB protein (SEQ ID NO: 17) and an importin alpha-5 protein (SEQ ID NO: 13) or a portion thereof sufficient to bind an EDD protein.
  • the BRCA2 and CHK2 proteins are associated with DNA damage or repair, primary acting as DNA-damage checkpoint control proteins.
  • the CIB protein is a member of the calcium-binding protein family that interacts with a DNA-dependent protein kinase and, as a consequence, is in the art to play a role in kinase-phosphatase regulation of DNA end-ligation events.
  • the CIB protein also interacts with integrin alpha(llb)beta(3), which may implicate this protein as a regulatory molecule for integrin alpha(llb)beta(3).
  • Importin alpha-5 protein is involved in ds-DNA break repair.
  • Importin alpha-5 is also recruited by RAG1 during V(D)J recombination, the process by which genes encoding immunoglobulins and T-cell receptors are generated.
  • nuclear targeting protein is meant a chaperonin protein that assists with the translocation of a protein from the cytosol to the nucleus.
  • the import of proteins into the nucleus involves an energy-independent docking of the protein to the nuclear envelope and an energy-dependent translocation through the nuclear pore complex.
  • a nuclear targeting protein will facilitate one or both of these processes.
  • Such a functional assignment is readily determined in the art by examining the effects of mutations in genes encoding the protein, or alternatively, by empirical data showing a direct effect on the ability of a protein to facilitate nuclear localisation of a protein.
  • Exemplary nuclear targeting proteins include importin alpha-1 (SEQ ID NO: 9), importin alpha-3 (SEQ ID NO: 11) and importin alpha-5 (SEQ ID NO: 13).
  • the nuclear targeting protein will comprise an amino acid sequence having at least about 80% identity to a sequence set forth in any one of SEQ ID NOs: 9, 11 or 13.
  • importin alpha-1 and importin alpha-3 interact with the nuclear localisation sequence (NLS) of the DNA helicase Q1 protein and the NLS of the SV40 T antigen, and dock the proteins to the nuclear envelope or nuclear pore complex in the nuclear transport of those proteins.
  • NLS nuclear localisation sequence
  • importins are also considered in the art to play a role in V(D)J recombination.
  • nuclear localisation sequence or “NLS” is meant a short region of basic amino acids or 2 such regions spaced about 10 amino acids apart that is required for nuclear localization of a protein, particularly transport mediated by an importin protein.
  • progesterone receptor protein For the purposes of defining the structure of a progesterone receptor protein, there is provided the amino acid sequence set forth herein as SEQ ID NO: 15. Variants of SEQ ID NO: 15, such as, for example, proteins having at least about 80% identity thereto are also within the scope of the present invention, the only requirement being that the variant is a functional progesterone receptor or derived from a functional progesterone receptor protein.
  • a human progesterone receptor protein has been shown by the present inventors to bind to an EDD protein.
  • a protein associated with vascularization is meant that the protein functions to enhance the development of new blood vessels in a subject either directly or indirectly (eg by inducing expression of a protein that enhances vascularization or interacting with a protein that enhances or inhibits vascularization).
  • the protein is associated with vasculogenic activity, whereby the term “vasculogenic activity” shall be understood to mean the formation of new blood vessels de novo.
  • vasculogenic activity shall be understood to mean the formation of new blood vessels de novo.
  • the process of vasculogenesis results in the in situ differentiation of mesodermal progenitor cells to endothelial cells that organize into a primitive vascular network. Many aggressive tumors (eg melanoma tumor cells) are also capable of inducing vasculogenesis in a subject.
  • a protein associated with vascularization is capable of enhancing or inhibiting angiogenesis.
  • angiogenesis is meant the development of new blood vessels from previously existing blood vessels. The process of angiogenesis involves the endothelial cells of a pre-existing blood vessel secreting membranes to erode the basement membrane of the vessel. Endothelial cells subsequently proliferate and migrate toward an angiogenic signal, forming tight cell junctions with other endothelial cells in order to form a new blood vessel. Angiogenesis occurs during, for example, embryonic development, wound healing, and formation of the corpus luteum, endometrium and placenta. However, aberrant angiogenesis is associated with a number of disorders, including, tumor metastasis.
  • a functional assignment of a protein that is associated with vascularization is readily determined in the art by examining the effects of mutations in genes encoding the protein having vascularization activity, or alternatively, by empirical data showing a direct effect on vascularisation, or by analysing protein-protein interactions with known vascularization modulatory proteins.
  • the effect of a protein on vascularization may be determined any assay known in the art, such as, for example, a bovine capillary endothelial cell proliferation assay, a chick CAM assay (as described in O'Reilly et al, Cell, 79(2): 315-328 1994), a mouse corneal assay or a mouse ischemic retinopathy assay (as described in Ozaki et al, Am. J. Path., 156(2): 697-707, 2000).
  • the protein having vascularization activity will be a nuclear protein.
  • proteins with vascularization activity include, transforming growth factor ⁇ , lipid phosphatase LPP3, c-Myc, dimethylarganine dimethylaminohydrolase (DDAH), cytochrome P450, Tie-2 and VE-cadherin.
  • the protein complex is a heterodimer or hetero-multimeric protein comprising an EDD protein. Those skilled in the art will be aware that a heterodimer or heterodimeric protein complex comprises two different peptide or polypeptide subunits.
  • heteromultimer shall be taken to mean a higher order protein complex comprising at least three peptide or polypeptide subunits, wherein at least two of said subunits are different.
  • a heterohexameric protein is known to comprise six peptide or polypeptide subunits, and, in the present context, may comprise three different homodimers, or six different monomers, or a dimer and a tetramer of different protein, etc.
  • the present invention is not to be limited by the composition and size of the protein complex, the only requirement being that at least one peptide or polypeptide subunit consists of EDD or a portion of EDD, and at least one other peptide or polypeptide subunit consists of a polypeptide selected from the group consisting of a protein having tumor suppressor activity, a protein associated with DNA damage or repair, a cell cycle modulatory protein, a nuclear targeting protein and a progesterone receptor protein, a portion of a protein having tumor suppressor activity, a portion of a protein associated with DNA damage or repair, a portion of a cell cycle modulatory protein, a portion of a nuclear targeting protein and a portion of a progesterone receptor protein.
  • the protein subunits of the protein complex are held in physical relation by any means known to those skilled in the art.
  • This physical relation may involve the formation of an induced magnetic field or paramagnetic field, covalent bond formation such as a disulfide bridge formation between polypeptide subunits, an ionic interaction such as occur in an ionic lattice, a hydrogen bond or alternatively, a van der Waals interaction such as a dipole-dipole interaction, dipole-induced- dipole interaction, induced-dipole-induced-dipole interaction or a repulsive interaction or any combination of the above forces of attraction.
  • the peptide or polypeptide subunits may be held in physical relation by expressing them as a fusion polypeptide, optionally separated by a spacer to permit their folding. Accordingly, the physical relation between the peptide or polypeptide subunits may be a consequence of their binding capability and attraction toward one another, or alternatively, a consequence of their mode of production.
  • the peptide, polypeptide or protein partners are in direct physical relation.
  • direct physical relation is meant that the binding partners contact each other without any intervening protein moiety or non-protein moiety.
  • the protein complexes of the present invention can clearly include one or more additional protein moieties or non-protein moieties, such as, for example, a protein or non-protein moiety that enhances or stabilizes the physical relation between EDD or a portion of EDD and the other binding partner.
  • the present invention further encompasses a protein complex wherein one or more of the binding partners include a post-translational modification, such as, for example, a phosphorylated, fucosylated, myristoylated, farnesylated, or glycosylated residue.
  • a post-translational modification such as, for example, a phosphorylated, fucosylated, myristoylated, farnesylated, or glycosylated residue.
  • Such post-translational modifications may enhance complex formation or stabilize the complex once it is formed.
  • Phosphorylation of one or more serine or tyrosine residues present on one or more of the binding partners including EDD or CHK2, such as by a member of the CDS1 subfamily of serine/threonine protein kinases (e.g. CHK2), is also contemplated.
  • Ubiquitination of one or more binding partners is also not to be excluded.
  • the binding partners of the protein complex are mammalian polypeptides or proteins, and more preferably of human origin. It is not strictly necessary for the binding partners to be derived from the same source, however this is preferred because the ability of the partners to associate or be maintained in physical non-covalent association with each other is generally enhanced if they are derived from the same organism.
  • EDD or other polypeptide that can form the protein complex of the invention, such as, for example a portion comprising a cysteine/histidine rich region (e.g. a zinc- binding domain), HECT domain, RING domain, nuclear localisation sequence (NLS), UBA domain that binds to mono- or multi-ubiquitin chains, or a region comprising alpha helices (e.g. carboxy-terminal 60 amino acids of SEQ ID Nos: 2 or 4).
  • a cysteine/histidine rich region e.g. a zinc- binding domain
  • HECT domain e.g. a zinc- binding domain
  • RING domain e.g. a nuclear localisation sequence
  • UBA domain that binds to mono- or multi-ubiquitin chains
  • alpha helices e.g. carboxy-terminal 60 amino acids of SEQ ID Nos: 2 or 4
  • the skilled artisan can readily determine a portion of the other binding partner that is sufficient to bind to an EDD protein or a portion thereof. Again, conventional binding assays for determining the binding between two proteins may be used to assay the suitability of such portions.
  • a portion of an EDD protein or other protein suitable for protein complex formation comprises at least about 5 amino acids in length, more preferably at least about 10 amino acids in length, even more preferably at least about 15 amino acids in length and still more preferably at least about 20 or 30 or 40 or 50 amino acids in length.
  • the portion of an EDD protein that is sufficient to bind to a protein having tumor suppressor activity or having cell cycle modulatory activity will at least comprise amino acid residues from about position 1400 to about position 2550 of SEQ ID NO: 2 or the corresponding region in SEQ ID NO: 4, or more preferably, the region of SEQ ID NO: 2 from about position 1406 to about position 2526.
  • the portion of an EDD protein that is sufficient to bind to a protein associated with DNA repair or damage will at least comprise amino acid residues in the C-terminal portion of the full-length EDD protein, such as, for example, from about position 889 to about position 2799 of SEQ ID NO: 2 or the corresponding region in SEQ ID NO: 4.
  • the portion of an EDD protein that is sufficient to bind to a nuclear targeting protein will at least comprise the nuclear localisation sequence of an EDD protein.
  • the EDD NLS comprises at least amino acid residues from about position 502 to about position 517 of SEQ ID NO: 2, or from about position 600 to about position 605 of SEQ ID NO: 2, or from about position 1222 to about position 1241 of SEQ ID NO: 2, or the corresponding regions in SEQ ID NO: 4.
  • the portion of an EDD protein that is sufficient to bind to a progesterone receptor protein will at least comprise the N-terminal portion of EDD, such as, for example, amino acid residues from about position 1 to about position 889 of SEQ ID NO: 2, or the corresponding regions in SEQ ID NO: 4, or more preferably, the region of SEQ ID NO: 2 from about position 420 to about position 889 or the equivalent region in SEQ ID NO: 4.
  • a preferred portion of the CHK2 protein that interacts with an EDD protein will at least comprise the FHA domain of CHK2 (i.e. amino acid residues 117 to 157 of SEQ ID NO: 19 or the equivalent region in SEQ ID NO: 21 , and more preferably residues 111 to 177 of SEQ ID NO: 19 or the equivalent region in SEQ ID NO: 21).
  • a preferred portion of a progesterone receptor (PR) protein that interacts with an EDD protein will comprise at least a C-terminal portion of PR, more preferably a region comprising a the hinge domain, DNA binding domain and ligand-dependent activation domain-2 of the full-length receptor protein (i.e. "CDE region").
  • PR progesterone receptor
  • a preferred portion of an importin protein that interacts with an EDD protein will at least comprise the C-terminal domain of importin, such as, for example, amino acids from about position 229 to about position 538 of SEQ ID NO: 13 or the homologous region in SEQ ID NO: 9.
  • Another embodiment of the present invention provides isolated peptides, polypeptides, and kits comprising same for producing the protein complex, or for identifying a modulator of a biological interaction between EDD or a portion of EDD and one or more other polypeptides selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein, and a protein associated with vascularization, or a portion thereof.
  • the kit comprises a first polypeptide consisting of EDD or a portion thereof sufficient to bind to a protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein and a protein associated with vascularization, and a second polypeptide consisting of a protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein and a protein associated with vascularization or a portion thereof sufficient to bind to said EDD protein or said portion of an EDD protein.
  • Such kits are used to produce protein complexes comprising: EDD.
  • the kit further includes a protein or a portion thereof sufficient to bind to a protein that binds EDD comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 , and SEQ ID NO: 23.
  • the subject kit is used to produce higher order protein complexes comprising an EDD protein and a protein that binds EDD and a protein that binds to the EDD-binding protein.
  • such kits are useful for analyzing competition between EDD and a protein that binds to an EDD- binding protein in the formation of a protein-protein complex.
  • the kit can be used to produce a complex comprising EDD and BRCA1 and CHK2 or to determine competition between BRCA1 and EDD for complex formation with CHK2.
  • the kit can be used to produce a complex comprising EDD and BRCA2 and CHK2 or to determine competition between BRCA2 and EDD for complex formation with CHK2, or between CHK2 and EDD for complex formation with BRCA2.
  • the kit can be used to produce a complex comprising EDD and BRCA2 and BRCA1 or to determine competition between BRCA1 and EDD for complex formation with BRCA2.
  • the kit can be used to produce a complex comprising EDD and TP53 and CHK2 or to determine competition between TP53 and EDD for complex formation with CHK2.
  • the kit can be used to produce a complex comprising EDD and CIB and integrin or to determine competition between integrin and EDD for complex formation with CIB.
  • the kit can be used to produce a complex comprising EDD and importin alpha-5 and RAG1 or to determine competition between RAG1 and EDD for complex formation with importin alpha-5.
  • the kit can be used to produce a complex comprising EDD and importin alpha-1/3 and DNA helicase or to determine competition between DNA helicase and EDD for complex formation with importin alpha-1/3.
  • the kit can be used to produce a complex comprising EDD and progesterone receptor and a heat shock protein that binds to the progesterone receptor or to determine competition between a heat shock protein and EDD for complex formation with the progesterone receptor.
  • the kit may also include one or more antibodies or ligands that bind to the first polypeptide or the second polypeptide, or to any one or more of the protein complexes supra comprising EDD, such as, for example, an antibody or ligand that specifically recognizes an assembled protein complex or the conformation of said protein complex, rather than the individual polypeptide components per se.
  • one or more antibodies or ligands that bind to the first polypeptide or the second polypeptide, or to any one or more of the protein complexes supra comprising EDD, such as, for example, an antibody or ligand that specifically recognizes an assembled protein complex or the conformation of said protein complex, rather than the individual polypeptide components per se.
  • the kit comprises: (a) a first compartment comprising an EDD protein or a portion thereof sufficient to form a protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor; and
  • a second compartment comprising an antibody or ligand that binds to a protein selected from the group consisting of (i) a CHK2 protein; (ii) a BRCA2 protein; (iii) a CIB protein; (iv) an importin alpha-1 protein; (v) an importin alpha-3 protein; (vi) an importin alpha-5 protein; and (vii) a progesterone receptor protein, or an antibody or ligand that binds to a protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor, wherein
  • the kit comprises a first compartment comprising an antibody or ligand that binds to an EDD protein and a second compartment comprising a protein selected from the group consisting of (i) a CHK2 protein; (ii) a BRCA2 protein; (iii) a CIB protein; (iv) an importin alpha-1 protein; (v) an importin alpha-3 protein; (vi) an importin alpha-5 protein; and (vii) a progesterone receptor protein, or a portion thereof sufficient to bind to an EDD protein.
  • a protein selected from the group consisting of (i) a CHK2 protein; (ii) a BRCA2 protein; (iii) a CIB protein; (iv) an importin alpha-1 protein; (v) an importin alpha-3 protein; (vi) an importin alpha-5 protein; and (vii) a progesterone receptor protein, or a portion thereof sufficient to bind to an EDD protein.
  • the kit comprises:
  • a first compartment comprising an isolated or recombinant protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor; and (b) a second compartment comprising an (i) antibody or ligand that binds to a polypeptide selected from the group consisting of a CHK2 protein, a BRCA2 protein, a CIB protein, an importin alpha-1 protein, an importin alpha-3 protein, an importin alpha-5 protein, a progesterone receptor protein and an EDD protein; or (ii) an antibody or ligand that bind
  • antibody refers to intact monoclonal or polyclonal antibodies, immunoglobulin (IgG, IgM, IgE) fractions, humanized antibodies, or recombinant single chain antibodies, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding a linear or conformational epitope of at least one binding partner of the protein complex, or to a conformational epitope of the assembled protein complex.
  • Humanized antibodies are antibodies in which amino acids have been replaced in the non-antigen binding regions in order to more closely resemble a human antibody, while still retaining the original binding ability.
  • antibodies are obtained from a commercial source, such as for example, Santa Cruz Biotechnology, Inc, CA 95060, USA. Other commercial sources will be well known to those skilled in the art.
  • antibodies are produced by conventional means.
  • an intact polypeptide, or a portion thereof containing a short amino acid sequence of interest is used as the immunizing antigen or immunogen.
  • the immunogen is derived from a natural source, produced by recombinant expression means or by in vitro translation of RNA, or synthesized chemically such as by Fmoc chemistry.
  • Immunogens consisting of short peptides a preferably conjugated to a carrier protein, such as, for example bovine serum albumin (BSA), thyroglobulin, or keyhole limpet hemocyanin (KLH), prior to immunization.
  • BSA bovine serum albumin
  • KLH keyhole limpet hemocyanin
  • the coupled peptide is then used to immunize the animal.
  • Various host animals e.g.
  • adjuvants include, for example, Freund's complete or incomplete adjuvant, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum are preferred.
  • Monoclonal antibodies are prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture, such as, for example, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al. Nature 256, 495-497, 1975; Kozbor et al., J. Immunol. Methods 81, 31-42, 1985; Cote et al., Proc. Natl. Acad. Sci. USA 80, 2026-2030, 1983; Cole et al., Mol. Cell Biol. 62, 109-120, 1984).
  • Such techniques involve splicing a mouse antibody gene to a human antibody gene to produce a molecule having the desired antigen specificity and biological activity (Morrison et al., Proc. Natl. Acad. Sci. USA 81, 6851-6855, 1984; Neuberger et al., Nature 312, 604-608, 1984; Takeda et al., Nature 314, 452-454, 1985).
  • Antibodies are also produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed by Orlandi et al., Proc. Natl. Acad. Sci. USA 86, 3833-3837, 1989; Winter ef al., Nature 349, 293-299, 1991 ).
  • Antibody fragments such as, for example, F(ab') 2 fragments
  • F(ab') 2 fragments are produced by pepsin digestion of an intact antibody molecule.
  • Fab fragments are generated by reducing the disulfide bridges of F(ab') 2 fragments.
  • Fab expression libraries are constructed, to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al., Science 254, 1275-1281 , 1989).
  • the antibodies or ligands may assist in the subsequent isolation or detection of the complex formed between EDD and another protein. Binding of the antibody or ligand to a region of the first or second polypeptide that is not involved in complex formation is preferred for this purpose, the only requirement being that, in use, the ligand does not disrupt the complex formed.
  • the ligand is a small molecule or alternatively, a binding partner for one of the protein complexes contemplated herein.
  • Particularly preferred ligands for use in accordance with this embodiment are selected from the group consisting of a heat shock protein that binds to progesterone receptor, BRCA1 , TP53, and nucleic acid (RNA or DNA).
  • the antibody or ligand may be labelled using a suitable reporter molecule, such as, for example, a fluorophore, chromophore, or radioisotope.
  • a suitable reporter molecule such as, for example, a fluorophore, chromophore, or radioisotope.
  • these may also be detected using antibodies in accordance with procedures known to those skilled in the art.
  • the kit is packaged with instructions for use.
  • kits of the invention are useful for producing and/or detecting the protein complexes of the invention in vitro or in vivo.
  • one or more of the non-antibody/Iigand components of the kits is added to a cellular source for a time and under conditions sufficient for complex formation to occur.
  • the antibody components are particularly useful for isolating the complex(es) thus formed.
  • any one of the kit components is labelled with a protein tag to facilitate subsequent isolation or purification of the protein complex.
  • the polypeptide components are contacted for a time and under conditions sufficient for complex formation to occur. Additional proteins may be provided from cellular or non-cellular sources to produce protein complexes other than those specifically referred to herein.
  • the antibody or ligand is used to detect or isolate the complex formed. The ligand should be selected such that it does not disrupt the protein complex formed.
  • an isolated antibody that binds to a protein complex comprising an EDD protein, preferably a protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor, subject to the proviso that said antibody does not bind to any individual protein of said complex in the absence of another protein of said complex.
  • a protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising E
  • the antibody recognizes a conformational epitope of the protein complex.
  • Another embodiment of the present invention provides an anti-idiotypic antibody that binds to an an antibody or ligand that binds to a protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor, subject to the proviso that said anti-idiotypic antibody does not bind to an antibody that binds to an individual protein of said complex in the absence of another protein of said complex
  • Another embodiment of the present invention provides methods for isolating a EDD binding protein or a complex comprising same from a suitable cellular source.
  • the protein or complex is provided substantially free of conspecific proteins, meaning that it is at least about 1-5% pure as determined by an analysis of proteins by SDS/PAGE. More preferably, the protein is at least about 10%, even more preferably at least about 20% pure, even more preferably at least about 25% pure, even more preferably at least about 30% pure, and even more preferably at least about 50% pure, and still more preferably substantially pure.
  • binding partners are separately isolated, from the same or a different cellular source that ectopically expresses or endogenously expresses at least one of the said binding partners.
  • the isolated binding partners are then combined in an amount and under conditions sufficient to facilitate their physical relation. Such conditions can be readily determined by those skilled in protein chemistry. Selection of buffer pH, ionic strength, and temperature, sufficient to maintain the binding partners in solution are generally preferred.
  • One or more protease inhibitors can also be included to prevent proteolytic digestion or degradation of the isolated polypeptides.
  • the protein complex per se may be isolated from a cellular source or sub-cellular source (e.g. nuclei) that contains both binding partners endogenously or ectopically. It is within the scope of this embodiment that the binding partners are expressed as a fusion protein or as distinct polypeptides.
  • Preferred cellular sources of the isolated polypeptide binding partners, or the protein complex include any mammalian cell, and preferably, a mammalian cell that is known to express EDD, and a protein selected from the group consisting of CHK2, BRCA2, CIB, importin alpha-1 , importin alpha-3, importin alpha-5 and a progesterone receptor protein, or alternatively, a cell that can be engineered to express said protein(s).
  • Exemplary cells for such a purpose include cancer cells (e.g.
  • carcinoma cells breast cancer cells such as ER-negative breast cancer cells, or squamous epithelial carcinoma cells or ovarian cancer cells, or hepatocellular carcinoma cells
  • epithelial cells cells of the central nervous system, kidney cells, T cells, NIH3T3 cells, murine 10T fibroblasts, MDA-MB-231 cells, MDCK cells, COS cells, CHO cells, HeLa cells, or T-47D cells, HeLa cells, MCF-7 cells, or HEK 293 cells.
  • other cells e.g. insect sf9 or sf21 cells, chick embryo cells and the like
  • the protein complex or a binding partner thereof is isolated from cell line that endogenously expresses one or both binding partners, such as, for example, a cancer cell selected from the group consisting of head and neck cancer, melanoma, metastatic melanoma, a squamous cell carcinoma of the tongue, breast cancer, adenocarcinoma, squamous lung cancer, gastrointestinal cancer (eg. gastric, colon, or pancreatic cancer), ovarian cancer, hepatocellular carcinoma, renal cell cancer, bladder cancer, a gynecological carcinoma (eg. ovarian cancer), prostate cancer, squamous cell carcinoma, non-squamous carcinoma, glioblastoma and medulloblastoma.
  • a cancer cell selected from the group consisting of head and neck cancer, melanoma, metastatic melanoma, a squamous cell carcinoma of the tongue, breast cancer, adenocarcinoma, squamous lung cancer,
  • the cell will be a metastatic melanoma cell, squamous cell carcinoma cell, a breast cancer cell, a hepatocellular carcinoma cell, or an ovarian cancer cell or a cell line derived from such cancers.
  • the protein complex or a binding partner thereof is isolated from a carcinoma cell or carcinoma cell line, HeLa cell, MCF-7 cell, T-47D cell, or a HEK293 cell or COS cell that ectopically expresses one or more binding partners.
  • Means for isolating the peptide, polypeptide, or protein binding partners, or the protein complex include any means of protein isolation known to the skilled protein chemist, such as, for example, size exclusion chromatography, ion- exchange (anion or cation exchange) chromatography, reverse phase chromatography, or affinity chromatography. Both high pressure (e.g. HPLC, FLPC, MALDI) and low pressure systems can be used.
  • high pressure e.g. HPLC, FLPC, MALDI
  • low pressure systems can be used.
  • Affinity methods using ligands or antibodies that bind to one or both of the binding partners to the protein-protein interaction are particularly preferred.
  • Antibodies against a protein domain of an EDD protein or one of its binding partners are particularly useful for isolating EDD or a complex comprising same.
  • naturally-occurring or recombinant protein is purified free of conspecific proteins by providing a matrix comprising antibody coupled to activated chromatographic resin (eg.
  • CNBr-activated Sepharose, Pharmacia blocking the resin and washing to remove unbound antibody and blocking agent, contacting the resin with a protein extract comprising a peptide or polypeptide to which the antibody binds under conditions sufficient to allow binding of said peptide or polypeptide (e.g., high ionic strength buffers in the presence of detergent), and eluting said peptide or polypeptide under conditions that disrupt the antibody antigen binding (eg, a buffer of pH 2-3 or a high concentration of a chaotrope, such as urea or thiocyanate ion).
  • a protein extract comprising a peptide or polypeptide to which the antibody binds under conditions sufficient to allow binding of said peptide or polypeptide (e.g., high ionic strength buffers in the presence of detergent), and eluting said peptide or polypeptide under conditions that disrupt the antibody antigen binding (eg, a buffer of pH 2-3 or a high concentration of a chaotrope, such as ure
  • small molecules, or proteins capable of binding to one of the binding partners can also be used to isolate one or both binding partners, or the protein complex per se, by affinity means. Conditions to permit such isolation can be readily determined by those skilled in protein chemistry. Selection of buffer pH, ionic strength, and temperature, sufficient to maintain the binding partners in solution are generally preferred.
  • one or more protease inhibitors e.g. papain, PMSF, leupeptin
  • one or more protease inhibitors are included to prevent proteolytic digestion or degradation of the isolated polypeptides.
  • naturally-occurring or recombinant protein is purified free of conspecific proteins by providing a matrix comprising a small molecule or protein binding partner coupled to activated chromatographic resin (eg.
  • the invention provides methods for producing a protein complex described herein by recombinant means.
  • a protein-encoding nucleotide sequence is placed in operable connection with a promoter or other regulatory sequence capable of regulating expression in a cell-free system or cellular system.
  • nucleic acid comprising a sequence that encodes an EDD protein or a portion of an EDD protein and a protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, and a progesterone receptor protein or a portion of said polypeptide sufficient to bind to said EDD protein or said portion of an EDD protein, in operable connection with a suitable promoter sequence, is expressed in a suitable cell for a time and under conditions sufficient for expression to occur.
  • Nucleic acid encoding the binding partners is readily derived from the nucleotide and amino acid sequences set forth herein, which except for SEQ ID Nos: 3-7, are publicly available.
  • the open reading frames are covalently linked in the same reading frame, such as, for example, using standard cloning procedures as described by Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, ISBN 047150338, 1992), which is herein incorporated by reference.
  • a spacer is placed between the open reading frames of the binding partners to facilitate their physical relation.
  • Preferred spacers comprise protein- encoding nucleotide sequences of at least about 15-30 nucleotides in length, preferably sequences encoding amino acids rich in proline.
  • the spacer is designed such that it does not interrupt the open reading frames of the partners.
  • promoter includes the transcriptional regulatory sequences of a classical genomic gene, including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence and additional regulatory elements (i.e., upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue- specific manner.
  • promoter is also used to describe a recombinant, synthetic or fusion molecule, or derivative which confers, activates or enhances the expression of a nucleic acid molecule to which it is operably connected, and which encodes the polypeptide or peptide fragment.
  • Preferred promoters can contain additional copies of one or more specific regulatory elements to further enhance expression and/or to alter the spatial expression and/or temporal expression of the said nucleic acid molecule.
  • Placing a nucleic acid molecule under the regulatory control of, i.e., "in operable connection with”, a promoter sequence means positioning said molecule such that expression is controlled by the promoter sequence. Promoters are generally positioned 5' (upstream) to the coding sequence that they control. To construct heterologous promoter/structural gene combinations, it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i.e., the gene from which the promoter is derived. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene.
  • the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i.e., the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur.
  • the prerequisite for producing intact polypeptides and peptides in bacteria such as E. coli is the use of a strong promoter with an effective ribosome binding site.
  • Typical promoters suitable for expression in bacterial cells such as E. coli include, but are not limited to, the lacz promoter, temperature-sensitive ⁇ L or ⁇ R promoters, T7 promoter or the IPTG-inducible tac promoter.
  • a number of other vector systems for expressing the nucleic acid molecule of the invention in E. coli are well-known in the art and are described, for example, in Ausubel et al (In: Current Protocols in Molecular Biology.
  • Typical promoters suitable for expression in viruses of eukaryotic cells and eukaryotic cells include the SV40 late promoter, SV40 early promoter and cytomegalovirus (CMV) promoter, CMV IE (cytomegalovirus immediate early) promoter amongst others.
  • CMV cytomegalovirus
  • Preferred vectors for expression in mammalian cells eg.
  • pcDNA vector suite supplied by Invitrogen, in particular pcDNA 3.1 myc-His-tag comprising the CMV promoter and encoding a C-terminal 6xHis and MYC tag; and the retrovirus vector pSR ⁇ tkneo (Muller et al., Mol. Cell. Biol., 11, 1785, 1991).
  • the vector pcDNA 3.1 myc-His (Invitrogen) is particularly preferred for expressing a secreted form of a protein in 293T cells, wherein the expressed peptide or protein can be purified free of conspecific proteins, using standard affinity techniques that employ a Nickel column to bind the protein via the His tag.
  • Means for introducing the isolated nucleic acid molecule or a gene construct comprising same into a cell for expression are well-known to those skilled in the art. The technique used for a given organism depends on the known successful techniques. Means for introducing recombinant DNA into animal cells include microinjection, transfection mediated by DEAE-dextran, transfection mediated by liposomes such as by using lipofectamine (Gibco, MD, USA) and/or cellfectin (Gibco, MD, USA), PEG-mediated DNA uptake, electroporation and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agracetus Inc., Wl, USA) amongst others.
  • nucleic acid comprising a sequence encoding each binding partner is placed in operable connection with a promoter sequence and expressed in a suitable cell. If the protein partners are expressed in the same cell, they may freely associate in said cell to form the protein complex of the invention. If the protein partners are produced in different cells, the cells are lysed and the cellular lysates mixed under conditions sufficient to permit the association of the binding partners.
  • the nucleotide sequences encoding the binding partners may be contained in the same or different nucleic acid molecules, and as a consequence, the use of single or multiple gene constructs to express the binding partners is clearly encompassed by the invention.
  • the requirements for expressing fusion polypeptides as described herein above are also relevant in this context, except that there is no need for a spacer.
  • different promoters will be used to express each binding partner, such as, for example, to prevent squelching or competition between promoters or regulatory sequences for cellular transcription factors.
  • Another embodiment of the present invention provides prognostic and diagnostic methods for determining a predisposition for disease, or a disease state, said methods comprising detecting a protein complex comprising: (i) an EDD protein; and
  • a nuclear protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein and a protein associated with vascularization.
  • the diagnostic/prognostic methods described herein detect a protein complex selected from the group consisting of (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor.
  • a protein complex selected from the group consisting of (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha
  • the invention relates to reagents and methods for detecting specific interaction between an EDD protein and a nuclear protein having tumor suppressor activity wherein the protein-protein interaction is associated with unregulated cell division or hyperproliferation of a cell or the appearance or occurrence of tumors associated with cancer, such as, for example, ovarian cancer or hepatocellular carcinoma or squamous cell carcinoma or breast cancer or metastatic melanoma.
  • the invention relates to reagents and methods for detecting specific interaction between an EDD protein and a nuclear protein having cell cycle modulatory activity wherein the protein-protein interaction is associated with unregulated cell division or hyperproliferation of a cell or the appearance or occurrence of tumors associated with cancer, such as, for example, ovarian cancer or hepatocellular carcinoma or squamous cell carcinoma or breast cancer or metastatic melanoma.
  • the invention relates to reagents and methods for detecting specific interaction between an EDD protein and a protein associated with DNA damage or DNA repair wherein the protein-protein interaction is associated with unregulated cell division or hyperproliferation of a cell or the appearance or occurrence of tumors associated with cancer, such as, for example, ovarian cancer or hepatocellular carcinoma or squamous cell carcinoma or breast cancer or metastatic melanoma.
  • the invention relates to reagents and methods for detecting specific interaction between an EDD protein and a progesterone receptor protein, wherein the protein-protein interaction activates the receptor in a ligand-dependent manner such as, for example, to enhance progesterone- mediated tumorigenesis or tumor growth or unregulated cell division or hyperproliferation of a cell.
  • the invention relates to reagents and methods for detecting specific interaction between an EDD protein and a protein associated with vascularization, wherein the protein-protein interaction is associated with formation of new blood vessels in a subject.
  • the protein-protein interaction is associated with vasculogenesis or angiogenesis in a subject suffering from cancer, psoriasis, diabetic blindness, age related macular degeneration or rheumatoid arthritis.
  • the invention relates to reagents and methods for detecting specific interaction between an EDD protein and a calcium/integrin binding protein (CIB) or DNA-dependent protein kinase interacting protein (KIP), wherein the protein-protein interaction is reduced in cells suffering DNA damage.
  • CNB calcium/integrin binding protein
  • KIP DNA-dependent protein kinase interacting protein
  • Preferred detection systems contemplated herein include any known assay for detecting a protein-protein interaction in a biological sample isolated from a human or mammalian subject, such as, for example, using one or more antibodies against the complex or each binding partner, or an epitope thereof.
  • a non-antibody ligand of the protein complex may be used, such as, for example, a small molecule (e.g. a chemical compound, agonist, antagonist, allosteric modulator, competitive inhibitor, or non-competitive inhibitor, of the complex that may or may not modulate complex formation or dissociation).
  • the use of antibody-based assay systems is particularly preferred.
  • the antibody or small molecule may be used in any standard solid phase or solution phase assay format amenable to the detection of protein complexes or protein-protein interactions.
  • Antibodies that specifically bind to the protein complex are used for the diagnosis of conditions or diseases characterized by the presence of said protein complex, or in prognostic assays to monitor disease progression in the presence of absence of treatment. Diagnostic assays for include methods which utilize the antibody and a label to detect the protein complex in human body fluids or extracts of cells or tissues.
  • the antibodies are used with or without modification, and may be labeled, either covalently or non-covalently, with a reporter molecule.
  • reporter molecules which are known in the art may be used, several of which are described above.
  • ELISA ELISA
  • RIA RIA
  • FACS fluorescence-activated cell sorting
  • Such methods provide a basis for diagnosing levels of the protein complex associated with disease.
  • a protein complex of the present invention that is associated with cancer induced by over expression of EDD and/or one of its binding partners, (e.g. EDD/CHK2 or EDD/BRCA2) can provide a poor prognosis of survival from the disease.
  • Normal or standard values of the complex for a healthy individual are established by combining body fluids or cell extracts taken from normal or healthy subjects, preferably human subjects.
  • the amount of standard complex formation may be quantified by various methods, preferably by photometric means, or using antibodies in a quantitative immunoassay (e.g. ELISA), wherein the amount of protein complex is determined by comparison against known amounts of a standard peptide, such as, for example, a peptide comprising an EDD protein domain.
  • a quantitative immunoassay e.g. ELISA
  • Quantities of the protein complex expressed in subject samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease or establishing a prognosis.
  • a level of a protein complex in excess of the standard level of that protein complex detected in a healthy subject is diagnostic of disease, and indicates a poor prognosis for survival.
  • Optical or fluorescent detection such as, for example, using mass spectrometry, MALDI-TOF, biosensor technology, evanescent fiber optics, or fluorescence resonance energy transfer, is clearly encompassed by the present invention.
  • biosensor diagnostic devices the assay substrate and detector surface are integrated into a single device.
  • One general type of biosensor employs an electrode surface in combination with current or impedance measuring elements for detecting a change in current or impedance in response to the presence of a protein-protein binding event (e.g. U.S. Patent No. 5,567,301).
  • Gravimetric biosensors employ a piezoelectric crystal to generate a surface acoustic wave whose frequency, wavelength and/or resonance state are sensitive to surface mass on the crystal surface. The shift in acoustic wave properties is therefore indicative of a change in surface mass, such as, for example, as a consequence of protein-protein binding (e.g. U.S. Patent Nos. 5,478,756 and 4,789,804.
  • Biosensors based on surface plasmon resonance (SPR) effects have also been proposed, for example, in U.S. Patent Nos. 5,485,277 and 5,492,840, which exploit the shift in SPR surface reflection angle that occurs when protein binds to the SPR interface.
  • SPR surface plasmon resonance
  • Biosensors have a number of potential advantages over binding assay systems having separate reaction substrates and reader devices.
  • One important advantage is the ability to manufacture small-scale, but highly reproducible, biosensor units using microchip manufacturing methods, such as, for example, described in U.S. Patent Nos. 5,200,051 and 5,212,050.
  • Another advantage is the potentially large number of different analyte detection regions that can be integrated into a single biosensor unit, allowing sensitive detection of several analytes with a very small amount of body-fluid sample. Accordingly, the simultaneous detection of the individual binding partners that form the protein complex, or the simultaneous detection of one or more protein complexes of the present invention, is possible using a biosensor.
  • Evanescent biosensors are particularly preferred because they do not require separation of the protein complex from unbound material, and their use can be coupled to standard immunoassay formats, as originally described by Hirshfield in U.S. Patent No. 4,447,546.
  • evanescent biosensors rely upon light of a particular wavelength interacting with a fluorescent molecule, such as, for example, a fluorescent antibody or small molecule attached near the probe's surface, to emit fluorescence at another wavelength, on binding of the protein complex of the invention to the antibody or small molecule.
  • the biosensor is protected from sensitivity degradation caused by non-specific binding of proteins to the sensor surface, by exposing the sensor surface to a solution of non- interfering proteins, so that the non-interfering proteins bind to said sensor surface to prevent the subsequent binding of the interfering proteins.
  • Enhanced protection of surfaces from biological proteins is also possible by completely covering surfaces with protective coatings, such as, for example, amorphous copolymers of tetrafluoroethylene and bis-2,2-trifluoromethyl-4.5-difluoro-1 ,2-dioxole, dissolved in a solvent containing fluorinated alkanes, and applied by deposition as a thin protective coating (US. Patent No. 5,356,668 by Paton et al.).
  • Assay systems suitable for use in high throughput screening of mass samples particularly a high throughput spectroscopy resonance method (e.g. MALDI-TOF, electrospray MS or nano-electrospray MS) or a detection system facilitating determination of real time association/dissociation constants, are particularly contemplated.
  • a high throughput spectroscopy resonance method e.g. MALDI-TOF, electrospray MS or nano-electrospray MS
  • detection system facilitating determination of real time association/dissociation constants are particularly contemplated.
  • a diagnosis or prognosis is made by separately determining the level(s) of expression of the binding partners.
  • the level of expression of the binding partners is determined by standard protein- based detection systems, antibody-based methods, or nucleic acid-based methods.
  • a high level of expression of certain binding partners such as EDD and a progesterone receptor can be indicative of disease, or, in the case of cancerous tissues, provide a poor prognosis for survival. Without being bound by any theory or mode of action, this may be a consequence of EDD trans- activating the progesterone receptor, thereby enhancing progestin-sensitive or progesterone-receptor mediated cell proliferation.
  • nucleic acid encoding EDD or a binding partner thereof such as, for example, a synthetic oligonucleotide, complementary RNA, DNA, or protein-nucleic acid (PNA), is used to detect and quantitate gene expression in biopsied tissues in which expression of the polypeptide is correlated with disease.
  • a synthetic oligonucleotide complementary RNA, DNA, or protein-nucleic acid (PNA)
  • PNA protein-nucleic acid
  • the diagnostic assay may be used to distinguish between absence, presence, and over expression of the binding partner, or to monitor expression following an initial diagnosis or during therapeutic intervention.
  • the detection of over expression of EDD and/or progesterone receptor is preferred.
  • Co-localization of expression of several binding partners in a particular cell, tissue or organ is also indicative of disease.
  • hybridization with PCR probes capable of detecting the nucleic acid (RNA or genomic DNA) encoding a binding partner is used.
  • the specificity of the probe is determined by its nucleotide sequence and the stringency of the hybridization or amplification (maximal, high, intermediate, or low). Generally, highly specific probes are preferred for use under more stringent conditions.
  • a normal or standard profile for expression of the partners is established, such as, for example, by combining body fluids or cell extracts taken from normal subjects with nucleic acid encoding the binding partners or a portion thereof, under conditions suitable for hybridization or amplification. Standard hybridization is then quantified by comparing the values obtained from normal subjects with the signal obtained using a known amount of a substantially purified nucleic acid. Standard values from normal samples are then compared with values from patient samples. Deviation between standard and subject values is diagnostic of the disease. Once a diagnosis is made by this or another method, hybridization assays are carried out to evaluate expression of the binding partners over time, or during a course of treatment.
  • RNA encoding EDD and/or its cognate binding partners particularly the progesterone receptor
  • biopsied tissue from an individual indicates a predisposition for the development of the disease, or is otherwise diagnostic of the disease, preferably prior to the appearance of actual clinical symptoms.
  • high levels of these transcripts can be indicative of a poor prognosis for survival.
  • Methods that are used to quantitate the expression include radiolabeling or biotinylating nucleotides, coamplification of a control nucleic acid, and the use of standard curves onto which the experimental results are interpolated (Melby et al., J. Immunol. Methods, 159, 235-244, 1993; Duplaa et al., Anal. Biochem. 212, 229-236, 1993).
  • a further embodiment of the present invention provides methods for determining a modulator of the activity, formation or stability of an isolated or recombinant protein complex comprising:
  • a nuclear protein selected from the group consisting of a protein having tumor suppressor activity, a protein having cell cycle modulatory activity, a protein associated with DNA repair or damage, a nuclear targeting protein, a progesterone receptor protein and a protein associated with vascularization or a portion of said protein sufficient to bind to said EDD protein or said portion of an EDD protein.
  • the protein complex is selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising EDD and importin alpha-3; (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor.
  • the modulator can enhance complex formation or stability or alternatively, partially or completely inhibits formation of the protein complex, prevent complex formation or enhance complex turnover in cells.
  • the modulator facilitates or enhances EDD and/or progesterone receptor turnover, particularly in cancer cells.
  • the methods of the present invention comprise determining the association or dissociation of the protein complex, or the structure of the complex, in the presence and absence of a candidate compound or a candidate antibody.
  • a modified association, dissociation, or structure, of the protein complex in the presence of a candidate compound or a candidate antibody indicates that the candidate is a modulator of the protein complex.
  • association, dissociation, or structure of the complex may be determined by direct means, such as, for example, by determining real time association or dissociation constants in the presence and absence of the candidate, or modified binding of an antibody that recognizes a conformational epitope of the complex.
  • Biosensors used essentially as described herein above, in the presence or absence of the candidate compound or antibody, are particularly suited to such applications.
  • association, dissociation, or structure of the complex may be determined by indirect means, such as, for example, using a protein recruitment system, n-hybrid screen, reverse n-hybrid screen, plate agar diffusion assay, ELISA, or other well known assay format for detecting protein-protein interactions.
  • indirect means generally use a reporter system to detect formation or dissociation of the protein complex.
  • one of the binding partners (e.g. EDD or a portion thereof) is immobilized on a solid matrix, such as, for example an array of polymeric pins or a glass support.
  • the immobilized binding partner is a fusion polypeptide comprising Glutathione-S-transferase (GST; e.g. an EDD-GST fusion), wherein the GST moiety facilitates immobilization of the protein to the solid phase support.
  • GST Glutathione-S-transferase
  • the second binding partner (e.g.
  • progesterone receptor CHK2, CIB, or BRCA2
  • the antibodies are generally labelled with fluorescent molecules or conjugated to an enzyme (e.g. horseradish peroxidase), or alternatively, a second labelled antibody can be used that binds to the first antibody.
  • the second binding partner is expressed as a fusion polypeptide with a FLAG or oligo-histidine peptide tag, or other suitable immunogenic peptide, wherein antibodies against the peptide tag are used to detect the binding partner.
  • oligo-HIS tagged protein complexes can be detected by their binding to nickel-NTA resin (Qiagen), or FLAG-labeled protein complexes detected by their binding to FLAG M2 Affinity Gel (Kodak). It will be apparent to the skilled person that the assay format described herein is amenable to high throughput screening of samples, such as, for example, using a microarray of bound peptides or fusion proteins.
  • a binding partner is immobilized on a solid support, such as by chemical synthesis thereon, or biotin- labelled and used in the liquid phase.
  • a two-hybrid assay is described in US Patent No. 6,316,223 to Payan et al., incorporated herein by reference.
  • the basic mechanism described by Payan et al. is similar to the yeast two hybrid system.
  • the binding partners are expressed as two distinct fusion proteins in a mammalian host cell.
  • a first fusion protein consists of a DNA binding domain which is fused to one of the binding partners
  • a second fusion protein consists of a transcriptional activation domain fused to the other binding partner.
  • the DNA binding domain binds to an operator sequence which controls expression of one or more reporter genes.
  • the transcriptional activation domain is recruited to the promoter through the functional interaction between binding partners. Subsequently, the transcriptional activation domain interacts with the basal transcription machinery of the cell, thereby activating expression of the reporter gene(s), the expression of which can be determined.
  • Candidate bioactive agents that modulate the protein-protein interaction between the binding partners are identified by their ability to modulate transcription of the reporter gene(s) when incubated with the host cell. Antagonists will prevent or reduce reporter gene expression, while agonists will enhance reporter gene expression. In the case of small molecule modulators, these are added directly to the cell medium and reporter gene expression determined.
  • peptide modulators are expressible from nucleic acid that is transfected into the host cell and reporter gene expression determined. In fact, whole peptide libraries can be screened in transfected cells.
  • reverse two hybrid screens such as, for example, described by Vidal et al., Proc. Natl Acad. Sci USA 93, 10315-10320, 1996, may be employed to identify antagonist molecules.
  • Reverse hybrid screens differ from froward screens supra in so far as they employ a counter-selectable reporter gene, such as for example, CYH2 or LYS2, to select against the protein-protein interaction. Cell survival or growth is reduced or prevented in the presence of a non-toxic substrate of the counter-selectable reporter gene product, which is converted by said gene product to a toxic compound.
  • EDD can be expressed as a DNA binding domain fusion, such as with the DNA binding domain of GAL4, and the portion of a progesterone receptor or CHK2 or BRCA2 that binds EDD is expressed as an appropriate transcription activation domain fusion polypeptide (e.g. with the GAL4 transcription activation domain).
  • the fusion polypeptides are expressed in yeast in operable connection with the URA3 counter-selectable reporter gene, wherein expression of URA3 requires a physical relation between the GAL4 DNA binding domain and transcriptional activation domain.
  • This physical relation is achieved, for example, by placing reporter gene expression under the control of a promoter comprising nucleotide sequences to which GAL4 binds.
  • Cells in which the reporter gene is expressed do not grow in the presence of uracil and 5-fluororotic acid (5-FOA), because the 5-FOA is converted to a toxic compound.
  • Candidate peptide inhibitor(s) are expressed in libraries of such cells, wherein cells that grow in the presence of uracil and 5-FOA are retained for further analysis, such as, for example, analysis of the nucleic acid encoding the candidate peptide inhibitors).
  • Small molecules that antagonize the interaction are determined by incubating the cells in the presence of the small molecules and selecting cells that grow or survive of cells in the presence of uracil and 5-FOA.
  • a protein recruitment system such as that described in U.S. Patent No. 5, 776, 689 to Karin et al., is used.
  • a protein-protein interaction is detected in a cell by the recruitment of an effector protein, which is not a transcription factor, to a specific cell compartment.
  • the effector protein Upon translocation of the effector protein to the cell compartment, the effector protein activates a reporter molecule present in that compartment, wherein activation of the reporter molecule is detectable, for example, by cell viability, indicating the presence of a protein-protein interaction.
  • the components of a protein recruitment system include a first expressible nucleic acid encoding a first fusion protein comprising the effector protein and one of the binding partners (e.g. progesterone receptor or a portion thereof or CHK2 or a portion thereof or BRCA2 or a portion thereof), and a second expressible nucleic acid molecule encoding a second protein comprising EDD with the NLS intact.
  • the reporter molecule in this context would comprise a molecule or cellular event that is regulated by the effector protein.
  • a cell line or cell strain in which the activity of an endogenous effector protein is defective or absent e.g.
  • a yeast cell or other non-mammalian cell is also required, so that, in the absence of the protein-protein interaction, the reporter molecule is not expressed.
  • a complex is formed between the binding partner moiety of the fusion polypeptide and EDD, thereby directing translocation of the complex to the nucleus mediated by an importin protein binding to the EDD NLS, wherein the effector protein then activates the reporter molecule.
  • Such a protein recruitment system can be practiced in essentially any type of cell, including, for example, mammalian, avian, insect and bacterial cells, and using various effector protein/reporter molecule systems.
  • a yeast cell based assay can be performed in which the interaction between EDD and one or more of its binding partners results in the recruitment of a guanine nucleotide exchange factor (GEF) to the plasma membrane, wherein GEF activates a reporter molecule, such as Ras, thereby resulting in the survival of cells that otherwise would not survive under the particular cell culture conditions.
  • GEF guanine nucleotide exchange factor
  • Suitable cells for this purpose include, for example, Saccharomyces cerevisiae cdc25-2 cells, which grow at 36°C only when a functional GEF is expressed therein (Petitjean et al., Genetics 124, 797-806, 1990) Translocation of the GEF to the plasma membrane is facilitated by a plasma membrane localization domain.
  • Activation of Ras is detected, for example, by measuring cyclic AMP levels in the cells using commercially available assay kits and/or reagents.
  • duplicate incubations are carried out in the presence and absence of a test compound, or in the presence or absence of expression of a candidate modulatory peptide in the cell.
  • Reduced survival or growth of cells in the presence of a candidate compound or candidate peptide indicates that the peptide or compound is an antagonist of the interaction between EDD and one or more of its binding partners.
  • a "reverse" protein recruitment system is also contemplated, wherein modified survival or modified growth of the cells is contingent on the disruption of the protein-protein interaction by the candidate compound or candidate peptide.
  • NIH 3T3 cells that constitutively express activated Ras in the presence of GEF can be used, wherein the absence of cell transformation is indicative of disruption of the protein complex by a candidate compound or peptide.
  • NIH 3T3 cells that constitutively express activated Ras in the presence of GEF have a transformed phenotype (Aronheim et al., Cell. 78, 949-961 , 1994)
  • small molecules are tested for their ability to dissociate the protein complex of the invention, by an adaptation of plate agar diffusion assay described by Vidal and Endoh, TIBS 17, 374-381, 1999, which is incorporated herein by reference.
  • a modulator is determined by a process comprising: (i) determining the level of a protein complex selected from the group consisting of: (i) a complex comprising EDD and CHK2; (ii) a complex comprising EDD and BRCA2; (iii) a complex comprising EDD and CIB; (iv) a complex comprising EDD and importin alpha-1 ; (v) a complex comprising
  • EDD and importin alpha-3 (vi) a complex comprising EDD and importin alpha-5; and (vii) a complex comprising EDD and progesterone receptor in the absence of a candidate compound or candidate antibody;
  • This embodiment of the invention applies mutatis mutandis to the determination of protein complexes comprising a portion of any one or more of the protein binding partners.
  • any one or more of the assay methods for antagonists as described herein above can be adapted for this purpose.
  • the level of the protein complex in the presence or absence of a candidate compound or antibody is related to antibody binding in the case of ELISAs, or to cell survival or growth, in the case of hybrid screens or protein recruitment assays.
  • ELISA-based assay formats are particularly suitable for this purpose, because they are readily quantifiable, by calibrating the detection system against known amounts of a protein standard to which the antibody binds. Such quantitation is well known to the skilled person.
  • the modulators identified using the methods described herein are useful for the therapeutic or prophylactic treatment of hyperproliferative disorders, or disorders associated with aberrant cell cycle regulation, aberrant DNA damage or repair, aberrant vascularization, progestin-sensitive disorders or progesterone receptor- mediated disorders such as, for example, aberrant cell division, tumorigenesis, tumor metastasis, or tumor cell invasion.
  • the modulators are preferably useful for the treatment of one or more symptoms associated with a cancer selected from the group consisting of squamous cell carcinoma, hepatocellular carcinoma, ovarian cancer, breast cancer, melanoma, head and neck cancer, adenocarcinoma, squamous lung cancer, gastrointestinal cancer (eg.
  • the modulators are preferably useful for the treatment of disorders or conditions associated with aberrant vascularisation, such as those disorders associated with excessive vascularisation, eg some forms of aggressive cancer, diabetic blindness, age-related macular degeneration, rheumatoid arthritis and psoriasis, and those disorders associated with insufficient vascularisation, eg coronary artery disease, stroke, and delayed wound healing. Additionally, it is preferable that the modulators are useful for inducing wound healing, stimulating organ regeneration, stimulating follicle development in the corpus luteum, stimulating placental growth during pregnancy and stimulating embryonic growth during pregnancy.
  • the present invention provides a method for treating a condition associated with elevated expression of an EDD protein in a cell, said method comprising administering an amount of a compound effective to reduce EDD expression in a cell.
  • the condition associated with EDD over expression is a cancer, particularly a cancer selected from the group consisting of squamous cell carcinoma, hepatocellular carcinoma, ovarian cancer, breast cancer, melanoma, head and neck cancer, adenocarcinoma, squamous lung cancer, gastrointestinal cancer (eg. gastric, colon, or pancreatic cancer), renal cell cancer, bladder cancer, prostate cancer, non-squamous carcinoma, glioblastoma and medulloblastoma.
  • the inventive method is suitable for preventing any cell advancing into mitosis if administered at an appropriate time and in a suitable amount.
  • the compound administered comprises nucleic acid
  • the nucleic acid is an antagonist of EDD expression, such as, for example, an antisense nucleic acid, peptide nucleic acid (PNA), ribozyme, or interfering RNA, which is complementary, in whole or in part, to a target molecule comprising a sense strand, and can hybridize with the target molecule, in particular, EDD-encoding RNA.
  • PNA peptide nucleic acid
  • ribozyme e.g., ribozyme
  • interfering RNAs Elbashir et al., Nature 411, 494-498, 2001 ; Sharp, Genes Devel. 15, 485-490, 2001; Lipardi et al., Cell 107, 297-307, 2001; Nishikura, Cell 107, 415-418, 2001
  • siRNA small interfering RNAs
  • the antisense nucleic acid, ribozyme, PNA, interfering RNA or siRNA comprises a sequence that is complementary to at least about 15-20 contiguous nucleotides of a sequence having at least about 80% identity to SEQ ID NO: 1 or SEQ ID NO: 3 (ie. it is complementary to EDD-encoding mRNA) and can hybridize thereto.
  • such antagonistic nucleic acid can be complementary to a target nucleic acid having the sequence of SEQ ID NOs:1 or 3 or a portion thereof sufficient to allow hybridization.
  • Longer molecules, comprising a sequence that is complementary to at least about 25, or 30, or 35, or 40, or 45, or 50 contiguous nucleotides of EDD-encoding mRNA are also encompassed by the present invention.
  • interfering RNA particularly siRNA is preferred for down-regulating EDD expression in a cell, thereby inhibiting cellular proliferation and causing cells to accumulate in the G2/M phase of the cell cycle, or causing altered cell-cell contacts, altered cell shape and disorganisation.
  • interfering RNAs generally comprise an RNA molecule having a region of self- complementarity capable of forming a double stranded RNA.
  • a construct comprising an antisense nucleic acid, ribozyme, PNA, interfering RNA or siRNA, can be introduced into a suitable cell to inhibit EDD expression and/or activity therein.
  • a construct can be introduced into some or all of the cells of a mammal.
  • the antisense nucleic acid, ribozyme, PNA, or interfering RNA inhibits EDD expression and the subsequent formation of deleterious protein-protein complexes involving an EDD protein. Accordingly, a cancer, or a hyperproliferative process that is mediated by EDD in the cell containing the construct is inhibited.
  • antibodies of the present invention can inhibit binding of a ligand (i.e., one or more ligands) to a mammalian EDD protein and/or can inhibit one or more functions mediated by a mammalian EDD protein in response to ligand binding.
  • the antibodies can inhibit (reduce or prevent) the interaction of EDD with a natural ligand such a the progesterone receptor.
  • One or more agents can be administered to the host by an appropriate route, either alone or in combination with another drug.
  • An effective amount of a nucleic acid or antibody agent having antagonist or agonist activity is administered.
  • An effective amount is an amount sufficient to achieve the desired therapeutic or prophylactic effect, under the conditions of administration, such as an amount sufficient for inhibition or promotion of EDD function.
  • EDD EDD
  • specific cells or tissues such as, for example, a cancer tissue or cell
  • Antibodies recognizing tumor-specific antigens have been used to deliver cytotoxic drugs to tumors.
  • Antibodies recognizing tumor-specific antigens can be conjugated to the active compound, however in the case of solid tumors, such immunoconjugates may be less effective in penetrating tumor tissue.
  • HN-1 a peptide that is specifically internalized by human squamous carcinoma
  • solid tumor tissue cells such as breast cancer cells.
  • an anticancer compounds that targets an Edd gene expression product can be conjugated to HN-1 and administered specifically to tumor tissue such as, for example, a squamous cell carcinoma (e.g.
  • conjugates can be delivered by intravenous administration, intratumoral administration, subcutaneous administration, intraperitoneal administration or topical administration.
  • the conjugate is administered by local, regional or systemic administration.
  • nucleic acid encoding an inhibitor of an EDD expression product such as, for example nucleic acid encoding siRNA capable of targeting Edd gene over expression or the formation of an EDD-containing protein complex
  • a suitable tumor-specific promoter sequence for example, an infectious recombinant viral vector expressing the RNA can be targeted to tumor cells through cellular surface receptors by genetic or biochemical modification of the viral surface.
  • cancer cells are targeted at the transcriptional level using lineage-specific promoters that restrict expression of the effector gene to a tumor cell and any related normal cell derived from the same developmental lineage.
  • tumor types that have been targeted in this manner include tumors of the colon, lung; breast, hepatocellular carcinoma and melanoma.
  • Tumor-specific promoters/enhancers have also been used in a therapeutic approach called “virus-directed enzyme/prodrug therapy” (VDEPT), wherein tumor-killing efficacy can be enhanced with reduced side effects on normal cells (the so-called “bystander effect”).
  • VDEPT virus-directed enzyme/prodrug therapy
  • AFP alpha-fetoprotein
  • the alpha-fetoprotein (AFP) promoter/enhancer cassette has been utilized to control E1 expression from an Adenoviral vector, to induce a virus-mediated oncolytic effect on hepatocellular carcinoma.
  • a tumor specific replication competent adenoviral (TSRCA) vector comprising the alpha-fetoprotein promoter to deliver a gene encoding siRNA is particularly preferred.
  • TSRCA tumor specific replication competent adenoviral
  • the "Complementary-Adenoviral Vector System” as described in US Patent Publication No. 20020142989 may be employed.
  • the compound effective in reducing EDD expression can be administered in the form of a liposome such as a cationic liposome.
  • routes of administration including, but not necessarily limited to oral, dietary, topical, parenteral (e.g., intravenous, intra-arterial, intramuscular, subcutaneous injection), and inhalation (e.g., intrabronchial, intranasal or oral inhalation, intranasal drops) routes of administration, depending on the agent and disease or condition to be treated.
  • parenteral e.g., intravenous, intra-arterial, intramuscular, subcutaneous injection
  • inhalation e.g., intrabronchial, intranasal or oral inhalation, intranasal drops
  • Formulation of an agent to be administered will vary according to the route of administration selected (e.g., solution, emulsion, capsule).
  • An appropriate composition comprising the agent to be administered can be prepared in a physiologically acceptable vehicle or carrier.
  • suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils, for instance.
  • Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers and the like (See, generally, Remington's Pharmaceutical Sciences, 17th Edition, Mack Publishing Co., Pa., 1985).
  • the agent can be solubilized and loaded into a suitable dispenser for administration (e.g., an atomizer, nebulizer or pressurized aerosol dispenser).
  • the agent can be administered via in vivo expression of the recombinant protein.
  • In vivo expression can be accomplished via somatic cell expression according to suitable methods (see, e.g. U.S. Pat. No. 5,399,346).
  • nucleic acid encoding the protein can be incorporated into a retroviral, adenoviral or other suitable vector (preferably, a replication deficient infectious vector) for delivery, or can be introduced into a transfected or transformed host cell capable of expressing the protein for delivery.
  • the cells can be implanted (alone or in a barrier device), injected or otherwise introduced in an amount effective to express the protein in a therapeutically effective amount.
  • the present invention clearly excludes any previously disclosed isolated protein complex consisting solely of EDD protein and TopBPI .
  • Ovarian tumor tissue and matched blood or normal ovarian tissue were obtained from 98 patients and DNA extracted as described previously (Obata et al, Cancer Res. 58, 2095-2097, 1998). Metastatic melanoma tissue and matched blood or normal skin tissue were obtained from 20 patients and DNA isolated as reported previously (Indsto et al, Cancer Genet Cytogenet 100, 68-71 , 1998). DNA was extracted from matched normal and hepatocellular carcinoma tissue samples microdissected from 19 primary liver tumors (Macdonald et al, Hepatology 28, 90- 97, 1998). For Al analysis, paraffin-embedded breast cancers and normal blood were obtained from 24 patients.
  • Tumor location was determined by haemotoxylin and eosin staining and cells were microdissected from 4-5 adjacent sections. DNA was extracted in lysis buffer (0.45% Tween 20, 5mg/ml proteinase K, 0.25% BSA) at 55°C for 8 hours, then boiled for 10 min. DNA was extracted from blood using a Puregene DNA isolation kit (Gentra Systems, Minneapolis, MN).
  • RT-PCR breast cancer samples were collected at the time of surgery. Normal breast tissue (based on histological examination) was removed from unaffected regions of the breast at the same time as excision of the cancer.
  • Paraffin-embedded archival samples from 12 squamous cell carcinoma of the anterior tongue and matched lymph nodes were from a series described by Bova et al (Bova et al, Clin. Cancer Res. 5, 2810-2819, 1999). Areas of malignant squamous cells were identified by a pathologist from haemotoxylin and eosin stained slides and were microdissected from unstained adjacent 10 ⁇ m sections under a light microscope. Normal tissue was gained from uninvolved lymph nodes and/or microdissected from areas of normal cells surrounding the squamous cell carcinoma. Samples were digested in 250 ⁇ l of proteinase K (2mg/ml) for 5 days at 37°C with constant agitation. The digest was then extracted once with phenol, once with chloroform, and DNA precipitated in ethanol overnight and re-dissolved in 30 ⁇ l of TE buffer ("microdissected DNA").
  • a human P1 genomic library (Incyte Genomics, CA) was screened with two cDNA probes covering 4kb of the EDD coding sequence (Callaghan et al, Oncogene 17, 3479-3491 , 1998).
  • DNA from positive clones was extracted, digested with Hinc II, separated by gel electrophoresis and re-screened by Southern blotting using an oligonucleotide probe (CA) 15 .
  • Positive genomic DNA fragments were cloned into pBIuescript and sequenced which identified a novel dinucleotide repeat microsatellite CEDD (CA repeat near EDD).
  • EDD genomic sequence became available (Genbank Accession: AC021004) and CEDD was located in an intron between bases 2616 and 2617 of the EDD coding sequence.
  • the minimum size of the EDD gene is 100 kb, consisting of at least 46 exons.
  • Microsatellite analysis was used to determine the frequency and distribution of Al on 8q22.3-24.13 using CEDD, 586F18b and seven other dinucleotide and tetranucleotide repeat polymorphic markers mapped in this region (Genome Database, www.gdb.org/) ( Figure 1).
  • CEDD, D8S326, D8S257, D8S300, D8S545 and D8S85 were used for analysis of ovarian cancers, hepatocellular carcinoma, metastatic melanoma and squamous cell carcinoma of the tongue.
  • the additional markers 586F18b, MYC-PCR.3 and D8S198 were used for analysis of breast cancers.
  • Primer pairs were obtained from Research Genetics (Huntsville, AL) and Pacific Oligos (Lismore, Australia). Ovarian DNA was analyzed by radio-isotope based methods as previously described (Obata et al, Cancer Res. 58, 2095-2097, 1998). For DNA from other tissues, in each PCR reaction the forward primer was labeled with either 6-FAM or TET fluorescent label. Reactions were performed using 40-60 ng of DNA from hepatocellular carcinoma and metastatic melanoma, 1 ⁇ l of breast cancer extracted DNA or 2-3 ⁇ l microdissected DNA from squamous cell carcinoma of the tongue.
  • the PCR reaction components were as follows: 10 mM Tris-HCI, pH 8.3; 50 mM KCI; 66 ⁇ M dNTP mix; 1.5 mM MgCI 2 ; 5 pmoles of both forward and reverse primer and 0.8 U of Amplitaq Gold DNA polymerase (Applied Biosystems, Sydney, Australia).
  • PCR conditions for microsatellites D8S326, D8S257, D8S545, D8S85, D8S198 and MYC-PCR.3 were: 12 min hotstart 95°C; 35 cycles (40 for microdissected DNA) of (1) 94°C 15 s, (2) 60°C 15 s (66°C for CEDD, 52°C for 586F18b) and (3) 72°C 30 s; 5 min 72 °C; 4 °C hold.
  • Amplification of the CEDD microsatellite from microdissected DNA required a 30s annealing step, a 1 min extension step, and 35 cycles.
  • Amplification of the microsatellite D8S300 was performed as follows: 12 min hotstart 95 °C; 35 cycles of (1) 94 °C 30 s, (2) 60°C 30s and (3) 72°C 60s; 5 min 72°C; 4°C hold. No PCR products could be obtained from DNA recovered from paraffin embedded tongue carcinoma with D8S300 primers, presumably because of DNA shearing.
  • Duplicate fluorescent products were separated on an ABI 377 DNA Sequencer (Applied Biosystems) and analyzed using Genescan and Genotyper software (Applied Biosystems). Ambiguous results were resolved on separate gels.
  • Al in hepatocellular carcinoma and breast cancer was defined by a reduction in relative fluorescence of heterozygous allele peaks by at least 30% in the tumor DNA compared to the matched normal DNA.
  • a reproducible difference of 20-30% in metastatic melanoma was considered significant due to the higher level of contaminating normal DNA present in these samples.
  • a difference of 50% or more was considered to represent Al in squamous cell carcinoma DNA due to a lower level of normal cellular DNA contamination in these samples.
  • Allelic imbalance is indicative of either loss or amplification of an allele and (presumably) the surrounding chromosomal region.
  • loss of heterozygosity LH is not readily distinguishable from amplification by this method, particularly when there is a significant degree of cross-contamination of tumor with normal DNA.
  • LDH loss of heterozygosity
  • FISH FISH analysis was carried out by Erica Woollatt at the Women's and Children's Hospital, Sydney, Australia.
  • Two P1 plasmids encoding approximately 100kb of EDD genomic sequence used for fluorescence in situ hybridization (FISH) were nick-translated with biotin-14-dATP and hybridized at a final concentration of 20 ng/ ⁇ l to metaphases from the breast cancer cell lines MDA-MB-436, SKBR-3, BT- 20 and BT-483.
  • the single copy FISH method was modified from that previously described (Callen et al, Ann. Genet.
  • chromosomes were stained before analysis with both propidium iodide (as counterstain) and DAPI (for chromosome identification). Images of metaphase preparations were captured by a CCD camera using the ChromoScan image collection and enhancement system (Applied Imaging, Newcastle, UK).
  • PCR primers for EDD were designed within 300 bases of the polyA addition site. The sequences of EDD specific primers were: forward EDD-407F GCTAGTCACCAACTTCTGGGTCTAA (SEQ ID NO: 26), reverse EDD-490R CAGCAAAAAGATAAATCACAGTGTAAATT (SEQ ID NO: 27), fluorescent probe EDD-433T FAM-CCCAGCCAAAGATGACAGCAGAACAAC- TAMRA (SEQ ID NO: 28).
  • DNA was extracted from the above cell lines using a DNA extraction kit (Stratagene, Sydney, Austalia). PCR reactions to determine genomic copy number utilized the reverse primer from above (unless mentioned).
  • Trizol reagent Life Technologies, Rockville, MD, USA
  • Levels of gene expression in the cancer samples was then determined by analyzing the transcribed cDNA samples using customized Affymetrix GeneChip® microarrays that comprise 59,618 oligonucleotide probe sets. These probe sets facilitate analysis of 46,000 gene clusters, representing over 90% of the predicted expressed genome.
  • Gene expression in 52 different tissues of the body was also determined using the previously described methods to facilitate the identification of changes in gene expression that are specific for ovarian cancer.
  • RNeasy Maxi Kit Qiagen
  • cDNA was synthesized using the Expand Reverse Transcriptase System (Boehringer Mannheim, Sydney, Australia). 2 ⁇ g total RNA and 2 ⁇ l oligo dT (Boehringer Mannheim) was made up to 22 ⁇ l with water, heated at 65 °C for 10 min and cooled on ice followed by addition of 8 ⁇ l Expand Reverse Transcriptase buffer (5x; 250 mM Tris-HCI, 200 mM KCI, 25 mM MgCI 2 , 2.5 % Tween 20 (v/v), pH 8.3), 1 mM each dATP, dCTP, dGTP and dTTP, 10 mM DTT and 2 ⁇ l (100U) Expand Reverse Transcriptase.
  • Expand Reverse Transcriptase buffer 5x; 250 mM Tris-HCI, 200 mM KCI, 25 mM MgCI 2 , 2.5 % Tween 20 (v/v), pH 8.3
  • the reverse transcriptase reaction was then performed at 42 °C for 45-60 min. Ten PCR products were designed to cover the entire 8.5 kb coding region of the EDD gene. PCR reactions included 3 ⁇ l of the reverse transcriptase reaction, 10 pmol of each primer, 1.75 units Expand High Fidelity DNA polymerase (Boehringer) and 1.5 mM MgCI 2 . Amplification was carried out using the following protocol: 2 min denature at 94 °C; 10 cycles of 30s denature, 30s annealing and 60s extension at 72°C; 24 cycles of 30s denature, 30s annealing and 60s extension with a 5s increase per cycle; 5 min extension.
  • Annealing temperatures depended on the primers used (primer sequences available on request).
  • PCR products were purified using the QIAquick PCR purification system (Qiagen) and quantitated by visualization on a gel. Sequencing reactions were performed at the Australian Genome Research Facility (Brisbane, Australia) and sequence analysis and assembly were performed using Editview and Autoassembler software, respectively (Applied Biosystems).
  • EDD immunohistochemistry Immunohistochemistry was performed on paraffin-embedded, formalin-fixed breast (9 normal breast and 46 breast cancers), general ovarian tissues (94 ovarian cancers) and 165 serous ovarian cancer tissues. Paraffin-embedded embryonic neural tissues from wild-type and EDD; ;" (knockout) mice were used as positive and negative controls, respectively. Paraffin-embedded cell pellets from the WT-30 cell line, which overexpresses EDD (Henderson et al., 2002) were used as an additional positive control. Sections were dewaxed and rehydrated before unmasking in target retrieval solution (high pH: DAKO Corporation, Carpenteria, CA) in a waterbath, at 100°C for 30 min.
  • target retrieval solution high pH: DAKO Corporation, Carpenteria, CA
  • streptavidin-biotin peroxidase detection system was used according to the manufacturer's instructions (Vectastain Elite kit; Vector Laboratories) with 3,3'- diaminobenzidine as substrate. Counterstaining was performed with Mayer's hematoxylin (DAKO Corporation).
  • EDD expression scores were determined by combining the percentage of cells expressing EDD (range of 1-4 for 1 %-100% cells stained) and intensity of staining (range of 0-3). A combined score of 0 was called no expression, a score in the range of 1-5 was low expression and a score of 6 and 7 was called high expression.
  • EDD expression and the proportion (percentage) of EDD positive cells in the serous ovarian cancer tissues were correlated with various clinicoathological parameters of ovarian disease (as shown in Table 2) in order to determine whether or not EDD expression is a prognostic marker of outcome of serous ovarian cancer.
  • Table 2 various clinicoathological parameters of ovarian disease
  • the frequency of Al surrounding the EDD locus (8q22.3) was investigated in malignant and pre-malignant ovarian tumors, breast cancers, hepatocellular carcinoma, metastatic melanoma and squamous cell carcinoma of the anterior tongue using nine microsatellites shown with their locations in Figure 1.
  • CEDD and 586F18b are located within introns of the EDD gene it can be assumed that chromosomal loss or gain involving these alleles is equivalent to loss or gain of an EDD allele.
  • the ovarian tumor set was comprised of several cancer subtypes (predominantly mucinous, endometrioid and serous), borderline and non-malignant benign tumors.
  • cancer subtypes predominantly mucinous, endometrioid and serous
  • borderline subtypes
  • non-malignant benign tumors within the cancer group 48% (34/71 ) displayed Al at one or more markers in the region ( Figure 2).
  • benign and borderline tumors exhibited only 1/23 and 1/5 cases of Al, respectively, involving several microsatellites but not CEDD or DS8257 (Table 1 ). Because of the low frequency of involvement of 8q22.3-8q23.3 in benign and borderline tumors they were omitted from the following analysis.
  • microsatellites were introduced to provide more information about Al at the EDD locus (586F18b) and at the telomeric region of 8q around MYC (8q24.12) (D8S198 and MYC- PCR.3).
  • Al was common on 8q with 16/24 (67%) breast cancers displaying Al at one or more markers (Table 1).
  • CEDD or 586F18b were involved in 6/16 (38%) of informative cases.
  • Al involved MYC-PCR.3 or D8S198, consistent with the frequent amplification of MYC in breast cancer, but in the majority of cancers Al was not continuous from 8q22.3 to 8q24 (examples shown in Figure 1).
  • EDD mRNA expression levels were determined by quantitative RT-PCR in 41 breast cancers, and in matched normal breast tissue controls for 14 of these cases (Figure 3A). Although the majority of cancers expressed EDD mRNA within the normal range, a significant number 11/41 (27%) had higher expression. Elevated expression was even more apparent when cancers were compared to their matched normal tissue controls, such that 6/14 (43%) cancers had > 4-fold increase in EDD expression, including one cancer with a 159-fold increase (Inset Figure 3A). Samples were also analysed for expression of several control genes, which controlled for epithelial content (CK18), cellular metabolism (GAPDH), general transcriptional activity (IF2B) or proliferation rate (MCM3) of the tumors analysed. EDD expression was not significantly altered when normalised to the expression of these genes.
  • CK18 epithelial content
  • GPDH cellular metabolism
  • IFN2B general transcriptional activity
  • MCM3 proliferation rate
  • EDD protein levels were determined by immunohistochemistry in 9 specimens of normal breast tissue, 46 breast carcinomas and 94 serous ovarian carcinomas. Positive controls of wild-type EDD embryonic mouse neural tissue (Figure 4B) and WT-30 cells (not shown) demonstrated intense nuclear staining while no expression was seen in EDD null embryonic mouse neural tissue ( Figure 4A). Of 9 normal breast samples, 4 had no detectable expression and 5 had low level expression of EDD ( Figure 4C). Of 46 breast carcinomas, all expressed EDD and demonstrated either low intensity (37%) or high intensity (63%) nuclear staining ( Figure 4D). Among the 94 serous ovarian carcinomas, 2% failed to express EDD while 59% had low (Figure 4E) and 39% had high expression (Figure 4F).
  • CA II carbonic anhydrase II
  • EDD expression levels correlate with patient survival in all type of ovarian cancer studied. Furthermore, EDD protein levels correlate significantly with disease relapse. Accordingly, EDD expression levels (mRNA or protein) are clearly predictors of patient survival and disease relapse.
  • EDD coding region mutations are apparently rare in cancer. Sequencing of the large EDD mRNA (8397 nt) revealed only 2/25 cancer cell lines with single nucleotide changes that result in amino acid changes. These alterations might represent rare polymorphisms rather than mutations as none of the changes were clearly disruptive and occurred in regions of the protein without any predicted functional significance. A splicing variant was found but this was present along with the unspliced transcript in every normal and cancer cell type examined.
  • EDD cDNAs used for in vitro translation, transfection and yeast two-hybrid screening are shown in Figure 5A.
  • EDDM, EDDF3M and EDDF5M contain a mutation (Cys2768 to Ala) at the active site cysteine necessary for E3 ligase activity in HECT proteins.
  • restriction fragment cloning was used to generate in vitro translation constructs expressing EDD aa 1-577 (EDDFIa), 578-889 (EDDFI b), 1-419 (EDDFIc), and 420-889 (EDDFId) ( Figure 5A).
  • EDD cDNA fragments used as baits were cloned from pBluescript-EDD (Callaghan et al, Oncogene 17, 3479-3491 , 1998) in frame with the Gal4 DNA binding domain (DBD) of the pAS2.1 vector (Clontech Laboratories, Palo Alto, CA, USA).
  • DBD Gal4 DNA binding domain
  • EDD-derived cDNAs were transcribed from pBluescript (Amersham Pharmacia Biotech, UK), pSG5 (Stratagene, La Jolla, CA, USA) or pRcCMV (Invitrogen, Gronigen, Netherlands) vectors.
  • a GST fusion of mouse importin ⁇ 1 (PTAC97), was expressed and purified as described previously (Hubner et al, 1997).
  • Full-length CIB was cloned from the pACT2 vector into the pGEX2T vector for GST-CIB fusion protein expression in bacteria and into the pCMVTag2C vector for mammalian expression of FLAG- tagged protein.
  • full length EDD was cloned into pEGFP-C1 (for N-terminal EGFP tag) and pEGFP-N1 (for C- terminal EGFP tag, Clontech Laboratories).
  • phPR1 vector encoding human PR B was obtained from P. Chambon (INSERM, France).
  • a PRE-luciferase reporter vector (pMSGIuc) was constructed by insertion of a MMTV-LTR promoter in the pGL3-Basic vector (Promega Corp.).
  • the phPR1 vector was used to clone the PR(AB) (aa 1-546) and PR(CDE) (aa 456-933) regions into pGEX4T2 for GST fusion protein expression.
  • vitamin D receptor pCMV-VDR along with pOS2-luc reporter vector were obtained from G. Leong (Garvan Institute, Australia).
  • Estrogen receptor was expressed from pCMV-ER (V.C. Jordan, Northwestern University Medical School, Chicago, USA) and pERE-TK-GL3 reporter vector was obtained from M. Parker (ICRF, UK).
  • SRC-1 was cut from pCR3.1-SRC1A (B. O'Malley, Baylor College, Texas) and cloned into pBluescript.
  • Yeast two-hybrid assay for EDD interacting proteins The cDNAs for full length EDD mutant and carboxy domain mutants (EDDM and EDD5M) were screened against a human placenta cDNA library in the pACT2 vector by the yeast two-hybrid method (Matchmaker 2, Clontech, Palo Alto, CA, USA). Stable transformants of Saccharomyces cerevisiae strain Y190 expressing EDD fusion protein were transformed with the library using the lithium acetate method and 2-3 x 10 6 primary transformants selected on his-leu-trp- plates. Following a second round of selection on the same medium, colonies were assayed for ⁇ .galactosidase activity using a filter-based assay.
  • Interacting plasmids that were positive for ⁇ .galactosidase only in the presence of the EDD bait plasmids were transformed into E. coli DH5 ⁇ cells for further analysis.
  • Manual sequencing was carried out using 33 P end-labelled primer in conjunction with the fmol Cycle sequencing kit (Promega Corp., Madison, Wl, USA). Sequences were analysed by Blast searches of the Genbank and EMBL databases and predicted proteins analysed for motifs using the ISREC Profile Scan Server (www.isrec.isb- sib.ch).
  • CG1945 yeast cells containing pAS2.1-EDD constructs were mated with Y187 yeast cells harbouring pACT2- derived plasmids. Diploids were selected on leu-trp- plates and used to inoculate cultures which were grown to saturation, diluted 1 :10 and grown for 16h. Yeast cells were harvested for protein and ⁇ .galactosidase activities were determined in a liquid chemiluminescence assay (Tropix Galacto-Light System, Applied Biosystems, CA, USA).
  • GST-tagged fusion proteins were prepared from E. coli strain BL21 according to established protocols (Pharmacia Protocol Handbook). Soluble fusion proteins were bound to glutathione agarose and quantitated via Coomassie blue staining against protein standards. 35S-labelled EDD protein and mutants or SRC-1 were synthesised in a coupled in vitro transcription/translation system (TNT Quick, Promega) and 10-20 ⁇ l reaction mixture was diluted in 1% Triton X-100 lysis buffer (Callaghan et al, Oncogene 17, 3479-3491 , 1998) and incubated with 5 ⁇ g of GST, GST-importin ⁇ 5, GST-PR(CDE) or GST-CIB coupled to glutathione agarose beads at 4°C for 2h. Beads were collected by centrifugation, washed extensively in lysis buffer and resuspended in SDS-PAGE sample buffer. After boiling, bound protein was visualised following SDS-PAGE and autoradiography.
  • HEK 293 and T-47D were maintained as previously described (Callaghan et al, Oncogene 17, 3479-3491 , 1998).
  • MCF-7 cells were maintained in RPMI medium (Life Biotechnologies) containing 10 % serum in 5% C02.
  • RPMI medium Life Biotechnologies
  • 3 x 10 6 HEK 293 cells were plated in HMEM containing 10% serum in 15cm petri dishes.
  • pRcCMV-EDD (10 ⁇ g) was added to the cells along with 30 ⁇ l Fugene reagent (Roche Diagnostics, Castle Hill, NSW, Australia).
  • GFP-tagged and endogenous EDD protein HEK 293, CHO, MCF-7 or T-47D cells were seeded in 6-well plates at 1-2 x 10 5 cells/well. Cells were transfected with 2 ⁇ g pEGFP-EDD or empty vector DNA and the following day split to chamber slides for 24-48h. Slides were washed in PBS, fixed in 3.7% paraformaldehyde, washed in PBS and mounted in 90% glycerol. GFP was visualised by fluorescence microscopy. For immunostaining, HEK 293 cells or EDD transfected HEK 293 cells (WT30) were embedded in paraffin.
  • Sections were de-waxed and rehydrated before unmasking in EDTA/Citrate buffer and then stained with goat anti-EDD antibody N19 (Santa Cruz, CA, USA). EDD signal was detected using DAKO LSAB Plus Link and Label (DAKO Corporation, CA, USA) with liquid 3,3'-diaminobenzidine Plus (DAKO Corporation, CA, USA) as substrate. Counterstaining was performed with hematoxylin.
  • Stable HEK 293 cells overexpressing EDDM were transfected with pCMVTag2C- CIB or empty vector using Fugene 6 reagent (Roche) for 24h. Following 6h incubation in the presence of MG132, cells were harvested and lysates prepared and one mg total protein incubated with anti-FLAG antibody M2 coupled to Sepharose (Sigma Chemical Co., St Louis, USA) for 2h at 4°C. Beads were recovered by centrifugation and washed extensively in lysis buffer. Western blotting for EDD has been described (Callaghan et al, Oncogene 17, 3479-3491 , 1998).
  • Nuclear receptor transactivation assays HEK 293 or COS7 cells were plated in 6-well plates (2 x 10 5 cells/well) and the medium changed to 2% charcoal-stripped FCS the following day. Transfection was carried out using 3-4 ⁇ l Fugene 6 Reagent (Roche) with 1-2 ⁇ g DNA comprised of 90ng receptor expression vector, 450ng luciferase reporter vector and 1.2 ⁇ g EDD, EDDM or SRC-1 cDNAs in either pRcCMV or pSG5, or empty vector, and 200ng GFP expression vector pGFP20. The following day cells were split into 96-well plates (7 x 10 3 cells/well) or 6-well plates (1.4 x 10 5 cells/well), and drugged 24h later.
  • pRSV- ⁇ -gal or pRL-TK Promega Corp., Madison, USA
  • vectors were transfected in place of pGFP20 and transfection efficiency monitored by assaying for ⁇ -galactosidase or Renilla luciferase activity respectively.
  • HEK 293 cells were plated at 3 x 10 5 cells/well of a 6-well dish in miminal essential medium with Hanks' salts (HMEM) supplemented with 10 % fetal bovine serum (Life Technologies, Gaithersburg, MD, USA). After 48h, medium was replaced with medium containing 20 ⁇ M MG132 (Calbiochem, CA, USA) or DMSO vehicle for 2-6h.
  • HMEM Hanks' salts
  • MCF-7 cells were incubated in RPMI containing 0.5% foetal bovine serum for 18h before addition of phleomycin (Cayla, France) at 100 ⁇ g/ml, hydroxyurea (Calbiochem, CA, USA) at 2mM or PBS vehicle, for 6h. Cells were harvested for total protein or nuclear protein extracts as described above.
  • zf-UBR1 (Pfam PF02207, (Bateman et al, Nucleic Acids Res 28, 263-266, 2000)), originally identified in the N-end rule E3 ubiquitin ligase UBR1 p/N-recognin from a range of species (Bartel et al, EMBO J. 9, 3179-3189, 1990; Varshavsky, Cell 69, 725-735, 1992; Kwon et al, Proc. Natl. Acad. Sci. USA 95, 7898-7903, 1998).
  • This central region of EDD also contains a potential bipartite nuclear localisation sequence (NLS), (KLKRTSPTAYCDCWEKCKCK, aa 1222- 1241 ; SEQ ID NO: 43) while another putative NLS resides in the N-terminal region (RKKMLEKARAKNKKPK, aa 502-517; SEQ ID NO: 44) upstream of a potential SV40 large T antigen-like NLS (PYKRRR, aa 630-635; SEQ ID NO: 45) (Dingwall et al, Trends Biochem Sci 16, 478-781 , 1991 ).
  • NLS potential bipartite nuclear localisation sequence
  • UAA domain also within the N-terminal region of EDD is another region conserved with HYD, designated as a "UBA domain" (aa 188-225), which may form a protein-protein interaction interface (Hofmann et al, TIBS 21, 172-173, 1996).
  • Amino terminal to the HECT domain (aa 2391-2455) lies still another region that may mediate protein interactions.
  • This 60 amino acid stretch shows 50% homology to a region within the carboxy terminus of polyA binding proteins (PABP-C) from a range of species (Callaghan et al, Oncogene 17, 3479-3491 , 1998; Kozlov et al, Proc. Natl. Acad. Sci. USA 98, 4409-4413, 2001).
  • yeast two-hybrid approaches were used to identify interacting proteins that may be ubiquitinylation targets of EDD or other associating proteins with a role in EDD function.
  • yeast two-hybrid screening of a human placental cDNA expression library was performed against baits encoding full length EDD or fragments containing one or more potential interaction domains of EDD (see Figure 5A).
  • Screening with full length EDDM (C2768A mutant) identified two independent cDNAs encoding the nuclear import protein importin ⁇ 5 (NPI-1, (O'Neill et al, Virology 206, 116-125, 1995; Kohler et al, Mol. Cell Biol.
  • Importin ⁇ has a specific role in nuclear import, by recognising NLSs, implying both that one or more of the potential NLSs within EDD are indeed functional, and that EDD may have a role in the nucleus, with importin ⁇ involved in transporting EDD from the cytoplasm to the nucleus.
  • the amino terminal one-third of the EDD protein contains two potential basic NLSs, one bipartite and one simple. To determine the relative contributions of these motifs to importin ⁇ binding, a set of constructs for in vitro translation were made that contained one, both or neither NLS. GST-importin ⁇ interacted with each NLS to some degree and no interaction was seen in the absence of both signals (Figure 6E). We therefore conclude that both N-terminal signals are required for full binding potential.
  • EDD is a nuclear protein
  • the N-terminal AB region of PR contains a ligand- independent activation function 1 while the C-terminal CDE region of PR contains the hinge and DNA binding domains and a ligand-dependent activation function 2.
  • the CDE region of PR, PR(CDE) interacted with endogenously expressed EDD from T-47D cells (Figure 8A). This interaction was mapped using in vitro translated EDD protein fragments. A strong interaction was detected between the amino terminal region of EDD (EDDF1 , aa 1-889) and the CDE region of PR, being greater than that seen for SRC-1 ( Figure 8B). In these in vitro assays, interactions between PR(CDE) and either SRC-1 or EDDF1 were not affected by the PR ligand ORG2058 (data not shown). No significant binding was observed between PR and other fragments of EDD ( Figure 8B and data not shown).
  • EDD fragments EDDF1a-EDDF1d were tested for their ability to bind GST-PR(CDE).
  • EDDFIa (aa 1-577) and EDDFIc (aa 1-419) contained the LXXLL motif
  • the strongest binding occurred between EDDFIb (aa 578-889) or EDDFId (aa 420-889) and PR(CDE) ( Figure 8C)
  • binding is mediated by the region of EDD consisting of amino acids 420-889, which includes both NLSs but not the LXXLL motif. This also ruled out the involvement of the UBA domain in this interaction. Taken together, these data demonstrate an interaction between EDD and PR.
  • EDD acts as a transcriptional coactivator for nuclear receptors
  • HECT-domain proteins such as yeast Rsp5, its human homolog hRPF1 (Imhof et al, Mol. Cell. Biol. 16, 2594-2605, 1996), and E6-AP (Hubner et al, J. Biol. Chem. 272, 17137- 17195, 1997) have coactivator activity for nuclear receptors, prompted an investigation of whether EDD could enhance transcriptional activation by PR-B.
  • HEK 293 and COS7 cells which lack endogenous PR, were transfected with a PR expression vector (pSG5/hPRB-1) and the progestin-responsive MMTV- luciferase reporter construct together with expression vectors for EDD, or SRC-1 as a positive control.
  • EDD consistently increased progestin (ORG2058)-induced luciferase activity three- to five-fold above control levels in both lines, an effect comparable to that of SRC-1 ( Figure 9A).
  • EDD and SRC-1 also slightly increased the basal activity of the luciferase MMTV- LTR promoter, an effect more apparent in the COS7 cell line.
  • EDD co-expression resulted in a greatly enhanced response to low concentrations of progestins such that without EDD transfection, 10nM ORG2058 gave a maximal response, whereas this was exceeded at a 100-fold lower concentration, 100pM, with EDD overexpression.
  • yeast two-hybrid screening was aimed at identifying other proteins involved in the ubiquitinylation or coactivation functions of EDD.
  • full length EDDM or EDDF5M (aa 889-2799) were used as baits, three clones encoding calcium- and integrin-binding protein/DNA dependent protein kinase interacting protein (C1B/KIP) were isolated: two full-length and another encoding CIB/KIP aa 5-191.
  • C1B/KIP calcium- and integrin-binding protein/DNA dependent protein kinase interacting protein
  • EDD protein was detected in FLAG immunoprecipitates from these lysates but not from those of vector transfected cells ( Figure 10D, left panel).
  • GST-CIB fusion protein also interacted with EDD in cell lysates prepared from nuclei of MCF-7 cells expressing endogenous levels of EDD ( Figure 10D, right panel, 'Control').
  • the I157T Li-Fraumeni-associated mutant retains the ability to bind phosphothreonine but has been shown to be unable to bind substrates of chk2 such as p53 (Falck et al, Oncogene 20, 5506- 5510, 2001 ) cdc25A (Falck et al, Nature 410, 842-847, 2001), BRCA1 and cdc25C (Li et al, Mol Cell 9, 1045-1054, 2002).
  • the I157T substitution had no effect on binding to EDD (Figure 12A), suggesting that EDD may instead bind through a phosphothreonine residue.
  • EDD is phosphorylated in cells as when Flag-tagged EDD was overexpressed in HEK-293 cells in the presence of 32 P-labelled orthophosphate and cell lysates prepared, the resulting Flag immunoprecipitates contained a labelled species corresponding to EDD ( Figure 11C).
  • EDD also interacts with BRCA2.
  • EDD was identified along with BRCA2 in a 2 MDa protein complex isolated from nuclear extracts of HeLa cells (R. Shiekhattar, Wistar Institute, U. Penn, personal communication). We confirmed this association was confirmed by co-immunoprecipitation of EDD and BRCA2 from HEK-293 cell lysates ( Figure 17A). Therefore we were interested to test the possibility of an interaction between chk2 and BRCA2. Indeed when chk2 was immunoprecipitated from MCF-7 nuclear extracts, both EDD and BRCA2 were detected ( Figure 17B). While the interaction between EDD and chk2 was diminished on phleomycin treatment, there was no effect on the amount of BRCA2 associated with chk2.
  • deletion mutants of BRCA2 are generated and labelled with 35S.
  • the ability of the full length EDD protein is tested to determine the region of BRCA2 to which EDD binds.
  • Such information facilitates the analysis of the BRCA2-EDD complex and the Chk2-EDD complexes in order to determine whether these interactions form a single complex (ie BRCA2-EDD-Chk2), or instead whether these interactions form distinct complexes.
  • EDD and BRCA2 these proteins are both expressed in HCT-15 cells, that lack Chk2 expression.
  • antibodies to EDD are used in immunoprecipitation experiments.
  • the captured protein complexes are separated using SDS-PAGE and BRCA2 levels determined using an anti-BRCA-2 antibody.
  • HCT-15 cells expressing EDD and BRCA2 are then transfected with an expression vector that expresses Chk2 and the coimmunoprecitptation experiments repeated, in order to determine the effect of Chk2 on the association of EDD and BRCA2.
  • Ubiquitinylation assays are be used to investigate whether EDD is activated in response to DNA damage and whether EDD targets BRCA2 for ubiquitinylation and subsequent degradation.
  • the assay utilizes in vitro translated or immunoprecipitated EDD with reactions performed in the presence of GST- or His-tagged ubiquitin, E1 and the E2 UbcH ⁇ b with TopBPI as positive control substrate.
  • EDD activity is determined in the presence and absence of ionizing radiation.
  • This assay is also used to test other candidate substrates for ubiquitinylation by EDD such as CIB, or the Gli1 , -2 and -3 proteins.
  • ceils are treated with ionising radiation at doses of between 4 and 12 Gy, and the cells allowed to recover for periods of 0-6h.
  • Activation of CHK2 and other downstream responses to DNA damage are monitored by immunoblotting to detect the levels of CHK2 phosphorylated at T68 and also for p53 accumulation where appropriate.
  • hydroxyurea is used to study the ATR-mediated response pathway of CHK2 stimulation and its effects on the EDD-BRCA2-CHK2 interactions.
  • EDD dissociates from chk2 on DNA damage. Therefore EDD may normally regulate chk2 and needs to be removed for chk2 activation. Overexpression of EDD, as observed in breast cancers for example, might then inhibit the activation of chk2 in response to DNA damage, thus leading to either replication of defective DNA or continued proliferation of cells with an abnormal chromosomal complement. These conditions could foster further mutation and lead to cancer or tumour progression. Conversely, in EDD knockout mouse embryos or cells subjected to EDD siRNAs, we propose that chk2, in the absence of the inhibitory effects of EDD, might be dysregulated and thus cause prolonged inappropriate cell cycle arrest.
  • EDD is a nuclear protein, most likely arising from a direct interaction with importin ⁇ via two NLSs within the N-terminus of EDD.
  • the HECT domain which has reversible ubiquitin binding activity in EDD and other E3 ligases (Callaghan et al, Oncogene 17, 3479-3491 , 1998), is also associated with a separate role in transcriptional coactivation in related proteins: Rsp5/hRPF1 and E6-AP coactivate ligand-dependent nuclear receptor activity (Imhof et al, Mol. Cell Biol. 16, 2594-2605, 1996; Nawaz et al, Mol.
  • EDD potentiates PR transactivation to a level comparable to that seen for the p160 coactivator SRC-1.
  • EDD has a distinct selectivity profile, being able to coactivate PR and VDR but not ER, in a ligand-dependent manner. This is in contrast to the HECT ligase E6-AP which coactivates a range of hormone receptors including ER, PR, AR and GR (Nawaz et al, Mol. Cell Biol 19, 1182- 1189, 1999).
  • Rsp5 also shows some selectivity, coactivating transcription by PR and GR but not ER (Imhof et al, Mol. Cell Biol. 16, 2594-2605, 1996).
  • EDD is unique among HECT ligases however in that enhancement of PR transactivation by EDD raises the intriguing possibility of a positive feedback loop, as EDD itself is a progesterone-regulated gene (Callaghan et al, Oncogene 17, 3479-3491 , 1998). Thus, overexpression of EDD seen in some breast cancers could increase the sensitivity of PR-positive tumours to lower levels of progestins.
  • RNA polymerase II itself is a target of ubiquitin-mediated proteolysis (Zhu et al, Nature 400, 687-693, 1999; Huibregtse et al, Proc. Natl. Acad. Sci. USA 94, 3656-3661 , 1997).
  • EDD and these other HECT ubiquitin ligases can still perform some function in the ubiquitinylation cascade without themselves having a catalytically active HECT domain.
  • EDD appears to be the only E3 ligase to possess both a RING-like zinc finger domain and a HECT domain and we cannot rule out the possibility that coactivation by EDD is mediated through the RING-like or UBA domains.
  • E6-AP The mechanism of coactivation by E6-AP, as for the p160 family, has been attributed to direct coactivator-receptor interaction, providing either bridging or enzymatic activities to the transcriptional complex.
  • HAT histone acetyl transferase
  • Two regions of E6-AP contain LXXLL receptor-binding motifs and both of these regions interact with PR (Nawaz et al, Mol. Cell Biol 19, 1182- 1189, 1999).
  • a search of the EDD sequence revealed one N-terminal, one C- terminal and three centrally located LXXLL domains ( Figure. 5A).
  • N-terminal and centrally located motifs lie in regions of high homology to HYD.
  • the N-terminal motif in the region with the strongest binding to PR(CDE), was not required for the interaction.
  • direct interaction between other N-terminal sequences of EDD and PR may partially explain the observed effects of EDD on PR transactivation.
  • Salghetti et al found that mono- ubiquitinylation of the VP16 transcriptional activation domain was sufficient for transcriptional activity (Salghetti et al, Science 293, 1651-1653, 2001).
  • the zf-UBR1 domain of EDD is also likely to be involved in protein-protein interactions.
  • the zf-UBR1 domain coincides with the type 1 site in UBR1 proteins, a binding site specific for N-end rule substrates with basic N-terminal residues (Kwon et al, Proc. Natl. Acad. Sci. USA 95, 7898-7903, 1998).
  • This zf-UBR1 domain is critical for function of the calossin-like RING-H2 finger protein, BIG and it therefore may also have a role in substrate recognition and binding in EDD family members.
  • Other HECTs have substrate interaction domains distinct from the HECT domain (eg.
  • EDD and CIB were shown to interact in MCF-7 and HEK 293 cells.
  • CIB is 58 % and 56 % homologous with other EF-hand proteins calmodulin and calcineurin B, respectively and may function as a calcium-dependent regulatory subunit of a kinase or phosphatase (Naik et al, J. Biol. Chem 272,
  • Snk and Fnk are activated by progesterone in maturing frog oocytes (Duncan et al, Exp. Cell Res. 270, 78-87, 2001 ) and have roles in both G1 and mitotic phases of the cell cycle and CIB could affect the activity of these kinases.
  • CIB is found in both the nucleus and cytoplasm and its subcellular localisation can be influenced by association with its interacting partners and by calcium levels (Kauselmann et al, EMBO J. 18, 5528-5539, 1999; Stabler et al, , J. Cell Biol. 145, 1277-1292, 1999) but its role in the nucleus is unexplored.
  • Ecfd-deficient mice were generated by homologous recombination in embryonic stem (ES) cells.
  • the Edd targeting construct was designed to delete
  • Edd was detectable by IHC in most cells of developing WT embryos ( Figure 18E), with the exception of hematopoietic cells. Neither GFP or LacZ expression was detectable in Edc ' ⁇ or Edd' ' embryos, most likely due to either very low ⁇ Gal/GFP expression, or production of a non-functional fusion protein.
  • Edd' ' embryos are slightly growth retarded as early as E7.5 when compared to wild-type and Edd * ' ' littermates ( Figure 19).
  • E8.5 Edd' ' embryos are clearly developmentally retarded, lagging at least 0.5 days behind the development of WT and Edd * ' ' littermates.
  • E9.5 and E10.5 Edd' ' embryos display severe growth defects, the most apparent being the absence of turning which occurs in WT embryos around E9 ( Figure 19).
  • the head is small and embryonic structures forming the jaw region (branchial arch) are significantly underdeveloped. Edd' ' embryos are frequently observed with a swollen pericardium, indicating osmotic imbalance within the embryo.
  • Edd' ' embryos also display a bulbous allantois indicating failure of chorioallantoic fusion and placentation (Figure 19).
  • blood cell pools can be seen in several regions of Edd' ' embryos. Specifically, a pool of blood cells can be seen within the pericardial cavity, indicating pericardial effusion (data not shown).
  • Edd ' ' ' embryos also appear to contain far less neural epithelium than WT and the epithelial structure is disorganised. In short, defects in Edd' ' embryonic tissue are widespread and do not appear to be restricted to a specific organ system or cell type.
  • E10.5 Edd' ' embryos suggested that along with a proliferative block, apoptosis was also contributing to the embryonic lethality observed in Ec/d-deficient embryos.
  • TUNEL staining was used to examine apoptosis in histological sections from embryos between E8.5 - 10.5 and no significant difference was observed in numbers of TUNEL-positive nuclei at E8.5 ( Figure 22A).
  • numerous condensed nuclei were observed in Edd' ' tissue at E9.5 and E10.5 (data not shown) and significantly higher levels of TUNEL-positive cells were visible in Edd' ' embryos compared to WT littermates at E9.5 and E10.5 ( Figure 22A).
  • Edd * ' mice were crossed with mice heterozygous for a truncating mutation in p53 (as described by Jacks et al, Curr Biol 4:1-7, 1994) and Edd/p53 double heterozygous animals were subsequently produced. Embryos from intercrosses of these double heterozygotes were examined and no difference was observed in the survival of Edd' ' embryos on a p53 ' ' ' background (Table 7).
  • Edd'7p53' ' embryos at E10.5 showed similar morphology to Edd'Vp53 * ' * embryos and all Edd' ⁇ /p53 ' ' ⁇ embryos observed at E11.5 were partially resorbed, demonstrating that decreased cell proliferation and activation of apoptosis in Edd' ' embryos are p53-independent.
  • EXAMPLE 4 The Role of EDD in Mammary Gland Development and Tumorigenesis 4.1 Production of a conditional knock-out of the Mouse EDD gene
  • Conditional Edd-deficient (Edd' ' ) mice are generated by homologous recombination in embryonic stem (ES) cells.
  • the Edd targeting construct is designed to flank exon 1 (which contains the ATG translation start site for EDD) of the EDD gene with Cre recombinase recognition sites (loxP). Expression of Cre recombinase in the tissue/s of interest causes excision of exon 1 , thereby silencing EDD in those tissue/s.
  • the targeting construct is electroporated into 129/SvJ ES cells. A portion of these cells are then electroporated with an expression vector that expresses Cre recombinase and clones that show disruption of the Edd gene by Southern blot analysis determined. A portion of the selected cells, that did not express Cre recombinase (ie those cell with an intact EDD gene) are used to generate chimeric mice by injection into blastocyst stage C57BL/6 embryos. Following backcrossing with C57BL/6 mice, F1 animals are analysed by Southern blotting and/or PCR (to detect the presence of the loxP sites) to confirm germline transmission of the mutated Edd allele.
  • mice expressing Cre recombinase only in mammary tissue are then generated.
  • This gene construct is then microinjected into the pronucleus of a fertilised oocyte and the oocyte introduced into the uterus of a pseudopregnant female C57BL/6 mouse.
  • mice born are screened for presence of the transgene by Southern hybridisation and/or PCR to detect the nucleic acid that encodes Cre.
  • Those mice that are found to carry the transgene are bred with WT C57BL/6 mice, and subsequent generations are screened for expression of Cre recombinase in mammary tissue using an anti-Cre antibody (Novagen, Madison, Wl, USA). Multiple tissues of positive mice are subsequently screened to ensure that the expression of Cre is limited to the mammary tissue.
  • mice expressing Cre and mice carrying f/oxed EDD are then crossed to generate mice that have had exon 1 of EDD excised in mammary tissue.
  • Expression of EDD in several tissues is determined by both Western blotting and immunohistochemistry as described in Example 3. Those mice that do not express EDD in mammary tissue, but maintain expression of EDD in all other tissues in which EDD is known to be expressed. These mice are then analysed to establish the role of EDD in mammary cell development and tumorigenesis.
  • EDD effect of EDD are analysed at weekly intervals for three weeks during lactation and at 5 day intervals for 6 weeks following weaning. At all time points mammary glands are also sectioned and stained with haemotoxylin and eosin to facilitate examination of the cellular structure of the glands. Additionally, glands are analysed for expression of EDD and EDD interacting proteins, such as, for example, BRCA2, CHK2, TopB1 and CIB.
  • EDD drosophila homolog of EDD
  • mammary tissue isolated from EDD 7' mice are analyzed for hedgehog signaling pathway components, eg ihh, shh, dhh, GH1 , Gli2, GH3, BMP-2, BMP-4 and patched proteins.
  • epithelial tissue from an EDD '1' mice are transplanted into a fat pads of a WT mouse, and epithelial tissue from a wt mouse is transplanted into a fatpad of a EDD '1' mouse (essentially as described in Naylor and Ormandy, Dev. Dvn. 225(1): 100-105, 2002 and references cited therein).
  • mice are aged for up to a period of 2 years. At various stages mice are sacrificed and analyzed for the development of spontaneous mammary tumors. The rate of tumor development in EDD 1' mice and wt mice at these stages are then compared to determine the effect of EDD on the development of mammary tumors in ageing mice.
  • EDD 1' mice are crossed with the MMTV/c-myc transgenic mice (Romieu-Mourez et al, Mol. Cell Biol, 23(16): 5738-5754, 2003). or the MMTV/wnt- 1 transgenic mice (Bocchinfuso et al, Cancer Res 59(8): 1869-1876, 1999) (both of which show a high incidence of mammary tumor formation).
  • WT, transgenic and transgenic/knockout mice are then analyzed to determine the effect of EDD on latency and frequency of tumor formation. Mammary glands are isolated from the mice at various stages of pregnancy and lactation and various ages and analyzed using whole mount analysis to determine the number of hyperplastic alveolar nodules, hyperplasias and tumors.
  • mice overexpressing EDD in this tissue are generated.
  • An expression construct with the nucleic acid encoding EDD (SEQ ID NO: 1) under control of the MMTV LTR (SEQ ID NO: 48), which drives expression only in mammary tissue is produced.
  • This gene construct is then microinjected into the pronucleus of a fertilised oocyte and the oocyte introduced into the uterus of a pseudopregnant female C57BL/6 mouse. All mice born are screened for presence of the transgene by Southern hybridisation and/or PCR to detect the transgenic construct encodes mammary tissue specific EDD.
  • mice that are found to carry the transgene are bred with WT C57BL/6 mice, and subsequent generations are screened for overexpression of EDD in mammary tissue using Western Blotting as described in Example 3. Multiple tissues of positive mice are subsequently screened to ensure that the overexpression of EDD is limited to the mammary tissue.
  • Mammary tissue is isolated from pregnant female mice (wt and igEDD *1' ) every 5 days during pregnancy, in addition to weekly intervals for three weeks during lactation and at 5 day intervals for 6 weeks following weaning Dissected mammary tissue is then analysed using whole-mount microscopy to determine terminal end bud density, internodal duct length, branching pattern and alveolar bud formation, and to determine the effect of EDD on these parameters (essentially as described in Example 4.2).
  • mammary glands are also sectioned and stained with haemotoxylin and eosin to facilitate examination of the cellular structure of the glands. Additionally, glands are analysed for expression of EDD and EDD interacting proteins, such as, for example, BRCA2, CHK2, TopB1 and CIB, in addition to hedgehog signaling pathway components, eg ihh, shh, dhh, GH1 , GH2, Gli3, BMP-2, BMP-4 and patched proteins.
  • EDD and EDD interacting proteins such as, for example, BRCA2, CHK2, TopB1 and CIB
  • mice are aged for up to a period of 2 years. At various stages mice are sacrificed and analyzed for the development of spontaneous mammary tumors. The rate of tumor development in tgEDD* 1" mice and wt mice at these stages are then compared to determine the effect of EDD on the development of mammary tumors in ageing mice.
  • siRNA was designed to inhibit the expression of EDD (sequence: sense 5'- GCAGUGUUCCUGCCUUCUUdTdT-3' (SEQ ID NO: 47), anti-sense 5'- dTdTCGUCACAAGGACGGAAGAA-3' (SEQ ID NO:48)), siRNA was synthesised, annealed and HPLC purified by Xeragon (Zurich, Switzerland). 2.2x10 6 MCF-7 cells or 2.6 x10 6 HEK-293 cells were plated in a 15 cm 2 dish and grown overnight. The normal breast epithelial cell lines HMEC 184 and MCF-10-A were grown in MCDB 170 media (Gibco) with 1% pituitary extract as an additive.
  • HMEC 184 and MCF10-A cells were plated at 1.2 x 10 6 cells/15 cm plate. Transfection conditions were the same as above except HMEC 184 and MCF10-A cells were transfected in pituitary extract-free medium and after 4 h 2% pituitary extract-containing medium is added. 8 hrs after transfection this medium was replaced with 1 % pituitary extract-containing medium A siRNA targeted against green fluorescence protein (GFP) was used as a negative control.
  • GFP green fluorescence protein
  • EDD RNAi Transfection of EDD RNAi in all cell lines resulted in substantial loss of EDD protein as assessed by Western blotting with an anti-EDD antibody (Figure 25).
  • EDD siRNA changes in cell morphology were seen in HMEC 184 cells and MCF-10A cells. This change was first observed two days after RNA interference was performed.
  • Cells transfected with EDD siRNA showed reduced and altered cell-cell contacts, cell shape was altered and cells were disorganised, compared to control cells ( Figure 26). Control cells tended to be elongated, making cell-cell contacts with neighbouring cells along the length of the cells, forming a sheet.
  • Cells transfected with EDD siRNA made fewer connections with neighbouring cells, while their more rounded shape prevents them from making connections along the length of the cells.
  • Actin filaments in HMEC 184 control cells were coordinated with actin in adjacent cells (Figure 29), whereas this organisation between neighbouring cells was not seen in cells transfected with EDD siRNA (figure 29).
  • EXAMPLE 6 Identification of Downstream Effects of EDD Silencing To ascertain biochemical pathways that are affected by EDD activity in cells, transcript profiling experiments were performed using Affymetrix DNA microarrays. HMEC 184 and MCF-7 cells were transfected with siRNA (EDD or GFP) as described in Example 5.1. Loss of EDD was confirmed by Western or Northern blot.
  • siRNA EDD or GFP
  • RNAi Data analysis identified genes which had decreased or increased mRNA expression in response to EDD depletion by RNAi.
  • Embryos were partially resorbed and scored as non-viable.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention se rapporte à de nouvelles méthodes de détection ou de traitement de la régulation aberrante du cycle cellulaire associée à l'expression d'une protéine nucléaire codée par un gène qui est lié pour mapper la position 8q22.3 du génome humain, ainsi qu'à de nouveaux réactifs utiles à cet effet. De manière plus particulière, cette invention concerne de nouvelles sondes d'acides nucléiques et de nouvelles sondes protéiques, qu'on utilise pour détecter un gène qui est lié pour mapper la position 8q22.3 du génome humain ou ses produits d'expression, ladite expression ou bien l'expression élevée dudit gène étant associée à l'aspect ou à l'existence de tumeurs associées au cancer, à la détérioration de l'ADN et aux effets induits sur les cellules par le récepteur de la progestérone. La présente invention concerne également des réactifs et des méthodes de détection ou de modulation des produits d'expression du gène, tel que, par exemple, dans le diagnostic ou le traitement du cancer, de la prolifération cellulaire, de la détérioration de l'ADN ou des effets induits sur les cellules par le récepteur de la progestérone.
EP03793494A 2002-09-05 2003-09-05 Nouvelles methodes de diagnostic et de therapie et reactifs correspondants Withdrawn EP1539957A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
AU2002951346A AU2002951346A0 (en) 2002-09-05 2002-09-05 Diagnosis of ovarian cancer
AU2002951346 2002-09-05
US42521802P 2002-11-07 2002-11-07
US425218P 2002-11-07
PCT/AU2003/001164 WO2004022750A1 (fr) 2002-09-05 2003-09-05 Nouvelles methodes de diagnostic et de therapie et reactifs correspondants

Publications (2)

Publication Number Publication Date
EP1539957A1 true EP1539957A1 (fr) 2005-06-15
EP1539957A4 EP1539957A4 (fr) 2006-10-11

Family

ID=31979115

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03793494A Withdrawn EP1539957A4 (fr) 2002-09-05 2003-09-05 Nouvelles methodes de diagnostic et de therapie et reactifs correspondants

Country Status (4)

Country Link
EP (1) EP1539957A4 (fr)
JP (1) JP2005537790A (fr)
CA (1) CA2497873A1 (fr)
WO (1) WO2004022750A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559601A (zh) * 2012-01-13 2012-07-11 清华大学 用于鉴定肿瘤细胞或肿瘤组织的crept抗体

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW200639252A (en) 2005-02-01 2006-11-16 Alcon Inc RNAi-mediated inhibition of ocular hypertension targets
IL177006A0 (en) * 2005-08-02 2006-12-10 Veridex Llc Predicting bone relapse of breast cancer
JP2008297257A (ja) * 2007-05-31 2008-12-11 St Marianna Univ School Of Medicine 消化器癌の新規治療薬
CN101429540B (zh) * 2007-11-09 2013-07-10 北京雅康博生物科技有限公司 实时定量pcr检测细胞周期蛋白b2基因表达的方法
JP6343560B2 (ja) * 2012-09-05 2018-06-13 富士フイルム和光純薬株式会社 乳癌の判定方法

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
No further relevant documents disclosed *
See also references of WO2004022750A1 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102559601A (zh) * 2012-01-13 2012-07-11 清华大学 用于鉴定肿瘤细胞或肿瘤组织的crept抗体
CN102559601B (zh) * 2012-01-13 2014-09-03 清华大学 用于鉴定肿瘤细胞或肿瘤组织的crept抗体

Also Published As

Publication number Publication date
JP2005537790A (ja) 2005-12-15
EP1539957A4 (fr) 2006-10-11
WO2004022750A1 (fr) 2004-03-18
CA2497873A1 (fr) 2004-03-18

Similar Documents

Publication Publication Date Title
US20060147922A1 (en) Novel diagnostic and therapeutic methods and reagents therefor
EP2518163B1 (fr) Modifications spécifiques du cancer de la prostate dans l'expression du gène ERG et procédés de détection sur la base de ces altérations
Wang et al. Sprouty4, a suppressor of tumor cell motility, is downregulated by DNA methylation in human prostate cancer
US6323331B1 (en) Beclin-related nucleic acid molecules, and uses thereof
WO2013141266A1 (fr) Procédé pour détecter un nouveau corps fusionné ret
Ray et al. Cyclin G‐associated kinase: A novel androgen receptor‐interacting transcriptional coactivator that is overexpressed in hormone refractory prostate cancer
He et al. Ras downstream effector GGCT alleviates oncogenic stress
JP2009165473A (ja) 癌
EP1539957A1 (fr) Nouvelles methodes de diagnostic et de therapie et reactifs correspondants
US20090232819A1 (en) Method using snail transcriptional repressor
JP2006524492A (ja) 血管形成に関連する核酸分子を同定するための方法
CA2253433A1 (fr) Regulateur de la degradation de l'arn chez les mammiferes induite par des transcrits non-sens
WO2006069306A2 (fr) Souris knock-out pour le gene suppresseur de tumeur anx7
WO2013113942A2 (fr) Nouveaux gènes de fusion dans le cancer du poumon
AU2003257275A1 (en) Novel diagnostic and therapeutic methods and reagents therefor
Liu et al. A novel loss-of-function mutation in TP53 in an endometrial cancer cell line and uterine papillary serous carcinoma model
WO2008075713A1 (fr) Marqueur pour le diagnostic du cancer et molécule cible pour une thérapie
JP4617257B2 (ja) ヒト癌関連遺伝子、それがコードする産物および適用
US9738936B2 (en) Breast cancer susceptibility gene GT198 and uses thereof
WO2022148346A1 (fr) Protéine à doigts de zinc zbtb20 en tant que biomarqueur pour la détection et le diagnostic d'un carcinome hépatocellulaire
US20140234321A1 (en) Hunk, a snf1-related kinase essential for mammary tumor metastasis
US20060211008A1 (en) Beta-parvin expression for use in diagnostic methods for assessment of breast cancer
Wang et al. Fine mapping and candidate gene analyses of pulmonary adenoma resistance 1, a major genetic determinant of mouse lung adenoma resistance
US20090238836A1 (en) Hip kinase for fertility control
JPWO2003100064A1 (ja) 新規ユビキチンリガーゼ

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050324

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20060908

17Q First examination report despatched

Effective date: 20070213

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20081209