Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

• the invention relates to an isolated nucleic acid having IRES (internai ribosome entry site) activity, said nucleotide sequence originating from the 5 'untranslated end (5'NTR) of the human FGF-1 gene.
• the subject of the invention is also a cassette for the expression of at least one molecule of interest in a eukaryotic cell, said cassette comprising the IRES of FGF-1 and making it possible to coexpress several molecules from the same mRNA.
• the cassette can be introduced directly or in the form of a vector into a host cell so that the recombinant vectors and the host cells transfected by said vector or the cassette are also part of the invention.
• the regulation of gene expression occurs at several levels, transcription, maturation, stability of F mRNA but also translation.
• Translation of an mRNA is subject to strict regulations and proves to be a key step in the regulation of gene expression. For example, increased translation of the proto-oncogene c-myc is associated with Bloom syndrome (20). This aberrant translational control could contribute to the increased risk that these patients run of developing cancers.
• Translation-level regulations involve numerous proteins and are exerted mainly via the 5 'and 3' untranslated regions (NTR) without excluding, however, certain structural elements of the coding part of the mRNAs.
• NTR 5 'and 3' untranslated regions
• the translation initiation stage is also subject to regulations.
• the classical initiation of translation is done by recognition of the cap (or CAP) located at the 5 'end of the transcript.
• This structure allows the setting of the translation initiation factors.
• eIF4F complex which plays the role of adapter between the cap and the small subunit of the 40S ribosome.
• This complex is made up of three factors, respectively eIF4E (“Cap binding protein”), eIF4A (an RNA helicase) and eIF4G which plays a bridge role, between the other translation initiation factors, the mRNA and the small 40S subunit.
• eIF4E Cap binding protein
• eIF4A an RNA helicase
• eIF4G which plays a bridge role, between the other translation initiation factors, the mRNA and the small 40S subunit.
• Certain messenger mRNAs lack a cap and therefore cannot be translated by the mechanism described by Marylin Kozak. This is the case with picomaviral RNAs (14), where another translation initiation system has been highlighted, involving an internal ribosome or IRES entry site at the 5 'non-region. translated (5'NTR). This site allows the ribosomes to bind directly inside the mRNA, and this by a mechanism still poorly understood. Since then IRES have been identified in the RNA of other groups of viruses such as flaviviruses, pestiviruses, tobamoviruses and retroviruses (19).
• the FGF-2 mRNA is provided with a long 5'NTR of approximately 500 nucleotides in which alternative initiations of translation have been demonstrated at the level of non-canonical codons CUG (1), which results in the formation of five isoforms of FGF-2.
• An internal ribosome entry site was also located between nucleotides 154 and 318 (unpublished data).
• VEGF mRNA also has a long untranslated sequence in which has been demonstrated, very recently, the presence of an alternative initiation at the level of a non-canonical codon CUG. In this 5'NTR, the presence of two IRES has been demonstrated, one is located upstream of the CUG and the other precedes the classic initiation codon AUG (6).
• the genomic structure (11) of FGF-1 comprises 3 exons containing the coding sequence (fig. N ° 1). The latter undergo splicing which results in the formation of a unique reading framework. Exon 3 contains the 3'NTR end which is provided with a polyadenylation site.
• Exon 1 is provided with a splice acceptor site which binds one of the 4 non-coding exons (A, B, C, D) following the activation of their respective promoter.
• Transcripts A and B are the majority transcripts which are mainly expressed in the brain, kidney and retina (fig. N ° 2). These two transcripts have respectively 5 'NTR of 435 and 147 nucleotides.
• Transcripts C and D are minor transcripts expressed very weakly in vivo (11). However, they are present in lines derived from glioblastoma and can be induced in fibroblasts or smooth muscle cells of vascular origin when subjected to serum deprivation or PMA treatment (phorbol 12-myristate 13 -acetate ). These two transcripts have respectively 5 'NTRs of 149 and 92 nucleotides.
• the presence of dRES is sought by transfecting Cos-7 cells with CAT-I-NuCAT vectors, containing the 5 'NTRs of FGF-1, then by subjecting the transfected cells to a western blot.
• the expression of the protein NuCAT is observed in the presence of transcripts A, B, C and D and testifies to the IRES activity of these 4 transcripts (qualitative analysis). Due to the strong homology of the sequences of the human 5 'NTRs with those of the ox and in particular of the mouse (9), the presence of IRES sites is also deduced therefrom in murine and bovine FGF-1.
• the IRES activity is measured by means of bicistronic vectors coding for reporter genes (in practice the LucF / LucR genes) in different lines.
• the calculation of the LucF / LucR ratio provides information on the internal input capacity of the 5 'NTR sequence and defines the IRES activity of this sequence.
• a very good IRES activity of the transcript A is observed in the Hela and Sk-Hep-1 cells, which is greater than that of 1TRES of the FGF-2.
• the Applicants have also compared, in vitro, on human cells, the IRES activity of the structure of the human 5 'NTR (transcribed A and B) with that of the murine 5' NTR (example 1 B2).
• the transfections were carried out in Cos-7, SK-Hep-1 and Saos-2 cells, to make a direct comparison with human sequences.
• the experiments showed that the IRES activity profiles of the human and murine variants A and B were similar.
• the invention consists not only in having demonstrated for the first time the IRES activity of the 5 'NTRs of FGF-1, but also, as will be demonstrated below, in having characterized the IRES sites in the various transcripts A, B , C and D of human FGF-1 (Example 2). More particularly, the Applicant has succeeded in identifying the smallest sequence of each of the transcripts A, B, C, D having IRES activity, both in vitro and in vivo. To do this, different continuous nucleotide sequences originating from the messenger RNA of FGF-1 were subcloned into a bicistronic vector coding for luciferase reporter genes. Different mammalian and human cell lines (in vitro) were transfected and the mouse muscle (in vivo) was transduced by these vectors.
• the IRES activity of human FGF-1 and, by homology, of murine FGF-1, is therefore disclosed for the first time in the present application. This activity has been demonstrated for each transcript A, B, C, D as well as for certain fragments of the 5 'NTR of these transcripts.
• homologous sequence is meant a sequence having at least 60% identity, advantageously 80% preferably 95% with a given sequence, the homology resulting in this case of variability from one species to another, in particular from mice to humans.
• the invention relates first of all to the use for its IRES activity of an isolated nucleic acid containing a sequence identical or homologous to the sequence SEQ ID 1 located between nucleotides 1 and 435 of the 5 'NTR of transcript A of human FGF-1 mRNA and hereinafter called A.
• This sequence corresponds to the entire sequence of the 5 'NTR of transcript A.
• the Applicant has also succeeded in identifying, on transcript A, nucleotide sequences of size smaller than the sequence SEQ ID 1, exhibiting IRES activity, which therefore suggests that the IRES site would be included in these sequences.
• the subject of the invention is also, in particular for use for its IRES activity:
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical to the sequence SEQ O 2, located between nucleotides 1 and 390 of the sequence SEQ ID 1 and hereinafter referred to as A2,
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ LD 3, located between nucleotides 39 and 435 of the sequence SEQ ID 1 and hereinafter referred to as A3,
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 4, located between nucleotides 122 and 435 of the sequence SEQ ID 1 and hereinafter referred to as A4, - an isolated nucleic acid exhibiting activity IRES comprising a sequence identical to or homologous to the sequence SEQ ID 5, located between nucleotides 214 and 435 of the sequence SEQ ID 1 and hereinafter called A5,
• A6 an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 6, located between nucleotides 122 and 390 of the sequence SEQ ID 1 and hereinafter called A6, - an isolated nucleic acid exhibiting activity IRES comprising a sequence identical or homologous to the sequence SEQ LD 7, located between nucleotides 214 and 390 of the sequence SEQ ID 1 and hereinafter referred to as A7,
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical to or homologous to the sequence SEQ ID 8, located between nucleotides 269 and 435 of the sequence SEQ ID 1 and hereinafter referred to as A8,
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 9, located between nucleotides 269 and 390 of the sequence SEQ LD 1 and hereinafter called A9.
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ LD 12, located between nucleotides 1 and 366 of the sequence SEQ LD 1 and hereinafter called A12,
• an isolated nucleic acid having an IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 16, located between nucleotides 122 and 366 of the sequence SEQ LD 1 and hereinafter referred to as Al 6
• an isolated nucleic acid having a IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 17, located between nucleotides 214 and 366 of the sequence SEQ ID 1 and hereinafter referred to as A1 7
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 18, located between nucleotides 269 and 366 of the sequence SEQ ID 1 and hereinafter referred to as Al 8,
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 19, located between nucleotides 1 and 344 of the sequence SEQ ID 1 and hereinafter called A 19,
• an isolated nucleic acid exhibiting IRES activity comprising a sequence identical or homologous to the sequence SEQ ID 20, located between nucleotides 1 and 330 of the sequence SEQ ID 1 and hereinafter called A20,
• the nucleic acid corresponding to the sequence (SEQ ID 18 (A18) constitutes the smallest fragment of the transcript A of human FGF-1 exhibiting IRES activity.
• SEQ ID 18 (A18) constitutes the smallest fragment of the transcript A of human FGF-1 exhibiting IRES activity.
• n does not obtain significant IRES activity, at least in human adenocarcinoma cells. Indeed, and as is apparent from the examples below, the IRES activity is not significant for the following fragments:
• sequence SEQ ID 14 located between nucleotides 282 and 390 of the sequence SEQ ID 1 and hereinafter called A14,
• sequence SEQ ID 15 located between nucleotides 282 and 366 of the sequence SEQ ID 1 and hereinafter referred to as A15.
• the invention also relates to an isolated nucleic acid exhibiting an IRES activity which is characterized in that it contains a sequence identical or homologous to the sequence SEQ ID 30 located between nucleotides 1 and 147 of the 5 'NTR of transcript B of human FGF-1 mRNA and hereinafter referred to as B.
• the sequence SEQ ID 30 corresponds to the entire sequence of the 5 'NTR of transcript B.
• the Applicant has also succeeded in identifying, on transcript B, nucleotide sequences of size smaller than the sequence SEQ ID 30, exhibiting an activity IRES, which therefore suggests that the IRES site would be included in these sequences.
• the subject of the invention is also:
• nucleic acid exhibiting IRES activity comprising a sequence identical to the sequence SEQ ID 31, located between nucleotides 1 and 93 of the sequence
• the nucleic acid corresponding to the sequence SEQ ID 31 (B2) constitutes the smallest fragment of the transcript B of human FGF-1 exhibiting IRES activity.
• SEQ ID 31 The nucleic acid corresponding to the sequence SEQ ID 31 (B2) constitutes the smallest fragment of the transcript B of human FGF-1 exhibiting IRES activity.
• the IRES activity is not significant for the following fragment:
• the subject of the invention is also an isolated nucleic acid exhibiting an IRES activity which is characterized in that it contains a sequence identical or homologous to the sequence SEQ ID 36 located between nucleotides 1 and 149 of the 5 'NTR of the transcript C of human FGF-1 mRNA and hereinafter referred to as C. This sequence corresponds to the entire sequence of the 5 'NTR of transcript C.
• the IRES site having been identified by the Applicant between nucleotides 1 and 103 of the sequence SEQ ID 36, the invention also relates to an isolated nucleic acid exhibiting an IRES activity which is characterized in that it contains a sequence identical or homologous to the sequence SEQ ID 37 located between nucleotides 1 and 103 of the sequence SEQ ID 36 hereinafter called C2.
• C3 an isolated nucleic acid having an IRES activity comprising a sequence identical to the sequence SEQ ID 38, located between nucleotides 59 and 149 of the sequence SEQ ID 36 and hereinafter referred to as C3
• C4 an isolated nucleic acid having an IRES activity comprising a sequence identical to the sequence SEQ ID 39, located between nucleotides 59 and 103 of the sequence SEQ ID 36 and hereinafter called C4.
• the invention also relates to an isolated or recombinant nucleic acid exhibiting an IRES activity which is characterized in that it contains a sequence identical or homologous to the sequence SEQ ID 42 located between nucleotides 1 and 92 of the 5 'NTR of the transcript D of human FGF-1 mRNA and hereinafter referred to as D.
• the sequence SEQ ID 42 corresponds to the entire sequence of the 5 'NTR of transcript D.
• the Applicants have moreover demonstrated that the IRES activity of certain fragments can be increased by adding a certain number of nucleotides 3 'to the IRES.
• the invention covers:
• the IRES activity of human and murine FGF-1 makes them potential candidates for the production of cassettes making it possible to express one or more genes of interest in eukaryotic cells, from the same mRNA under the control of a sole promoter.
• gene of interest denotes nucleic acids coding for polypeptides such as proteins of therapeutic interest, antigens, anti-angiogens, pro-angiogens, suppressors. tumors or genes intended to compensate for a genetic anomaly of the mutation type, etc.
• the invention relates to a cassette for the expression of at least one gene of interest in a eukaryotic cell, said cassette being characterized in that it contains at least one nucleic acid as described above. .
• cassettes comprising a single gene can be used either for the production of molecules of interest in vitro, or in gene therapy.
• first cistron provides the level of dependent translation while the second gene (second cistron) is expressed in proportion to the internal input activity of the ribosomes at the level of different 5 'NTR from FGF-1
• the multicistronic cassette of the invention comprises IRES of FGF-1 as they are characterized in the present application, associated or not with other IRES such as, for example, those identified on BIP (Immunoglobulin heavy -chain binding protein), the fibroblastic growth factor FGF-2, the proto-oncogene c-myc, the growth factor PDGF "Platelet Derived Growth Factor” and the VEGF "Vascular Endothelial Growth Factor”.
• the expression cassette contains at least two genes of interest separated by a nucleic acid as previously described, the first gene (first cistron) providing the level of dependent translation while the second gene (second cistron) is expressed in proportion to the activity of the IRES site present in said nucleic acid.
• the cassette also contains a promoter making it possible to control the expression of the gene (s).
• multicistronic expression cassettes make it possible to express the product of the nucleotide or nucleotides or the genes which they contain, from the same mRNA in vivo.
• These cassettes can also make it possible to express different types of molecules of industrial interest such as receptors, enzymes, etc.
• Gene therapy can be envisaged according to two distinct techniques, perfectly known to those skilled in the art.
• the first technique consists in introducing, in vivo, directly into the host organism (human or animal), a pharmaceutical composition containing the naked cassette contained in double stranded DNA, said pharmaceutical composition forming part of the present invention.
• this is coupled, in the pharmaceutical composition, to any compound capable of promoting penetration of the cassette into cells, in particular PEI and its derivatives, liposomes and derivatives ...
• the recombinant vectors contained in the pharmaceutical composition, into which the expression cassettes are inserted, are also part of the invention.
• the expression cassettes can be inserted into plasmid or viral vectors such as retrovirus, lentivirus, adenovirus and AAV.
• the second gene therapy technique consists of removing a cell from the host organism, then in vitro, introducing the naked or inserted cassette into a vector in the cell, the modified cell then being reintroduced into the host organism. In this way, the product of the cassette can be expressed in the patient's body.
• this cassette can be used for the in vitro production of said molecule from cell cultures.
• the cassette can be in naked form or inserted into a vector.
• the cassette or the vector are then introduced into a host cell by transfection technique, well known to those skilled in the art.
• transfection technique well known to those skilled in the art.
• Such techniques can for example be physical techniques (electroporation), chemical techniques, synthetic vectors, calcium phosphate precipitation or other methods such as cell fusion, conjugation, etc.
• the invention also relates to a recombinant host cell, which is characterized in that it comprises the expression cassette or a recombinant vector as previously described.
• the recombinant host cells of the invention are in particular, but not limiting:
• the production of the peptide is obtained by transfection, in vitro, of the host cell cultured by the naked cassette or inserted into a vector.
• Analysis of the expression of the peptide is carried out from cell extracts prepared from the transfected cells. Depending on the nature of the peptide of interest, its level of expression will be analyzed by different detection techniques (enzymatic assay, immuno logical detection, etc.). For the purpose of industrial use of the molecules of interest, these can be purified. For other uses, the cells genetically modified by the expression cassette will be used to produce the molecules of interest (ex vivo gene therapy, pharmacological screening).
• the expression cassette produced from the IRES sequences which are the subject of the present invention can also be inserted into the cells (egg) of an animal to create a transgenic animal.
• the invention also relates to a transgenic animal which is characterized in what its cells include the naked cassette or inserted into a vector, as previously described.
• the animal is obtained by introducing the cassette or the vector into the cells at the embryonic stage. This type of technology is perfectly known to those skilled in the art.
• Figure 1 The fibroblast growth factor 1 gene: Organization of the human FGF-1 gene. Exons 1, 2 and 3 constitute the 3 coding exons; splicing non-coding exons -1 A, 1B, 1C, 1D at exon 1 will generate mRNAs A, B, C, D respectively. The transcription starting point for transcript A is preceded by the canonical sequences CCAAT and TATA.
• transcripts A and B are predominant and expressed in the kidney, brain and retina.
• Transcripts C and D are in the minority and expressed in fibroblasts and Vascular Smooth Muscle Cells (VML) after induction with serum or PMA. They are also expressed in cells derived from prostate cancer (PC3), lungs, or cells derived from glioblastomas
• IRES study strategy Principle of bicistronic vectors: The first cistron of bicistronic mRNA provides the level of dependent translation, the second is expressed in proportion to the internal input activity at the 5 'level FGF-1 NTR. The calculation of the protein Y / protein X ratio defines the IRES activity of the sequence located between the two cistrons.
• Figure 4 Consecutive Western blotting of CAT-I-NuCAT vector transfections in Cos-7 cells: The intensity of the bands corresponding to CAT provides the level of cap-dependent translation. The intensity of the NuCAT bands corresponds to
• NT extract from non-transfected cells
• FGF-2 vector containing the 5 'NTR of FGF-2.
• A, B, C, D, vectors respectively containing the 5 'NTR A, B, C, D of human FGF-1;
• arrow 1 high molecular weight isoforms derived from the alternative initiation of translation in the 5 'NTR of FGF-2 at the level of the CUG initiation codon.
• Figure 5 LucR-I-LucF bicistronic mRNA and Comparison of the IRES activity of the 5 'NTRs of human FGF-1 in different cell types
• Figure 5A Schematic representation of the bicistronic LucR-I-LucF mRNA. A looped rod structure was placed 3 'from LucR to limit the phenomenon of non-specific reinitiation of translation at the level of the second LucF cistron.
• Figure 5B Diagram of the IRES activities of the 5 'NTRs of human FGF-1 in different cell types. The ordinate values are obtained by calculating the ratio of LucF / LucR activities and are expressed in arbitrary units.
• Figure 6 Representation of the murine FGF-1 gene and transcripts.
• Figure 6 A Gene structure of murine FGF-1. Exons 1, 2, and 3 constitute the 3 coding exons; the splicing of the non-coding exons -1A and -IB at the level of exon 1 generates the mRNAs A and B of FGF-1.
• Figure 6B Scheme of transcripts A and B of murine FGF-1.
• the transcripts have in common the reading frame and the 3 'NTR zone, and differ by their 5' NTR end.
• Figure 7A Alignment of the 5 'NTR A sequences of murine (mFGF-1) and human (h-FGF-1) FGF-1.
• Figure 7B Diagram of IRES activities of 5 'NTR A and B of human (hFGFl) and murine (mFGFl) FGF-1 in different cell types. The ordinate values are obtained by calculating the ratio of LucF / LucR activities and are expressed in arbitrary units.
• Figure 8 Diagram of IRES activities of different 5 'NTR subfragments of human FGF-1 in human SK-Hep-1 adenocarcinoma cells. The ordinate values are obtained by calculating the ratio of LucF / LucR activities and are expressed in arbitrary units.
• Figure 8 IRES activity of 20 nucleotide sequences of fragment A (A, A2, A3, A4, A5, A6, A7, A8, A9, A10, Ai l, A12, A13, A14, A15, A16, A17, A18, A19, A20)
• Figure 8B IRES activity of 4 nucleotide sequences of fragments B and C, respectively (B, B2, B3, B4) and (C, C2, C3, C4) and the nucleotide sequence of fragment D.
• Figure 8C IRES activity of 6 mutated A fragments (A26, A21, A22, A23, A24, A25) in the 911 lines (embryonic retinoblasts)
• Figure 8D IRES activity of 2 mutated B fragments (B10, B1) of 2 mutated C fragments (C10, Cl 1) in the 911 lines (embryonic retinoblasts)
• Figure 8E IRES activity of 3 mutated fragments A27, A28, A29 in the 911 lines (embryonic retinoblasts)
• Figure 10 Diagram comparing the IRES activity of the transcript A of human FGF-1, in vivo (intramuscular injection in mice), with regard to IRES of EMCV, VEGF, FGF2, Bip and PDGF.
• Figure 11 Diagram comparing the ERES activity of the transcript A of human FGF-1 and its subfragments A2, A6, A7 and A9, in vivo, with regard to the IRES of EMCV.
• Figure 12 Diagram comparing the ERES activity of the transcript A of human FGF-1 and of its subfragment Al 1, of the transcript B of human FGF-1 and of its subfragments B2 and B3, of the transcript C of human FGF-1 and its fragments C2 and C3, with regard to TIRES of EMCV
• RNAble lysis solution (Eurobio). Subsequently, the total RNAs undergo chloroform treatment, isopropanol precipitation and 80% ethanol washing. After drying, they are taken up in 50 ⁇ l of water and dosed at 260 nm.
• Reverse Transcription The reverse transcription reactions were carried out according to the superscript II protocol (GIBCO BRL) using, for all cell types, 2 ⁇ g of total RNA extracts per reaction.
• GEBCO BRL superscript II protocol
• Oligonucleotides They are presented in the 5 'to 3' direction, the Spel and Ncol cloning sites are underlined in the 3 'and 5' primers respectively.
• the 3 ′ primer is common to all 5 ′ NTRs of the same organism, due to its pairing at the TATG level of Texonl.
• Primer 3 ACCACCGCTGCTTGCTGCCGAGCCATGGCTGAA SEQ ED 48
• PCRs were carried out with TAQ polymerase platinum (Gibco BRL) for its capacity to amplify DNA rich in GC and its very good specificity. For each PCR, 3 ⁇ l of the cDNAs made above were used. For the PCRs aimed at amplifying the 5 'NTR C and D, 50 ng of a plasmid fragment carrying a part of these different 5'NTRs supplied by I-M Chiu (11) was added. The amplifications of the murine A and B transcripts were carried out in the same way. The amplifications are carried out according to the “Touch Down PCR” method.
• the 5 'NTR A was amplified with the primer 5' A and the primer 3 ', under the following conditions: 94 ° C 5 min, then 3 cycles 94 ° C 30sec / 76 ° C 2 min, then 3 cycles 94 ° C 30sec / 74 ° C 2min then 25 cycles 94 ° C 30sec / 72 ° C 2 min, finally 72 ° C 5 min.
• the 5 'NTR B was amplified under the following conditions: 94 ° C 5 min, then 3 cycles 94 ° C 30sec / 68 ° C 2min, then 3cycles 94 ° C 30sec / 66 ° C lmin / 68 ° C 1min then 25 cycles 94 ° C 30sec / 64 ° C lmin / 68 ° C 1min, finally 68 ° C 5 min, using the primers 3 'and 5' B.
• 5 'NTR C, D, and the 5' Murine NTR A and B were amplified, with their corresponding primers, under conditions similar to 5 'NTR B with hybridization temperatures of 70 ° C, 70 ° C, 68 ° C and 66 ° C respectively.
• the cell lines were obtained from T “American Type Culture Collection” (ATCC) or T “European Collection of Cell Cultures” (ECACC) and were cultivated according to their instructions.
• ATCC American Type Culture Collection
• ECACC European Collection of Cell Cultures
• the insertion of the various 5 'NTRs of FGF-1 into the bicistronic vectors was carried out using the Spel and Ncol sites located in the PCR primers 5' and 3 'respectively.
• the various plasmids were obtained by conventional molecular biology techniques, namely: ligation, transformation, selection of positive clones, sequencing and preparation of a concentrated solution at l ⁇ g / ⁇ l.
• Transfections All of the transfections were carried out with the FUGENE 6 reagent according to the protocol provided by Boeringher-Roche, at a rate of 2.5 ⁇ l per ⁇ g of plasmid DNA.
• the transfections for the luciferase assays are carried out in 12-well dishes with 80,000 cells and 1 ⁇ g of plasmid per well.
• the transfections carried out for the Western blots are carried out with 2 ⁇ g of plasmid DNA in dishes 5 cm in diameter seeded with 200,000 Cos-7 cells.
• Luciferase assay The activity of LucR and LucF was measured using the “dual luciferase reporter assay” system (Promega). The transfected cells, placed in 12-well dishes, are rinsed twice with PBS. Then they are detached and homogenized in 100 ⁇ l of the lysis buffer supplied with the kit, 48 hours after the transfection. The chemiluminescent signals of LucF and LucR are measured in a luminometer (Berthold) equipped with automatic injectors.
• the CAT and NuCAT proteins are immunodetected by an anti-CAT polyclonal rabbit antibody prepared in the laboratory (dilution 1/10000). After their fixation, anti-rabbit IgG antibodies coupled to peroxidase are detected using the chemiluminescence reagent (Amersham).
• Cloning of the 5 'NTR of human FGF-1 cDNA The first step consisted in cloning the various 5' NTRs of human FGF-1. To do this, the total RNA was extracted from human cell lines present in the laboratory. After reverse transcription, PCRs aimed at amplifying the sequences of the various 5 'NTRs of the FGF-1 have been performed. After amplification, the presence of the expected fragment informs about the existence of each transcript in the cell type tested. The amplification of the various 5 'NTRs of human FGF-1 was observed using cDNAs from SK-Hep-1, SK-N-BE and SK-N-AS cells. The more abundant SK-Hep-1 cell cDNA allowed cloning into bicistronic vectors.
• Bicistronic vectors The strategy of bicistronic vectors used to demonstrate the existence of IRES (14) was applied to test the IRES activity of the different 5 'NTRs of FGF-1 in different cell types (fig n ° 3). These constructions make it possible to express, from the same mRNA, two different reporter genes. The different 5 'NTRs of FGF-1 have been introduced between these 2 reporter genes. The first cistron provides the level of dependent translation. The second cistron is expressed in proportion to the internal entry activity of the ribosomes at the level of the various 5 'NTRs of FGF-1
• CAT-I-NuCAT bicistronic vectors were first used to determine qualitatively, by Western Blot, the internal input activity of the various 5'NTRs of the FGF -1. Indeed, these vectors are provided with cDNA of chloramphenicol acetyl transferase (or CAT) in the first cistron and that of a fusion protein Nucleoline-CAT (NuCAT) in the second cistron (fig.n ° 4). Due to the difference in molecular weight between these two proteins, they will be easily separated on polyacrylamide gel in denaturing condition.
• chloramphenicol acetyl transferase or CAT
• NuCAT Nucleoline-CAT
• the CAT and NuCAT proteins will be easily visualized, by the use of antibodies directed against the C-terminal region of CAT, after transfer to the membrane.
• the evaluation of the relationship between the second and the first cistron informs about the internal input capacity of the inserted sequence and defines its ERES activity.
• LucR-I-LucF bicistronic vectors The LucR-I-LucF bicistronic vectors (4) express two luciferases, which use different substrates.
• the Rénillia luciferase (LucR) is the first cistron and the Firefly luciferease (LucF) is the second cistron (fig. 5A).
• LucF reports on internal entry activity and is very sensitive to dosing, like LucR.
• the use of such a system allows rapid, precise and concomitant quantification of the activity of each reporter.
• the calculation of the LucF / LucR ratio provides information on the internal input capacity of the 5 'NTR sequence and defines the IRES activity of this sequence.
• the IRES activity between the different cell types is calibrated, in the laboratory, using the vector RHL (4), which contains a loop rod structure but no IRES between the two cistrons. This vector makes it possible to determine the value of non-specific initiation of the second cistron and to overcome variations in the efficiency of transfections between the cell types.
• the 5'NTR A is the most active, with values varying from 5.5 to 12.7. Its activity, in Hela and Sk-Hep-1 cells, is greater than that of TIRES of FGF-2. In contrast, TERES of variant A works less well than that of FGF-2 in Cos-7 and Saos-2 cells (although the values recorded in these cell types are the highest).
• Variant B of FGF-1 is more active than A in Cos-7 cells (10 units), and its activity is modest in Saos-2 cells.
• 5 'NTR B has no activity.
• variant C it has a medium activity in SK-Hep-1 and Saos-2 (5.8 and 7.5 respectively). It is in spite of everything in this latter cell type where the 5 'NTR C is the most active. Its activity in Cos-7 and Hela cells is extremely low.
• the IRES activity profiles of the human and murine variant A are similar. They have values of the same order of magnitude and seem to be regulated in the same way depending on the cell type, with the exception of Saos-2 cells. Indeed, the IRES activity of the murine variant A is greater in these cells and is close to the value observed for TERES of FGF-2. We also find internal input values of the same order of magnitude for the 5 'NTR B human and murine. In addition, the best IRES activity is observed in Cos-7 cells, for the construction containing the 5 'NTR B of human FGF-1: this is also the case with the murine counterpart.
• EXAMPLE 2 CHARACTERIZATION OF THE ERES OF THE 4 TRANSCRIPTS A, B, C and D OF HUMAN FGF-1 ex vivo
• Example 2A Characterization in Human Adenocarcinoma Cells (SK-Hep-1)
• the characterization of the IRES of the 4 transcripts consists in determining which is the smallest nucleotide sequence of each of the fragments A to D exhibiting satisfactory IRES activity, which allows to locate in a relatively precise way the IRES site of each of the transcripts.
• This experiment is carried out on human adenocarcinoma cells (SK-Hep-1). The following were thus tested: - the entire 5 'NTR of the transcript A (A),
• nucleotide sequences corresponding to continuous fragments of the 5 'NTR of transcript A (A2, A3, A4, A5, A6, A7, A8, A9, A10, Ai 1, A12,
• transcript B A13, A14, A15, A16, A17, A18, A19, A20), - the entire 5 'NTR of transcript B (B),
• transcript B (B2, B3, B4)
• the nucleotide sequences to be tested are continuous sequences originating from messenger TARN and have been subcloned into a bicistronic vector according to a procedure identical to that described in Example 1.
• the bicistronic vector codes for two luciferases, renilla luciferase (LucR , first cistron) and firefly luciferase or firefly (LucF, second cistron).
• the nucleotide sequences to be tested were therefore inserted between the two luciferase genes, so as to quantify, by measuring the LucF activity, their capacity to generate an initiation of translation by internal entry of the ribosomes.
• the value of LucF activity is related to the value of LucR activity which is proportional to the amount of mRNA.
• the LucF / LucR ratio is itself related to the value of a negative control (bicistronic vector without IRES) which represents the level of "leak”.
• Luciferase LucR and LucF activity was measured 48 hours after transfection on cellular extracts of human adenocarcinoma (SK-Hep-1).
• IRES FGF-IA as shown in Figure 8A, the 5'NTR A of the FGF-1 mRNA (nucleotides 1 to 435) allows the internal entry of ribosomes with an efficiency of approximately 14 AU (FIG. 8A, construction A), which therefore confirms the results of Example 1.
• the analysis of different segments of this 5 'NTR makes it possible to conclude that the internal input activity does not require nt 1 to 270, nor the nt 387 to 435.
• the minimum IRES of the FGF-IA comprises nucleotides 269 to 366 (construction Al 8).
• the IRES activity is optimized by the presence of nt located on both sides, ie from 214 to 269 and from 366 to 435 (construction A5). It should be noted that an essential but not necessarily sufficient element is found between nt 270 and 304.
• FIG. 8B indicates that the 5'NTR B of the mRNA of FGF-1 (nt 1 to 147) has a relatively low IRES activity of the order of 3 AU, which therefore comes confirm the results of Example 1. Deletion of nt 0 to 39 completely inactivates TIRES (Fig. 8B, construction B3 and B4).
• TIRES of FGF-1 B has superior activity in other cell types.
• IRES FGF-1C Figure 8B indicates that the 5'NTR C of the FGF-1 mRNA (149 nt) has a strong IRES activity with an efficiency of 6 AU. Interestingly, the deletion of nt 103 to 149 (corresponding to the area common to the 4 NTRs of the FGF-1 mRNA) generates an increase in the activity of TIRES (4 AU): it can therefore be concluded that minimum TIRES of FGF1-C includes nt 1 to 103. Furthermore, the deletion of the first 59 nt inactivates the IRES activity.
• IRES FGF-ID Figure 8B indicates that the 5'NTR D of the FGF-1 mRNA has no IRES activity in SK-Hep-1 cells. However, other examples will show that this fragment has IRES activity in other cell types, in particular the C2 / 7 myoblasts.
• Example 2B • characterization in cells 91 1 (r.e11nl pg ⁇ p rptinr>hlastp; embryonic hymans) and in cells C / 7 (cells of murine myoblasts)
• Example 2 A is repeated with the fragments A2, A6, A7 and A9
• Embryonic retinoblast cells and myoblasts are seeded one to two days before transfection into a 24-well plate. All transfections of retinoblast and myoblast cells were carried out with the reagent Lipofectamine according to the protocol provided by Life Technologies, at a rate of 3 ⁇ l per ⁇ g of plasmid DNA per well. The cells are lysed, 48 h post transfection, with 100 ⁇ l of lysis buffer (Dual Luciferase, Promega).
• luciferase activities are measured on 20 ⁇ l of cell lysate (Mediator PhL, Luminometer) for 10 s after 50 ⁇ l of addition of reagent (Dual Luciferase, Promega).
• the hairpin is a reference sequence of looped rod structure, not containing IRES.
• the 5 ′ NTR of the transcript A as well as the fragments A2, A6, A7 and A9 exhibit satisfactory IRES activity.
• Example 2C Characterization in C2 / 7 Myoblast Cells Then Differentiated into Myotubes)
• Example 2 A is repeated with the transcripts A, A9, B, C, D and this activity is compared with that of EMCV.
• Myoblast cells are seeded one to two days before transfection into a 12-well plate.
• the transfections carried out on the fragments containing hairpin, EMCV, A, A9, B, C, or D; are made in duplicate as described above.
• the cells are lysed, 24 h post transfection ( Figure 9C in shaded) or 9 days post transfection ( Figure 9C in dotted lines).
• Figure 9C in shaded
• Figure 9C in dotted lines the myoblast cells are differentiated into myotubes in a DMEM medium supplemented with 5% horse serum.
• the TIRES activity of the FGF-1 transcript A, of the A9 fragment and of the FGF-1 transcript B has a higher activity in the myotubes than in myoblasts.
• the FGF-1 transcript C and D has comparable activity in myoblasts and myotubes.
• Example 2D Characterization of Mutant Transcripts in 911 Cells (Human Embryonic Retinoblast Cells)
• Example 2 A is repeated from different transcripts to which a given sequence is added between TERES ° and the AUG codon of the firefly gene.
• A26 SEQ ID 26 (nt 269 to 435 of the sequence SEQ ID 8+ 20 nt) A21: SEQ ID 21 (nt 269 to 435 of the sequence SEQ ID 8 + 40 nt) A22: SEQ ID 22 (nt 269 to 435 of the sequence SEQ ED 8 + 70 nt) A25: SEQ ID 25 (nt 269 to 435 of the sequence SEQ ED 8 + 135 nt) A23: SEQ ED 23 (nt 269 to 390 of the sequence SEQ ED 9 + 70 nt) A24: SEQ ED 24 (nt 269 to 390 of the sequence SEQ ID 9 + 135 nt) B10: SEQ ID 34 (nt 1 to 147 of the sequence SEQ ID 30 + 40 nt) Bl 1: SEQ ED 35 (nt 1 to 147 of the sequence SEQ ED 30 + 70 nt) C10: SEQ ED 40 (nt 1 to 149 of the sequence SEQ ID 36 +
• the efficiency of TIRES of FGF1A (FIG. 8C) is increased for the mutants A26 and A21 and slightly decreased for the A22 and A25. However, the segment between nucleotides 390 and 435 is necessary to have an efficiency of TIRES (mutant A23 and A24). It is observed that the efficiency of TIRES of FGF1B and 1C is increased by 4 to 6 AU compared to wild TIRES (FIG. 8D). We also observe good plasticity of fragments A, B and C.
• Example 2E Characterization of Mutant Transcripts in 911 Cells (Human Embryonic Retinoblast Cells)
• Example 2 A is repeated from different transcripts of the A8 fragment to which a 40 nt sequence different from one fragment to another is added, between TERES ° and the AUG codon of the feverfly gene.
• A27 SEQ ID 27 (nt 269 to 435 of the sequence SEQ ID 8 + 40 nt)
• A28 SEQ ED 28 (nt 269 to 435 of the sequence SEQ ID 8 + 40 nt)
• A29 SEQ ED 29 (nt 269 to 435 of the sequence SEQ ED 8 + 40 nt)
• the animals used are female mice weaned for around 6 weeks.
• the strain used is Balb / C (EFFA CREDO).
• the mice are anesthetized with a mixture of ketamine (100 mg / kg) and xylazine (10 mg / kg) intraperitoneally.
• the duration of the anesthesia is 20 minutes.
• the DNA is amplified and purified by maxi-preparation in the absence of endotoxin (Endofree, Qiagen). After precipitation, the DNA is taken up in a 150 mM NaCl solution (Sigma) at a concentration of approximately 50 ⁇ g in 30 ⁇ l.
• DNA is injected into the left anterior tibia using a Hamilton syringe.
• the leg previously shaved, is coated with conductive gel.
• the two electrodes are applied on either side of the tab to make Telectro transfer.
• 8 electrical pulses of 20 milli seconds are delivered at a frequency of 2Hz., The voltage being 200V / cm.
• the animals are sacrificed by intraperitoneal injection of 0.1 ml of sodium pentobarbital 6 and then by cervical dislocation.
• the anterior tibia is removed and frozen in liquid nitrogen.
• the muscles are then ground in 500 ⁇ l of lysis buffer added with a protein inhibitor cocktail at 16.7 ⁇ l / ml.
• the muscle lysates are thawed for 5 minutes at 37 ° C, vortexed and centrifuged at 4 ° C for 5 minutes at 15,000 G.
• the luciferase activities are measured on 20 ⁇ l of muscle lysate (Mediators PliL, Luminometer) for 10 s after 50 ⁇ l of reagent addition (Dual Luciferase, Promega).
• the control muscle is either a muscle into which 30 ⁇ l of 150 mM NaCl was injected and then electroporated, or a muscle which has not undergone anything.
• This example aims to compare, in vivo, in mouse muscle, the ERES activity of the transcript A of human FGF-1 compared to other IRES such as that of EMCV, VEGF, FGF2, Bip and PDGF.
• the TERES activity of FGF-IA is equivalent to that of EMCV and greater than the ERES of VEGF, FGF-2, Bip and PDGF.
• EXAMPLE 3 B Comparison of the IRES Activity of the Transcript A of Human FGF-1 and Its Subfragments A, A2, A6, A7 and A9, in vivo, with Regard to TIRES of EMCV
• the IRES of FGF-IA and those modified, A2, A6 and A7 has an IRES activity similar to that of T RES of EMCV, while minimum IRES of FGF-IA ( construction A9) has slightly higher activity.
• EXAMPLE 3C Comparison of the IRES Activity of Transcript A of Human FGF-1 and Its Sub Fragment A1, of Transcript B of Human FGF-1 and Its Subfragments B2 and B3 of Transcript C of Human FGF-1 and its fragments C2 and C3, with regard to TIRES of EMCV
• TIRES of FGF-1B and FGF-1C has activity similar to that of EMCV.
• the minimum IRES of FGF-1B (fragments B3) and FGF-1C (fragment C2) have a much higher activity than that of EMCV.
• the Al 1 fragment has no activity, this confirms that the minimum TERES of the FGF-IA is the A9 fragment (example 3B).
• PDGF2 / c-sis mRNA leader contains a differentiation-linked internai ribosomal entry site (D-IRES). J Biol Chem 272: 9356-62. 3. Chetouani, F., P. Monestie, P. Thebault, C. Gaspin, and B. Michot.
• ES SA an integrated and interactive computer tool for analyzing RNA secondary structure. Nucleic Acids Res 25: 3514-22.
• FGF-1 mouse fibroblast growth factor 1
• FGF1 fibroblast growth factor 1

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• General Health & Medical Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Physics & Mathematics (AREA)
• Medicinal Chemistry (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Biophysics (AREA)
• Pharmacology & Pharmacy (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Molecular Biology (AREA)
• Plant Pathology (AREA)
• Veterinary Medicine (AREA)
• Microbiology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biochemistry (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=29724940

Family Applications (1)

Country Status (6)

• 2002
  • 2002-06-27 FR FR0208009A patent/FR2841564A1/fr active Pending
• 2003
  • 2003-06-26 WO PCT/FR2003/001969 patent/WO2004003209A2/fr not_active Ceased
  • 2003-06-26 JP JP2004516868A patent/JP2005530512A/ja active Pending
  • 2003-06-26 CA CA002490017A patent/CA2490017A1/fr not_active Abandoned
  • 2003-06-26 EP EP03761643A patent/EP1516057A2/de not_active Withdrawn
  • 2003-06-26 AU AU2003258826A patent/AU2003258826A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events