EP1402013A2 - Homoaconitase servant de cible a des fongicides - Google Patents

Homoaconitase servant de cible a des fongicides

Info

Publication number
EP1402013A2
EP1402013A2 EP02743184A EP02743184A EP1402013A2 EP 1402013 A2 EP1402013 A2 EP 1402013A2 EP 02743184 A EP02743184 A EP 02743184A EP 02743184 A EP02743184 A EP 02743184A EP 1402013 A2 EP1402013 A2 EP 1402013A2
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
acid sequence
seq
homoaconitase
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02743184A
Other languages
German (de)
English (en)
Inventor
Annette Freund
Wilhelm Schäfer
Karen Sonnenberger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1402013A2 publication Critical patent/EP1402013A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)

Definitions

  • Homoaconitase as a target for fungicides
  • the present invention relates to the use of homoaconitase as a new target for fungicides.
  • the present invention further relates to the identification and isolation of the nucleic acid sequence SEQ ID No: 1 coding for the protein homoaconitase and its functional equivalents, and to a method for
  • the present invention further relates to a transgenic organism containing SEQ ID NO: 1 or a functional equivalent of SEQ ID N0: 1, which is characterized by increased lysine production compared to a non-transgenic fungus.
  • the object of the present invention was therefore to identify a new fungicidal target.
  • the object of the present invention is therefore to identify new targets for fungicides and to provide methods which are suitable for identifying fungicidal active ingredients.
  • homoaconitase encoded by the sequence SEQ ID N0: 1 or a functional equivalent of SEQ ID N0: 1 is suitable as a fungicide of the target. Furthermore, it was found that an increase in lysine biosynthesis was achieved in a transgenic fungus which contains SEQ ID NO: 1 by increased expression of homoaconitase.
  • transgenic fungi containing the nucleic acid sequences according to the invention are characterized by an increased lysine content compared to a non-transgenic fungus.
  • affinity tag denotes a peptide or polypeptide whose coding nucleic acid sequence can be fused with the sequence coding for the target protein directly or by means of a linker using common cloning techniques.
  • the affinity tag is used to isolate the recombinant target protein using affinity chromatography.
  • the above-mentioned linker can optionally contain a protease cut part (e.g. for thrombin or factor Xa), whereby the affinity tag can be cleaved from the target protein if necessary.
  • common affinity tags are the "His tag” e.g. by Quiagen, Hilden, "Strep-Tag", the Myc-Tag "(Invitrogen, Carlsberg), the chitin-binding domain and an intein from New England Biolab and the so-called CBD-Tag from Novagen.
  • Enzymatic activity / activity test The term enzymatic activity describes the ability of an enzyme to convert a substrate into a product. Both the natural substrate of the enzyme and a synthetic modified ana- logon of the natural substrate can be used. The enzymatic activity can be carried out in a so-called activity test
  • both the starting material and the product can be used as a substrate in the corresponding activity test.
  • “Expression” describes transcription and subsequent translation of a gene in a cell containing the desired nucleic acid sequence.
  • “Expression cassette or nucleic acid sequence” An expression cassette containing a nucleic acid sequence according to the invention means, for example, a genomic or a complementary DNA sequence or an RNA sequence and semisynthetic or fully synthetic analogues thereof. These sequences can be in linear or circular form, extra-chromoso al or integrated into the genome.
  • the nucleic acid sequences according to the invention can be produced synthetically or can be obtained naturally or contain a mixture of synthetic and natural DNA components, and can consist of different heterologous gene segments from different organisms.
  • Artificial nucleic acid sequences are also suitable here as long as they enable expression of the target protein in a cell or an organism.
  • synthetic nucleotide sequences can be generated with respect to the codon-usage-of optimized from the organisms to be transformed wur- 'the.
  • nucleotide sequences mentioned above can be produced in a manner known per se by synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleotide building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897).
  • various DNA fragments can be manipulated in such a way that a nucleotide sequence with the correct reading direction and correct reading frame is obtained.
  • the nucleic acid fragments are connected to one another using general cloning techniques, as described, for example, in T.
  • Gene describes a nucleic acid sequence coding for a protein, which can be transcribed into RNA (mRNA, rRNA, tRNA, snRNA, senseRNA or anti-senseRNA) and can optionally be associated with regulatory sequences. Examples of regulatory sequences are promoter sequences. Other optional elements are, for example, introns.
  • Genetic control sequence The term “genetic control sequences” (to be seen equivalent to the term “regulatory sequence”) describes the sequences which have an influence on the formation or the function of the expression cassette according to the invention and, for example, the transcription and possibly translation in ensure prokaryotic or eukaryotic organisms. Examples are promoters or so-called “enhancer” sequences. In addition to these control sequences or instead of these sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically modified in such a way that the natural regulation was switched off and the expression of the target gene was increased. The control sequence is selected depending on the host organism or parent organism.
  • Genetic control sequences also include the 5 'untranslated region, introns or the non-coding 3' region of genes. Control sequences are further to be understood as those which enable homologous recombination or insertion into the genome of a host organism or which allow removal from the genome.
  • “Functional equivalents” here describe nucleic acid sequences that • 1) hybridize under standard conditions with the nucleic acid sequence coding for the target protein (according to the present invention with SEQ ID NO: 1) or parts of the nucleic acid sequence coding for the target protein and
  • an enzymatically active target protein in the case of the present invention, homoaconitase
  • short oligonucleotides with a length of about 10-50 bp; preferably 15-40 bp, for example of the conserved or other regions which can be determined by comparison with other related genes in a manner known to the person skilled in the art. But it can also be longer
  • fragments of the nucleic acids according to the invention or the complete sequences can be used for the hybridization. Varies depending on the nucleic acid used: oligonucleotide, longer fragment or complete sequence or depending on the type of nucleic acid DNA or RNA used for the hybridization
  • the melting temperatures for DNA: DNA hybrids are approx. 10 ° C lower than those of ⁇ DNA: RNA hybrids of the same length.
  • hybridization conditions for DNA DNA hybrids at 0.1 x SSC and temperatures between about 20 ° C to 45 ° C, preferably between about 30 ° C to 45 ° C.
  • DNA RNA hybrids the hybridization conditions are advantageously 0.1 ⁇ x SSC and temperatures between about 30 ° C to 55 ° C, preferably between about 45 ° C to 55 ° C.
  • the temperatures indicated for the hybridization are, for example, calculated melting temperature values for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide.
  • the experimental conditions for DNA hybridization are in relevant textbooks
  • a “functional equivalent” is meant further particular also contain natural or artificial mutations of the relevant nucleic acid sequences of the target protein and their homologs from other organisms which make possible the expression of the enzymatically active target protein in a 'cell or organism.
  • the present invention also includes those nucleotide sequences which are obtained by modifying the nucleic acid sequence of the target protein described by SEQ ID NO 1.
  • the aim of such a modification can e.g. the insertion of further restriction enzyme interfaces, the removal of superfluous DNA or the addition of further sequences.
  • Proteins which are encoded via said nucleic acid sequences should, however, still have the desired functions despite a different nucleic acid sequence.
  • the term functional equivalent can also refer to the protein encoded by the corresponding nucleic acid sequence.
  • the term functional equivalent describes a protein whose amino acid sequence is identical to SEQ ID NO: 2 to a certain percentage.
  • Functional equivalents thus include naturally occurring variants of the sequences described herein as well as artificial, e.g. nucleic acid sequences obtained by chemical synthesis and adapted to codon use or the amino acid sequences derived therefrom.
  • “Appropriate response time” means the time it takes to perform an activity test and depends not only on the method used, but also on the sensitivity of the equipment used. The determination of the reaction times is known to the person skilled in the art. When using photometric methods test systems, the reaction times are generally between> 0 to 40 minutes.
  • Homoaconitase is defined here as an enzyme that reverses. sibel is able to catalyze the conversion of homoaconitate to homoisocitrate.
  • Homoaconitase activity refers to the ability of an enzyme to catalyze the conversion of homoaconitate to homoisocitrate. This term is equivalent to the term "biological activity of a homoaconitase”.
  • Identity or “homology” between two nucleic acid sequences or polypeptide sequences is defined by the identity of the nucleic acid sequence / polypeptide sequence over the respective total sequence length, which is determined by comparison with the aid of the GAP program algorithm. (Wisconsin, - Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA) is calculated using the following parameters:
  • Gap Weight 50 Length Weight: 3
  • Knock-out transformants denotes individual cultures of a transgenic organism, in the case of P. teres homokaryotic individual cultures, in which a specific gene was specifically inactivated via transformation.
  • Natural genetic environment means the natural chromosal locus in the organism of origin or the presence in a genomic library.
  • the natural genetic environment of the nucleic acid sequence is preferably at least partially preserved.
  • the surrounding area flanks the nucleic acid sequence at least on the 5 'or 3' side and has a sequence length of at least 50 bp, preferably at least 100 bp, particularly preferably at least 500 bp, very particularly preferably at least 1000 bp, most preferably at least 5000 bp.
  • Operative or functional linkage is understood to mean the sequential arrangement of promoter, coding sequence, terminator and possibly other regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.
  • Recombinant DNA describes a combination of DNA sequences in a non-natural arrangement that can be produced by recombinant DNA technology, but also DNA containing cell-own and foreign or synthetic DNA, also homologous and heterologous DNA based on the relatives of the organisms
  • Recombinant DNA technology generally known techniques for fusing DNA sequences (e.g., described in Sambrook et al., 1989, Cold Spring Habour, NY, Cold Spring Habour Laboratory Press).
  • Replication origins ensure the multiplication of the expression cassettes or vectors according to the invention in microorganisms, e.g. pBR322 ori or P15A ori in E. coli (Sambrook et al.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
  • a growth, fluorescence, chemo-, bioluminescence or resistance assay or a photometric measurement (intrinsic color) or enzyme activity can be used to evaluate the transformation efficiency or the expression location or time using these genes.
  • Reporter proteins Schott al., Curr Biol 1996, 6: 325-330; Leffel SM et al., Biotechni-
  • selection markers confer resistance to antibiotics. Examples include the npt gene, which is resistant to the aminoglyciside antibiotics neomycin (G 418), kanamycin, and paromycin (Deshayes A et al., EMBO J. 4 (1985) 2731-2737) conferred the hygro gene (Marsh JL et al., Gene. 1984; 32 (3): 481-485), the sul gene ( Guerineau F et al., Plant Mol Biol. 1990; 15 (1): 127-136), the hygromycin gene (Gen Bank Accession NO: K 01193) and the she-ble gene, which is resistant to bleomycin Gives antibiotic Zeocin.
  • selection ark genes are genes which confer resistance to 2-deoxyglucose-6-phosphate (WO 98/45456) or phosphinotricin etc. or those which confer antimetabolite resistance, for example the dhfr -Gen (Reiss, Plant Physiol. (Life Sei. Adv.) 13 (1994) 142-149). Also suitable are genes such as trpB or hisD (Hartman SC and Mulligan RC, Proc Natl Acad Sei US A. 85 (1988) 8047-8051).
  • Mannose-phosphate isomerase WO 94/20627
  • ODC ornithine decarboxylase
  • McConlogue 1987 in: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, ed.
  • deaminase from Aspergillus terreus (Tamura K et al., Biosci Biotechnol Biochem. 59 (1995) 2336-2338).
  • Signal decrease based on the enzymatic activity, a decrease in the enzymatic activity of the enzyme incubated with a test compound in comparison to the activity of the ⁇ nyzms not incubated with the test compound is meant, which lies outside of a measurement error.
  • substrate is the compound which is recognized by the enzyme in its original function and which is converted into a product by means of a reaction catalyzed by the enzyme.
  • Test compound denotes the substances that were tested and identified in accordance with the method according to the invention. These substances can e.g. B. from expression libraries, for example cDNA expression libraries or peptides, proteins, nucleic acids, antibodies, small organic substances, hormones, • PNAs or the like (Milner, Nature Medicin 1 (1995), 879-880; Hupp, Cell. 83 (1995), 237-245; Gibbs, Cell. 79 (1994), 193-198 and references cited therein). The substances can be chemically synthesized or microbiologically produced substances and can occur, for example, in cell extracts from, for example, plants, animals or microorganisms.
  • Transformation describes a process for the introduction of heterologous DNA into a pro- or eukaryotic cell.
  • a transformed cell describes not only the product of the transformation process itself, but also all transgenic ones Descendants of the transgenic organism produced by the transformation.
  • Transgene Relating to a nucleic acid sequence, an expression cassette or a ' vector containing said nucleic acid sequence or an organism transformed with said nucleic acid sequence, expression cassette or vector, transger describes all such constructions produced by genetic engineering methods, in which either
  • nucleic acid sequences are not in their natural genetic environment or have been modified by genetic engineering methods.
  • the modification can be achieved here, for example, by mutating one or more nucleotide residues of the corresponding nucleic acid sequence.
  • Active ingredient here is synonymous with the term “compound with a fungicidal action”.
  • Homoaconitase reversibly catalyzes the conversion of in an ⁇ -aminoadipate pathway that is only found in archaebacteria and fungi for the synthesis of the amino acid lysine (Nishida, H. et al., Journal of Molecular Evolution 51 (2000) 299-302) Homoaconitate to homoisocitrate
  • homoaconitase is a new target for fungicides for controlling pathogenic fungi, preferably phytopathogenic fungi.
  • homoaconitase was clearly identified as a suitable target protein (target) for fungicidal active ingredients.
  • the present invention therefore relates to the use of the gene product of a nucleic acid sequence from a phytopathogenic fungus coding for a protein with the biological activity of a homoaconitase as a target for fungicides, the nucleic acid sequence
  • nucleic acid sequence with the nucleic acid sequence shown in SEQ ID N0.-1; or b) a nucleic acid sequence which can be derived from the amino acid sequence shown in SEQ ID NO: 2 on the basis of the degenerate genetic code by back-translation; or
  • SEQ ID N0: 1 The functional equivalents according to the invention of SEQ ID N0: 1 claimed here have an identity with SEQ ID No: 2 of P. teres homoaconitase of at least 61%, 62%, 63%, 64%, 65%, 66%, 67 %, 68%, 69% and 70% preferably at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% preferably at least 81%, 82%, 83 %, 84%, 85%, 86%, 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99% on.
  • Said functional equivalents. are characterized by essentially the same functionality, i.e. they are still able to reversibly catalyze the conversion of homoaconitate to homoisocitrate.
  • Pathogenic fungi are to be understood as those fungi that colonize a host and thereby cause a disease of the host.
  • Examples of fungi affecting plants, so-called phytopathogenic fungi are, in addition to P. teres, which affects barley, the following species: Alternaria species, Podosphaera species, Sclerotinia species, Physalospora canker on vegetables and fruit, Botrytis cinerea (gray mold) Strawberries, vegetables, ornamental plants and vines, Corynespora melonis on cucumbers, strawberries; Colletotrichum species on cucumbers; Diplocarpon rosae on roses; Elsinoe fawcetti and Diaporthe citri on citrus fruits; Sphaerotheca species on cucumbers, squash, strawberries and roses; Cinula neccata on cucumbers, Cercospora species on peanuts, sugar beets, egg plants and date plums; Erysiphe cichoracearum
  • Fusarium species should preferably be understood to mean the following species: F. graminearum, F. di erium, F. merismoides, F. lateritium, F. decem-cellulare, F. poae, F. tricinctum, F. sporotrichioides, F. chlamydosporum, F. rnoniliforme, F. proliferatum, F. anthophilum, F. subglutinans, F. nygamai, F. oxysporum, F. solani, F. culmorum, F. sambucinum, F. crookwellense, F. avenaceum ssp.
  • avenaceum F. avenaceum ssp. ayhong, F. avenaceum .ssp.- nurragi, F. hetrosporum, F. acuminatum ssp. acuminatum, F. acuminatum ssp. armenia-cum, F. longipes, F. compactum, F. equiseti, F. scripi, F. polyphialidicum, F. semitectum and F. beomiforme.
  • P.renophora species or “Pyrenophora species” should preferably be understood to mean the following species: P. graminea, P. hordei, P. japonica, P. teres, P. teres f. aculata, P. teres f. teres, P. tritici-repentis.
  • the present invention furthermore relates to the following nucleic acids:
  • nucleic acid sequence which, on the basis of the degenerate genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 2 by back-translation;
  • nucleic acid sequence which can be derived on the basis of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 2 by back-translating a functional equivalent;
  • SEQ ID NO: encode 2 amino acid sequence shown; or e) functional analogs of the nucleic acid sequence shown in SEQ ID NO: 1, which codes for functional analogs of the amino acid sequence shown in SEQ ID NO: 2; or
  • the present invention further relates to nucleic acid sequences encoding a polypeptide with the biological activity of a homoaconitase, comprising
  • the nucleic acid sequences preferably originate from a phytopathogenic fungus.
  • the term “phytopathogenic fungus” here means the species mentioned at the beginning.
  • the nucleic acid sequence preferably originates from the Pyrenophora or Fusarium species mentioned at the outset, very particularly preferably P. teres and F. graminearum.
  • the use of the gene product of one of the abovementioned nucleic acid sequences coding for a protein with the biological activity of a homoaconitase as a target for fungicides is also an object of the present invention.
  • SEQ ID NO: 2 has an identity with SEQ ID No: 2 of P. teres homoaconitase of at least 64%, 65%, 66%, 67%, 68%, 69% and 70%. preferably at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% preferably at least 81%, 82%, 83%, 84%, 85%, 86% , 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%.
  • Said functional equivalents are characterized by essentially the same functionality, i.e. they are still able to reversibly catalyze the conversion of homoaconitate to homoisocitrate.
  • SEQ ID NO: 2 The functional equivalents of SEQ ID NO: 2 according to the invention have an identity with SEQ ID No: 1 of homoaconitase from P. teres of at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78 %, 79%, 80% preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99%.
  • Said functional equivalents are characterized by essentially the same functionality, ie they are still able to reversibly catalyze the conversion from homoaconitate to homoisocitrate.
  • the invention further relates to sections of SEQ ID NO: 1 and functional equivalents of SEQ ID NO: 1, the range of the section extending from amino acid position 2 to 783.
  • the range from the amino acid position 200 to 600 is preferred here.
  • the range from the amino acid position 250 to 550 is particularly preferred, and very particularly preferably from amino acid position 300 to 500.
  • nucleic acid sequences can be used for the production of hybridization probes, by means of which the corresponding full-length genes can be isolated.
  • manufacture of these probes and the conduct of the experiments are known. This can be done, for example, by the targeted production of radioactive or non-radioactive probes by means of PCR and the use of appropriately labeled oligonucleotides with subsequent hybridization experiments.
  • the technologies required for this are described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).
  • the corresponding probes can also be modified using standard technologies (Lit. SDM or random mutagenesis) so that they can be used for other purposes, e.g. as a probe that hybridizes specifically to mRNA and the corresponding coding sequences for the purpose of analyzing the corresponding sequences in other organisms.
  • parts of the nucleic acids according to the invention can be used as probes for the detection and isolation of functional analogs of SEQ ID NO: 1 from other fungal species due to sequence identities.
  • Part or all of the sequence of the corresponding SEQ ID NO: 1 is used here as a probe for screening in a genomic or cDNA bank of the corresponding fungus or in a computer search for analogous sequences in electronic databases.
  • probes described above are the analysis of possibly changed expression profiles of the nucleic acids according to the invention in various fungi, preferably from the Pyrenophora or Fusarium species mentioned at the beginning, particularly preferably P. teres or F. graminearum especially in connection with certain factors such as increased resistance to fungicides , the detec- tion of the fungus in plant material and detection of emerging resistance.
  • the increase in resistance to a fungicide targeting homoaconitase is often based on mutation, e.g. the exchange of amino acids caused by a mutation in the nucleic acid sequence, at locations essential for substrate specificity, e.g. in the area of the active center or at other points on the protein that affect the binding of the substrate. Due to the changes described above, the binding of the inhibitor acting as a fungicide to the Erf. - Protein are made more difficult or even prevented, so that a limited or no fungicidal action can be observed in the corresponding cultures.
  • the probes described above may be used based on the above-defined nucleic acid sequences for the detection of mutant according Homoaconitasenukleinklanzen in completely or partially resistant phytopathogenic fungi.
  • the invention furthermore relates to expression cassettes comprising a nucleic acid sequence coding for homoaconitase
  • nucleic acid sequence with the nucleic acid sequence shown in SEQ ID N0: 1; or b) a nucleic acid sequence which can be derived from the amino acid sequence shown in SEQ ID NO: 2 on the basis of the degenerate genetic code by back-translation; or
  • Another object of the invention is the use of expression cassettes, the nucleic acid sequence of which codes for one of the above-mentioned nucleic acid sequences or for functional equivalents of the nucleic acid sequence SEQ ID NO: 1 with an identity of at least 71% to SEQ ID N0: 1 for the production recom - Binary homoaconitase for the test systems listed below e.
  • the nucleic acid sequence can e.g. be a DNA or a cDNA sequence.
  • an expression cassette according to the invention comprises a promoter at the 5 'end of the coding sequence and a transcription termination signal at the 3' end and optionally further genetic control sequences which are operatively linked to the intermediate coding sequence for the homoaconitase gene.
  • Analogs of the expression cassettes described above are also according to the invention, which can come about, for example, through a combination of the individual nucleic acid sequences on one polynucleotide (multiple constructs), on several polynucleotides in one cell (co-transformation) or through sequential transformation.
  • Vectors according to the invention also contain at least one copy of the nucleic acid sequences used and / or of the nucleic acid construct according to the invention or the expression cassettes described above. These vectors contain nucleic acid sequences comprising:
  • the use of the aforementioned vectors or of vectors containing nucleic acid sequences comprising functional equivalents of the nucleic acid sequences SEQ ID N0: 1 with an identity of at least 65% to SEQ ID N0: 1 for the production of recombinant protein for the test systems is also possible.
  • vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus, adenovirus, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chro osomally. Chromosomal replication is preferred.
  • the nucleic acid construct according to the invention can also advantageously be introduced into the organisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA can consist of a linearized plasmid or only of the nucleic acid construct as a vector or the nucleic acid sequences used.
  • nucleic acid sequences used in the method according to the invention can also be introduced into an organism alone.
  • nucleic acid sequences are to be introduced into the organism, they can all be introduced into the organism together in a single vector or each individual gene in a vector, the different vectors being able to be introduced simultaneously or successively.
  • Advantageous control sequences for the expression cassettes or vectors according to the invention are, for example, in promoters such as cos, tac, trp, tet, lpp, lac, laclq, T7, T5, T3, gal, trc, ara -, SP6, 1-PR or in the 1-PL promoter, which can be used for the expression of homoaconitase in gram-negative bacterial strains.
  • promoters such as cos, tac, trp, tet, lpp, lac, laclq, T7, T5, T3, gal, trc, ara -, SP6, 1-PR or in the 1-PL promoter, which can be used for the expression of homoaconitase in gram-negative bacterial strains.
  • control sequences are, for example, in the amy and SP02 promoters, which can be used for the expression of homoaconitase in gram-positive bacterial strains, and in contain the yeast or fungal promoters ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, AOX1 and GAP, which can be used to express homoaconitase in yeast strains.
  • control elements for expression in insect cells are the polyhedrin promoter and the p10 promoter (Luckow, V.A. and Summers, M.D. (1988) Bio / Techn. 6, 47-55).
  • advantageous control sequences for the expression of homoaconitase in cell culture are, for example, the following eukaryotic promoters of viral origin, e.g. Promoters of Polyoma, Adenovirus 2, Cytomegalovirus or Simian Virus 40 contain.
  • the expression cassettes according to the invention and the vectors derived from them can also contain other functional elements in addition to the promoters mentioned above. Examples include, but are not limited to:
  • the expression cassette and vectors derived therefrom can be used for transformation of bacteria, cyanobacteria, yeasts, filamentous tosen fungi and algae and eukaryotic cells (such as insect cells) of homoaconitase be used with the objective of the recombinant production, wherein the production of a suitable expression cassette of the Organism in which the gene is to be expressed.
  • the present invention relates to the transgenic organisms produced by transformation with one of the above-described embodiments of an expression cassette or a vector, and the recombinant homoaconitase obtainable from the transgenic organism by expression.
  • microorganisms for recombinant expression are also eukaryotic cell lines.
  • bacteria of the genus Escherichia, Erwinia, Flavobacterium, Alcaligenes or Cyanobacteria, for example of the genus Synechocystis or Anabena are preferred.
  • Preferred yeasts are Candida, Saccharomyces, Hansenula or Pichia.
  • Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Fusarium, Beauveria, Mortierella, Saprolegnia, Pythium, or others in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995).
  • transgenic animals are also suitable as host organisms, for example C. elega s. "
  • yeast vectors for use in yeast are pYep-Secl (Baldari, et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 ( Schultz et al., (1987) Gene 54: 113-123), and pYES derivatives, pGAPZ derivatives, pPICZ derivatives and the vectors of the "Pichia Expression Kit” (Invitrogen Corporation, San Diego, CA).
  • insect cell expression vectors can also be used advantageously, e.g. for expression in Sf 9 cells. These are e.g. the vectors of the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39).
  • plant cells or algal cells can advantageously be used for gene expression.
  • plant expression vectors can be found in Becker, D., et al. (1992) "New plant binary vectors with selectable markers located proximal to the ' left border", Plant Mol. Biol. 20: 1195-1197 or in Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acid. Res. 12: 8711-8721.
  • nucleic acid sequences according to the invention can be expressed in mammalian cells.
  • Examples of corresponding expression vectors are pCDM8 and pMT2PC mentioned in: Seed, B. (1987) Nature 329: 840 or Kaufman et al. (1987) EMBO J. 6: 187-195).
  • Promoters of viral origin that are preferably to be used are e.g. Promoters of polyoma, adenovirus 2, cytomegalovirus or simian virus 40.
  • prokaryotic and eukaryotic expression systems are mentioned in chapters 16 and 17 in Sambrook et al. , Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor
  • Another object of the invention relates to methods for identifying compounds having a fungicidal activity which inhibit homoaconitase or its functional analogs.
  • the method is based comprehensively on the use of nucleic acid sequences
  • nucleic acid sequence with the nucleic acid sequence shown in SEQ ID N0: 1; or b) a nucleic acid sequence which can be derived from the amino acid sequence shown in SEQ ID NO: 2 on the basis of the degenerate genetic code by back-translation; or
  • homoaconitase of at least 61%, 62%, 63%, 64%, 65%, 66%, 67 %, 68%, 69% and 70% preferably at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% preferably at least 81%, 82%, 83 %, 84%, 85%, 86%, 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % on.
  • the nucleic acid sequences mentioned above are referred to below as the nucleic acid sequences according to the invention.
  • a polypeptide encoded by one of the nucleic acid sequences according to the invention is hereinafter referred to as homoaconitase or protein / polypeptide according to the invention.
  • the present invention relates to the use of the gene product of a nucleic acid sequence according to the invention, as defined above, as a target for the determination of fungicidally active substances.
  • the methods according to the invention for identifying compounds having a fungicidal action are characterized in that the transcription, expression, translation or the activity of the gene product of the nucleic acid sequence according to the invention is influenced and those compounds are selected which reduce the transcription, expression, translation or the activity of the gene product or block, the nucleic acid sequence according to the invention being selected from the group of the following sequences:
  • nucleic acid sequence which can be derived on the basis of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 2; or c) a nucleic acid sequence which, based on the degenerate genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 2 by back-translating a functional equivalent; or
  • SEQ ID NO: encode 2 amino acid sequence shown
  • the biological activity is reduced by at least 10%, advantageously at least 20%, preferably at least 30%, particularly preferably by at least 50% and more than the natural activity of the gene product especially preferred to understand at least 70%.
  • Blocking the activity of the gene product means 100% blocking of the activity or partial blocking of the activity, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95% blocking of the biological activity.
  • nucleic acid molecule i. Bringing a nucleic acid molecule according to the invention or a homoaconitase into contact with one or more test compounds under conditions which allow the binding of the test substance (s) to the nucleic acid molecule or to the homoaconitase which is encoded by the above-mentioned nucleic acid molecule;
  • the method according to the invention can be carried out in separate separate method approaches in vivo or in vitro and / or advantageously together or particularly advantageously in a high-throughput screening and can be used to identify compounds with a fungicidal action.
  • sample to be examined which contains a compound with a fungicidal activity identified by the method according to the invention, has been identified, then it is either possible to isolate this compound directly from the sample.
  • the sample can be divided into different groups, e.g. if it consists of a large number of different test compounds so as to reduce the number of different test compounds per sample and then to repeat the method according to the invention with such a "sub-sample".
  • the steps described above can be repeated several times, preferably until the sample examined according to the method according to the invention only comprises a small number of compounds or only one compound with a fungicidal action.
  • HTS enables a multitude of different connections to be tested in parallel.
  • the use of carriers which contain one or more of the nucleic acid molecules according to the invention, one or more vectors containing the nucleic acid sequence according to the invention, one or more transgenic organisms which contain at least one of the nucleic acid sequences according to the invention or one or more May contain (poly) peptides encoded via the nucleic acid sequences according to the invention.
  • the carrier used can be solid or liquid, is preferably solid, particularly preferably a microtiter plate.
  • the above-mentioned carriers are also the subject of the present invention.
  • microtiter plates are used, which as a rule can comprise volumes of 50 to 500 ⁇ l, preferably 200 ⁇ l.
  • the other components of a HTS system are commercially available to match the respective microtiter plates, such as many instruments, materials, automatic pipetting devices, robots, automated plate readers and plate washers.
  • a preferred embodiment of the in vitro method comprises the following steps, wherein
  • said polypeptide is either expressed in an enzymatically active form in a transgenic organism according to the invention or an organism containing the protein according to the invention is cultivated;
  • step b) the protein obtained in step a) is incubated with a test compound in the resting or growing organism directly, in the cell disruption of the transgenic organism, in partially purified form or in a form purified to homogeneity;
  • a test compound is selected by step b) which inhibits a polypeptide encoded by a nucleic acid sequence according to the invention.
  • homoaconitase is expressed in a transgenic organism or an organism which naturally contains homoaconitase encoded by a nucleic acid sequence according to the invention is cultivated;
  • step (c) compounds are selected in step (c) which result in a significant decrease in the enzymatic activity, a reduction of at least 10%, advantageously at least 20%, preferably at least 30%, particularly preferably around at least 50% and very particularly preferably by at least 70% or a 100% reduction (blocking) is achieved.
  • the compounds having a fungicidal action or active ingredients are identified by determining the enzymatic activity in the presence and absence of a compound to be investigated.
  • the homoaconitase required for the test can be isolated either by heterologous expression from a transgenic organism according to the invention or from an organism which contains homoaconitase, for example from a fungus, preferably from one of the pyrenophora or Fusarium species mentioned above, particularly preferably from P. teres or F. graminearum.
  • Examples of other organisms from which homoaconitase can preferably be isolated are Alternaria kikuchiana, Alternaria inali, Alternaria solani, Ashbya gossypii, otrytis cinerea, Cercospora beti- cola, Cercospora fuligena, Cercospora kaki, Cladosporum carpophilumumotumus, Cochlioboletumus, Cochlioboletus, Cochlioboletus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolususus, Cochliobolususus, Cochliobolususus, Cochliobolususus, Cochliobolususus, Cochliobolusus, Cochliobolusus, Cochliobolus colus, Cochliobolus
  • fungal strains are Aspergillus, Trichoderma, Neurospora, Fusarium, Beauveria, Pyrenophora teres, Saccharomyces (e.g. Saccharomyces cerevisiae), Pichia (e.g. Pichia pastoris, Pichia methanolica), Magnaporthe, Pyrialeria or others Indian Chem Engr. Section B. Vol 37, No 1,2 (1995). Archaebacteria can also be used.
  • the solution containing the polypeptide according to the invention can consist of the lysate of the original organism or of the transgenic organism. If necessary, the polypeptide according to the invention can be partially or completely purified using standard methods. A general overview of common techniques for protein purification can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1994); ISBN -0-87969-309-6. In the case of recombinant representation, the protein fused to an affinity tag can be purified by affinity chromatography.
  • the enzymatic activity is determined by incubating the polypeptide according to the invention with a suitable substrate, the conversion of the substrate or the increase in the product formed being monitored.
  • suitable substrates are homoaconitate, homoisocitrate and derivatives of these compounds.
  • Preferred substrates are those whose increase or decrease can be monitored photometrically.
  • the conversion of the substrate is monitored photometrically, based on one of Strassman et al. described method (Strassman et al., J. Biol. Chem. 241 (1966) 5401-5407):
  • the reaction can be monitored photometrically via the decrease in absorption, that is to say decrease in homoaconitate, at 240 nm. The determination of the enzymatic activity takes place depending on the substrate decrease at the time. 2.
  • the reaction can increase the absorption at 240nm, ie. The increase in the homoaconitate formed can be monitored photometrically.
  • the determination of the enzymatic activity is carried out in a pH range from 7.0 to 9.0.
  • the homoaconitase is now incubated with a test compound to be investigated.
  • the enzymatic activity of the polypeptide according to the invention is determined by one of the methods mentioned above in comparison to the activity of the uninhibited homoaconitase.
  • the polypeptide according to the invention is inhibited, a significant decrease in the enzymatic activity in comparison to the enzymatic activity of the non-inhibited polypeptide according to the invention is observed.
  • the detection according to step ii of the above method can be carried out using techniques which show the interaction between protein and ligand.
  • Either the test compound or the enzyme may contain a detectable label, e.g. a fluorescent, radioisotope, chemiluminescent or enzymatic label.
  • enzymatic labels are Horseraddish peroxidase, alkaline phosphatase or lucifierase. The subsequent detection depends on the marking and is known to the person skilled in the art.
  • FCS Fluorescence correlation spectroscopy
  • the polypeptide according to the invention is now linked on a suitable carrier and incubated with the test compound to be examined. After one or more suitable washing steps, the molecules of the test compound additionally bound to the protein can be detected using the above-mentioned methodology and thus possible inhibitors can be selected.
  • the test compounds identified in this way, which bind to the polypeptide according to the invention, may be suitable as inhibitors.
  • Biacore is based on the change in the refractive index on a surface when a test compound is bound to a protein immobilized on said surface. Since the change in the refractive index for a defined change in the mass concentration at the surface is virtually identical for all proteins and polypeptides, this method can in principle be applied to any protein (Lindberg et al. Sensor Actuators 4 (1983) 299-304; Malmquist Nature 361 (1993) 186-187). The test compound is injected into a reaction cell with a volume of 2-5 ⁇ l, on the walls of which the protein has been immobilized.
  • the binding of the corresponding test compound to the protein and thus the identification of possible inhibitors can be carried out by recording the laser light reflected from the surface via surface plasmon response (SPR).
  • SPR surface plasmon response
  • the test compounds thus identified which bind to the polypeptide according to the invention may be suitable as inhibitors.
  • Fluorescence Resonance Energy Transfer is based on the radiation-free energy transfer between two spatially adjacent fluorescence molecules under suitable conditions. A prerequisite is the overlap of the emission spectrum of the donor molecule with the excitation spectrum of the acceptor molecule.
  • Test compounds can be measured using FRET (Cytometry 34, 1998, pp. 159-179).
  • FRET Fluorescence Resolved Fluorescence
  • a particularly suitable embodiment of the FRET technology is the "Homogeneous Time Resolved Fluorescence" (HTRF), as sold by Packard BioScience.
  • HTRF Homogeneous Time Resolved Fluorescence
  • the compounds identified in this way can be suitable as inhibitors.
  • the measurement of surface plasmon resonance is based on the change in the refractive index on a surface when a test compound is bound to a protein immobilized on said surface. Since the change in the refractive index for a defined change in the mass concentration at the surface is virtually identical for all proteins and polypeptides, this method can in principle be applied to any protein (Lindberg et al.
  • the measurement can be carried out, for example, with the aid of the automated analyzers based on surface plasmon resonance sold by Biacore (Freiburg) in a throughput of currently up to 384 samples per day.
  • a method according to the invention can be used directly to measure the binding of the test compound to the invented. - Build up protein.
  • the compounds identified in this way can be suitable as inhibitors.
  • the 5 methods mentioned above can be designed so that a correspondingly labeled chemical reference compound is replaced by further test compounds to be tested ("displacement assay").
  • transgenic organisms which, after transformation with a nucleic acid sequence according to the invention, are able to express @@@@ homoaconitase;
  • step b) applying a test compound to the organism from step a) and an analog, non-transformed organism;
  • test compounds which bring about a reduced growth rate, survivability and / or infectivity of the non-transgenic organism compared to the growth of the transgenic organism.
  • An analog, non-transformed organism is to be understood as the organism that was used as the starting organism in step a).
  • the transformation can be carried out with a expression cassette, a vector according to the invention or the nucleic acid according to the invention itself.
  • Suitable organisms which are transformed with the nucleic acid sequence or expression cassette or vector according to the invention are, preferably, fungi, particularly preferably the phytopathogenic fungi mentioned at the beginning, very particularly preferably the fungi of the Pyrenophora or Fusarium species mentioned above, particularly preferably from P. teres or F. graminearum., In which the sequence coding for a polypeptide according to the invention is incorporated via transformation.
  • All of the compounds with a fungicidal activity (also called active ingredients) identified by the abovementioned methods can then be checked for their fungicidal activity in an in vivo activity test.
  • the corresponding substance is incubated with a culture of a pathogenic fungus, preferably a culture of a phytopathogenic fungus, particularly preferably a culture of P. teres, the fungicidal activity e.g. about limited growth can be determined.
  • the active ingredients identified via the abovementioned methods can also be present in the form of their agriculturally useful salts.
  • Agriculturally useful salts include, in particular, the salts of those cations or the acid addition salts of those acids whose cations or anions do not adversely affect the fungicidal activity of the active compounds.
  • the cations include, in particular, the ions of the alkali metals, preferably sodium and potassium, the alkaline earth metals, preferably calcium, magnesium and barium, and the transition metals, preferably manganese, copper, zinc and iron, and also the ammonium ion, which, if desired, can carry one to four C 1 -C 4 -alkyl substituents and / or a phenyl or benzyl substituent, preferably diisopropylammonium, tetramethylammonium, tetrabutylammonium, trimethylbenzylammonium, and further phosphonium ions, Sulfonium ions,.
  • sulfonium and sulfoxonium ions preferably tri (C C-C 4 alkyl) sulfoxonium, into consideration.
  • Usable acid addition salts are primarily chloride, bromide, fluoride, hydrogen sulfate, sulfate, dihydrogen phosphate, hydrogen phosphate, phosphate, nitrate, hydrogen carbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate, and the anions of C 1 -C 4 formate alkanoic acids , Acetate, propionate and butyrate. They can be formed by reacting I with an acid of the corresponding anion, preferably hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid or nitric acid.
  • All of the active substances identified by means of the abovementioned processes are, if they contain asymmetrically substituted ⁇ -carbon atoms, either as racemates, mixtures of enantiomers or as pure enantiomers and, if they have chiral substituents, can also be present as mixtures of diastereomers. They are suitable for combating the phytopathogenic fungi mentioned at the beginning.
  • the invention therefore furthermore relates to processes for producing an agrochemical composition having a fungicidal action, characterized in that
  • an active ingredient is identified using one of the abovementioned methods according to the invention.
  • the active ingredient identified via (a) or an agriculturally useful salt of the active ingredient identified via (a) is formulated with appropriate auxiliaries.
  • compositions which have a fungicidal action and can be prepared by the abovementioned process are also an object of the present invention.
  • the active compounds from step a) can be formulated, for example, in the form of directly sprayable aqueous solutions, powders, suspensions, also high-strength aqueous, oily or other suspensions or suspoemulsions or dispersions, emulsions, oil dispersions, pastes, dusts, sprinkling agents or granules, and by spraying , Atomizing, dusting, scattering or pouring can be used.
  • the application forms are directed according to the uses and the nature of the active ingredient used; in any case, they should ensure the finest possible distribution of the active compounds according to the invention.
  • the so-called active ingredients as such or in an oil or solvent can be dissolved or dispersed, it being possible to add further formulation auxiliaries for homogenization.
  • liquid or solid concentrates which are suitable for dilution with water can also be prepared from active ingredient and, if appropriate, solvent or oil and optionally further auxiliaries.
  • Emulsion concentrates EC, EW
  • suspensions SC
  • soluble concentrates SL
  • pastes pastilles
  • wettable powders or granules are mentioned here, whereby the solid formulations can either be water-soluble (soluble) or dispersible (wettable) , Corresponding powder or granules or tablets can also be provided with a solid coating which prevents abrasion or premature release of the active ingredient ("coating").
  • auxiliary means the following substance classes: anti-foaming agents, thickeners, wetting agents, adhesives, dispersants or emulsifiers, bactericides and thixotropic agents.
  • anti-foaming agents thickeners, wetting agents, adhesives, dispersants or emulsifiers, bactericides and thixotropic agents.
  • the meaning of the above-mentioned agents is known to the person skilled in the art.
  • SLs, EWs and ECs can be produced by simply mixing the corresponding ingredients, powder by mixing or grinding in special mill types (e.g. hammer mills).
  • SCs and SEs are usually produced by wet milling, it being possible to produce an SE from a SC by adding an organic phase containing further auxiliaries or active ingredients.
  • the manufacture is known.
  • Granules for example coated granules, impregnated granules and homogeneous granules, can be prepared by binding the active ingredients to solid carriers.
  • Solid carriers are, for example, mineral soils such as silicas, silica gels, silicates, talc, kaolin, limestone, lime, chalk, bolus, loess, clay, dolomite, diatomaceous earth, calcium and magnesium sulfate, magnesium oxide, ground plastics, fertilizers such as ammonium sulfate, ammonium phosphate , Ammonium nitrate, ureas and vegetable products such as cereal flour, tree bark, wood and nutshell flour or cellulose powder. Details of the production are known to the person skilled in the art, and e.g. listed in the following documents: US 3,060,084, EP-A 707445 (for liquid concentrates), Browning, "Agglomeration", Chemical Engineering, Dec.
  • inert liquid and / or solid carriers suitable for the agrochemical compositions according to the invention are known to the person skilled in the art, such as, for example, liquid additives such as mineral oil fractions from medium to high boiling point such as kerosene or diesel oil, also coal tar oils as well as oils of vegetable or animal origin, aliphatic, cyclic and aromatic see hydrocarbons, e.g.
  • surfactants suitable for the formulations according to the invention are known to the person skilled in the art, such as, for example. Alkali, alkaline earth, ammonium salts of aromatic ' sulfonic acids, e.g.
  • Powders, materials for broadcasting and dusts can advantageously be produced as solid carriers by mixing or grinding the active ingredients together with a solid carrier.
  • the fungicidal compositions or the active compounds can be applied curatively, eradicatively or protectively.
  • the application rates of active ingredient are 0.001 to 3.0, preferably 0.01 to 1.0 kg / ha of active substance, depending on the control target, season, target plants and growth stage.
  • Another object of the present invention is a method for controlling harmful fungi, characterized in that the fungi or the materials, plants, soil or seeds to be protected against fungal attack are treated with an effective amount of an active ingredient or an agrochemical composition with a fungicidal action. Harmful fungi are to be understood as the phytopathogenic fungi mentioned at the beginning.
  • Another object of the invention relates to the production of a transgenic organism, the transgenic organism being characterized by an increased lysine production compared to a non-transgenic organism.
  • Archaebacteria and fungi are preferred as transgenic organisms.
  • the transgenic organism is a fungus, preferably the Pyrenophora or Fusarium species mentioned above, particularly preferably P. teres or F. graminearum.
  • further organisms are Alternaria kiku- chiana, Alternaria mali, Alternaria solani, Ashbya gossypii, otrytis cinerea, Cercospora beticola, Cercospora fuligena, Cercospora kaki, Cladosporum carpophilum, Cochliob ⁇ lus heterostrophus, Colletotethrumumortumariumumototrophum lorosolarium, Cototrichum lorotumaronostructus, Collototrichum lortariumumostarium, Collototrichum lorotumarostolarototrophum lorumumostarium, Colletotrichum lorotumaronostium, Collototrichum lorotumarost
  • fungal strains are Aspergillus, Trichoderma, Neurospora, Fusarium, Beauveria, Pyreno- phora teres, Saccharomyces (e.g. Saccharomyces cerevisiae), Pichia (e.g. Pichia pastoris, Pichia methanolica), Magnaporthe, Pyrialeria or others in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995). Arma bacteria can also be used.
  • Saccharomyces e.g. Saccharomyces cerevisiae
  • Pichia e.g. Pichia pastoris, Pichia methanolica
  • Magnaporthe Pyrialeria or others in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995). Arma bacteria can also be used.
  • An increase in lysine production compared to the starting organism means an increase in the lysine content by at least 10%, preferably by at least 20%, particularly preferably by at least 10 40%, very particularly preferably by at least 80%.
  • the transgenic fungus can be produced in the following ways:
  • the corresponding fungus is transformed with one of the above-described 15 embodiments of an expression cassette or vector according to the invention containing SEQ ID N0: 1 or a functional equivalent of said sequence, with here naturally the control sequences mentioned above for the construction of the expression cassette / vectors 20 according to the invention are used which enable the heterologous expression of the target sequence in a fungus.
  • the additional expression of a polypeptide according to the invention can take place either via targeted induction or continuously. This results in an increased production of the metabolic end product lysine compared to a non-transgenic fungus.
  • Cloning methods such as Restriction cleavage, DNA isolation, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, sequence analysis of recombinant DNA as well as Southern and Western blots were carried out as in Sambrook et al. , Cold Spring Harbor Laboratory Press (1989) and Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1994); ISBN 0-87969-309-6.
  • the bacterial strains used below (E. coli DH5 ⁇ , DHB10) were obtained from BRL Gibco, or Invitrogen ,. Carlsberg, CA related.
  • the vector pAN7-l (Punt et al., Gene 56 (1987) 117-124)
  • the vector pCR ® 2.1-T0P0-TA Invitrogen the vector pUC18 Pharmacia
  • the vector pGEM by the company were Promega used, used.
  • the isolation of the P. teres wild type strain 15A is described in J. Wiland et al. (Phytopathology 89 (1999), 176-181).
  • the DSM.-4527 can be used as F. Graminearum wild type strain 8/1.
  • the sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA, 74, 5463-5467 (1977)). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed.
  • the primers DEG Homacl and DEGHomacII were constructed for the detection of the homoaconitase in P. teres and F. graminearum, with conserved amino acid blocks from the protein sequences of the Homoacononces stored in the gene bank from Saoacaronces cerevisiae (Accession No. U46154) and Aspergillus nidulans (Accession No. X99624) were used for the construction:
  • a fragment of 1630 bases was amplified in the case of P. teres and a fragment of 1757 bp in the case of F. graminearum, cloned into the pCR 2.1-TOPO-TA vector using standard cloning techniques and then transformed into E. coli DH10B.
  • the sequencing of the construct produced showed that the fragment had a 65% identity with the homoaconitase from S. cerevisiae and a 70% identity with the DNA sequence of the homoaconitase from Aspergillus nidulans.
  • the sequencing of the construct produced showed that the fragment had a 61.73% identity with the homoaconitase from S. cerevisiae, a 68.73% identity with the DNA sequence of the homoaconitase from Aspergillus nidulans and a 67.46% identity with the DNA sequence of the homoaconitase from Aspergillus fumiga- tus.
  • the phage bank was equipped with the "Lambda FIX ® II Xh ⁇ l Partial Fill-In
  • the phages were transferred to Sambrook el al. (Molecular Cloning. 2nd edition, Cold Spring Harbor Laboratory Press) on Hybond N + nylon membrane from Amersham.
  • the DNA was fixed on the filter using UV radiation (1200 ⁇ J / cm 2 ).
  • the DIG system was used in accordance with the manufacturer's instructions (Röche company).
  • the standard hybridization buffer contained no formamide.
  • the probe was made from the following two primers labeled with digoxygenin in a PCR: HOM / Hyg forw. : 5 '-ctggccaaagctagggtcgta-3'
  • HOM / Hyg rev. 2 5 '-acagtcattccaacatgtacggtg-3'
  • the signals were visualized using an autoradiography film (Hyperfilm TM ECL TM).
  • DNA was isolated from the positive clone according to Lösch (dissertation (2015) Hamburg: 2000). A large lysate was produced for this. The DNA isolated from this was cut with various restriction enzymes and analyzed in a Southern blot. From the bands that showed a signal with the homoaconitase probe already used in phage screening, a DNA band of approximately 6 kb cut with Sall was selected and cloned into the Sall interface of the pUC18 vector. The subsequent sequencing showed that the entire gene sequence of the homoaconitase from P. teres is located on this fragment.
  • a 2314 bp fragment of the sequence SEQ ID N0: 1 comprising 2352 was amplified from the Lambda bank fragment (see example). This fragment was then cloned into the pGEM-T vector. The construct produced was given the name pGEM-T / HOM. A 1084 bp fragment of the homoaconitase gene, which also contains the putative active center, was cut out by a restriction enzyme digestion of the construct produced with the restriction enzymes BsrGI and Nhel. Im so mo therefore, the modified vector construct remains at the end 227 bp or 1003 bp of the homoaconitase gene.
  • a hygromycin cassette containing the restriction enzyme interfaces BsrGI and Nhel was then cloned into the position of the removed homoaconite fragment in the linearized vector.
  • the hygromycin cassette was made up of the glucoamyase promoter region (Gen Bank Accession No: Z 30918), the hygromycin gene (Gen Bank Accession NO: K 01193) and the trpC terminator sequence (Gen Bank Accession) No: E 05643) using common cloning techniques.
  • the resulting construct was also in the vector pGEM-T and was called pGEM-T / hph. This construct was then amplified with primers containing the attached restriction sites BsrGI and Nhel and those with BsrGI and Nhel cut
  • the KO cassette was then amplified by PCR with the Expand Polymerase® from Röche. In this way, 15 ⁇ g of the KO cassette were amplified and purified for the subsequent transformation via gel elution.
  • HOM start 5 ⁇ GGCGCCGCTACTGGTCAAACC 3 ⁇
  • HOM end 5 "GGCGCCTTGTTGACGGGGA 3 ⁇
  • mycelium was grown in liquid culture over 2 days at 28 ° C and 180rpm in CM ( according to Leach et al. (J. Gen. Microbiol. 128 ( 1982) 1719-1729.) Incubated, crushed and then incubated for a further day at 28 ° C., 180 rpm was then washed twice with distilled water. Ten grams of mycelium were mixed with 40 ml of 5% enzyme-osmotic solution (700 mM NaCl, -5% Driselase, sterile) and incubated for 3 hours at 28 ° C. and 10 ORp.
  • enzyme-osmotic solution 700 mM NaCl, -5% Driselase, sterile
  • the progressive protoplasting was followed microscopically via samples.
  • the protoplasts were separated from mycelium residues by filtration, pelleted (3000 rpm, 10 min, 4 ° C.), and after washing with 10 ml each of 700 mM NaCl and SORB-TC (1.2 M sorbitol, 50 mM CaCl 2 lOmM Tris / HCl, pH 7.0) in 1 ml SORB-TC.
  • the concentration of protoplasts was determined by counting under the microscope.
  • Protoplasts were immediately placed on ice, carefully mixed with 15 ⁇ g of the KO HOM cassette amplified by PCR from pHOM / hph and then incubated on ice for 10 min. After adding a volume of PEG-TC (60% (w / V) PEG4000, 50mM CaCl 2 , lOmM Tris / HCl pH 7.0) and subsequent incubation on ice for 15 minutes, 8 volumes - based on the original culture volume - SORB- TC medium added.
  • PEG-TC 50% (w / V) PEG4000, 50mM CaCl 2 , lOmM Tris / HCl pH 7.0
  • the KO plasmid pAN7-Hom-1 was isolated according to standard procedures, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in ' Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing A ⁇ oc. and Wiley-Interscience (1994), center linearized in 'connection with MamI (isoschizomer BsaBI) and adjusted to a concentration of 30g / 01.
  • the petri dishes were overlaid with water agar containing 10 ml of hygromycin (16 g / l agar, 300 mg / l hygromycin) and then incubated at 28 ° C. Mycelium colonies that grew through the selection agar were cut out and separated on CMHyg plates (CMkompl medium with 150 mg / 1 hygromycin).
  • DNA from the mycelium of these cultures was checked for vector integration using Southern ' blot.
  • genomic DNA was 3 5 ge ⁇ chnitten the P. teres transformants and the wild type with the enzyme BstXI and the gramninearum F. Tran ⁇ formanten with Nru I and fractionated in Agaro ⁇ egel. Homoaconitas gene-specific fragments of 2314 bp labeled with digoxygenin were used as the probe.
  • Czapek Medium is an amino acid deficient medium, ie. Transformants that do not grow on this medium are auxotrophic for at least one amino acid.
  • mycelium from the P. teres wild type strain 15A or F. graminearum wild type strain 8/1 was incubated in an analogous manner.
  • the P. teres knockout transformants grew in comparison to the. Wild type 15 A not on the Czapek medium.
  • the F. graminearum mutants grew with a 2 day delay compared to the wild type 8/1.
  • RNA isolation was grown for RNA isolation as for DNA isolation (see Example 1B). The medium was centrifuged off and the mycelium was washed twice with ice-cold water. The RNA isolation was carried out with the peqGOLD RNAPure TM from Promega according to the manufacturer's instructions. The amount was quantified photometrically and the quality of the RNA was checked by gel electrophoresis.
  • HOM start TCAATGAGACGCCCAAAGTACC
  • HOM end ACGATGGAGGACTGCCAATCT
  • the PCR was carried out with 1 / 20th of the cDNA approach according to the manufacturer's instructions from Gibco for the single strand synthesis with SUPERSCRIPT TM II. Only the wild type P. teres 15A cDNA gave a product of the expected size. The five lysine axotrophic transformants no longer produce mRNA for homoaconitase synthesis.
  • the control PCR with the microliter, which was removed before the Superscript addition yielded no product, which shows that the RNA was free of DNA a product which, compared to that from genomic DNA, is smaller by the spliced intron. This also confirms that the RNA was free of DNA and also intact.
  • the virulence of the transformants vis-à-vis the host is determined via visual assessment.
  • the test can be carried out both on the whole plant and with cut leaf segments (Detached Leaf).
  • the filter paper with the leaf segments is placed in a petri dish filled with 10 ml sterile tap water. Each leaf section is inoculated drop-wise with a set conidia suspension (50 conidia / 20 ⁇ l) with 0.01% Tween20 and then cultured in a phyto chamber for up to 7 days. The intensity and size of the necrosis is compared to the wild-type infection.
  • Mycelium was freshly grown in CM medium (2 days incubation at 28 ° C and 180rpm), separated by centrifuging the medium, washed once with distilled water and carefully dried using filter paper.
  • the mycelium was then milled with liquid nitrogen and 100 mg mixed with 1000 ⁇ l of extraction buffer (40% glycerol, 2mM DTT, 1 tablet Complete ® Mini EDTA-free (Fa.Röche) to 10 ml, 200mM potassium phosphate pH 6.5). After an incubation of 5 min on ice and subsequent centrifugation (15300 rpm, 4 ° C., 30 min), the supernatant was transferred to a new reaction vessel and the protein content was determined using the Bio-Rad Protein Assay Dye Reagent Concentrate according to the manufacturer's instructions.
  • B) Activity test 50% glycerol, 2mM DTT, 1 tablet Complete ® Mini EDTA-free (Fa.Röche) to 10 ml, 200mM potassium phosphate pH 6.5. After an incubation of 5 min on ice and subsequent centrifugation (15300 rpm, 4 ° C., 30 min), the supernatant was transferred to a new reaction vessel and the protein content
  • the homoaconitase activity in the wild-type strain and in the lysine autotrophic transformants was determined. As can be seen from Figure 1, the homoaconitase activity of the lysine auxotrophic transformants is negligibly low.
  • SEQ ID 1 Nucleic acid sequence of the homoaconitase from P. teres
  • SEQ ID 2 amino acid sequence of the homoaconitase from P. teres
  • Figure 1 Measurement of homoaconitase activity in the wild-type strain and in two knockout mutants (labeled ⁇ lys4 P. eres in the figure)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne l'utilisation d'homoaconitase en tant que nouvelle cible pour des fongicides. La présente invention concerne également l'identification et l'isolement de la séquence d'acides nucléiques SEQ ID No: 1 codant la protéine homoaconitase et de ses équivalents fonctionnels, ainsi qu'un procédé pour identifier des composés à action fongicide sur la base des séquences d'acides nucléiques susmentionnées ou des protéines codées par ces séquences. En outre, cette invention concerne un organisme transgénique renfermant la SEQ ID No: 1 ou un équivalent fonctionnel de la SEQ ID No: 1, qui est caractérisé par une production plus élevée de lysine par comparaison avec un champignon non transgénique.
EP02743184A 2001-06-21 2002-06-13 Homoaconitase servant de cible a des fongicides Withdrawn EP1402013A2 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DE10129531 2001-06-21
DE10129531 2001-06-21
DE10146707 2001-09-21
DE10146707 2001-09-21
PCT/EP2002/006485 WO2003000880A2 (fr) 2001-06-21 2002-06-13 Homoaconitase servant de cible a des fongicides

Publications (1)

Publication Number Publication Date
EP1402013A2 true EP1402013A2 (fr) 2004-03-31

Family

ID=26009550

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02743184A Withdrawn EP1402013A2 (fr) 2001-06-21 2002-06-13 Homoaconitase servant de cible a des fongicides

Country Status (4)

Country Link
EP (1) EP1402013A2 (fr)
JP (1) JP2005503781A (fr)
CA (1) CA2450792A1 (fr)
WO (1) WO2003000880A2 (fr)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1235855A2 (fr) * 1999-03-22 2002-09-04 Novozymes Biotech, Inc. Methodes de surveillance de l'expression genique multiple
WO2002033118A2 (fr) * 2000-08-03 2002-04-25 The Texas A & M University System Enzyme isocitrate lyase provenant de mycobacterium tuberculosis et d'agents inhibiteurs pour combattre une infection persistante

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03000880A3 *

Also Published As

Publication number Publication date
CA2450792A1 (fr) 2003-01-03
WO2003000880A3 (fr) 2003-12-04
JP2005503781A (ja) 2005-02-10
WO2003000880A2 (fr) 2003-01-03

Similar Documents

Publication Publication Date Title
EP1525304A1 (fr) Cytochrome b5 reductase nadh-dependante utilisee comme cible pour herbicides
WO2003000880A2 (fr) Homoaconitase servant de cible a des fongicides
WO2005042734A1 (fr) Ser/thr kinase participant à l'autophagocytose en tant que cible pour des fongicides
WO2004070038A1 (fr) Mevalonate-kinase utilisee comme cible pour des fongicides
EP1293562B1 (fr) Glyoxal oxydases fongiques
DE60314258T2 (de) Gtp cyclohydrolase ii als ziel für fungizide
EP1612276A1 (fr) Procédé pour identifier des fungicides basé sur la thymidylate kinase
DE10150677A1 (de) Neue Targets für Fungizide
US20050089854A1 (en) Homoaconitase as a target for fungicides
EP1398633A2 (fr) Procédé pour l'identification de fungicides
EP1319715B1 (fr) IMP déshydrogénase et son utilisation pour l'identification de substances fongicides
DE10221725A1 (de) Glyoxaloxidasen aus Pilzen
EP1288307A1 (fr) Utilisation de la fructose-1,6 diphosphate aldolase pour l'identification de nouvelles substances fongicides
DE10232773A1 (de) Proteine des Ubiquitin Proteasom Stoffwechsels als Targets für Fungizide
DE10356218A1 (de) Verfahren zum Identifizieren von fungizid wirksamen Verbindungen basierend auf Pyruvatkinasen aus Pilzen
WO2003048349A2 (fr) Utilisation d'acetoacetyl-coa thiolase pour l'identification de nouvelles substances presentant une activite fongicide
DE10330234A1 (de) Verfahren zum Identifizieren von fungizid wirksamen Verbindungen basierend auf Mevalonat Kinasen aus Pilzen
WO2003105591A1 (fr) Procede d'identification de composes a action fongicide
EP1394265A2 (fr) Méthode pour l'identification des fongicides en utilisant une ribose-5-phosphate isomerase
EP1493821A1 (fr) Procédé pour l'identification de fungicides en employant la guanylate kinase
WO2005098030A2 (fr) Procede pour identifier des composes a action fongicide sur la base de thioredoxine reductases
DE10356433A1 (de) Verfahren zum Identifizieren von fungizid wirksamen Verbindungen basierend auf UMP/CMP-Kinasen aus Pilzen
DE102005025191A1 (de) Verfahren zum Identifizieren von fungizid wirksamen Verbindungen basierend auf Isopentenylpyrophosphat-Isomerasen
KR20050102977A (ko) 캔디다 알비칸스의 이형전환과 병원성에 관련된 신규의유전자 ＣａＭＯＢ２

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17P Request for examination filed

Effective date: 20040604

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20050919