EP1527185B1 - Plastidtransformation mit modularen vektoren - Google Patents

Plastidtransformation mit modularen vektoren Download PDF

Info

Publication number
EP1527185B1
EP1527185B1 EP03784146A EP03784146A EP1527185B1 EP 1527185 B1 EP1527185 B1 EP 1527185B1 EP 03784146 A EP03784146 A EP 03784146A EP 03784146 A EP03784146 A EP 03784146A EP 1527185 B1 EP1527185 B1 EP 1527185B1
Authority
EP
European Patent Office
Prior art keywords
sequence
interest
plastome
homologous
region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP03784146A
Other languages
English (en)
French (fr)
Other versions
EP1527185A1 (de
Inventor
Stefan Herz
Hans-Ulrich Koop
Timothy J. Golds
Christian Eibl
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Icon Genetics AG
Original Assignee
Icon Genetics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icon Genetics AG filed Critical Icon Genetics AG
Publication of EP1527185A1 publication Critical patent/EP1527185A1/de
Application granted granted Critical
Publication of EP1527185B1 publication Critical patent/EP1527185B1/de
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8214—Plastid transformation

Definitions

  • the present invention relates to plant biotechnology in general and more particularly to a process and vectors for plastid transformation of plants. Specifically, the present invention provides a process of genetic transformation of plant plastids. Also disclosed are vectors for the process and plants or plant cells obtained or obtainable according to the process of the invention.
  • organelles i.e. plastids and mitochondria
  • plastids and mitochondria are derived from initially independent prokaryotes that were taken up into a predecessor of present day eukaryotic cells by separate endosymbiotic events (Gray, 1991).
  • these organelles contain their own DNA, DNA transcripts in the form of messenger RNA, ribosomes, and at least some of the necessary tRNAs that are required for decoding of genetic information (Marechal-Drouard et al., 1991).
  • Plastids can be genetically transformed
  • a capability of transforming plastids is highly desirable since it could make use of the high gene dosage in these organelles that bears the potential of extremely high expression levels of transgenes.
  • plastid transformation is attractive because plastid-encoded traits are not pollen transmissible; hence, potential risks of inadvertent transgene escape to wild relatives of transgenic plants are largely reduced.
  • Other potential advantages of plastid transformation include the feasibility of simultaneous expression of multiple genes as a polycistronic unit and the elimination of positional effects and gene silencing that may result following nuclear transformation.
  • an antibiotic resistance marker cassette such as an expression cassette containing the gene aadA (encoding the enzyme aminoglycoside adenyl transferase), which confers resistance to inhibitors like Spectinomycin or Streptomycin ( US5877402 ) or aphA-6 (encoding the enzyme aminoglycoside phosphotransferase A-6) which confers resistance to kanamycin (Huang et.al., 2002).
  • selection is achieved by replacing a complete resident plastid gene by a mutant gene which confers resistance to selection inhibitors ( US5451513 ).
  • selection marker genes that are needed for the selection of transgenic plant cells from a vast background of untransformed cells code for antibiotic or herbicide resistance.
  • the selection marker gene or the mutant plastid gene is included in the integrating region, which is flanked by homologous regions directing the plastome integration. Selection for plastid transformants is then achieved by cultivating transformed plant material on medium containing the appropriate inhibitor. As these marker genes are stably integrated into the genome together with the genes of interest, they will remain in the homoplastomic transgenic plants although they are not required for the function of the genes of interest. These remaining marker genes are a main issue of criticism of plant biotechnology.
  • Plastid transformation vectors usually contain one or more gene(s) of interest flanked by two regions of the insertion site, which are necessary for the stable introduction of the engineered sequences into the plastome by homologous recombination events ( US5877402 , US5451513 ).
  • transformation vector molecules which contain a large number of different fragments: two flanks, a marker gene, one or more gene(s) of interest and regulatory elements such as promoter, 5'-UTR, 3'-UTR or spacer elements.
  • the cloning of transformation vectors is problematic in cases wherein (at least one of) the cloned gene(s) has a toxic effect on the bacteria used for cloning. Moreover, using the highly desirable potential to co-express a series of introduced transgenes is limited by the overall size of the transforming plasmid.
  • Achieving the homoplastomic status is supported by several cycles of regeneration on selective medium containing the appropriate antibiotics. Usually 3 - 5 of such cycles are necessary to obtain the homoplastomic recombinant status. The presence of remaining copies of wild type plastome can be monitored by molecular analysis like PCR or Southern Hybridization. As several weeks are needed for one regeneration cycle it takes several months to generate homoplastomic plastid transformants.
  • the process of the invention comprises introducing a first and a second DNA molecule into plastids of a plant to be transformed.
  • These DNA molecules which are used as vectors may be introduced consecutively, i.e. in two separated steps, or simultaneously, i.e. in a one-step procedure. It is less laborious and therefore preferred to introduce said two DNA molecules in a one-step procedure, e.g. by using a mixture of said DNA molecules.
  • known transformation methods may be used (see below).
  • Said first DNA molecule contains a first region homologous to a region of the plastome for directing plastome integration and a first sequence of interest.
  • Said second DNA molecule contains a second region homologous to a region of the plastome for directing plastome integration and a second sequence of interest.
  • one region homologous to a region of the plastome is sufficient for each DNA molecule.
  • said first or said second DNA molecule contains only one region homologous to a region of the plastome for directing plastome integration. More preferably, said first and said second DNA molecule both contain only one region homologous to a region of the plastome for directing plastome integration.
  • Said homologous regions direct integration of each DNA molecule to a desired site of the plastome.
  • the first and the second homologous region together determine the type of DNA modification (e.g. insertion, deletion) of the plastome by the process of the invention.
  • the aim of performing the process of the invention is to introduce an integration sequence into the plastome without any further plastome modification like a deletion of plastome sequences.
  • said homologous regions of the first and the second DNA molecules correspond together to a continuous plastome sequence.
  • said homologous regions are derived from plastomes of the plant species to be transformed. As long as sufficient homology for homologous recombination is guaranteed, the homologous regions may be derived from other plant species, preferably however, from closely related plant species.
  • each homologous region for plastome integration may vary in a wide range as long as the recombination frequency is sufficient.
  • Each homologous region may have a length of between 100 and 5000 bp.
  • the recombination frequency decreases as the length of the homologous regions decreases. Therefore the length is preferably at least 200 to 300 bp. More preferably, the length is between 500 and 2000 bp, most preferbly between 500 and 1000 bp.
  • Said sequences of interest may contain any nucleotide sequence to be integrated into the plastome.
  • said sequences of interest contain a gene to be expressed.
  • Said first and said second sequence of interest may each contain a fragment of a gene to be expressed, whereby said gene is assembled in said integration sequence.
  • the invention is highly versatile in this respect. Preferably, however, said first and said second sequence of interest are different.
  • Said first sequence of interest contains a sequence segment that is homologous to a sequence segment of said second sequence of interest.
  • this homologous segment is an overlapping region of said first and said second sequence of interest.
  • the homologous sequence segment allows recombination of said first and said second sequence of interest such that an integration sequence is formed in the plastome, whereby said integration sequence contains at least a portion of said first and at least a portion of said second sequence of interest as a continuous sequence (cf. Fig. 5 ).
  • the sequence segment in a sequence of interest is preferably positioned at the distal end of the sequence of interest with respect to said homologous region that directs plastome integration.
  • said first and said second sequence of interest each contains said homologous sequence segment, i.e. a sequence that is of sufficient homology to enable homologous recombination between said first and said second sequence of interest.
  • the homologous sequence segment of the first and of the second sequence of interest are identical.
  • Said sequence segment may be or may contain a sequence (or a part thereof) involved in expression of an RNA and/or a protein.
  • Said sequence segment may be or may contain a sequence involved in regulating transcription or translation of a coding sequence (e.g. a promoter, a 5' or a 3' untranslated sequence, a ribosome binding site etc. or parts thereof).
  • said sequence segment may be or may contain a coding sequence (or a part thereof) of a protein to be expressed.
  • the sequence segment of said first sequence of interest and the sequence segment of said second sequence of interest are preferably identical in order not to perturb the function of said regulating or said coding sequence.
  • said sequence segment may have the sole purpose of allowing recombination between said first and said second sequence of interest for forming said integration sequence and may not be involved in expression of an RNA or protein.
  • Said sequence segment(s) are typically part of the transplastome of the transgenic plant or plant cells generated according to the invention (cf. figure 6 and 6 ).
  • Said sequence segment may be part of a transcription unit, whereby it may become part of a transcript formed from said transcription unit. If said sequence segment (or a part thereof) is undesired in such a transcript (e.g. if said sequence segment interrupts a coding sequence that codes for a protein to be expressed), the undesired part may be cut out by RNA splicing.
  • an intron notably a self-splicing intron like a group I or a group II intron, may be included in said sequence segment for splicing out undesired parts.
  • the first sequence of interest may provide a 5' part of the intron and the second sequence of interest may provide a 3' part of the intron, whereby a functional intron may be assembled when said integration sequence in formed.
  • Said first and said second sequence of interest may be identical, leading to an integration sequence consisting of said sequence of interest.
  • each sequence of interest may be considered to consist of said homolgous sequence segment.
  • said first or said second sequence of interest contains a sequence in addition to said homologous sequence segment. More preferably, said first and said second sequence of interest each contains a sequence in addition to said homologous sequence segment, whereby said additional sequences in said first and said second sequence of interest are different.
  • Said integration sequence preferably comprises sequence portions from said first and from said second sequence of interest. If said first and said second sequence of interest each contains a gene of interest, an integration sequence may be formed comprising two genes of interest.
  • the process of the invention may be used for assembling a desired integration sequence from said first and said second sequence of interest.
  • the assembly of the integration sequence may be used to generate in the plastids a new function not present in one of said sequences of interest alone.
  • a gene of interest consisting of a coding sequence and of various regulatory sequences may be assembled to a functional form in said integration sequence.
  • a coding sequence of interest in said first sequence of interest may be combined with a promoter or other regulatory sequences provided with said second sequence of interest (or vice versa). In this way, a regulatory sequence giving rise to a desired expression of said coding sequence may be selected or screened for.
  • a coding sequence for expressing a protein of interest may be assembled in said integration sequence, whereby said first and said second sequence of interest (and optionally further sequences of interest from further vectors) each provide a part of said coding sequence to said integration sequence.
  • Self-splicing introns may be used for achieving the correct reading frame of the protein to be expressed on messenger RNA level.
  • the process of the invention may comprise introducing one or more additional DNA molecules into said plant plastids in addition to said first and said second DNA molecule.
  • Said additional DNA molecule(s) comprise(s) additional sequence(s) of interest.
  • said third DNA molecule preferably contains a sequence segment homologous to a sequence segment of said first sequence of interest and a sequence segment homologous to said second sequence of interest.
  • Said third DNA molecule does preferably not have a homologous region for plastome integration.
  • transformants are selected that contain the desired integration sequence. Selection is typically supported by an inhibitor or antibiotic the transformants are resistent against due to a marker gene. Selection may further comprise allowing segregation of transformed and untransformed sectors (e.g. on leaves). Transformants or transformed sectors may be identified by molecular analyis, e.g. PCR and Southern blotting. Further, transformants or transformed sectors may be identified phenotypically, e.g. by the expression of a transgene. A transgene may e.g. be detected by Western blotting, by a characteristic enzymatic activity or by another characteristic property like optical, notably fluorescent property.
  • a marker gene for selecting transformants may be introduced into a plastome with said first or said second sequence of interest.
  • said first second sequence of interest may provide a fragment of a marker gene to said integration sequence and said second sequence of interest may provide another fragment of said marker gene, whereby said fragments are combined to a functional marker gene in said integration sequence.
  • said first sequence of interest contains a 5' part of a marker gene and said second sequence of interest contains a 3' part of said marker gene.
  • Said integration sequence may then contain said marker gene such that it can be expressed. This embodiment allows selection for integration of both vectors and recombination to form said integration sequence.
  • Selectable marker-free transgenic plants or plant cells may be obtained in the process of the invention by designing said first and said second sequence of interest of said first and said second DNA molecule, respectively, such that the selectable marker gene in the integration sequence is flanked by sequence elements homologous to each other for allowing excision of the marker gene by homologous recombination similarly as described by lamtham and Day ( Nature Biotechnol. (2000) 18, 1172-1176 ).
  • said first sequence of interest may contain upstream of a 5' part of said marker gene a sequence element homologous to a sequence element located downstream of a 3' part of said marker gene on the second sequence of interest, whereby said sequence elements enable excision by homologous recombination of a part of said integration sequence that comprises said 5' and/or said 3' part of said marker gene.
  • Excision of the marker gene typically requires release of selection pressure said marker gene provides resistance against.
  • Said first and said second sequence of interest may each contain a complete marker gene.
  • said first sequence of interest may contain said 5' part of said marker gene and said second sequence of interest may contain said 3' part of said marker gene, whereby neither said 5' part nor said 3' part is capable of conferring resistance in the absence of said 3' part or said 5' part, respectively.
  • said 5' part may be: a promoter, 5'-untranslated sequences, and the coding sequence of said marker gene.
  • Said 3' part may be: the coding sequence of said marker gene, and 3'-untranslated sequences.
  • the invention provides a further embodiment that allows to produce marker free transplastomic plants.This may be achieved by including a selectable marker gene in one of said DNA molecules outside of a sequence unit consisting of said region homologous to a region of the plastome and said sequence of interest. Such a positioning of a marker gene allows loss of said marker gene in the course of recombination events that take place.
  • a selectable marker gene may be included in said first or said second DNA molecule in the described fashion, or in said first and said second DNA molecule. If a selectable marker gene is included in said first and in said second DNA molecule, these selectable marker genes may be the same or they may be different selectable marker genes.
  • a selectable marker gene is split into a first and a second fragment, whereby said first fragment is incorporated in said first DNA molecule outside of a first sequence unit and said second fragment is incorporated in said second DNA molecule outside of a second sequence unit.
  • Said first sequence unit consists of said first homologous region and said first sequence of interest.
  • Said second sequence unit consists of said second homologous region and said second sequence of interest.
  • the process of the invention may be applied to all plants. Preferably, it is applied to multi-cellular plants. Most preferably, the process of the invention is applied to crop plants. Examples of crop plants are given in the definitions.
  • the invention further provides a kit-of-parts comprising a first and a second DNA molecule as defined herein.
  • a DNA molecule for plastid transformation containing one region homologous to a region of a plastome for directing plastome integration and a sequence of interest.
  • a library of DNA molecules as defined herein is disclosed, whereby each of said DNA molecules contains a different sequence of interest.
  • Such a library may be created by cloning a mixture of DNA sequences of interest into a vector that contains a region homologous to a region of a plastome for directing plastome integration.
  • the library may be maintained by transforming the DNA molecules into cells like bacterial (e.g. E. coli) or plant cells.
  • plants or plant cells transformed with said DNA molecules of said kit-of-parts or with said disclosed DNA molecule are also disclosed.
  • the process described herein may be applied to introduce sequences of interest such as genes or regulatory elements or to introduce mutations such as point mutations insertions or deletions into the plastome.
  • the process of the invention allows to generate transplastomic plants, whereby the homoplastomic state can be attained after less regeneration cycles than with prior art processes.
  • homoplastomic plants may be achieved after 0 to 4 regeneration cycles, preferably after 2 cycles, and more preferably after 1 regeneration cycle.
  • the homoplastomic state is achieved in primary transformants without a regeneration cycle.
  • the process of the invention allows an enormous reduction of the time required to achieve homoplastomic transplastomic plants. The reasons for this surprising efficiency improvement is presently unclear. Compared to conventional plastid transformation, the method described herein is faster, because fewer steps are necessary to obtain homoplastomic plants.
  • the method allows the use of smaller transformation vectors for which cloning is simpler than in the case of conventional plastid transformation vectors.
  • the method relieves plastid transformation from any limitation on the number or size of sequences to be introduced, because an unlimited number of transformation vectors with overlapping sequences may be used.
  • the method relieves plastid transformation from any limitation imposed by sequences, which are toxic for the bacteria used for cloning, because the toxic sequences may be cloned into two different vector molecules in a way that each of them separately can not be toxic, even if they are expressed into a protein sequence.
  • the method can be applied to generate transformants, whereby the final plant does not carry any resistance marker gene.
  • 3'-UTR transcribed but not translated region of a (->) gene, downstream of a (->) coding region
  • 5'-UTR transcribed but not translated region of a (->) gene, upstream of a (- >) coding region
  • the 5'-UTR contains sequence information for translation initiation (ribosome binding site, (->) RBS) close to its 3' end
  • aadA (->) coding region of bacterial aminoglycoside adenyl transferase, a frequently used protein, that detoxifies antibiotic (->) selection inhibitors spectinomycin and/or streptomycin
  • aphA-6 (->) coding region of bacterial aminoglycoside phosphotransferase A-6, a protein that detoxifies the antibiotic (->) selection inhibitor: kanamycin chloroplast: (->) plastid containing chlorophyll
  • coding region nucleotide sequence containing the information for a)
  • flanks of the (->) plastid (->) transformation (->) vector determine, where changes in the target (->) plastome are generated by (->) transformation; gene expression: process turning sequence information into function; in (->) genes encoding polypeptides, gene expression requires the activity of a (- >) promoter, which initiates and directs RNA polymerase activity, leading to the formation of a messenger RNA, which is subsequently translated into a polypeptide; in (->) genes encoding RNA, the (->) promoter -mediated activity of RNA polymerase generates the encoded RNA; gene(s): nucleotide sequence(s) encoding all elements, which are required to secure function e.g.
  • genes are organised in (->) operons, which contain at least one complete (->) coding region; in (->) genes encoding polypeptides, these elements are: (1) a (->) promoter, (2) a 5' untranslated region ((->) 5'-UTR), (3) a complete (->) coding region, (4) a 3' untranslated region ((->) 3'-UTR); in (->) genes encoding RNA.
  • gene of interest modified or newly introduced sequence: the purpose of a (->) transformation attempt; genome: Complete DNA sequence of a cell's nucleus or a cell organelle; GFP green fluorescent protein homologous recombination: process leading to exchange, insertion or deletion of sequences due to the presence of one or more (->) flanks with sufficient sequence homology to a target site in a (->) genome; intron: sequence interrupting a (->) coding region; operon: organisational structure of several(->) genes sharing a promoter; plant(s): organism(s) that contain(s) (->) plastids in its (their) cells; this invention particularly relates to multicellular (->) plants; these include the group of gymnosperms (such as pine, spruce and fir etc.) and angiosperms (such as the monocotyledonous crops maize, wheat, barley, rice, rye, Triticale, sorghum, sugar cane, asparagus, garlic, palm tress etc., and
  • amyloplasts (->) chloroplasts, chromoplasts, etioplasts, gerontoplasts, leukoplasts, proplastids etc; plastome: complete DNA sequence of the (->) plastid; promoter: nucleotide sequence functional in initiating and regulating transcription; RBS, ribosomal binding site: DNA sequence element upstream of the (->) translation start codon of a (->) coding region, that mediates ribosome binding and translation initiation from the respective RNA transcript; RBS elements are either part of (->) 5'-UTRs or of (->) spacers; selection inhibitor: chemical compound, that reduces growth and development of non- transformed cells or organelles stronger than that of transformed ones; sequence of interest modified or newly introduced sequence of any length: the purpose of a (->) transformation attempt; if introduction of a sequence is not intended, the length of the sequence of interest can be zero, i.e.
  • a sequence of interest of a DNA molecule used as a vector has at least one sequence segment homologous to a sequence segment of another DNA molecule used as a vector.
  • transformation vector cloned DNA molecule that was generated to mediate (->) transformation of a (->) genome; transformation: process leading to the introduction, the excision or the modification of DNA sequences by treatment of (->) plants or plant cells including the use of at least one (->) transformation vector; transgene: DNA sequence derived from one (->) genome, introduced into another one; uidA: (->) coding region of bacterial ⁇ glucuronidase, a frequently used reporter protein.
  • Conventional plastid transformation vectors usually contain an integration sequence which is not present in the wild type plant and that contains a selectable marker gene, one or more gene(s) of interest and regulatory elements such as promoters, 5'-UTRs, 3'-UTRs or spacer elements.
  • the integration sequence is flanked by two sequences homologous to the targeting plastome thus directing the position of the plastome integration. Insertion of the integration region into the target plastome is achieved by double reciprocal homologous recombination events.
  • a simplified model suggests that integration occurs via two homologous recombination events, one event at each flank ( Fig. 1 ).
  • the actual molecular process is difficult to monitor and may be more complex involving intermediates.
  • the vectors of this invention contain not more than one homologous region
  • this invention discloses a process for producing transplastomic plants or plant cells, in which at least two different types of DNA molecules (e.g. transformation vectors) are introduced into plastids, preferably simultaneously.
  • DNA molecules e.g. transformation vectors
  • One homologous region for directing plastome integration is sufficient for each of said vectors, preferably each vector contains not more than one homologous region for directing plastome integration.
  • each vector contains a sequence of interest that is preferably not present in the wild type plant. The sequences of interest of said vectors will result in an integration sequence in the transplastomic plant obtained.
  • the integration sequence may contain foreign genes such as a marker gene or other sequences of interest.
  • the marker gene may be any gene conferring resistance against an inhibitor such as an antibiotic resistance gene like aphA-6 or an herbicide resistance gene like bar or an visible marker gene like GFP.
  • sequences of interest are any genes encoding or capable of expressing a useful protein like proinsulin, interferone, human serum albumin, human growth factors, peptides functioning as vaccines (such as a vaccine against hepatitis B) or genes for technical enzymes.
  • the integration sequence to be generated may also consist in a deletion of plastid sequences, e.g. in order to generate specific mutants.
  • At least two DNA molecules are released into the plastid, each containing a homologous region defining the integration site of the plastome.
  • said first or said second DNA molecule does not have more than one homologous region for directing plastome integration. More preferably, neither said first nor said second DNA molecule has more than one homologous region for directing plastome integration. This does not exclude the use of elements in the sequences of interest that have homology to plastome sequences like promoters or regulatory elements or other plastid sequences. If such elements homologous to plastid sequences are used in a sequence of interest, they may in principle also act as plastome integration sequences leading to undesired integration events.
  • undesired integration events may in many cases be unproblematic, e.g. if they do not lead to stable transformants or to transformants that may be selected for by the selectable marker employed. Moreover, undesired transformants may be detected by molecular analysis e.g. of the integration sequence.
  • Elements homologous to plastid sequences are preferably significantly shorter than the homologous regions for plastome integration. This measure generally achieves a significantly lower recombination frequency for said homologous elements than for said homologous regions.
  • such elements homologous to plastid sequences are preferably taken from plastome sequences located far away from the desired integration site of the DNA molecule to impede undesired recombination events.
  • the at least two different vector molecules are either released simultaneously or in two or more different transformation steps. Simultaneous transformation of at least two types of molecules is called co-transformation. Following co-transformation of the at least two vector molecules, the first regenerates containing plastids with the desired plastome modification appear after about 3 weeks of cultivation under adequate selection and culture conditions, depending on the transformation method applied.
  • the method of co-transformation can be used with any transformation method which is suitable for generation of plastid transformants. Examples for suitable plastid transformation methods are the biolistic transformation, the PEG-mediated transformation, other transfection methods using chemical agents or the electric field mediated transfection of nucleic acids.
  • the at least two vector molecules may be applied in separated transformation steps. Consecutive transformation by at least two transformation steps leads to the same integration results observed during co-transformation.
  • the third vector does not have to contain any homologous sequences derived from the target plastome, as long as the sequences of interest of the vectors contain an overlapping region sufficient for recombination. The same is true if more than three vectors are used.
  • Fragments of the marker gene may be located on different vectors, whereby the marker gene is assembled by recombination processes.
  • the vectors of this invention enable the generation of homoplastomic plants in a very short time
  • Homoplastomic transformants do not contain any wild type plastomes.
  • the presence of wild type plastomes can be monitored by methods such as Southern hybridization or PCR analysis.
  • Southern hybridization or PCR analysis In transplastomic plant material recovered from primary regenerates which appear after transformation of plant tissue or cells, routine Southern analysis was performed to identify recombinant plastomes and to detect remaining wild type plastomes. 40 % of the analyzed material from these primary regenerated does not contain any remaining wild type plastomes. Wild type plastomes could be eliminated from the other regenerates in only one step of sub-culture, whereas up to 5 cycles of sub-culture are needed using conventional transformation vectors.
  • FIG. 4 A hypothetical mechanism for the introduction of foreign sequences according to this invention is described in figure 4 .
  • one of the two vector molecules which contain a homologous region recombine with the respective plastome sequence.
  • the homologous recombination event leads to the integration of the whole vector including the plasmid backbone. It also leads to a duplication of the homologous region. This process is reversible and may result in an excision of the recombinant sequence by homologous recombination mediated by the duplicated homologous regions unless the process is stabilized by another integration event. If the integration sequence contains a selectable marker gene which can be expressed, the vector will tend to stay integrated if selective pressure is applied.
  • the plastome with one integrated vector is highly unstable.
  • a second recombination event may lead to the integration of at least one other molecule. If the other molecule contains another homologous region, a recombination with the respective homologous region of the plastome may occur. Alternatively, it is also possible that the recombination is mediated by any of the other repeated sequences such as the vector backbone or the overlapping region of the molecules.
  • the second recombination event may occur between the free first vector and the integrated second vector (shown in fig. 4 ), or between the free second vector and the integrated first vector (not shown in fig. 4 ) or between the integrated first vector and the integrated second vector located on different plastome molecules (not shown in fig.
  • Vector molecules that do not contain a homologous plastid region may only recombine with the other repeated sequences. In either case, an integration of the whole second vector molecule will appear. In cases where more than two vector molecules are used, all the molecules will integrate by one of the homologous regions. After integration of the different molecules into the plastome, a vast series of secondary intramolecular recombinations between any of the repeated sequences is possible. As a consequence all the repeated regions will be eliminated. The final result of these various recombination events is the generation of a continuous recombinant region referred to as integration sequence.
  • the vectors of this invention can be used in a combinatorial approach
  • Expression in plastids is useful for a broad range of different purposes ranging from modified nutrient composition to high level expression of pharmaceuticals in plants. For that purpose it is necessary to obtain a set of interchangeable promoters and regulatory elements differing in strength and expression pattern. This allows to construct expression vectors for different purposes (weak, strong, constitutive or regulated expression etc.). The elements should be interchangeable to modify the expression level. For many cases it is favourable to use promoters, 5'-UTR and 3'-UTR from different genes because this excludes internal recombinations where the inserted gene is exchanged with an endogenous gene via identical 5'- and 3'-UTRs. On the other hand, 5'- and 3'-UTRs sometimes interact and together determine translation activities.
  • Modular vectors of this invention containing only the 5'- or 3'-regulatory elements allow an easy and fast way of combining different regulatory elements thus generating the desired expression cassette in the integration sequence.
  • Vectors with different elements can be kept in libraries and can be combined at will.
  • a mixture of different regulatory elements on different vectors can be used for transformation.
  • the expression cassette with the desired properties is then obtained by selection of the transformant with desired properties, optionally followed by molecular analysis.
  • the vectors of this invention avoid surplus cloning work
  • plastid transformation vectors usually contain a selectable marker gene needed for the selection of the transformants, one or more gene(s) of interest and regulatory elements such as promoters, 5'-UTRs, 3'-UTRs or spacer elements. It needs a substantial effort to generate these highly complex plasmids consisting of many different elements. However, in different transformation vectors many identical elements are used. Using the method of this invention it is possible to construct a vector that contains these identical elements, such as a homologous region, a selection marker gene and regulatory elements in one molecule. The at least one other transformation vector carries the different sequences of interest to be introduced into the plastome. Combining the first vector molecule with any other adequate vector containing any of the desired sequences reduces the complexity of the plasmids and consequently the effort to construct these molecules.
  • the vectors of this invention are smaller than conventional plastid transformation vectors and thus allow for the insertion of more sequences of interest
  • transformation vectors are frequently restricted by insert size limitations.
  • Conventional plastid transformation vectors usually contain two homologous regions, a selectable marker and regulatory elements. Therefore, only a limited number of additional sequences can be introduced. However it may be desirable to engineer complex metabolic pathways in the plastids, which depend on the expression of several different enzymes.
  • the vectors of the invention contain less compulsory sequences compared to conventional vectors, it is possible to insert longer sequences of interest.
  • more than two transformation vectors with overlapping regions may be used in order to introduce even larger integration sequences which are assembled in the plastids.
  • the genes to be introduced into plants can have toxic effects on the bacteria used for cloning.
  • construction of the transformation vector is restricted.
  • An example for a sequence that has toxic effects on bacteria is the gene HbsAg encoding a surface antigen of the Hepatitis B virus. Expression of the gene in plant plastids would be desirable, because it would constitute a source for a vaccine e.g. against Hepatitis.
  • cloning of the full gene including the regulatory elements used in conventional transformation vectors is restricted, because the plastid regulatory elements are also active in bacteria.
  • Using the vectors of this invention it is possible to split the full expression cassette of a gene like HbsAg between two molecules in a way that none of the vectors alone contains an expressible cassette. Using that approach the restrictive effects of genes toxic for bacteria are overcome.
  • the vectors of this invention allow the generation of resistance marker free plants
  • a method for obtaining plastid transformants which are devoid of resistance marker genes is highly desirable in order to prevent unwanted spread of the marker gene into the environment.
  • Conventional plastid transformation vectors usually contain a suitable resistance marker gene which is necessary for the selection of the transformants.
  • the resistance marker is located in the integration sequence of the transformation vector and leads to a stable plastome integration of the resistance gene in the final plant.
  • the resistance marker gene may also be split in two or more overlapping fragments, each located on a different vector, whereby the resistance is only mediated if the fragments recombine to the complete expressible marker gene.
  • intron splicing may be used for processing a primary transcript to obtain a desired secondary transcript, e.g. for correct translation of a protein of interest.
  • a 5' part of an intron may be included in said first sequence of interest and a 3' part of an intron may be included in said second sequence of interest (or vice versa), whereby a functional intron is formed upon formation of said integration sequence and transcription in plastids.
  • Said 5' and said 3' intron parts may be derived from a natural intron or derivatives thereof.
  • Self-splicing introns like group I and group II introns have the ability to splice themselves out of pre-mRNA.
  • Both group I and group II introns are capable of splicing (including trans-splicing) in artificial systems ( Been et al., 1986, Cell, 47, 207-216 ; Jacquier et al., 1986, Science, 234, 1099-1194 ; Jarrell et al., 1988, Mol. Cell Biol. 8, 2361-2366 ).
  • Trans-splicing was also found for group II introns in split genes of chloroplasts ( Kohchi et al., 1988, Nucl. Acids Res., 16,10025-10036 ), and for a group I intron in an artificial split gene in Escherichia coli ( Galloway-Salvo et al., 1990, J. Mol.
  • Group I introns were first discovered in Tetrahymena thermophila rRNA ( Cech, T.R., 1990, Annu. Rev. Biochem., 59, 543-568 ). They require a U in the target sequence immediately 5' of the cleavage site and bind 4-6 nucleotides on the 5' side of the cleavage site. There are over 75 known members of this group up to now. They were found also in fungal and plant mitochondria ( Richard & Dujon, 1997, Curr. Genet., 32, 175-181 ; Cho et al., 1998, Proc. Natl. Acad. Sci.
  • Plastids are transformed simultaneously with said first and said second DNA molecule referred to as modular vectors ( fig 5 ).
  • Vector 1 (said first DNA molecule) contains one region homologous to a plastome region (said first homologous region). The integration of sequences of interest should take place downstream of this plastome region.
  • the homologous region typically has a length of 500 to 1000 bp. If desirable, shorter or longer sequences may also be used.
  • the first sequence of interest is located downstream of this homologous region.
  • the upstream part of the integration sequence is contained in the first sequence of interest downstream of this homologous region.
  • Vector 2 contains one region homologous to a plastome region (said second homologous region).
  • the integration of sequences of interest should take place upstream of this plastome region.
  • the homologous region typically has a length of 500 to 1000 bp, too.
  • the second sequence of interest is located upstream of this homologous region.
  • the downstream part of the integration sequence is contained in the second sequence of interest upstream of this homologous region.
  • the two homologous regions of the two vectors are present next to each other on the plastome without intervening sequences.
  • a sequence segment of the downstream region of the first sequence of interest on vector 1 is homologous to a sequence segment of the upstream region of the second sequence of interest on vector 2.
  • This homologous sequence segment is also referred to as overlapping region.
  • this homologous sequence segment has a length of 500 to 1000 bp.
  • the marker gene for selecting transformants can be located as two fragments on the two vectors, i.e. one fragment on each vector.
  • the marker gene may be split into two fragments in several ways. Non limiting examples for that splitting are:
  • homologous regions on the vectors are chosen such that the integration sequence is integrated in a plastome region transcribed by an endogenous promoter, it is not necessary to include a promoter in front of the marker gene.
  • additional gene(s) of interest may be included either in the sequences of interest of vector 1 or vector 2 or both.
  • an integration sequence necessary for stable plastid transformation on three vectors ( fig. 6 ).
  • Non limiting examples are: insertion of very long integration sequences (e.g. gene clusters), serial construction of transformation vectors etc.
  • Vector 1 contains a first region homologous to the plastome region and a first sequence of interest downstream thereof.
  • the integration of the integration sequence should take place downstream of this plastome region. Downstream of the first homologous region, the upstream part of the integration sequence is present in the first sequence of interest.
  • Vector 2 contains a second region homologous to the plastome region and a second sequence of interest.
  • the integration of the integration sequence should take place upstream of this plastome region. Upstream of this homologous region, the downstream part of the integration sequence is present in the second sequence of interest.
  • the homologous sequences are typically 500 to 1000 bp long, but are not limited to this length.
  • Vector 3 contains a third sequence of interest, the upstream part of which is homologous to the sequence of interest of vector 1 and the downstream part is homologous to a sequence of interest of vector 2.
  • Vector 3 may or may not contain the complete integration sequence which should be integrated into the plastome.
  • the marker gene will be present in the full vector integration intermediates ( fig. 7 ). When selection pressure is released, the marker gene is excised together with vector sequences.
  • the homologous plastid sequences and sequences of interest are arranged as described in embodiment 1. Contrary to embodiment 1, the marker gene is not included in the sequence of interest. Instead it is located elsewhere on vector 1 or vector 2.
  • the marker gene is separated from the unit consisting of the homologous region and the sequence of interest by vector sequences.
  • vector 1 and vector 2 each contains a marker gene in this fashion, whereby these marker genes are different, e.g. aadA and aphA6.
  • Selection is then carried out by using a combination of the two respective antibiotics e.g 500 mg/l spectinomycin + 25 mg/l kanamycin.
  • a fragment of a marker gene is located on vector 1 and the other fragment of the marker gene is located on vector 2, whereby both fragments are outside the above-defined unit. It is a prerequisite then that both fragments share a homologous segment (overlapping region) which allows recombination of both fragments to assemble a complete functional marker gene after insertion of both vectors into the plastome.
  • the selection pressure maintains intermediates containing said functional marker. When selection pressure is removed, the marker gene together with remaining vector sequences will be removed by recombination due to repetitive vector sequences.
  • Resistance marker free plants can be obtained by using modular vectors which contain homologous sequence elements 5' of the resistance marker gene on the first DNA molecule and 3' of the resistance marker gene on the second DNA molecule, whereas the resistance marker gene or a fragment thereof is present on said first and said second DNA molecule.
  • the resistance marker gene flanked by two homologous sequence elements is inserted into the plastome.
  • the presence of the selection marker in the insertion sequence can be maintained by selective pressure.
  • the selective pressure for the maintenance of the resistance marker gene is released.
  • a further recombination event mediated by the two homologous sequence elements may lead to an excision of the selection marker gene. Consequently, the final plant does not carry the resistance marker gene used for selection of the transformants.
  • the process of the invention is preferably carried out with crop plants which include gymnosperms (such as pine, spruce and fir etc.) and angiosperms.
  • Angiosperms are more preferred.
  • Angiosperms include monocotyledonous plants like maize, wheat, barley, rice, rye, Triticale, sorghum, sugar cane, asparagus, garlic, palm tress etc., and dicotyledonous plants like tobacco, potato, tomato, rape seed, sugar beet, squash, cucumber, melon, pepper, Citrus species, egg plant, grapes, sunflower, soybean, alfalfa, cotton etc.
  • Solanaceae are most preferred (e.g. potato, tomato, pepper, egg plant, tobacco).
  • Example 1 PCR analysis of complete vector integration (via one flank) into the plastid genome
  • Plastid transformation vector pKCZ Plastid transformation vector pKCZ
  • pKCZ is a conventional plastid transformation vector where the selection marker is cloned between the two flanks used for homologous recombination.
  • the vector is designed to make a neutral insertion between trnR and trnN in the inverted repeat region of the tobacco plastid genome (Zou, 2001).
  • pKCZ comprises two flanking sequences for homologous recombination (corresponding to Nicotiana tabacum plastome sequences 31106-132277 and 132278-133396, according to GenBank accession number Z00044) and an aadA plastid expression cassette under control of the 16s rRNA promoter (Koop et al., 1996).
  • a schematic drawing of the plasmid construct is shown in figure 8 .
  • Plastid transformants (cycle-0) were identified by PCR using total DNA isolated with the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). To determine the presence of the aadA gene the primers oSH81 (5'-CTATCAGAGGTAGTTGGCGTC-3') and oFCH60 (5'-CACTACATTTCGCTCATCGCC-3') were used. The PCR program was as follows: 3 min at 94 °C, 1 cycle; 45 sec at 94 °C, 45 sec at 55 °C, 2 min at 72°C, 30 cycles; final extension at 72°C for 10 min. The results showed that 48 lines from 54 analysed (6 bombarded leaves) gave the expected amplification product of 504 bp.
  • oSH58 (5'-TATTCCGACTTCCCCAGAGC-3') and oFCH60 (5'-CACTACATTTCGCTCATCGCC-3') were used.
  • Primer oSH58 is located outside (downstream) of the right flank of pKCZ in the tobacco plastome and in combination with oFCH60 can only give the expected product of 2106 bp upon integration of the aadA expression cassette between trnR and trnN in the inverted repeat.
  • the PCR program was as follows: 5 min at 94 °C, 1 cycle; 45 sec at 94 °C, 45 sec at 55 °C, 3.5 min at 72°C, 35 cycles; final extension at 72°C for 7 min. All 48 of the aadA PCR positive lines showed the expected right-flank- aadA product of 2106 bp. Ten of the cycle-0 transformants (1:1, 1:2, 1:3, 1:4, 1:5, 2:1, 2:4, 2:5 2:6 and 2:7) were selected for further analysis.
  • PCR was performed using primers s oSH3 (5'-GGCATCAGAGCAGATTG-3') and oSH58 (5'-TATTCCGACTTCCCCAGAGC-3').
  • Primer oSH3 is located within the vector backbone of pKCZ (pUC18) and primer oSH58 is located outside (downstream) of the right flank of pKCZ in the tobacco plastome.
  • a product of 2638 bp can only be obtained with these two primers when complete pKCZ integration has occurred as shown in figure 2 .
  • No PCR product of the expected size will be obtained from the wild type plastome fragment (comprising left and right flanks) since the binding site for oSH3 is absent.
  • the PCR program was as follows: 5 min at 94 °C, 1 cycle; 45 sec at 94 °C, 45 sec at 55 °C, 3.5 min at 72°C, 35 cycles; final extension at 72°C for 7 min.
  • 9 of the 10 cycle-0 transformants analysed showed a PCR product of 2.6 kb which would be consistent with complete integration of pKCZ into the plastid genome within these lines ( fig. 3A ). No product of the correct size was observed in the wild type control or in sample 1:1.
  • the model presented in figure 2 also predicts that all cycle-II lines which are negative for complete vector integration should still show PCR signals consistent with a stably integrated aadA cassette due to the molecular rearrangements previously described.
  • oSH58 5'-TATTCCGACTTCCCCAGAGC-3'
  • oFCH60 5'-CACTACATTTCGCTCATCGCC-3'
  • the PCR program was as follows: 5 min at 94 °C, 1 cycle; 45 sec at 94 °C, 45 sec at 55 °C, 3.5 min at 72°C, 35 cycles; final extension at 72°C for 7 min. All 10 of the cycle-II transformants show the expected right-flank- aadA product of 2106 bp ( fig. 3D ) which would be consistent with the scenario shown in figure 2 .
  • Modular vector pICF742 ( fig. 9 ) comprises the right flanking region homologous to the tobacco plastome, the tobacco rpl32 promoter, the tobacco psbA-5'-UTR and the aadA marker gene.
  • the right flanking region was amplified from tobacco plastid DNA (bp 132279 to bp 133390 of the N. tabacum plastome) with modifying primers 5'-TGGAGCTCGAATTGCCGCGAGCAAAGATATTAATG -3' and 5'-TACGAATTCAAGAGAAGGTCACGGCGAGAC-3', introducing an SacI recognition site at the 5'-end and an EcoRl recognition site at the 3'-end.
  • the PCR product was purified and digested with SacI and EcoRl and ligated into a pUC18 plasmid which was digested with the same enzymes.
  • the rpl32 promoter was amplified from tobacco plastid DNA (bp 113917 to bp 114055 of the N. tabacum plastome) with modifying primers 5'- GACCCTGCAGGCAAAAAATCTCAAATAGCC -3' and 5'- CGGGATCCGATTTTTCTTTAGACTTCGG-3', introducing a PstI recognition site at the 5'-end and a BamHI recognition site at the 3'-end.
  • the PCR product was reamplified with modifying primers 5'- CGGGATCCGATTTTTCTTTAGACTTCGG-3' and 5'-CGAGCTCCACCGCGGTGGCGGCCCGTCGACCCTGCAGGCAAAAAATCTC-3' to introduce a new multi cloning site containing a Sacl recognition site at the 5'-end.
  • the resulting PCR product was digested with BamHI and Sacl and ligated into the similar restricted pUC18 vector containing the right flanking region.
  • the psbA-5'-UTR was amplified from tobacco plastid DNA (complementary to bp 1598 - bp 1680 of the N.
  • coli was amplified from plasmid pFaadAll (Koop et al., 1996) with the modifying primer 5'- TGAATTCCCATGGCTCGTGAAGCGG-3' and 5'-GGTGATGATGATCCTTGCCAACTACCTTAGTGATCTC -3' introducing a NcoI recognition site at the 5'-end.
  • the PCR product was reamplified with primers 5'-TGAATTCCCATGGCTCGTGAAGCGG-3' and 5'-GCTCTAGATTAGTGATGATGGTGATGATGATCCTTGCC-3' to introduce a His-tag and Xbal recognition site at the 3'-end.
  • the PCR product was digested with Ncol and Xbal.
  • the pUC18 vector containing the right flanking region and the rpl32 promoter was digested with BamHI and Xbal and ligated with the digested psbA-5'-UTR and the digested aadA.
  • the resulting plasmid was digested with Xbal and Ndel to remove the remaining pUC18 multicloning site.
  • the digested plasmid was purified on an agarose gel. The band at 4600 bp was extracted purified and the ends filled in with Klenow polymerase. The plasmid was then religated, resulting in pICF742.
  • Modular vector pICF743 ( fig. 10 ) comprises the left flanking region homologous to the tobacco plastome, the alpha operon terminator from E. coli and the aadA marker gene.
  • the multicloning site of pUC18 between Pael and SapI was removed and replaced by a new multicloning site consisting of (from 5' to 3') BamHI, Kpnl, Xbal and Ncol.
  • the left flanking region was amplified from tobacco plastid DNA (bp 131106 to bp 132277 of the N. tabacum plastome) with modifying primers 5'- GATGGATCCTTGCTGTTGCATCGAAAGAG -3' and 5'-CACTGGTACCCGGGAATTGTGACCTCTCGGGAGAATC -3', introducing a BamHI recognition site at the 5'-end and a Kpnl recognition site at the 3'-end.
  • the PCR product was purified and digested with BamHI and Kpnl and ligated into the pUC18 plasmid with new multicloning site, which was digested with the same enzymes.
  • the resulting plasmid was digested with Kpnl and Xbal.
  • the digested vector was ligated with the single strand oligonucleotide 5'-GATGTCTAGAAGCAACGTAAAAAAACCCGCCCCGGCGGGTTTTTTTATACCCGTAGTATCCCCAGCGGCCG CGGTAC-3', coding for the E. coli alpha operon terminator.
  • the complementary strand was filled in with Taq polymerase, digested with Xbal and religated.
  • the resulting vector was digested with Ncol and Xbal and ligated with the aadA PCR product from pICF742, resulting in vector pICF743.
  • PCR with all three primer showed amplificates, proving the integration of both vectors resulting in one continuous integrated region ( fig. 12 ).
  • the calculated amplificate sizes are 2139 bp (A), 2035 bp (B) and 1450 bp (C) which fits well with the observed sizes.
  • Remarkably no wild type signal (290 bp) is visible with primer pair C, indicating that even in such an early stage no untransformed is present.
  • Five spectinomycin/streptomycin resistant calli from cycle-0 and cycle-I were then analysed in three independent Southern blot experiments ( fig. 13 ).
  • Translation based vectors do not contain own promoter elements but rely on endogenous promoter elements of the plastome upstream of the desired integration site.
  • This example presents two modular vectors (pICF1033 and pICF1034) which in combination substitute a translation based vector (pICF986) which could not be constructed despite several attempts because of the high expression level in E. coli.
  • T7G10 used mediates high expression in plastids as well as in E. coli.
  • the vectors do not contain plastid promoter elements, the left flanking region necessary for homologous recombination contains sequence elements which have promoter activity in E. coli.
  • the two modular vectors pICF1033 ( fig 15 ) and pICF1034 ( fig. 16 ) could be constructed without problems.
  • the modular vector containing the left flanking region (pICF1033) does not contain the complete gene to be expressed, this modular vector avoids the problematic high expression in E. coli.
  • Modular vector pICF1033 contains the left flanking region homologous to the tobacco plastome, the ribosomal binding site of gene 10 from phage T7 and the N-terminal part of the uidA reporter gene.
  • the left flanking region was amplified from tobacco plastid DNA (complementary to bp 534 to bp 1336 of the N. tabacum plastome) with modifying primers 5'-TATAGGGCCCAGCTATAGGTTTACATTTTTACCC-3' and 5'- GTCCTGCAGTTATCCA-TTTGTAGATGGAGCTTCG-3', introducing a Bsp120I recognition site at the 5'-end and a Pstl recognition site at the 3'-end.
  • the PCR product was purified and digested with Bsp120I and Pstl and ligated into the pICF5001 vector, which was digested with the same enzymes.
  • Plasmid pICF5001 is a pUC18 derivative containing the modified multi cloning site 5'-GAATTCGGGCCCGTCGACCCTGCAGGCCCGGGGATCCATATGCCATGGTCTAGATGATCATCATCACCATC ATCACTAATCTAGAGAGCTCCTCGAGGCGGCCGCGGTACCATGCATGCAAGCTT-3'.
  • the ligation results in pICF5001 harbouring the left flanking region.
  • the ribosomal binding site of gene 10 from phage T7 and an N-terminal fusion tag enhancing translation activity was introduced by inserting the synthetic nucleotide sequence 5'-CTGCAGGATCCTATAGGGAGACCACAACGGTTTCCCTCTAGTAATAATTTTGTTTAACTTTAAGAAGGAGATA TACATATGGCTAGCATTTCCATGG-3' between the Pstl and Ncol site of pICF5001 harbouring the left flanking region.
  • the resulting vector was digested with Ncol and HindIII.
  • the N-terminal fragment of uidA was amplified from E.
  • the PCR product was purified and digested with Ncol and HindIII.
  • the PCR product was then inserted into the vector, digested with the same enzymes, resulting in pICF1033.
  • Modular vector pICF1034 contains the ribosomal binding site of gene 10 from phage T7, the complete uidA reporter gene, a second synthetic ribosomal binding site, the aadA marker gene and the right flanking region.
  • the ribosomal binding site of gene 10 from phage T7 was introduced into pICF5001 as described above. Modifying primers 5'-CATGCCATGGTCCGTCCTGTAGAA-3' and 5'-CTGGGTACCTTATTGTTTGCCTCCCTGCTGCG-3' were used to amplify the complete uidA gene, while introducing a Ncol recognition site at the 5'-end and a KpnI recognition site at the 3'-end. The PCR product was digested with Ncol and Kpnl and ligated into the vector containing the T7 ribosomal binding site, digested with the same enzymes. The aadA sequence from E.
  • coli was amplified from plasmid pFaadAll (Koop et al., 1996) with the modifying primers 5'-GGATCCATGCGTGAAGCGGTTATCGCCG-3' and 5'-GGTGATGATGATCCTTGCCAACTACCTTAGTGATCTC-3'.
  • the PCR product was reamplified with modifying primers 5'-GGGGTACCAGTTGTAGGGAGGGATCCATGCGTGAAGC-3' and 5'-GCTCTAGATTAGTGATGATGGTGATGATGATCCTTGCC-3' to introduce a His-tag and Xbal recognition site at the 3'-end and a synthetic ribosomal binding site and Kpnl recognition site at the 5'-end.
  • the PCR product was purified and digested with Kpnl and Xbal.
  • the right flanking region was amplified from tobacco plastid DNA (complementary to bp 155370 to bp 533 of the N. tabacum plastome) with modifying primer 5'- CTAATCTAGAGAGCTCGTCTATAGGAGGTTTTGAAAAG -3', introducing a Xbal recognition site at the 5'-end and exact primer 5'- CCAGAAAGAAGTATGCTTTGG -3', binding behind a HindIII restriction site in the tobacco plastome.
  • the PCR product was purified and digested with Xbal and HindIII.
  • the vector containing the T7 ribosomal binding site and uidA gene was digested with Kpnl and HindIII and then ligated with the two PCR products (digested with Kpnl/Xbal resp. Xbal/HindIII), resulting in vector pICF1034.
  • the modular vector system can also be used with other important crop species.
  • This example illustrates efficient plastid transformation in potato ( Solanum tuberosum) following particle bombardment of protoplast-derived micro colonies using the vectors described in Example 2. Due to the high degree of homology between the plastomes of tobacco and potato the vectors containing tobacco flanking sequences can also be used for tobacco.
  • Plants of S. tuberosum cv. Walli were grown in vitro as sterile shoot cultures (20 ⁇ 1°C, 16h day, light intensity 75 ⁇ 10 ⁇ moles/m 2 /sec). New cultures were initiated every 2 months by transferring shoot tips (approx. 2 cm in length) to MS medium (Murashige and Skoog, 1962) in glass tubes (2.5 x 20 cm). Young fully expanded leaves were selected from 3-4 week old plants and used for protoplast isolation. Leaves were cut into 1 mm stripes with a scalpel and preplasmolysed in 10 ml of MMM-550 medium.
  • MMM-550 medium contains 4.066 g/l MgCl 2 6H 2 0, 1.952 g/l 2-(N-morpholino)ethanesulfonic acid (MES) and ⁇ 86 g/l mannitol (adjusted to 550 mOsm and pH 5.8). After 1 hour of incubation in the dark the MMM-550 was removed and replaced with 10 ml of MMS-550 medium containing 0.4% w/v Macerozyme R10 and 0.4% Cellulase R10.
  • MES 2-(N-morpholino)ethanesulfonic acid
  • MMS-550 medium contains 4.066 g/l MgCl 2 ⁇ 6H 2 0, 1.952 g/l MES and ⁇ 150 g/l sucrose (adjusted to 550 mOsm and pH 5.8).
  • the leaf explants in enzyme solution were incubated for 16 hours in the dark at 25°C without shaking. The following day the digestion was filtered through a 100 ⁇ m sieve into a centrifuge tube and then carefully overlaid with 2 ml of MMM-550 medium and centrifuged (10 min, 70 x g ).
  • Intact protoplasts were collected from the band at the interface and washed once by resuspending in 10 ml of potato protoplast culture medium followed by centrifugation (10 min, 50 x g ).
  • the protoplast culture medium contains 133.75 mg/l NH 4 Cl, 950 mg/l KNO 3 , 220 mg/l CaCl 2 2H 2 O, 185 mg/l MgSO 4 7H 2 O, 85 mg/l KH 2 PO 4 , B5 microelements (Gamborg et al.
  • MS Fe-EDTA (Murashige and Skoog, 1962), 100 mg/l myo-inositol, 100 mg/l glutamine, 100 mg/l casein hydrolysate, 1 mg/l nicotinic acid, 10 mg/l thiamine hydrochloride, 1 mg/l pyridoxine hydrochloride, 250 mg/l xylose, 975 mg/l MES, 2 mg/l naphthalene acetic acid (NAA), 0.2 mg/l 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5 mg/l 6-benzylaminopurine (BAP) and -94 g/l glucose (adjusted to 550 mOsm and pH 5.8).
  • NAA naphthalene acetic acid
  • 2,4-D 2,4-dichlorophenoxyacetic acid
  • BAP 6-benzylaminopurine
  • Protoplasts were counted and resuspended at 2x the required final plating density in protoplast culture medium (2.0 x 10 5 /ml) and mixed with an equal volume of 1.2% w/v alginic acid prepared in MMM-550 medium.
  • Thin alginate layer culture in polypropylene grids was made as described in Dovzhenko et al. (1998). Following solidification of the alginate matrix, grids were cultured in 5cm Petri dishes containing 2 ml of protoplast culture medium. Protoplasts were incubated for one day in the dark (26 ⁇ 1°C) and then transferred to standard culture room conditions for further development (26 ⁇ 1°C, 16h day, light intensity 75 ⁇ 10 ⁇ moles/m 2 /sec).
  • SH-1 medium contains 267.5 mg/l NH 4 Cl, 1900 mg/l KNO 3 , 440 mg/l CaCl 2 2H 2 O, 370 mg/l MgSO 4 ⁇ 7H 2 O, 170 mg/l KH 2 PO 4 , MS microelements and Fe-EDTA (Murashige and Skoog, 1962), Nitsch vitamins (Nitsch and Nitsch, 1969), 40 mg/l adenine sulphate, 100 mg/l casein hydrolysate, 975 mg/l MES, 0.1 mg/l NAA, 0.5 mg/l BAP, 10 g/I sucrose and 50 g/l mannitol (adjusted to pH 5.8).
  • Plastid transformants were observed as green micro colonies following 8-12 weeks of selection (non-transformed tissues are bleached on SH-1 medium containing spectinomycin). Individual colonies (approx. 1 mm in diameter) were transferred to 5 cm dishes containing SH-1 medium + 100 mg/l spectinomycin. For regeneration calli (approx. 5 mm in diameter) were transferred to SH-2 medium solidified with 0.4% w/v Gelrite containing 100 mg/l spectinomycin.
  • SH-2 medium is identical to SH-1 medium (see above) except that the NAA is replaced with 0.1 mg/l indole-3-acetic acid (IAA), BAP is replaced with 1 mg/l zeatin and the mannitol content is reduced from 50 g/l to 36 g/l. Shoots were removed from regenerating calli after 6-8 weeks of culture on SH-2 medium these were transferred to antibiotic-free MS medium for rooting and further development.
  • Spectinomycin resistant potato shoots were analysed by PCR to verify correct plastid transformation. Three different primer pairs were used as described for the analysis of tobacco transformants (example 2):

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Diaphragms For Electromechanical Transducers (AREA)
  • Materials For Medical Uses (AREA)

Claims (20)

  1. Verfahren zur Erzeugung von transgenen Pflanzen oder Pflanzenzellen, die auf ihrem Plastom transformiert sind, wobei das Verfahren umfasst:
    (a) Einführen eines ersten und eines zweiten DNA-Moleküls in Plastide von Pflanzen, wobei
    das erste DNA-Molekül eine erste Region, die homolog zu einer Region auf dem Plastom ist, enthält, um eine Integration ins Plastom zu dirigieren, und eine erste gewünschte Sequenz, und
    das zweite DNA-Molekül eine zweite Region, die homolog zu einer Region auf dem Plastom ist, enthält, um eine Integration in das Plastom zu dirigieren, und eine zweite gewünschte Sequenz,
    wobei ein Sequenzsegment der ersten gewünschten Sequenz homolog zu einem Sequenzsegment der zweiten gewünschten Sequenz ist, und
    (b) Selektion von Transformanten, die eine stabil in das Plastom integrierte Integrationssequenz enthalten, wobei die Integrationssequenz mindestens einen Teil der ersten und mindestens einen Teil der zweiten gewünschte Sequenz als kontinuierliche Sequenz enthält.
  2. Das Verfahren nach Anspruch 1, wobei das erste und das zweite DNA-Molekül in die Plastiden der Pflanze mittels Kotransformation eingeführt werden.
  3. Das Verfahren nach einem der Ansprüche 1 oder 2, wobei die erste und die zweite gewünschte Sequenz verschieden sind.
  4. Das Verfahren nach einem der Ansprüche 1 bis 3, wobei die erste und die zweite gewünschte Sequenz zusätzlich zu dem Sequenzsegment jeweils eine weitere Sequenz enthalten.
  5. Das Verfahren nach einem der Ansprüche 1 bis 4, wobei ein oder mehrere weitere DNA-Moleküle in die Plastiden der Pflanze eingeführt werden zusätzlich zu dem ersten und dem zweiten DNA-Molekül, wobei das/die weitere(n) DNA-Molekül(e) zusätzliche gewünschte Sequenzen enthalten.
  6. Das Verfahren nach Anspruch 5, wobei das eine zusätzliche DNA-Molekül ein Sequenzsegment enthält, das zu einem Sequenzsegment der ersten gewünschten Sequenz homolog ist, und ein Seqzenzsegment, das zu einem Seqzenzsegment der zweiten gewünschten Sequenz homolog ist.
  7. Das Verfahren nach einem der Ansprüche 1 bis 6, wobei die erste und/oder die zweite und/oder eine zusätzliche gewünschte Sequenz ein oder mehrere gewünschte Gene oder Fragmente eines gewünschten Gens enthält.
  8. Das Verfahren nach einem der Ansprüche 1 bis 7, wobei ein gewünschtes Gen in zwei oder mehr Fragmente gespalten wird und die erste und/oder die zweite und/oder die zusätzliche gewünschte Sequenz ein Fragment des gewünschten Gens enthält, und
    wobei das gewünschte Gen aus den zwei oder mehr Fragmenten bei der Bildung der Integrationssequenz zusammengesetzt wird.
  9. Das Verfahren nach einem der Ansprüche 1 bis 7, wobei die erste gewünschte Sequenz einen 5'-Teil eines gewünschten Gens und die zweite gewünschte Sequenz einen 3'-Teil des gewünschten Gens enthält, und die Integrationssequenz das gewünschte Gen so enthält, dass es exprimiert werden kann.
  10. Das Verfahren gemäß Anspruch 9, wobei die Expression des gewünschten Gens RNA-Trans-Spleißen umfasst.
  11. Das Verfahren gemäß Anspruch 9, wobei die erste gewünschte Sequenz stromaufwärts des 5'-Teils des gewünschten Gens ein Sequenzelement enthält, das homolog zu dem stromabwärts des 3'-Teils des gewünschten Gens der zweiten gewünschten Sequenz ist, wobei die Sequenzelemente die Exzision mittels homologer Rekombination eines Teils der Integrationssequenz ermöglichen, der den 5'-Teil und/oder den 3'-Teil des gewünschten Gens enthält.
  12. Das Verfahren nach einem der Ansprüche 7 bis 11, wobei das gewünschte Gen ein Selektionsmarkergen ist.
  13. Das Verfahren nach einem der Ansprüche 1 bis 12, wobei das erste oder das zweite DNA-Molekül ein Selektionsmarkergen außerhalb einer Sequenzeinheit enthält, die aus der zu einer Region des Plastoms homologen Region und der gewünschten Sequenz besteht, um den Verlust des Selektionsmarkergens zu ermöglichen.
  14. Das Verfahren nach einem der Ansprüche 1 bis 12, wobei ein Selektionsmarkergen in ein erstes und ein zweites Fragment gespalten wird, wobei
    das erste Fragment in das erste DNA-Molekül außerhalb einer ersten Sequenzeinheit eingefügt wird und
    das zweite Fragment in das zweite DNA-Molekül außerhalb einer zweiten Sequenzeinheit eingefügt wird,
    wobei die erste Sequenzeinheit aus der ersten homologen Region und der ersten gewünschten Sequenz besteht und wobei die zweite Sequenzeinheit aus der zweiten homologen Region und der zweiten gewünschten Sequenz besteht.
  15. Das Verfahren nach einem der Ansprüche 12 bis 14, wobei das Selektionsmarkergen aphA-6 ist.
  16. Das Verfahren nach einem der Ansprüche 1 bis 15, wobei das erste DNA-Molekül nur eine einzige Region enthält, die homolog zu einer Region des Plastoms ist, um die Integration in das Plastom zu dirigieren.
  17. Das Verfahren nach einem der Ansprüche 1 bis 15, wobei das erste und das zweite DNA-Molekül je nur eine einzige Region enthält, die homolog zu einer Region des Plastoms ist, um die Integration in das Plastom zu dirigieren.
  18. Das Verfahren nach einem der Ansprüche 1 bis 17, wobei die erste und die zweite homologe Region zusammen einer kontinuierlichen Sequenz auf dem zu transformierenden Plastom entsprechen.
  19. Das Verfahren nach einem der Ansprüche 1 bis 18, wobei homoplastomische transgene Pflanzen aus den Transformanten regeneriert werden.
  20. Kit umfassend ein erstes und ein zweites DNA-Molekül wie in einem der Ansprüche 1 bis 19 definiert.
EP03784146A 2002-08-06 2003-08-01 Plastidtransformation mit modularen vektoren Expired - Lifetime EP1527185B1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10236001A DE10236001A1 (de) 2002-08-06 2002-08-06 Transformation von Plastiden unter Verwendung modularer Vektoren
DE10236001 2002-08-06
PCT/EP2003/008549 WO2004015115A1 (en) 2002-08-06 2003-08-01 Plastid transformation using modular vectors

Publications (2)

Publication Number Publication Date
EP1527185A1 EP1527185A1 (de) 2005-05-04
EP1527185B1 true EP1527185B1 (de) 2008-07-30

Family

ID=30469490

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03784146A Expired - Lifetime EP1527185B1 (de) 2002-08-06 2003-08-01 Plastidtransformation mit modularen vektoren

Country Status (10)

Country Link
US (1) US7528292B2 (de)
EP (1) EP1527185B1 (de)
JP (1) JP4384037B2 (de)
AT (1) ATE403004T1 (de)
AU (1) AU2003255350B2 (de)
CA (1) CA2495545A1 (de)
DE (2) DE10236001A1 (de)
ES (1) ES2311116T3 (de)
MX (1) MXPA05001401A (de)
WO (1) WO2004015115A1 (de)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1766032B1 (de) * 2004-02-13 2012-10-10 Monsanto Technology, LLC In-vivo-zusammenbau von transkriptionseinheiten
US20080044853A1 (en) * 2004-06-21 2008-02-21 Novozymes A/S Stably Maintained Multiple Copies of at Least Two Orf in the Same Orientation
FR2880356B1 (fr) * 2005-01-05 2007-04-06 Bayer Cropscience Sa Sa Plantes transplastomiques exemptes du gene marqueur de selection
CA2700008A1 (en) * 2007-08-01 2009-02-05 Bioglow Inc. Bioluminescent plants comprising bacterial lux operon and methods of making same
MA41180A (fr) 2014-12-17 2017-10-24 Bayer Cropscience Nv Plantes caractérisées par une capacité améliorée de fixation du carbone photosynthétique

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5583103A (en) * 1988-06-28 1996-12-10 La Jolla Cancer Research Foundation Inhibition of transforming growth factor beta activity
US5451513A (en) * 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
CA2312474C (en) 1997-12-05 2012-07-03 Europaisches Laboratorium Fur Molekularbiologie Novel dna cloning method
DE10101276A1 (de) * 2001-01-12 2002-07-18 Icon Genetics Ag Verfahren und Vektoren zur Transformation von Plastiden
DE10102389A1 (de) * 2001-01-19 2002-08-01 Icon Genetics Ag Verfahren und Vektoren zur Plastidentransformation höherer Pflanzen
WO2003054189A2 (de) 2001-12-20 2003-07-03 Sungene Gmbh & Co. Kgaa Verfahren zur transformation von pflanzlichen plastiden
WO2003054201A1 (de) 2001-12-20 2003-07-03 Sungene Gmbh & Co. Kgaa Verfahren zur transformation von pflanzlichen plastiden

Also Published As

Publication number Publication date
DE60322543D1 (de) 2008-09-11
US20060117400A1 (en) 2006-06-01
ATE403004T1 (de) 2008-08-15
AU2003255350B2 (en) 2010-10-07
WO2004015115A1 (en) 2004-02-19
EP1527185A1 (de) 2005-05-04
US7528292B2 (en) 2009-05-05
JP4384037B2 (ja) 2009-12-16
MXPA05001401A (es) 2005-06-03
AU2003255350A1 (en) 2004-02-25
CA2495545A1 (en) 2004-02-19
JP2005534329A (ja) 2005-11-17
ES2311116T3 (es) 2009-02-01
DE10236001A1 (de) 2004-02-19

Similar Documents

Publication Publication Date Title
US5527674A (en) Genetic construct for selection of homologous recombinants on a single selective medium
US20040137631A1 (en) Processes and vectors for plastid transformation
CA2433882C (en) Processes and vectors for plastid transformation of higher plants
EP1102528B1 (de) Translations-kontrollelemente für proteinexpression mit hoher ausbeute in den plastiden von höheren pflanzen und verfahren zu deren verwendung
MX2008004001A (es) Plantas de aloe transgenicas para produccion de proteinas y metodos relacionados.
US20100218277A1 (en) Method of plastid transformation in asteraceae, vector for use therein and plants thus obtained
US7504555B2 (en) Translation control elements for high-level protein expression in the plastids of higher plants and methods of use thereof
EP1404848B1 (de) Auf replizierende vektoren basierende genexpression in plastiden
EP1527185B1 (de) Plastidtransformation mit modularen vektoren
WO2005054478A1 (en) Controlling gene expression in plastids
AU2002304711A1 (en) Gene expression in plastids based on replicating vectors
JP2006075078A (ja) キク科植物の葉緑体の形質転換方法
EP2006387A1 (de) Translationsregulationselemente für die Plastidentransformation
JP4373363B2 (ja) 長鎖ｄｎａ断片導入葉緑体形質転換用ベクター
JP4474542B2 (ja) 構成的発現プロモーター
CA2808845A1 (en) Promoters and methods for transforming tubers and transformed tubers
Ranjan et al. Chloroplast Transformation
AU2002228044A1 (en) Processes and vectors for plastid transformation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041223

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

17Q First examination report despatched

Effective date: 20050512

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20050512

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ICON GENETICS GMBH

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REF Corresponds to:

Ref document number: 60322543

Country of ref document: DE

Date of ref document: 20080911

Kind code of ref document: P

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: BOHEST AG

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081230

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2311116

Country of ref document: ES

Kind code of ref document: T3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081030

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20080831

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

Ref country code: DK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20090506

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081030

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090131

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20080730

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20081031

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: LU

Payment date: 20110825

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20110812

Year of fee payment: 9

Ref country code: IE

Payment date: 20110817

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20110818

Year of fee payment: 9

Ref country code: AT

Payment date: 20110726

Year of fee payment: 9

Ref country code: ES

Payment date: 20110824

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 20110812

Year of fee payment: 9

Ref country code: IT

Payment date: 20110728

Year of fee payment: 9

Ref country code: NL

Payment date: 20110823

Year of fee payment: 9

BERE Be: lapsed

Owner name: ICON GENETICS G.M.B.H.

Effective date: 20120831

REG Reference to a national code

Ref country code: NL

Ref legal event code: V1

Effective date: 20130301

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: AT

Ref legal event code: MM01

Ref document number: 403004

Country of ref document: AT

Kind code of ref document: T

Effective date: 20120801

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120831

Ref country code: NL

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130301

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120831

REG Reference to a national code

Ref country code: FR

Ref legal event code: ST

Effective date: 20130430

REG Reference to a national code

Ref country code: IE

Ref legal event code: MM4A

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120801

Ref country code: BE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120831

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120801

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120801

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120831

REG Reference to a national code

Ref country code: ES

Ref legal event code: FD2A

Effective date: 20131021

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120802

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20120801

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20220824

Year of fee payment: 20

Ref country code: DE

Payment date: 20220816

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 60322543

Country of ref document: DE

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20230731

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20230731