EP1402013A2

EP1402013A2 - Homoaconitase as a target for fungicides

Info

Publication number: EP1402013A2
Application number: EP02743184A
Authority: EP
Inventors: Annette Freund; Wilhelm Schäfer; Karen Sonnenberger
Original assignee: BASF SE
Current assignee: BASF SE
Priority date: 2001-06-21
Filing date: 2002-06-13
Publication date: 2004-03-31
Also published as: JP2005503781A; WO2003000880A3; WO2003000880A2; CA2450792A1

Abstract

The invention relates to the use of homoaconitase as a novel target for fungicides. The invention also relates to the identification and isolation of the nucleic acid sequence SEQ ID No: 1 coding for the protein homoaconitase and the functional equivalents thereof, and to a method for identifying compounds having fungicidal action based on the above-mentioned nucleic acid sequences or the proteins coded by said sequences. The invention further relates to a transgenic organism containing the SEQ ID NO: 1 or a functional equivalent of the SEQ ID NO:l, which is characterised by increased lysine production compared to a non-transgenic fungus.

Description

Homoaconitase as a target for fungicides

description

The present invention relates to the use of homoaconitase as a new target for fungicides. The present invention further relates to the identification and isolation of the nucleic acid sequence SEQ ID No: 1 coding for the protein homoaconitase and its functional equivalents, and to a method for

Identification of compounds with a fungicidal action based on the nucleic acid sequence mentioned above or the proteins encoded by these sequences. The present invention further relates to a transgenic organism containing SEQ ID NO: 1 or a functional equivalent of SEQ ID N0: 1, which is characterized by increased lysine production compared to a non-transgenic fungus.

The basic principle of identifying fungicides by inhibiting a defined enzyme (target) is known

(WO 00/3657). In the course of increasing resistance problems with fungicides, however, there is a great need to detect enzymes which could represent new targets for fungicides.

The object of the present invention was therefore to identify a new fungicidal target.

The detection of new targets is associated with great difficulties in practice because the inhibition of an enzyme which is part of a metabolic pathway often does not further influence the growth or infectivity of the pathogenic fungus. This may be because the pathogenic fungus switches to alternative metabolic pathways whose existence is not known or not that the inhibited enzyme limiting for the metabolic _we g. The target suitability of a gene product can therefore not be predicted even with knowledge of the gene function.

The object of the present invention is therefore to identify new targets for fungicides and to provide methods which are suitable for identifying fungicidal active ingredients.

Surprisingly, it was found that the homoaconitase encoded by the sequence SEQ ID N0: 1 or a functional equivalent of SEQ ID N0: 1 is suitable as a fungicide of the target. Furthermore, it was found that an increase in lysine biosynthesis was achieved in a transgenic fungus which contains SEQ ID NO: 1 by increased expression of homoaconitase.

The object of the invention was thus achieved by

1) the isolation of the nucleic acid sequence SEQ ID NO: 1 coding for the homoaconitase, in particular the homoaconitase originating from the phytopathogenic fungus Pyrenophora (P.) Teres;

2) the validation of homoaconitase as a fungicide target using molecular biological methods in Pyrenophora teres and Fusarium graminearum;

3) the provision of an activity test to identify inhibitors of homoaconitase; such as

4) the use of the inhibitors identified via the activity test as fungicides.

Furthermore, it was surprisingly found that transgenic fungi containing the nucleic acid sequences according to the invention are characterized by an increased lysine content compared to a non-transgenic fungus.

At this point, some of the terms used in the description are now defined.

"Affinity tag": denotes a peptide or polypeptide whose coding nucleic acid sequence can be fused with the sequence coding for the target protein directly or by means of a linker using common cloning techniques. The affinity tag is used to isolate the recombinant target protein using affinity chromatography. The above-mentioned linker can optionally contain a protease cut part (e.g. for thrombin or factor Xa), whereby the affinity tag can be cleaved from the target protein if necessary. Examples of common affinity tags are the "His tag" e.g. by Quiagen, Hilden, "Strep-Tag", the Myc-Tag "(Invitrogen, Carlsberg), the chitin-binding domain and an intein from New England Biolab and the so-called CBD-Tag from Novagen.

"Enzymatic activity / activity test": The term enzymatic activity describes the ability of an enzyme to convert a substrate into a product. Both the natural substrate of the enzyme and a synthetic modified ana- logon of the natural substrate can be used. The enzymatic activity can be carried out in a so-called activity test

1) the increase in the product; or

2) the removal of the starting material; or

3) acceptance of a specific cofactor; or

4) a combination of at least two of the parameters mentioned under 1) to 3)

can be determined depending on a defined period of time. If the enzyme catalyzes a reversible reaction, both the starting material and the product can be used as a substrate in the corresponding activity test.

"Expression" describes transcription and subsequent translation of a gene in a cell containing the desired nucleic acid sequence.

"Expression cassette or nucleic acid sequence": An expression cassette containing a nucleic acid sequence according to the invention means, for example, a genomic or a complementary DNA sequence or an RNA sequence and semisynthetic or fully synthetic analogues thereof. These sequences can be in linear or circular form, extra-chromoso al or integrated into the genome. The nucleic acid sequences according to the invention can be produced synthetically or can be obtained naturally or contain a mixture of synthetic and natural DNA components, and can consist of different heterologous gene segments from different organisms.

Artificial nucleic acid sequences are also suitable here as long as they enable expression of the target protein in a cell or an organism. For example, synthetic nucleotide sequences can be generated with respect to the codon-usage-of optimized from the organisms to be transformed wur- ^'the.

All of the nucleotide sequences mentioned above can be produced in a manner known per se by synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleotide building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). When preparing an expression cassette, various DNA fragments can be manipulated in such a way that a nucleotide sequence with the correct reading direction and correct reading frame is obtained. The nucleic acid fragments are connected to one another using general cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Inquiry, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al. , Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1994).

“Gene” describes a nucleic acid sequence coding for a protein, which can be transcribed into RNA (mRNA, rRNA, tRNA, snRNA, senseRNA or anti-senseRNA) and can optionally be associated with regulatory sequences. Examples of regulatory sequences are promoter sequences. Other optional elements are, for example, introns.

“Genetic control sequence”: The term “genetic control sequences” (to be seen equivalent to the term “regulatory sequence”) describes the sequences which have an influence on the formation or the function of the expression cassette according to the invention and, for example, the transcription and possibly translation in ensure prokaryotic or eukaryotic organisms. Examples are promoters or so-called "enhancer" sequences. In addition to these control sequences or instead of these sequences, the natural regulation of these sequences may still be present before the actual structural genes and may have been genetically modified in such a way that the natural regulation was switched off and the expression of the target gene was increased. The control sequence is selected depending on the host organism or parent organism. Genetic control sequences also include the 5 'untranslated region, introns or the non-coding 3' region of genes. Control sequences are further to be understood as those which enable homologous recombination or insertion into the genome of a host organism or which allow removal from the genome.

"Functional equivalents" here describe nucleic acid sequences that ^• 1) hybridize under standard conditions with the nucleic acid sequence coding for the target protein (according to the present invention with SEQ ID NO: 1) or parts of the nucleic acid sequence coding for the target protein and

5

2) are capable of causing the expression of an enzymatically active target protein (in the case of the present invention, homoaconitase) in a cell or an organism.

10 For hybridization, short oligonucleotides with a length of about 10-50 bp; preferably 15-40 bp, for example of the conserved or other regions which can be determined by comparison with other related genes in a manner known to the person skilled in the art. But it can also be longer

15 fragments of the nucleic acids according to the invention or the complete sequences can be used for the hybridization. Varies depending on the nucleic acid used: oligonucleotide, longer fragment or complete sequence or depending on the type of nucleic acid DNA or RNA used for the hybridization

20 these standard conditions. For example, the melting temperatures for DNA: DNA hybrids are approx. 10 ° C lower than those of ^■ DNA: RNA hybrids of the same length.

Under standard conditions, for example, depending on the nucleus

25 acid temperatures between 42 and 58 ° C in an aqueous buffer solution with a concentration between 0.1 to 5 x SSC (1 X SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or additionally in the presence of 50 % Formamide such as 42 ° C in 5 x SSC, 50% formamide to understand. The are advantageously

30 hybridization conditions for DNA: DNA hybrids at 0.1 x SSC and temperatures between about 20 ° C to 45 ° C, preferably between about 30 ° C to 45 ° C. For DNA: RNA hybrids the hybridization conditions are advantageously 0.1 ^■ x SSC and temperatures between about 30 ° C to 55 ° C, preferably between about 45 ° C to 55 ° C. This

The temperatures indicated for the hybridization are, for example, calculated melting temperature values for a nucleic acid with a length of approx. 100 nucleotides and a G + C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are in relevant textbooks

• _Q genetics such as Sambrook et al. , "Molecular Clbning",

Cold Spring Harbor Laboratory, 1989, and can be described according to formulas known to the person skilled in the art, for example depending on the length of the nucleic acids, the type of hybrid or the G + C

Calculate salary. Further information on hybridization can be found on _m 5 _r . the following textbooks can be found in the specialist: Ausubel et al.

(eds), 1985, Current Protocols m Molecular Biology, John Wiley &

Sons, New York; Harnes and Higgins (eds), 1985, Nucleic Acids

Hybridization: A Practical Approach, IRL Press at Oxford University versity press, oxford; Brown (ed), 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.

By a "functional equivalent" is meant further particular also contain natural or artificial mutations of the relevant nucleic acid sequences of the target protein and their homologs from other organisms which make possible the expression of the enzymatically active target protein in a ^'cell or organism.

Thus, for example, the present invention also includes those nucleotide sequences which are obtained by modifying the nucleic acid sequence of the target protein described by SEQ ID NO 1. The aim of such a modification can e.g. the insertion of further restriction enzyme interfaces, the removal of superfluous DNA or the addition of further sequences. Proteins which are encoded via said nucleic acid sequences should, however, still have the desired functions despite a different nucleic acid sequence.

The term functional equivalent can also refer to the protein encoded by the corresponding nucleic acid sequence. In this case, the term functional equivalent describes a protein whose amino acid sequence is identical to SEQ ID NO: 2 to a certain percentage.

Functional equivalents thus include naturally occurring variants of the sequences described herein as well as artificial, e.g. nucleic acid sequences obtained by chemical synthesis and adapted to codon use or the amino acid sequences derived therefrom.

In general, regardless of the amino acid sequence (encoded by a corresponding nucleic acid sequence), functional equivalents each have the same enzymatic activity as the protein that is encoded by the nucleic acid sequence SEQ ID NO: 1. The "functional equivalents" thus have the biological activity of a homoaconitase.

"Appropriate response time" means the time it takes to perform an activity test and depends not only on the method used, but also on the sensitivity of the equipment used. The determination of the reaction times is known to the person skilled in the art. When using photometric methods test systems, the reaction times are generally between> 0 to 40 minutes.

"Homoaconitase" is defined here as an enzyme that reverses. sibel is able to catalyze the conversion of homoaconitate to homoisocitrate.

"Homoaconitase activity" refers to the ability of an enzyme to catalyze the conversion of homoaconitate to homoisocitrate. This term is equivalent to the term "biological activity of a homoaconitase".

"Identity" or "homology" between two nucleic acid sequences or polypeptide sequences is defined by the identity of the nucleic acid sequence / polypeptide sequence over the respective total sequence length, which is determined by comparison with the aid of the GAP program algorithm. (Wisconsin, - Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA) is calculated using the following parameters:

Gap Weight: 50 Length Weight: 3

Average Match: 10 Average Mismatch: -9

“Mutations” include substitutions (= replacements), additions (additions), deletions (deletions), inversions (changes) or insertions (insertions) of one or more nucleotide residues, whereby the corresponding amino acid sequence of the target protein is also replaced by substitution, insertion or deletion can change one or more amino acids.

"Knock-out transformants" denotes individual cultures of a transgenic organism, in the case of P. teres homokaryotic individual cultures, in which a specific gene was specifically inactivated via transformation.

"Natural genetic environment" means the natural chromosal locus in the organism of origin or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably at least partially preserved. The surrounding area flanks the nucleic acid sequence at least on the 5 'or 3' side and has a sequence length of at least 50 bp, preferably at least 100 bp, particularly preferably at least 500 bp, very particularly preferably at least 1000 bp, most preferably at least 5000 bp. "Operative linkage": Operative or functional linkage is understood to mean the sequential arrangement of promoter, coding sequence, terminator and possibly other regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended when expressing the coding sequence.

"Recombinant DNA" describes a combination of DNA sequences in a non-natural arrangement that can be produced by recombinant DNA technology, but also DNA containing cell-own and foreign or synthetic DNA, also homologous and heterologous DNA based on the relatives of the organisms

"Recombinant DNA technology": generally known techniques for fusing DNA sequences (e.g., described in Sambrook et al., 1989, Cold Spring Habour, NY, Cold Spring Habour Laboratory Press).

"Replication origins" ensure the multiplication of the expression cassettes or vectors according to the invention in microorganisms, e.g. pBR322 ori or P15A ori in E. coli (Sambrook et al.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

25 "reporter genes" code for easily quantifiable proteins.

A growth, fluorescence, chemo-, bioluminescence or resistance assay or a photometric measurement (intrinsic color) or enzyme activity can be used to evaluate the transformation efficiency or the expression location or time using these genes.

30 points can be made. Reporter proteins (Schenborn E, Groskreutz D. Mol Biotechnol. 1999; 13 (l): 29-44) such as "green fluorescence protein" (GFP) (Gerdes HH and Kaether C, FEBS Lett. 1996) are very particularly preferred ; 389 (1): 44-47; Chui WL et al., Curr Biol 1996, 6: 325-330; Leffel SM et al., Biotechni-

35 ques. 23 (5): 912-8, 1997), chloramphenicol acetyl transferase, a luciferase (Giacomin, Plant Sei 1996, 116: 59-72; Scikantha ^' , J Bact 1996, 178: 121; Millar et al., Plant Mol Biol Rep 1992 10: 324-414), and luciferase genes in general ß-galactosidase, or ß-glucuronidase (Jefferson et al., EMBO J. 1987, 6,

40 3901-3907), the Ura3 gene, the Ilv2 gene, the 2-deoxyglucose-6-phosphate-phosphatase gene, β-lactamase gene, the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene or the BASTA (= gluphosinate resistance) - Gene.

45 "selection markers" confer resistance to antibiotics. Examples include the npt gene, which is resistant to the aminoglyciside antibiotics neomycin (G 418), kanamycin, and paromycin (Deshayes A et al., EMBO J. 4 (1985) 2731-2737) conferred the hygro gene (Marsh JL et al., Gene. 1984; 32 (3): 481-485), the sul gene ( Guerineau F et al., Plant Mol Biol. 1990; 15 (1): 127-136), the hygromycin gene (Gen Bank Accession NO: K 01193) and the she-ble gene, which is resistant to bleomycin Gives antibiotic Zeocin. Further examples of selection ark genes are genes which confer resistance to 2-deoxyglucose-6-phosphate (WO 98/45456) or phosphinotricin etc. or those which confer antimetabolite resistance, for example the dhfr -Gen (Reiss, Plant Physiol. (Life Sei. Adv.) 13 (1994) 142-149). Also suitable are genes such as trpB or hisD (Hartman SC and Mulligan RC, Proc Natl Acad Sei US A. 85 (1988) 8047-8051). The gene of mannose-phosphate isomerase (WO 94/20627), the ODC (ornithine decarboxylase) gene (McConlogue, 1987 in: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, ed.) Or the deaminase from Aspergillus terreus (Tamura K et al., Biosci Biotechnol Biochem. 59 (1995) 2336-2338).

"Significant decrease": based on the enzymatic activity, a decrease in the enzymatic activity of the enzyme incubated with a test compound in comparison to the activity of the Ξnyzms not incubated with the test compound is meant, which lies outside of a measurement error.

"Substrate": substrate is the compound which is recognized by the enzyme in its original function and which is converted into a product by means of a reaction catalyzed by the enzyme.

“Test compound” denotes the substances that were tested and identified in accordance with the method according to the invention. These substances can e.g. B. from expression libraries, for example cDNA expression libraries or peptides, proteins, nucleic acids, antibodies, small organic substances, hormones, ^• PNAs or the like (Milner, Nature Medicin 1 (1995), 879-880; Hupp, Cell. 83 (1995), 237-245; Gibbs, Cell. 79 (1994), 193-198 and references cited therein). The substances can be chemically synthesized or microbiologically produced substances and can occur, for example, in cell extracts from, for example, plants, animals or microorganisms.

"Transformation" describes a process for the introduction of heterologous DNA into a pro- or eukaryotic cell. A transformed cell describes not only the product of the transformation process itself, but also all transgenic ones Descendants of the transgenic organism produced by the transformation.

"Transgene": Relating to a nucleic acid sequence, an expression cassette or a ^' vector containing said nucleic acid sequence or an organism transformed with said nucleic acid sequence, expression cassette or vector, transger describes all such constructions produced by genetic engineering methods, in which either

1) the nucleic acid sequence of the target protein; or

2) one functional with the nucleic acid sequence of the target protein. linked genetic control sequence; or

3) a combination of (1) and (2)

are not in their natural genetic environment or have been modified by genetic engineering methods. The modification can be achieved here, for example, by mutating one or more nucleotide residues of the corresponding nucleic acid sequence.

“Active ingredient” here is synonymous with the term “compound with a fungicidal action”.

Homoaconitase reversibly catalyzes the conversion of in an α-aminoadipate pathway that is only found in archaebacteria and fungi for the synthesis of the amino acid lysine (Nishida, H. et al., Journal of Molecular Evolution 51 (2000) 299-302) Homoaconitate to homoisocitrate

Although, among other genes of the lysine biosynthetic pathway, homoaconitases from non-pathogenic fungi such as Aspergillus nidulans (Weidner et al., Molecular and General Genetics 255 (1997)

237-247, identity related the SEQ ID No: 1 = 70.0%, related of SEQ ID No: 2 = 63.2%), Saccharomyces cerevisiae (Gen bank Acc. No. X93502; identity related to SEQ ID No: 1 = 65%, related to SEQ ID No: 2 = 56.8% ) and Candida albicans (gene name lys4, Candida database: Contig 6-2495 (69967bp-72022bp); identity related to SEQ ID No: 2 = 56.7%) are known and their relevance for lysine metabolism has been characterized (Wang et al., Curr. Gen. 16 (1989) 7-12; Weidner et al., Mol. Gen. Gen. 255 (1997) 237-247), so far there has been no characterization of enzymes that are found in pathogenic or phytopathogenic fungi catalyze steps in this pathway as well as study serve to prove the relevance of homoaconitase for the growth of phytopathogenic fungi.

A gene sequence which presumably codes for a homoaconitase is also known from Schizosaccharomyces pombe (Gen bank Acc. No. CAB52279; identity related to SEQ ID No: 2 = 51.6%).

By producing knock-out transformants of the P. teres wild-type strain 15A with respect to the homoaconitase gene, it was surprisingly possible to show that homoaconitase is not only for lysine biosynthesis, but also for the growth and survival of the phytopathogenic fungus P. teres is essential. The knock-out transformants described above were neither able to grow on minimal medium, nor survive on barley despite the lysine present in barley.

These results were confirmed by another knock-out in a second phytopathogenic fungus, Fusarium (F.) graminearum. The F. graminearum knock-out transformants showed a delayed growth on minimal medium and were no longer able to attack wheat to the same extent as the wild type. Sequencing of the Fusarium-derived homoaconitase fragment (SEQ ID NO: 3) showed that the fragment had a 61.73% identity with the S. cerevisiae homoaconitase and a 68.73% identity with the Aspergillus homoaconitase DNA sequence nidulans had a 67.46% identity with the DNA sequence of the homoaconitase from Aspergillus fumigatus and a 68.25% identity with the DNA sequence of the homoaconitase from P. teres.

Based on the present invention, homoaconitase is a new target for fungicides for controlling pathogenic fungi, preferably phytopathogenic fungi.

For the first time, homoaconitase was clearly identified as a suitable target protein (target) for fungicidal active ingredients.

The present invention therefore relates to the use of the gene product of a nucleic acid sequence from a phytopathogenic fungus coding for a protein with the biological activity of a homoaconitase as a target for fungicides, the nucleic acid sequence

a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID N0.-1; or b) a nucleic acid sequence which can be derived from the amino acid sequence shown in SEQ ID NO: 2 on the basis of the degenerate genetic code by back-translation; or

c) functional equivalents of the nucleic acid sequences SEQ ID

NO: l with an identity of at least 61% to SEQ ID NO: 1.

The functional equivalents according to the invention of SEQ ID N0: 1 claimed here have an identity with SEQ ID No: 2 of P. teres homoaconitase of at least 61%, 62%, 63%, 64%, 65%, 66%, 67 %, 68%, 69% and 70% preferably at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% preferably at least 81%, 82%, 83 %, 84%, 85%, 86%, 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , 99% on. Said functional equivalents. are characterized by essentially the same functionality, i.e. they are still able to reversibly catalyze the conversion of homoaconitate to homoisocitrate.

Pathogenic fungi are to be understood as those fungi that colonize a host and thereby cause a disease of the host. Examples of fungi affecting plants, so-called phytopathogenic fungi, are, in addition to P. teres, which affects barley, the following species: Alternaria species, Podosphaera species, Sclerotinia species, Physalospora canker on vegetables and fruit, Botrytis cinerea (gray mold) Strawberries, vegetables, ornamental plants and vines, Corynespora melonis on cucumbers, strawberries; Colletotrichum species on cucumbers; Diplocarpon rosae on roses; Elsinoe fawcetti and Diaporthe citri on citrus fruits; Sphaerotheca species on cucumbers, squash, strawberries and roses; Cinula neccata on cucumbers, Cercospora species on peanuts, sugar beets, egg plants and date plums; Erysiphe cichoracearum and Sphaerotheca fuliginea on pumpkin plants, Leveillula taurica on allspice; Mycosphaerella species on apples and Japanese apricot; Phyllactinia kakicola, Gloesporium kaki, on Japanese apricot; Gymnosporangium yama- dae, Leptotthrydium pomi, Podosphaera leucotricha and Gloedes poigena on apples; Cladosporium carpophilum on pears and Japanese apricot; Phomopsis species on pears; Phytopora species on Citrus fruits, potatoes, onions; Phytophthora infestans on potatoes and tomatoes, Erysiphe graminis (powdery mildew) on cereals, Fusarium and Verticillium species on various plants, Glomerella cingulata on tea; Drechslera or Bipolaris species on cereals, Mycosphaerella species on bananas and peanuts, Plasmopara viticola on vines and grapefruits, Personospora species on onions, spinach and chrysanthemums; Phaeoisariopsis vitis and Spacelo a ampelina on grapefruits; Pseudocercosporella herpotrichoi- of wheat and barley, Pseudoperonospora species on hops and cucumbers, Puccinia species and Typhula species on cereals, Pyricularia oryzae on rice, Rhizoctonia species on cotton, rice and lawn, Stachosporium nodorum on wheat, Uncinula necator on vines, Usti - Lago species on cereals and sugar cane, Gaeumannomyces graminis on oats and beets, and Venturia species (scab) on apples and. Pears. Examples of human pathogenic fungi are species such as Candida albicans and Aspergillus fumigatus.

The term "Fusarium species" or Fusarium species should preferably be understood to mean the following species: F. graminearum, F. di erium, F. merismoides, F. lateritium, F. decem-cellulare, F. poae, F. tricinctum, F. sporotrichioides, F. chlamydosporum, F. rnoniliforme, F. proliferatum, F. anthophilum, F. subglutinans, F. nygamai, F. oxysporum, F. solani, F. culmorum, F. sambucinum, F. crookwellense, F. avenaceum ssp. avenaceum, F. avenaceum ssp. aywerte, F. avenaceum .ssp.- nurragi, F. hetrosporum, F. acuminatum ssp. acuminatum, F. acuminatum ssp. armenia-cum, F. longipes, F. compactum, F. equiseti, F. scripi, F. polyphialidicum, F. semitectum and F. beomiforme.

The term “Pyrenophora species” or “Pyrenophora species” should preferably be understood to mean the following species: P. graminea, P. hordei, P. japonica, P. teres, P. teres f. aculata, P. teres f. teres, P. tritici-repentis.

The present invention furthermore relates to the following nucleic acids:

a) a nucleic acid sequence with that in SEQ ID NO: 1; or

b) a nucleic acid sequence which, on the basis of the degenerate genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 2 by back-translation; or

c) a nucleic acid sequence which can be derived on the basis of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 2 by back-translating a functional equivalent; or

d) functional analogs of the nucleic acid sequence shown in SEQ ID NO: 1, which are suitable for a polypeptide with the in

SEQ ID NO: encode 2 amino acid sequence shown; or e) functional analogs of the nucleic acid sequence shown in SEQ ID NO: 1, which codes for functional analogs of the amino acid sequence shown in SEQ ID NO: 2; or

f) parts of the nucleic acid sequences a), b), c) or d).

The present invention further relates to nucleic acid sequences encoding a polypeptide with the biological activity of a homoaconitase, comprising

a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID NO: 1; or

b) a nucleic acid sequence which, owing to the degenerate genetic code, is converted back from the sequence shown in SEQ ID

NO: 2 deduced amino acid sequence shown; or

c) functional equivalents of the nucleic acid sequences SEQ ID NO: 1 with an identity of at least 71% to the SEQ ID NO: 1.

The nucleic acid sequences preferably originate from a phytopathogenic fungus. The term “phytopathogenic fungus” here means the species mentioned at the beginning. The nucleic acid sequence preferably originates from the Pyrenophora or Fusarium species mentioned at the outset, very particularly preferably P. teres and F. graminearum. The use of the gene product of one of the abovementioned nucleic acid sequences coding for a protein with the biological activity of a homoaconitase as a target for fungicides is also an object of the present invention.

The functional equivalents of SEQ ID NO: 2 according to the invention have an identity with SEQ ID No: 2 of P. teres homoaconitase of at least 64%, 65%, 66%, 67%, 68%, 69% and 70%. preferably at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% preferably at least 81%, 82%, 83%, 84%, 85%, 86% , 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%. Said functional equivalents are characterized by essentially the same functionality, i.e. they are still able to reversibly catalyze the conversion of homoaconitate to homoisocitrate.

The functional equivalents of SEQ ID NO: 2 according to the invention have an identity with SEQ ID No: 1 of homoaconitase from P. teres of at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78 %, 79%, 80% preferably at least 81%, 82%, 83%, 84%, 85%, 86%, 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, 99%. Said functional equivalents are characterized by essentially the same functionality, ie they are still able to reversibly catalyze the conversion from homoaconitate to homoisocitrate.

The invention further relates to sections of SEQ ID NO: 1 and functional equivalents of SEQ ID NO: 1, the range of the section extending from amino acid position 2 to 783. The range from the amino acid position 200 to 600 is preferred here. The range from the amino acid position 250 to 550 is particularly preferred, and very particularly preferably from amino acid position 300 to 500.

The above-mentioned nucleic acid sequences can be used for the production of hybridization probes, by means of which the corresponding full-length genes can be isolated. The manufacture of these probes and the conduct of the experiments are known. This can be done, for example, by the targeted production of radioactive or non-radioactive probes by means of PCR and the use of appropriately labeled oligonucleotides with subsequent hybridization experiments. The technologies required for this are described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989). The corresponding probes can also be modified using standard technologies (Lit. SDM or random mutagenesis) so that they can be used for other purposes, e.g. as a probe that hybridizes specifically to mRNA and the corresponding coding sequences for the purpose of analyzing the corresponding sequences in other organisms.

Furthermore, parts of the nucleic acids according to the invention can be used as probes for the detection and isolation of functional analogs of SEQ ID NO: 1 from other fungal species due to sequence identities. Part or all of the sequence of the corresponding SEQ ID NO: 1 is used here as a probe for screening in a genomic or cDNA bank of the corresponding fungus or in a computer search for analogous sequences in electronic databases.

Further applications of the probes described above are the analysis of possibly changed expression profiles of the nucleic acids according to the invention in various fungi, preferably from the Pyrenophora or Fusarium species mentioned at the beginning, particularly preferably P. teres or F. graminearum especially in connection with certain factors such as increased resistance to fungicides , the detec- tion of the fungus in plant material and detection of emerging resistance.

The increase in resistance to a fungicide targeting homoaconitase is often based on mutation, e.g. the exchange of amino acids caused by a mutation in the nucleic acid sequence, at locations essential for substrate specificity, e.g. in the area of the active center or at other points on the protein that affect the binding of the substrate. Due to the changes described above, the binding of the inhibitor acting as a fungicide to the Erf. - Protein are made more difficult or even prevented, so that a limited or no fungicidal action can be observed in the corresponding cultures.

Since di ^'s changes occurring here often include only a few base pairs, the probes described above may be used based on the above-defined nucleic acid sequences for the detection of mutant according Homoaconitasenukleinsäuresequenzen in completely or partially resistant phytopathogenic fungi.

After isolation of the corresponding homoaconitase gene or gene segment from the corresponding resistant fungus by means of the above-mentioned probes, followed by sequencing and comparison with the corresponding wild-type nucleic acid sequence, there are basically two methods available for the analysis:

1) Preparation of oligonucleotides based on one of the abovementioned nucleic acid sequences containing the

Mutation with subsequent PCR; or

2) Production of oligonucleotides based on one of the nucleic acid sequences mentioned above, the region flanking the mutation being amplified by means of PCR, followed by restriction digestion and / or sequencing.

The invention furthermore relates to expression cassettes comprising a nucleic acid sequence coding for homoaconitase

a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID N0: 1; or b) a nucleic acid sequence which can be derived from the amino acid sequence shown in SEQ ID NO: 2 on the basis of the degenerate genetic code by back-translation; or

c) functional equivalents of the nucleic acid sequences SEQ 'ID NO: 1 with an identity of at least 71% to the SEQ ID NO: 1.

Another object of the invention is the use of expression cassettes, the nucleic acid sequence of which codes for one of the above-mentioned nucleic acid sequences or for functional equivalents of the nucleic acid sequence SEQ ID NO: 1 with an identity of at least 71% to SEQ ID N0: 1 for the production recom - Binary homoaconitase for the test systems listed below e. The nucleic acid sequence can e.g. be a DNA or a cDNA sequence.

The expression cassettes advantageously also contain genetic control sequences which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette according to the invention comprises a promoter at the 5 'end of the coding sequence and a transcription termination signal at the 3' end and optionally further genetic control sequences which are operatively linked to the intermediate coding sequence for the homoaconitase gene.

Analogs of the expression cassettes described above are also according to the invention, which can come about, for example, through a combination of the individual nucleic acid sequences on one polynucleotide (multiple constructs), on several polynucleotides in one cell (co-transformation) or through sequential transformation.

Vectors according to the invention also contain at least one copy of the nucleic acid sequences used and / or of the nucleic acid construct according to the invention or the expression cassettes described above. These vectors contain nucleic acid sequences comprising:

a) a nucleic acid sequence with the nucleic acid sequence shown in SEQ ID N0: 1; or

NO: 2 deduced amino acid sequence shown; or c) functional equivalents of the nucleic acid sequences SEQ ID NO: 1 with an identity of at least 71% to SEQ ID N0: 1

According to the invention, the use of the aforementioned vectors or of vectors containing nucleic acid sequences comprising functional equivalents of the nucleic acid sequences SEQ ID N0: 1 with an identity of at least 65% to SEQ ID N0: 1 for the production of recombinant protein for the test systems is also possible.

In addition to plasmids, vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus, adenovirus, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chro osomally. Chromosomal replication is preferred.

In a further embodiment of the vector, the nucleic acid construct according to the invention can also advantageously be introduced into the organisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA can consist of a linearized plasmid or only of the nucleic acid construct as a vector or the nucleic acid sequences used.

In a further advantageous embodiment, the nucleic acid sequences used in the method according to the invention can also be introduced into an organism alone.

If, in addition to the nucleic acid sequences, further genes are to be introduced into the organism, they can all be introduced into the organism together in a single vector or each individual gene in a vector, the different vectors being able to be introduced simultaneously or successively.

Advantageous control sequences for the expression cassettes or vectors according to the invention are, for example, in promoters such as cos, tac, trp, tet, lpp, lac, laclq, T7, T5, T3, gal, trc, ara -, SP6, 1-PR or in the 1-PL promoter, which can be used for the expression of homoaconitase in gram-negative bacterial strains.

Further advantageous control sequences are, for example, in the amy and SP02 promoters, which can be used for the expression of homoaconitase in gram-positive bacterial strains, and in contain the yeast or fungal promoters ADC1, MFa, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, AOX1 and GAP, which can be used to express homoaconitase in yeast strains.

Examples of suitable control elements for expression in insect cells are the polyhedrin promoter and the p10 promoter (Luckow, V.A. and Summers, M.D. (1988) Bio / Techn. 6, 47-55).

In addition to polyadenylation sequences, advantageous control sequences for the expression of homoaconitase in cell culture are, for example, the following eukaryotic promoters of viral origin, e.g. Promoters of Polyoma, Adenovirus 2, Cytomegalovirus or Simian Virus 40 contain.

Further prokaryotic and eukaryotic expression systems are mentioned in chapters 16 and 17 in Sambrook et al. , Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Further advantageous vectors are described in Hellens et al. (Trends in plant science, 5, 2000).

The expression cassettes according to the invention and the vectors derived from them can also contain other functional elements in addition to the promoters mentioned above. Examples include, but are not limited to:

1) reporter genes;

2) origins of replication;

3) 'selection marker;

4) So-called affinity tags, fused with the homoaconitase directly or by means of a linker optionally containing one

Protease interface.

^'The expression cassette and vectors derived therefrom can be used for transformation of bacteria, cyanobacteria, yeasts, filamentous tosen fungi and algae and eukaryotic cells (such as insect cells) of homoaconitase be used with the objective of the recombinant production, wherein the production of a suitable expression cassette of the Organism in which the gene is to be expressed. The present invention relates to the transgenic organisms produced by transformation with one of the above-described embodiments of an expression cassette or a vector, and the recombinant homoaconitase obtainable from the transgenic organism by expression.

In addition to bacteria, yeasts, algae and fungi, preferred microorganisms for recombinant expression are also eukaryotic cell lines.

Within the bacteria, bacteria of the genus Escherichia, Erwinia, Flavobacterium, Alcaligenes or Cyanobacteria, for example of the genus Synechocystis or Anabena, are preferred.

Preferred yeasts are Candida, Saccharomyces, Hansenula or Pichia.

Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Fusarium, Beauveria, Mortierella, Saprolegnia, Pythium, or others in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995).

In principle, transgenic animals are also suitable as host organisms, for example C. elega s. ^"

It is also preferred to use expression systems and vectors that are publicly available or commercially available.

The typical advantageous, commercially available fusion and expression vectors pGEX [Pharmacia Biotech Ine; Smith, D.B. and Johnson, K.S. (1988) Gene 67: 31-40], pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which contains glutathione S-transferase (GST), maltose binding protein, or Protein A, which pTrc vectors (Amann et al., (1988) Gene 69: 301-315) the "pKK233-2" from CLONTECH, Palo Alto, CA and the "pET" and "pBAD" vector series from Strata - gene, La Jolla.

Further advantageous vectors for use in yeast are pYep-Secl (Baldari, et al., (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 ( Schultz et al., (1987) Gene 54: 113-123), and pYES derivatives, pGAPZ derivatives, pPICZ derivatives and the vectors of the "Pichia Expression Kit" (Invitrogen Corporation, San Diego, CA). Vectors for use in filamentous fungi are described in: van den Honel, CAMJJ & Punt, PJ (1991) "Gene transfer Systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, JF Peberdy, et al. , eds., p. 1-28, Cambridge University Press: Cambridge.

Alternatively, insect cell expression vectors can also be used advantageously, e.g. for expression in Sf 9 cells. These are e.g. the vectors of the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39). The "MaxBac 2.0 Kit" baculovirus expression systems from Invitrogen, Calsbald or the "BacPAK baculovirus expression system" from CLONTECH, Palo Alto, CA.

Furthermore, plant cells or algal cells can advantageously be used for gene expression. Examples of plant expression vectors can be found in Becker, D., et al. (1992) "New plant binary vectors with selectable markers located proximal to the ^' left border", Plant Mol. Biol. 20: 1195-1197 or in Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acid. Res. 12: 8711-8721.

Furthermore, the nucleic acid sequences according to the invention can be expressed in mammalian cells. Examples of corresponding expression vectors are pCDM8 and pMT2PC mentioned in: Seed, B. (1987) Nature 329: 840 or Kaufman et al. (1987) EMBO J. 6: 187-195). Promoters of viral origin that are preferably to be used are e.g. Promoters of polyoma, adenovirus 2, cytomegalovirus or simian virus 40. Further prokaryotic and eukaryotic expression systems are mentioned in chapters 16 and 17 in Sambrook et al. , Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, NY, 1989. Further advantageous vectors are described in Hellens et al. (Trends in plant science, 5, 2000).

Another object of the invention relates to methods for identifying compounds having a fungicidal activity which inhibit homoaconitase or its functional analogs.

The method is based comprehensively on the use of nucleic acid sequences

c) functional equivalents of the nucleic acid sequences SEQ ID N0: 1 with an identity of at least 61% to the SEQ ID NO: 1

or on the use of the amino acid sequences of homoaconitase from a phytopathogenic fungus encoded by the abovementioned nucleic acid sequences. The functional equivalents according to the invention of SEQ ID N0: 1 claimed here have an identity with SEQ ID No: 2 of P. teres homoaconitase of at least 61%, 62%, 63%, 64%, 65%, 66%, 67 %, 68%, 69% and 70% preferably at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% preferably at least 81%, 82%, 83 %, 84%, 85%, 86%, 88%, 88%, 89%, 90% particularly preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99 % on. The nucleic acid sequences mentioned above are referred to below as the nucleic acid sequences according to the invention. A polypeptide encoded by one of the nucleic acid sequences according to the invention is hereinafter referred to as homoaconitase or protein / polypeptide according to the invention.

The present invention relates to the use of the gene product of a nucleic acid sequence according to the invention, as defined above, as a target for the determination of fungicidally active substances.

The methods according to the invention for identifying compounds having a fungicidal action are characterized in that the transcription, expression, translation or the activity of the gene product of the nucleic acid sequence according to the invention is influenced and those compounds are selected which reduce the transcription, expression, translation or the activity of the gene product or block, the nucleic acid sequence according to the invention being selected from the group of the following sequences:

a) a nucleic acid sequence with that in SEQ ID NO: 1; or

b) a nucleic acid sequence which can be derived on the basis of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 2; or c) a nucleic acid sequence which, based on the degenerate genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 2 by back-translating a functional equivalent; or

SEQ ID NO: encode 2 amino acid sequence shown; or

e) functional analogs of the nucleic acid sequence shown in SEQ ID NO: 1, which codes for functional analogs of the amino acid sequence shown in SEQ ID NO: 2.

By reducing the transcription, expression, translation or the activity of the gene product, the biological activity is reduced by at least 10%, advantageously at least 20%, preferably at least 30%, particularly preferably by at least 50% and more than the natural activity of the gene product especially preferred to understand at least 70%. Blocking the activity of the gene product means 100% blocking of the activity or partial blocking of the activity, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95% blocking of the biological activity.

A further embodiment of the method according to the invention for identifying compounds with a fungicidal action comprises the following steps:

i. Bringing a nucleic acid molecule according to the invention or a homoaconitase into contact with one or more test compounds under conditions which allow the binding of the test substance (s) to the nucleic acid molecule or to the homoaconitase which is encoded by the above-mentioned nucleic acid molecule; and

i, whether the tverbindung ^Tes' binds) detecting the homoaconitase of i);

ii) evidence of whether the test compound reduces or blocks the activity of the homoaconitase from i); or

iii) Evidence as to whether the test compound reduces or blocks the transcription, translation or expression of the nucleic acid from i). All of the above-mentioned embodiments of the method according to the invention are referred to below as the method according to the invention.

The method according to the invention can be carried out in separate separate method approaches in vivo or in vitro and / or advantageously together or particularly advantageously in a high-throughput screening and can be used to identify compounds with a fungicidal action.

If a sample to be examined, which contains a compound with a fungicidal activity identified by the method according to the invention, has been identified, then it is either possible to isolate this compound directly from the sample. Alternatively, the sample can be divided into different groups, e.g. if it consists of a large number of different test compounds so as to reduce the number of different test compounds per sample and then to repeat the method according to the invention with such a "sub-sample". Depending on the complexity of the sample, the steps described above can be repeated several times, preferably until the sample examined according to the method according to the invention only comprises a small number of compounds or only one compound with a fungicidal action.

HTS enables a multitude of different connections to be tested in parallel. For the practical implementation in HTS, the use of carriers which contain one or more of the nucleic acid molecules according to the invention, one or more vectors containing the nucleic acid sequence according to the invention, one or more transgenic organisms which contain at least one of the nucleic acid sequences according to the invention or one or more May contain (poly) peptides encoded via the nucleic acid sequences according to the invention. The carrier used can be solid or liquid, is preferably solid, particularly preferably a microtiter plate. The above-mentioned carriers are also the subject of the present invention. According to the most widespread technique, 96-well, 384-well or 1536-well microtiter plates are used, which as a rule can comprise volumes of 50 to 500 μl, preferably 200 μl. In addition to the microtiter plates, the other components of a HTS system are commercially available to match the respective microtiter plates, such as many instruments, materials, automatic pipetting devices, robots, automated plate readers and plate washers.

In addition to the HTS methods based on microtiter plates, so-called "free format assays" or test systems which have no physical barriers between the samples can also be used are, for example, in Jayaickreme et al. , Proc. Natl. Acad. Be USA 19 (1994) 161418; Chelsky, "Strategies for Screening Cooperative Libaries, First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 710, 1995); Salmon et al., Molecular Diversity 2 (1996), 5763 and US 5,976,813.

The following preferred embodiments of the method according to the invention are based on steps i) and iii).

A preferred embodiment of the in vitro method comprises the following steps, wherein

a) said polypeptide is either expressed in an enzymatically active form in a transgenic organism according to the invention or an organism containing the protein according to the invention is cultivated;

b) the protein obtained in step a) is incubated with a test compound in the resting or growing organism directly, in the cell disruption of the transgenic organism, in partially purified form or in a form purified to homogeneity;

c) a test compound is selected by step b) which inhibits a polypeptide encoded by a nucleic acid sequence according to the invention.

The term “inhibited” is to be equated with the term “significant decrease in the enzymatic activity”, which is defined below.

An analogous form of the above method is characterized in that

a) either homoaconitase is expressed in a transgenic organism or an organism which naturally contains homoaconitase encoded by a nucleic acid sequence according to the invention is cultivated;

b) contacting homoaconitase from the organism from step a) in the cell disruption of the organism, in partially purified form or in a form purified to homogeneity, with a test compound; and c) a test compound is selected which reduces or blocks the activity of the homoaconitase, the activity of the homoaconitase incubated with the test compound being determined with the activity of a 'homoaconitase not incubated with a test compound.

In both of the above process variants, compounds are selected in step (c) which result in a significant decrease in the enzymatic activity, a reduction of at least 10%, advantageously at least 20%, preferably at least 30%, particularly preferably around at least 50% and very particularly preferably by at least 70% or a 100% reduction (blocking) is achieved.

In a preferred embodiment, the compounds having a fungicidal action or active ingredients are identified by determining the enzymatic activity in the presence and absence of a compound to be investigated.

The homoaconitase required for the test can be isolated either by heterologous expression from a transgenic organism according to the invention or from an organism which contains homoaconitase, for example from a fungus, preferably from one of the pyrenophora or Fusarium species mentioned above, particularly preferably from P. teres or F. graminearum. Examples of other organisms from which homoaconitase can preferably be isolated are Alternaria kikuchiana, Alternaria inali, Alternaria solani, Ashbya gossypii, otrytis cinerea, Cercospora beti- cola, Cercospora fuligena, Cercospora kaki, Cladosporum carpophilumumotumus, Cochlioboletumus, Cochlioboletus, Cochlioboletus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolusus, Cochliobolus colus, Cochliobolus colus , Colletotrichum heterostrophus, Colletotrichum lagenarium, Corynespora melonis, Diaporthe citri, Diplocarpon rosae, Elsinoe fawcetti, Erisyphe graminis, Leveillula taurica, Fusarium cul o- rum Fusarium nivale, Fusarium Glataesomamulumangulumangulamium, glaki pellata, gloamata gramearomium pelargonium gum, glucosomium gum pellet, pomegranate granules Leptothyrium pomi, Magnaporthe grise, Mycosphaerella pomi, My- cosphaerella nawae, Neurospora crassa, Peronospora destructor, Peronospora spinaciae, Phaeoisariopsis vitis, Phyllactinia kaki- cola, Physalospora canker, Phytophthoraophitophytora phytora investora pith haera leucotricha, Podosphaera tridactyla, Pomophis sp., pseudo cercorsporella herpotrichoides, Pseudoperonospora cubensis, Puccinia allii, Puccinia recondita, Puccinia horiana, Pyricularia oryzae, Uncinula necator, Sclerotinia cinerea, Sclerotinia mali, Sclerotinia sclerotiorum, Septoria tritici, Sphaerotheca fuligi- nea, Sphaerotheca humuli , Sphaerotheca pannosa, Spaceloma ampelina, Stagnospora nodorum, Typhula ishikariensis, Typhula in- carnata, Ustilago maydis, Venturia inaequalis, Venturia nashi-cola. Further preferred fungal strains are Aspergillus, Trichoderma, Neurospora, Fusarium, Beauveria, Pyrenophora teres, Saccharomyces (e.g. Saccharomyces cerevisiae), Pichia (e.g. Pichia pastoris, Pichia methanolica), Magnaporthe, Pyrialeria or others Indian Chem Engr. Section B. Vol 37, No 1,2 (1995). Archaebacteria can also be used.

The solution containing the polypeptide according to the invention can consist of the lysate of the original organism or of the transgenic organism. If necessary, the polypeptide according to the invention can be partially or completely purified using standard methods. A general overview of common techniques for protein purification can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1994); ISBN -0-87969-309-6. In the case of recombinant representation, the protein fused to an affinity tag can be purified by affinity chromatography.

The enzymatic activity is determined by incubating the polypeptide according to the invention with a suitable substrate, the conversion of the substrate or the increase in the product formed being monitored.

Examples of suitable substrates are homoaconitate, homoisocitrate and derivatives of these compounds.

Preferred substrates are those whose increase or decrease can be monitored photometrically.

In a particularly preferred embodiment, the conversion of the substrate is monitored photometrically, based on one of Strassman et al. described method (Strassman et al., J. Biol. Chem. 241 (1966) 5401-5407):

1. When using homoaconitate as a substrate, the reaction can be monitored photometrically via the decrease in absorption, that is to say decrease in homoaconitate, at 240 nm. The determination of the enzymatic activity takes place depending on the substrate decrease at the time. 2. When using homoisocitrate as the substrate, the reaction can increase the absorption at 240nm, ie. The increase in the homoaconitate formed can be monitored photometrically.

In a particularly preferred embodiment, the determination of the enzymatic activity is carried out in a pH range from 7.0 to 9.0.

To identify compounds with a fungicidal action, the homoaconitase is now incubated with a test compound to be investigated. After a suitable reaction time, the enzymatic activity of the polypeptide according to the invention is determined by one of the methods mentioned above in comparison to the activity of the uninhibited homoaconitase. When the polypeptide according to the invention is inhibited, a significant decrease in the enzymatic activity in comparison to the enzymatic activity of the non-inhibited polypeptide according to the invention is observed.

The detection according to step ii of the above method can be carried out using techniques which show the interaction between protein and ligand. Either the test compound or the enzyme may contain a detectable label, e.g. a fluorescent, radioisotope, chemiluminescent or enzymatic label. Examples of enzymatic labels are Horseraddish peroxidase, alkaline phosphatase or lucifierase. The subsequent detection depends on the marking and is known to the person skilled in the art.

In this context, five preferred embodiments are to be mentioned in particular, which are also suitable for high-throughput methods in connection with the present invention:

1) Fluorescence correlation spectroscopy (FCS) (Proc. Natl. Acad. Sei. USA (1994) 11753-11575) can be used to determine the average diffusion rate of a fluorescence molecule as a function of mass in a small sample volume. By measuring the change in mass or the resulting change in diffusion rate of a test compound when binding to the polypeptide according to the invention, FCS can be used to determine protein-ligand interactions. The test compounds identified in this way, which bind to the polypeptide according to the invention, may be suitable as inhibitors. 2) Surface Enhanced Laser Desorption / Ionization (SELDI) in combination with a Time of Flight Mass Spectrometer (MALDI-TOF) enables fast analysis of molecules on a carrier and can be used to analyze protein-ligand interactions (Worral et al., (1998) Anal. Biochem. 70: 750-756). In a preferred embodiment, the polypeptide according to the invention is now linked on a suitable carrier and incubated with the test compound to be examined. After one or more suitable washing steps, the molecules of the test compound additionally bound to the protein can be detected using the above-mentioned methodology and thus possible inhibitors can be selected. The test compounds identified in this way, which bind to the polypeptide according to the invention, may be suitable as inhibitors.

3) Biacore is based on the change in the refractive index on a surface when a test compound is bound to a protein immobilized on said surface. Since the change in the refractive index for a defined change in the mass concentration at the surface is virtually identical for all proteins and polypeptides, this method can in principle be applied to any protein (Lindberg et al. Sensor Actuators 4 (1983) 299-304; Malmquist Nature 361 (1993) 186-187). The test compound is injected into a reaction cell with a volume of 2-5μl, on the walls of which the protein has been immobilized. The binding of the corresponding test compound to the protein and thus the identification of possible inhibitors can be carried out by recording the laser light reflected from the surface via surface plasmon response (SPR). The test compounds thus identified which bind to the polypeptide according to the invention may be suitable as inhibitors.

4) Fluorescence Resonance Energy Transfer "(FRET) is based on the radiation-free energy transfer between two spatially adjacent fluorescence molecules under suitable conditions. A prerequisite is the overlap of the emission spectrum of the donor molecule with the excitation spectrum of the acceptor molecule. By fluorescent labeling of invented protein and the

Test compounds can be measured using FRET (Cytometry 34, 1998, pp. 159-179). A particularly suitable embodiment of the FRET technology is the "Homogeneous Time Resolved Fluorescence" (HTRF), as sold by Packard BioScience. The compounds identified in this way can be suitable as inhibitors. 5) The measurement of surface plasmon resonance is based on the change in the refractive index on a surface when a test compound is bound to a protein immobilized on said surface. Since the change in the refractive index for a defined change in the mass concentration at the surface is virtually identical for all proteins and polypeptides, this method can in principle be applied to any protein (Lindberg et al. Sensor Actuators 4 (1983) 299-304; Malmquist Nature 361 (1993) 186-187). The measurement can be carried out, for example, with the aid of the automated analyzers based on surface plasmon resonance sold by Biacore (Freiburg) in a throughput of currently up to 384 samples per day. A method according to the invention can be used directly to measure the binding of the test compound to the invented. - Build up protein. The compounds identified in this way can be suitable as inhibitors.

Alternatively, the 5 methods mentioned above can be designed so that a correspondingly labeled chemical reference compound is replaced by further test compounds to be tested ("displacement assay").

Another possibility for identifying inhibitors of the polypeptide according to the invention is in so-called in vivo methods, which are based on the following steps:

a) the production of transgenic organisms which, after transformation with a nucleic acid sequence according to the invention, are able to express @@@@ homoaconitase;

b) applying a test compound to the organism from step a) and an analog, non-transformed organism;

c) determining the growth or survivability of the transgenic and a non-transformed organism after the application of the test compound from step b); and

d) Selection of test compounds which bring about a reduced growth rate, survivability and / or infectivity of the non-transgenic organism compared to the growth of the transgenic organism.

An analog, non-transformed organism is to be understood as the organism that was used as the starting organism in step a). The transformation can be carried out with a expression cassette, a vector according to the invention or the nucleic acid according to the invention itself.

Suitable organisms which are transformed with the nucleic acid sequence or expression cassette or vector according to the invention are, preferably, fungi, particularly preferably the phytopathogenic fungi mentioned at the beginning, very particularly preferably the fungi of the Pyrenophora or Fusarium species mentioned above, particularly preferably from P. teres or F. graminearum., In which the sequence coding for a polypeptide according to the invention is incorporated via transformation.

There is also the possibility, by elucidating the three-dimensional structure of the polypeptide according to the invention by means of X-ray structural analysis, of detecting further potential fungicidal active substances by means of "molecular modeling". The production of protein crystals required for the X-ray structure analysis as well as the corresponding measurements and subsequent evaluations of said measurements as well as the methodology of "molecular modeling" are known to the person skilled in the art. In principle, "Molecular Modeling" can also be used to optimize the active substances identified using the abovementioned methods.

All of the compounds with a fungicidal activity (also called active ingredients) identified by the abovementioned methods can then be checked for their fungicidal activity in an in vivo activity test. Here, the corresponding substance is incubated with a culture of a pathogenic fungus, preferably a culture of a phytopathogenic fungus, particularly preferably a culture of P. teres, the fungicidal activity e.g. about limited growth can be determined.

All of the compounds with fungicidal activity (active ingredients) identified by the abovementioned methods are the subject of the present invention.

The active ingredients identified via the abovementioned methods can also be present in the form of their agriculturally useful salts.

Agriculturally useful salts include, in particular, the salts of those cations or the acid addition salts of those acids whose cations or anions do not adversely affect the fungicidal activity of the active compounds. The cations include, in particular, the ions of the alkali metals, preferably sodium and potassium, the alkaline earth metals, preferably calcium, magnesium and barium, and the transition metals, preferably manganese, copper, zinc and iron, and also the ammonium ion, which, if desired, can carry one to four C 1 -C ₄ -alkyl substituents and / or a phenyl or benzyl substituent, preferably diisopropylammonium, tetramethylammonium, tetrabutylammonium, trimethylbenzylammonium, and further phosphonium ions, Sulfonium ions,. preferably tri (Cχ-C ₄ alkyl) sulfonium and sulfoxonium ions, preferably tri (C C-C ₄ alkyl) sulfoxonium, into consideration. Anions. Usable acid addition salts are primarily chloride, bromide, fluoride, hydrogen sulfate, sulfate, dihydrogen phosphate, hydrogen phosphate, phosphate, nitrate, hydrogen carbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate, and the anions of C 1 -C ₄ formate alkanoic acids , Acetate, propionate and butyrate. They can be formed by reacting I with an acid of the corresponding anion, preferably hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid or nitric acid.

All of the active substances identified by means of the abovementioned processes are, if they contain asymmetrically substituted α-carbon atoms, either as racemates, mixtures of enantiomers or as pure enantiomers and, if they have chiral substituents, can also be present as mixtures of diastereomers. They are suitable for combating the phytopathogenic fungi mentioned at the beginning.

The invention therefore furthermore relates to processes for producing an agrochemical composition having a fungicidal action, characterized in that

a) an active ingredient is identified using one of the abovementioned methods according to the invention and

b) the active ingredient identified via (a) or an agriculturally useful salt of the active ingredient identified via (a) is formulated with appropriate auxiliaries.

The agrochemical compositions which have a fungicidal action and can be prepared by the abovementioned process are also an object of the present invention.

The active compounds from step a) can be formulated, for example, in the form of directly sprayable aqueous solutions, powders, suspensions, also high-strength aqueous, oily or other suspensions or suspoemulsions or dispersions, emulsions, oil dispersions, pastes, dusts, sprinkling agents or granules, and by spraying , Atomizing, dusting, scattering or pouring can be used. The application forms are directed according to the uses and the nature of the active ingredient used; in any case, they should ensure the finest possible distribution of the active compounds according to the invention.

For the production of emulsions, pastes or aqueous or oil-containing dispersions, the so-called active ingredients as such or in an oil or solvent can be dissolved or dispersed, it being possible to add further formulation auxiliaries for homogenization. However, liquid or solid concentrates which are suitable for dilution with water can also be prepared from active ingredient and, if appropriate, solvent or oil and optionally further auxiliaries. Emulsion concentrates (EC, EW), suspensions (SC), soluble concentrates (SL), pastes, pastilles, wettable powders or granules are mentioned here, whereby the solid formulations can either be water-soluble (soluble) or dispersible (wettable) , Corresponding powder or granules or tablets can also be provided with a solid coating which prevents abrasion or premature release of the active ingredient ("coating").

In principle, the term auxiliary means the following substance classes: anti-foaming agents, thickeners, wetting agents, adhesives, dispersants or emulsifiers, bactericides and thixotropic agents. The meaning of the above-mentioned agents is known to the person skilled in the art.

SLs, EWs and ECs can be produced by simply mixing the corresponding ingredients, powder by mixing or grinding in special mill types (e.g. hammer mills). SCs and SEs are usually produced by wet milling, it being possible to produce an SE from a SC by adding an organic phase containing further auxiliaries or active ingredients. The manufacture is known. Granules, for example coated granules, impregnated granules and homogeneous granules, can be prepared by binding the active ingredients to solid carriers. Solid carriers are, for example, mineral soils such as silicas, silica gels, silicates, talc, kaolin, limestone, lime, chalk, bolus, loess, clay, dolomite, diatomaceous earth, calcium and magnesium sulfate, magnesium oxide, ground plastics, fertilizers such as ammonium sulfate, ammonium phosphate , Ammonium nitrate, ureas and vegetable products such as cereal flour, tree bark, wood and nutshell flour or cellulose powder. Details of the production are known to the person skilled in the art, and e.g. listed in the following documents: US 3,060,084, EP-A 707445 (for liquid concentrates), Browning, "Agglomeration", Chemical Engineering, Dec. 4, 1967, 147-48, Perry's Chemical Engineer's Handbook, 4th Ed., McGraw-Hill, New York, 1963, pages 8-57 and ff. WO 91/13546, US 4,172,714, US 4,144,050, US 3,920,442, US 5,180,587, US 5,232,701, US 5,208,030, GB 2,095,558, US 3,299,566, Klingman, Weed Control as a Science, John Wiley and Sons, Inc., New York, 1961, Hance et al. , Weed Control Handbook, 8th Ed., Blackwell Scientific Publications, Oxford, 1989 and Mollet, H., Grubemann, A., Formulation technology, Wiley VCH Verlag GmbH, Weinheim (Federal Republic of Germany), 2001.

A large number of inert liquid and / or solid carriers suitable for the agrochemical compositions according to the invention are known to the person skilled in the art, such as, for example, liquid additives such as mineral oil fractions from medium to high boiling point such as kerosene or diesel oil, also coal tar oils as well as oils of vegetable or animal origin, aliphatic, cyclic and aromatic see hydrocarbons, e.g. Paraffin, tetrahydronaphthalene, alkylated naphthalenes or their derivatives, alkylated benzenes or their derivatives, alcohols such as methanol, ethanol, propanol, butanol, cyclohexanol, ketones such as cyclohexanone or strongly polar solvents, e.g. A ine such as N-methylpyrrolidone or water.

A large number of surface-active substances (surfactants) suitable for the formulations according to the invention are known to the person skilled in the art, such as, for example. Alkali, alkaline earth, ammonium salts of aromatic ^' sulfonic acids, e.g. lignin, phenol, naphthalene and dibutylnaphthalenesulfonic acid, as well as of fatty acids, alkyl and alkylarylsulfonates, alkyl, lauryl ether and fatty alcohol sulfates, and salts of sulfated hexa- , Hepta- and octadecanols as well as fatty talc glycol glycol ether, condensation products of sulfonated naphthalene and its derivatives with formaldehyde, condensation products of naphthalene or naphthalenesulfonic acids with phenol and formaldehyde, polyoxyethylene octylphenol ether, ethoxylated isoctyl, octyl, or nonylphenol, Tributylphenyl polyglycol ether, alkylaryl polyether alcohols, isotridecyl alcohol, fatty talc alcohol ethylene oxide condensates, ethoxylated castor oil, polyoxyethylene alkyl ether or polyoxypropylene alkyl ether, lauryl alcohol polyglycol ether acetate, sorbitol ester, lignin sulfite waste liquor or methyl cellulose.

Powders, materials for broadcasting and dusts can advantageously be produced as solid carriers by mixing or grinding the active ingredients together with a solid carrier.

The fungicidal compositions or the active compounds can be applied curatively, eradicatively or protectively. The application rates of active ingredient are 0.001 to 3.0, preferably 0.01 to 1.0 kg / ha of active substance, depending on the control target, season, target plants and growth stage.

Another object of the present invention is a method for controlling harmful fungi, characterized in that the fungi or the materials, plants, soil or seeds to be protected against fungal attack are treated with an effective amount of an active ingredient or an agrochemical composition with a fungicidal action. Harmful fungi are to be understood as the phytopathogenic fungi mentioned at the beginning.

Another object of the invention relates to the production of a transgenic organism, the transgenic organism being characterized by an increased lysine production compared to a non-transgenic organism.

Archaebacteria and fungi are preferred as transgenic organisms.

In a particularly preferred embodiment, the transgenic organism is a fungus, preferably the Pyrenophora or Fusarium species mentioned above, particularly preferably P. teres or F. graminearum. Examples of further organisms are Alternaria kiku- chiana, Alternaria mali, Alternaria solani, Ashbya gossypii, otrytis cinerea, Cercospora beticola, Cercospora fuligena, Cercospora kaki, Cladosporum carpophilum, Cochliobσlus heterostrophus, Colletotethrumumortumariumumototrophum lorosolarium, Cototrichum lorotumaronostructus, Collototrichum lortariumumostarium, Collototrichum lorotumarostolarototrophum lorumumostarium, Colletotrichum lorotumaronostium, Collototrichum lorotumarostium, Colletotrichum lorotumaronostructus, Collototrichum lorotomariumostolumotrophenium citri, Diplocarpon rosae, Elsinoe fawcetti, Erisyphe graminis, Leveil- lula taurica, Fusarium culmorum _# Fusarium nivale, Fusarium graminearum, Gloedes pomigena, Gloesporium kaki, Glomerella cingulata, Gymnosporangium yamadaiuma pomphosphate, Mypomorphic pellet, myamophosphate pomphora, Pym crassa, Peronospora destructor, Peronospora spinaciae, Phaeoisariopsis vitis, Phyllactinia kakicola, Physalospora canker, Phytophthora citrophithora, Phytophthora ihvestans, Phytophthora porri, Plasmopora viticola, Podosphaera leuca- phaorporas , Pseudopero- nospora cubensis, Puccinia allii, Puccinia recondita, Puccinia horiana, Pyricularia oryzae, Uncinula necator, Sclerotinia cinerea, Sclerotinia mali, Sclerotinia sclerotiorum, Septoria trititici, Sphaerotheca fuligincaumannella, puma Typhula ishikariensis, Typhula incarnata, Ustilago maydis, Venturia inaequalis, Venturia nashicola. Other preferred fungal strains are Aspergillus, Trichoderma, Neurospora, Fusarium, Beauveria, Pyreno- phora teres, Saccharomyces (e.g. Saccharomyces cerevisiae), Pichia (e.g. Pichia pastoris, Pichia methanolica), Magnaporthe, Pyrialeria or others in Indian Chem Engr. Section B. Vol 37, No 1,2 (1995). Arma bacteria can also be used.

An increase in lysine production compared to the starting organism means an increase in the lysine content by at least 10%, preferably by at least 20%, particularly preferably by at least 10 40%, very particularly preferably by at least 80%.

The transgenic fungus can be produced in the following ways:

1. The corresponding fungus is transformed with one of the above-described 15 embodiments of an expression cassette or vector according to the invention containing SEQ ID N0: 1 or a functional equivalent of said sequence, with here naturally the control sequences mentioned above for the construction of the expression cassette / vectors 20 according to the invention are used which enable the heterologous expression of the target sequence in a fungus. The additional expression of a polypeptide according to the invention can take place either via targeted induction or continuously. This results in an increased production of the metabolic end product lysine compared to a non-transgenic fungus.

2. In a second embodiment, through targeted modification of the natural gene coding for a polypeptide according to the invention, an increased biological activity of the in

30 reached according to the invention naturally occurring mushroom polypeptides. As a result, an increased production of the metabolic end product lysine is achieved compared to a non-transgenic fungus. This modification can be achieved on the one hand by targeted mutation of the gene coding for a polypeptide 5 according to the invention or by the transformation of a fungus with a nucleic acid sequence which codes for a gene product which has an increased biological activity. The biological activity was changed in such a way that an activity increased by at least 0-10%, preferably by at least 30%, particularly preferably by at least 50%, very particularly preferably by at least 100%, was achieved compared to the starting organism.

3. Increased transcription and translation of the gene sequence is achieved by targeted modification of the promoter of the natural homo-moonsonence. This increases the production of the metabolic end product lysine compared to a non-transgenic fungus.

The invention is illustrated by the following examples, but is not limited to these.

The genetic engineering processes on which the following exemplary embodiments are based are briefly described below:

A: General procedures

Cloning methods such as Restriction cleavage, DNA isolation, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, sequence analysis of recombinant DNA as well as Southern and Western blots were carried out as in Sambrook et al. , Cold Spring Harbor Laboratory Press (1989) and Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1994); ISBN 0-87969-309-6.

The bacterial strains used below (E. coli DH5α, DHB10) were obtained from BRL Gibco, or Invitrogen ,. Carlsberg, CA related. For cloning the vector pAN7-l (Punt et al., Gene 56 (1987) 117-124), the vector pCR ^® 2.1-T0P0-TA Invitrogen, the vector pUC18 Pharmacia and the vector pGEM by the company were Promega used, used. The isolation of the P. teres wild type strain 15A is described in J. Wiland et al. (Phytopathology 89 (1999), 176-181). For example, the DSM.-4527 can be used as F. Graminearum wild type strain 8/1.

B: Sequence analysis of recombinant DNA

The sequencing of recombinant DNA molecules was carried out with a laser fluorescence DNA sequencer from ABI according to the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA, 74, 5463-5467 (1977)). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed.

C: Materials used

Unless otherwise stated, all chemicals used in the following were obtained in pA quality from the companies Fluka (Neu-Ulm), Merck (Darmstadt), Roth (Karlsruhe), Serva (Heidelberg) and Sigma (Deisenhofen). Solutions were prepared with pyrogen-free water, hereinafter referred to as H20, from a Milli-Q Water System water treatment system (Millipore, Eschborn). Restriction enzymes, DNA-modifying enzymes and molecular biological kits were developed by the companies AGS (Heidelberg), Amersham (Braunschweig), Biometra (Göttingen), Röche (Mannheim), Genomed (Bad Oeynnhausen), New. England Biolabs (Schwalbach / Taunus), Novagen (Madison, Wisconsin, USA), Perkin- Elmer (Weiterstadt), Pharmacia (Freiburg), Qiagen (Hilden) and Stratagene (Heidelberg). Unless otherwise stated, they were used according to the manufacturer's instructions.

All media and buffers used for the genetic engineering experiments were sterilized either by sterile filtration or by heating in an autoclave.

example 1

Identification of the genomic nucleic acid sequence of the homoaconitase from P. teres and F. graminearum

A) Identification of the genomic nucleic acid sequence of the homoaconitase from P. teres and F. graminearum

With the help of the sequence information from the genes of the homoaconitase from Saccharomyces cerevisiae and Aspergillus nidulans, the primers DEG Homacl and DEGHomacII were constructed for the detection of the homoaconitase in P. teres and F. graminearum, with conserved amino acid blocks from the protein sequences of the Homoacononces stored in the gene bank from Saoacaronces cerevisiae (Accession No. U46154) and Aspergillus nidulans (Accession No. X99624) were used for the construction:

DEGHo acl: 5 '-CGGCCACCAGATCatgathgarga-3'

DEGHomacII: 5 '-GATGGAGTTCCGGGAGAAGatrttnccraa-3'

This was followed by a PCR according to the program shown in Table 1 with 1.5 mM MgCl ₂ (BRL Gibco), 0.2 mm dNTP mix (MBI Fermentas), 150 p ol each of the two primers, 0.8 U Taq Polyme - rase and 100 ng genomic DNA from the wild-type strain P. teres 15 A and F. graminearum 8/1. The template DNA used was produced from the wild-type strain P. teres 15 A and F. graminearum 8/1 in accordance with the specification of the DNA isolation kit (Gentra Systems, Minneapolis, USA).

Table 1

A fragment of 1630 bases was amplified in the case of P. teres and a fragment of 1757 bp in the case of F. graminearum, cloned into the pCR 2.1-TOPO-TA vector using standard cloning techniques and then transformed into E. coli DH10B.

The sequencing of the construct produced showed that the fragment had a 65% identity with the homoaconitase from S. cerevisiae and a 70% identity with the DNA sequence of the homoaconitase from Aspergillus nidulans.

The sequencing of the construct produced showed that the fragment had a 61.73% identity with the homoaconitase from S. cerevisiae, a 68.73% identity with the DNA sequence of the homoaconitase from Aspergillus nidulans and a 67.46% identity with the DNA sequence of the homoaconitase from Aspergillus fumiga- tus.

B) Production and screening of a genomic lambda library from P. teres 15A and isolation of a clone coding for homoaconitase

The phage bank was equipped with the "Lambda FIX ^® II Xhόl Partial Fill-In

Vector Kit "and the" Gigapack ^® III Gold Packaging Extract "(from Stratagene) according to the manufacturer's instructions.

The phages were transferred to Sambrook el al. (Molecular Cloning. 2nd edition, Cold Spring Harbor Laboratory Press) on Hybond N + nylon membrane from Amersham. The DNA was fixed on the filter using UV radiation (1200μJ / cm ² ). For the detection of positive clones, the DIG system was used in accordance with the manufacturer's instructions (Röche company). The standard hybridization buffer contained no formamide. The probe was made from the following two primers labeled with digoxygenin in a PCR: HOM / Hyg forw. : 5 '-ctggccaaagctagggtcgta-3'

HOM / Hyg rev. 2: 5 '-acagtcattccaacatgtacggtg-3'

These amplify a 1418 bp fragment from the fragment of the homoaconitase originally amplified with degenerate primers.

The signals were visualized using an autoradiography film (Hyperfilm ™ ECL ™).

DNA was isolated from the positive clone according to Lösch (dissertation Universität Hamburg: 2000). A large lysate was produced for this. The DNA isolated from this was cut with various restriction enzymes and analyzed in a Southern blot. From the bands that showed a signal with the homoaconitase probe already used in phage screening, a DNA band of approximately 6 kb cut with Sall was selected and cloned into the Sall interface of the pUC18 vector. The subsequent sequencing showed that the entire gene sequence of the homoaconitase from P. teres is located on this fragment.

Example 2

Production of the knock-out transformants

A) Production of the knock-out constructs (KO constructs)

P. teres

The following two primers were constructed to produce the knock-out construct:

HOM start: 5 'TCAATGAGACGCCCAAAGTACC 3 ^l

HOM end: 5 ^X ACGATGGAGGACTGCCAATCT 3 *

Using these primers, a 2314 bp fragment of the sequence SEQ ID N0: 1 comprising 2352 was amplified from the Lambda bank fragment (see example). This fragment was then cloned into the pGEM-T vector. The construct produced was given the name pGEM-T / HOM. A 1084 bp fragment of the homoaconitase gene, which also contains the putative active center, was cut out by a restriction enzyme digestion of the construct produced with the restriction enzymes BsrGI and Nhel. Im so mo therefore, the modified vector construct remains at the end 227 bp or 1003 bp of the homoaconitase gene.

A hygromycin cassette containing the restriction enzyme interfaces BsrGI and Nhel was then cloned into the position of the removed homoaconite fragment in the linearized vector. The hygromycin cassette was made up of the glucoamyase promoter region (Gen Bank Accession No: Z 30918), the hygromycin gene (Gen Bank Accession NO: K 01193) and the trpC terminator sequence (Gen Bank Accession) No: E 05643) using common cloning techniques. The resulting construct was also in the vector pGEM-T and was called pGEM-T / hph. This construct was then amplified with primers containing the attached restriction sites BsrGI and Nhel and those with BsrGI and Nhel cut

Vector pGEM-T / HOM cloned. The construct thus produced was given the name pHOM / hph.

The KO cassette was then amplified by PCR with the Expand Polymerase® from Röche. In this way, 15 μg of the KO cassette were amplified and purified for the subsequent transformation via gel elution.

F. graminearum

The following two primers were constructed to produce the knock-out construct:

HOM start: 5 ^λ GGCGCCGCTACTGGTCAAACC 3 ^λ

HOM end: 5 "GGCGCCTTGTTGACGGGGA 3 ^Λ

The 500 bp fragment (SQ ID NO: 3) was separated on a 1% TAE agarose gel, cut out, isolated with the BioRad gel elution kit and cloned into pGEM-T (E. coli DH5a). After plasmid preparation, a 950 bp fragment was cloned with PvuII into the Ehel site of pAN7-lM (PUNT et al., 1987, M = point mutation in the Ncol site of pAN7-l, instead of BsrDI site). This created the KO vector pAN7-Hom-l.

B) Production of protoplasts

For the protoplasting of the P. teres wild-type strain 15 A and the F. graminearum wild-type strain 8/1, mycelium was grown in liquid culture over 2 days at 28 ° C and 180rpm in CM ₍ according to Leach et al. (J. Gen. Microbiol. 128 ( 1982) 1719-1729.) Incubated, crushed and then incubated for a further day at 28 ° C., 180 rpm was then washed twice with distilled water. Ten grams of mycelium were mixed with 40 ml of 5% enzyme-osmotic solution (700 mM NaCl, -5% Driselase, sterile) and incubated for 3 hours at 28 ° C. and 10 ORp. The progressive protoplasting was followed microscopically via samples. The protoplasts were separated from mycelium residues by filtration, pelleted (3000 rpm, 10 min, 4 ° C.), and after washing with 10 ml each of 700 mM NaCl and SORB-TC (1.2 M sorbitol, 50 mM CaCl ₂ lOmM Tris / HCl, pH 7.0) in 1 ml SORB-TC. The concentration of protoplasts was determined by counting under the microscope.

C) transformation

10 ⁷ protoplasts were used for the transformation of P. teres. After a heat shock (5min, 48 ° C) the

Protoplasts were immediately placed on ice, carefully mixed with 15 μg of the KO HOM cassette amplified by PCR from pHOM / hph and then incubated on ice for 10 min. After adding a volume of PEG-TC (60% (w / V) PEG4000, 50mM CaCl ₂ , lOmM Tris / HCl pH 7.0) and subsequent incubation on ice for 15 minutes, 8 volumes - based on the original culture volume - SORB- TC medium added.

For the subsequent transformation of F. graminearum protoplasts, the KO plasmid pAN7-Hom-1 was isolated according to standard procedures, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in ^' Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Aεεoc. and Wiley-Interscience (1994), center linearized in ^'connection with MamI (isoschizomer BsaBI) and adjusted to a concentration of 30g / 01.

For the transformation, 10 ⁷ protoplasts were placed on ice, the KO-Vector Design prepared as described above ^'rs mixed gently with 30μg and then incubated for 10 min on ice. After adding a volume of PEG-TC (60% (w / V) PEG4000, 50 mM CaCl ₂ , 10 mM Tris / HCl pH 7.0) and subsequent incubation for 15 minutes on ice, 8 volumes - based on the original culture volume - became SORB-TC Medium added.

D) Selection of the knock-out transformants produced The transformation batch was mixed with 400 ml of 45 ° C. warm CM _reg . Medium (1 g / 1 yeast extract, 1 g / 1 casein hydrolyzate, 342 g / l sucrose, 16 g / l agar) and applied in 20 ml aliquots on 20 petri dishes with a diameter of 90 mm. 5

In the case of P. teres transformation approaches incubation, the Petri dishes were et each with 10 ml hygromycin containing water agar (12 g / l agar, 225μg / ml hygromycin) überεchicht ^'and incubated in the Anschlusε at 24 ° C after 2-3 days at 24 ° C. Mycelial colonies • 1-0 that grew through the selection agar were excised and assayed for CM _Hyg . Plates (consisting of CM medium supplemented with 75μg / ml hygromycin B) isolated.

After incubation for 1 day at 28 ° C., the petri dishes were overlaid with water agar containing 10 ml of hygromycin (16 g / l agar, 300 mg / l hygromycin) and then incubated at 28 ° C. Mycelium colonies that grew through the selection agar were cut out and separated on CMHyg plates (CMkompl medium with 150 mg / 1 hygromycin).

20

E) Evidence of knock out transformation

The transformants from P. teres were on POA medium (manufactured according to Speakman, J.B. & Pommer, E.-H. Bulletin of the British Mycological Society 20 (1986) 129-130)) and those from F.

25 graminearum on SNA medium (according to Nirenberg 1981 Can. J. Bot. 59: 1599-1609) stimulated to conidion under UV light. A single conidia was transferred to a CM _Hy g plate, whereby homokaryotic cultures were obtained. Subsequently, agar blocks with mycelium were cut out from this plate for 30 _{and transferred} into CMjom _p i medium and incubated at 28 ° C., 180 rpm for 48 hours.

DNA from the mycelium of these cultures was checked for vector integration using Southern ^' blot. For this purpose, genomic DNA was 3 ₅ geεchnitten the P. teres transformants and the wild type with the enzyme BstXI and the gramninearum F. Tranεformanten with Nru I and fractionated in Agaroεegel. Homoaconitas gene-specific fragments of 2314 bp labeled with digoxygenin were used as the probe.

40

With five transformants from P. teres and with 9 transformants from

F. graminearum, a band with increased mass was observed instead of the band of the homoaconitase gene. The difference in mass between the band of the homoaconitase gene and the mass of the band mentioned above corresponds to the mass of the KO construct, which corresponds to an integration of the KO-HOM cassette into the gene coding for homoaconitase indicates.

Example 3

A) Investigation and characterization of the knock-out transformants

With a scalpel were small, with mycelium the knock-out

Agar blocks covered with transformants from a CMκ ₀ pi.-Medi.um

Agar plate cut out and on Czapek medium plates according to Raper et al. (A Manual of the Penicillia. Waverly Press Inc., The Williams & Wilkins Company, Baltimore (1949) 64-65). Czapek Medium is an amino acid deficient medium, ie. Transformants that do not grow on this medium are auxotrophic for at least one amino acid. As a control, mycelium from the P. teres wild type strain 15A or F. graminearum wild type strain 8/1 was incubated in an analogous manner.

The P. teres knockout transformants grew in comparison to the. Wild type 15 A not on the Czapek medium. The F. graminearum mutants grew with a 2 day delay compared to the wild type 8/1.

as a control, the experiment described above was carried out with Czapek Medium plates which had been supplemented with lysine. No differences between knock-out transformants and wild type could be determined: By deliberately switching off the homoaconitase gene, the transformants were no longer able to produce lysine.

B) Checking P. teres transformants with RT-PCR

Mycelium was grown for RNA isolation as for DNA isolation (see Example 1B). The medium was centrifuged off and the mycelium was washed twice with ice-cold water. The RNA isolation was carried out with the peqGOLD RNAPure ™ from Promega according to the manufacturer's instructions. The amount was quantified photometrically and the quality of the RNA was checked by gel electrophoresis.

Before the RT-PCR, a DNase digestion with deoxyribonuclease I, amplification grade from Gibco, was carried out according to the manufacturer's instructions. The single-strand synthesis of the cDNA with SUPER-SCRIPT ™ II from Gibco follows. The manufacturer's instructions were followed. For the subsequent PCR reaction, the primers HOM start and HOM end were used, which act at the beginning and at the end of the coding gene sequence of homoaconitase.

HOM start: TCAATGAGACGCCCAAAGTACC

HOM end: ACGATGGAGGACTGCCAATCT

The PCR was carried out with 1 / 20th of the cDNA approach according to the manufacturer's instructions from Gibco for the single strand synthesis with SUPERSCRIPT ™ II. Only the wild type P. teres 15A cDNA gave a product of the expected size. The five lysine axotrophic transformants no longer produce mRNA for homoaconitase synthesis.

One microliter each was taken from the reaction mixture used for the single-strand synthesis as controls before SUPERSCRIPT ™ II was added. With. the control PCRs with primers (ActF: tgggacgatatggaiaaiatctggca, ActR: tcitcgtattcttgcttigaiatcacat (Voigt, K. et al. (2001) Gene 270: 113-120), which was a fragment from the constitutively expressed actingen of P. teres, the control PCR with the microliter, which was removed before the Superscript addition, yielded no product, which shows that the RNA was free of DNA a product which, compared to that from genomic DNA, is smaller by the spliced intron. This also confirms that the RNA was free of DNA and also intact.

C) Virulence and ability to adhere the selected P. teres transformants

The virulence of the transformants vis-à-vis the host is determined via visual assessment. The test can be carried out both on the whole plant and with cut leaf segments (Detached Leaf).

The incompletely resistant barley variety Harbin (Steffenson, BJ, 1992) and the susceptible type of barley Hazera (Steffenson, BJ, 1992) are used for this test, no cotyledons being used. In addition, leaves of summer wheat Nandu are included in the test, which serves as a non-host to control the test condition. In a round filter (0 90 mm, Schleicher & Schüll, Ref. No. 10311609) approx. 7 cm long leaf sections of the plants described above are fixed at a distance of approx. 6 cm so that the top of the leaf faces upwards. Five leaf segments of a barley variety and one leaf section from wheat are used. The filter paper with the leaf segments is placed in a petri dish filled with 10 ml sterile tap water. Each leaf section is inoculated drop-wise with a set conidia suspension (50 conidia / 20μl) with 0.01% Tween20 and then cultured in a phyto chamber for up to 7 days. The intensity and size of the necrosis is compared to the wild-type infection.

Parallel to the pathogenicity test, the ability of P. teres to attach to a barley leaf surface within a certain period of time is determined indirectly via the damage pattern.

This so-called adhesion test is carried out analogously to the pathogenicity test described above. However, only susceptible barley varieties are used (Kombar (Steffenson, B.J., 1992), Hazera).

After drop-shaped wetting of the leaf sections in the filter paper with conidia suspension, the conidia suspension on two sheets is immediately removed. The wetted area is then washed with 2 × 50 μl of 0.01% + Tween in order to remove all non-adherent conidia. The three other drops are left on the leaves for three hours and then also removed and the drip point washed. This is followed by a 7-day incubation in the phyto chamber. The wild type also serves as a comparison here.

It was shown that the lysine auxotrophic transformants are avirulent and unable to infect beyond the site of infection.

D) Virulence of the selected F. graminearum transformants

In order to test the virulence of the transformants, summer wheat of the Nandu and Munk varieties was infected. Both varieties are classified in the classification class 6 of the Bundessortenamt and are therefore particularly susceptible to the infection of F. graminearum.

In each infection experiment, an infection with the F. geaminearum wild type strain 8/1, from which the transformants originated, was carried out as a positive control and an inoculation with pure water as a negative control. In addition, in each infection experiment, in addition to the KO mutants identified from the Southern blot, a transformant with an optically integrated pAN7-Hom-1 was also inoculated on wheat. For the infection, conidia from SNA plates (SNA medium according to Nirenberg 1981 Can. J. Bot. 59: 1599-1609 containing 22 g agar) were washed off with water and adjusted to a concentration of 5 × 10 ⁴ conidia / ml. In the middle of the ear, right next to the ovary, 10 μl of this conidia suspension were inoculated. The plants were then sprayed with water and the individual ears were wrapped in plastic wrap and kept in a phyto chamber until visible infection (ag / night rhythm: day: 18oC, 16h, 25000 lux; night: 16oC, 8h). The infections were evaluated after 13 days.

In the case of infection with F. geaminearum wild type strain 8/1, strong mycelium growth around the infected spikelet, beginning to browning of the spikelet and extension of the infection to neighboring spikelets was observed. A significantly reduced infection was observed in the KO mutants compared to the wild type strain 8/1. In the EK Topis infection ^'chen transformant ^was' analogous to that of wild typεtammeε observed. A comparison test with water showed no infection.

It follows from the results described above that Ho oaconitaεe is essential for the pathogenicity of F. graminearum, since the fungus cannot effectively infect the host in the absence of these genes.

Example 4

A) Protein isolation in P. teres

All steps were carried out at 4 ° C.

Mycelium was freshly _grown in CM _medium (2 days incubation at 28 ° C and 180rpm), separated by centrifuging the medium, washed once with distilled water and carefully dried using filter paper.

The mycelium was then milled with liquid nitrogen and 100 mg mixed with 1000 μl of extraction buffer (40% glycerol, 2mM DTT, 1 tablet Complete ^® Mini EDTA-free (Fa.Röche) to 10 ml, 200mM potassium phosphate pH 6.5). After an incubation of 5 min on ice and subsequent centrifugation (15300 rpm, 4 ° C., 30 min), the supernatant was transferred to a new reaction vessel and the protein content was determined using the Bio-Rad Protein Assay Dye Reagent Concentrate according to the manufacturer's instructions. B) Activity test

For the photometric determination of the homoaconitase activity at room temperature, 12 μg protein were mixed with 80 nmol substrate (substrate stock solution: 10 mM Homoiocitrate 3, 30 mM potassium phosphate pH 8.5) in a final volume of 120 μl reaction buffer (30 mM potassium phosphate pH 8.5) and the absorption at 240 nm recorded over 20 min.

C) Comparison of the homoaconiatse activity in the wild-type strain and two auxotrophic mutants

The homoaconitase activity in the wild-type strain and in the lysine autotrophic transformants was determined. As can be seen from Figure 1, the homoaconitase activity of the lysine auxotrophic transformants is negligibly low.

Description of the sequences:

SEQ ID 1: Nucleic acid sequence of the homoaconitase from P. teres

SEQ ID 2: amino acid sequence of the homoaconitase from P. teres

Description of the picture:

Figure 1: Measurement of homoaconitase activity in the wild-type strain and in two knockout mutants (labeled Δlys4 P. eres in the figure)

Claims

claims

1. Use of the gene product of a nucleic acid sequence from a phytopathogenic fungus coding for a protein with the biological activity of a homoaconitase as a target for fungicides, the nucleic acid sequence

b) a nucleic acid sequence which, owing to the degeneracy of the genetic code by back translation in SEQ ID NO: can be ^'derived illustrated 2 amino acid sequence; or

c) functional equivalents of the nucleic acid sequences

SEQ ID N0: 1 with an identity of at least 61% to SEQ ID N0: 1.

2. Nucleic acid sequences comprising:

a) a nucleic acid sequence with that in SEQ ID NO: 1; or

b) a nucleic acid sequence which can be derived on the basis of the degenerate genetic code from the amino acid sequence shown in SEQ ID NO: 2; or

d) functional analogs of the nucleic acid sequence shown in SEQ ID NO: 1, which code for a polypeptide with the amino acid sequence shown in SEQ ID NO: 2; or

e) functional analogs of the nucleic acid sequence shown in SEQ ID NO: 1, which codes for functional analogs of the amino acid sequence shown in SEQ ID NO: 2; or

f) parts of the nucleic acid sequences a), b), c) or d).

3. A nucleic acid sequence according to claim 2 coding for a polypeptide with the biological activity of a homoaconitase, comprising

b) a nucleic acid sequence which, owing to the degenerate genetic code, can be derived by back-translation from the amino acid sequence shown in SEQ ID NO: 2; or

c) functional equivalents of the nucleic acid sequences SEQ ID NO: 1 with an identity of at least 71% to SEQ ID NO: 1.

4. nucleic acid sequence according to claims 2 to 3, which comes from a phytophathogenic fungus.

5. nucleic acid sequence according to claims 2 to 4 which originates from the phytophatogenic fungus Pyrenophora teres.

6. nucleic acid sequence according to claims 2 to 4 which comes from the phytophatogenic fungus Fusarium graminearum.

7. Method for the detection of functional analogs of SEQ ID N0: 1 by producing a probe, followed by a search of a genomic or cDNA bank of the corresponding species or a computer search for analogue sequences in electronic databases.

8. A method for identifying mutations in a nucleic acid sequence coding for a protein with the biological activity of a homoaconiase according to claims 2 to 6, originating from a phytopathogenic fungus consisting of

a) the production of oligonucleotides based on a nucleic acid sequence according to claims 2 to 6 containing the mutation with subsequent PCR; or

b) the production of oligonucleotides based on a nucleic acid sequence according to claims 2 to 6, the region flanking the mutation being amplified by means of PCR, followed by restriction digestion and / or sequencing.

9. Use of the gene product of a nucleic acid sequence according to claims 2, 3, 4, 5 or 6 or a functional equivalent of the nucleic acid sequences SEQ ID NO: 1 with an identity of at least 61% to the SEQ ID NO: 1 as target

5 for the determination of fungicidal substances.

10. Expression cassette containing a nucleic acid sequence coding for homoaconitase according to claims 2 to 6.

10 11. Expression cassette according to claim 10, containing

a) genetic control sequences functionally linked to the nucleic acid sequence defined in claims 2 to 6; or

15 b) additional functional elements; or

c) a combination of a) and b).

20 12. Vector containing an expression cassette according to claim 10 or 11.

13. Transgenic organism containing at least one nucleic acid sequence according to claim 2, 3, 4, 5 or 6, an expression

25 cassette according to one of claims 10 to 11 or a vector according to claim 12.

14. Transgenic organism according to claim 13, selected from bacteria, yeast, fungi, animal or plant cells.

30

15. Comprehensive use of nucleic acid sequences

35 b) a nucleic acid sequence which can be derived from the amino acid sequence shown in SEQ ID NO: 2 on the basis of the degenerate genetic code by back-translation; or

40 c) functional equivalents of the nucleic acid sequences SEQ ID NO: 1 with an identity of at least 61% to SEQ ID NO: 1

5 or amino acid sequences of homoaconitase from a phytopathogenic fungus encoded by the above-mentioned nucleic acid sequences in a method for identifying compounds having a fungicidal action. 5

16. A method for identifying substances having a fungicidal action, characterized in that the transcription, expression, translation or the activity of the gene product of a nucleic acid sequence according to claims 2 to 6 is encoded.

10th amino acid sequence is influenced and such substances are selected that reduce or block transcription, expression, translation or the activity of the gene product.

17. The method according to claim 16 comprising the following steps: 15 i) contacting a nucleic acid molecule according to claim 2, 3, 4, 5 or 6 or a functional equivalent of the nucleic acid sequences SEQ ID NO: 1 with an identity of at least 61% to the SEQ ID NO: l or the one through

20 nes of the above-mentioned nucleic acid molecules encoded homoaconitase with one or more test substances under conditions which allow the test substance (s) to bind to the nucleic acid molecule or the homoaconitase; and

25 ii) evidence of whether the test compound binds to the homoaconitase from i);

iii) evidence of whether the test compound reduces or blocks the activity of the Ho oa- conitase from i); or

iv) evidence of whether the test compound is transcriptional,

Translation or expression of the nucleic acid from i) reduced or blocked. 35

18. The method according to claims 16 to 17, characterized in that the identification of the substances is carried out in a high-throughput screening.

40 19. The method according to claims 16 to 18, characterized in that the method is carried out by means of an organism.

20. The method according to claim 19, characterized in that the 45 method is carried out by means of an organism according to claim 13 or 14.

21. The method according to claims 16 to 20, characterized in that

a) either homoaconitase in a transgenic organism

5 containing a nucleic acid sequence according to claim 2, 3, 4, 5 or 6 or a functional equivalent of the nucleic acid sequence SEQ ID NO: 1 with an identity of at least 61% to the SEQ ID N0: 1 is expressed or an organism which naturally contains homoaconitase , 10 is cultivated;

b) the homoaconitase from the organism in step a) in the cell disruption of the organism, in partially purified form, or in a form purified to homogeneity with a

15 test compound is contacted; and

c) a test compound is selected which reduces or blocks the activity of the homoaconitase, the activity of the homoaconi-

20 tase with the activity of a homoaconitase not incubated with a test compound is determined.

22. The method according to claims 21, characterized in that homoaconitase is incubated with a test compound

25 and after a suitable reaction time the enzymatic activity of the enzyme in comparison to the activity of the uninhibited enzyme is determined photometrically.

23. The method according to claims 21 to ^'22, characterized gekennzeich- net 30, that Homoaconitat used as substrate for measuring the enzymatic activity, and the enzymatic activity of homoaconitase is beεtimmt on the decrease in absorbance at 240nm.

24. The method according to claims 21 to 22, characterized in that homoisocitrate is used as the substrate for determining the enzymatic activity, and the enzymatic activity of the homoaconitase is determined by the increase in absorption at 240 nm.

40

25. The method according to any one of claims 16 to 24, characterized in that the test compound selected via the method is applied to verify the fungicidal activity on a phytophathogenic fungus.

45

26. The method according to claim 16 or 17 for identifying substances having a fungicidal action, comprising the following steps:

5 a) the production of organisms which, after transformation with a nucleic acid sequence according to claim 2, 3, 4, 5 or 6 or a functional equivalent of the nucleic acid sequences SEQ ID N0: 1 with an identity of at least 61% to the SEQ ID NO: 1 are able to express a poly-peptide with the biological activity of a homoaconitase;

b) the application of a test compound to the organism from step a) and to an analog, non-trans-

15 mediated organism;

c) determining the growth or ^'the viability of the transgenic and the untransformed organism following application of the test compound from step b);

20 and

d) Selection of test substances which result in reduced growth, survivability and / or infectivity of the non-transgenic organism compared to the

25 cause growth of the transgenic organism.

27. Transgenic organism according to claim 13 or 14, characterized in that it has an increased lysine production in comparison with a non-transgenic organism.

30

28. Transgenic organism according to claim 27, characterized in that the organism comes from the group of fungi or archae bacteria.

35 29. Transgenic organism according to claim 27, characterized in that the organism comes from the group of phytopathogenic fungi.

30. Active ingredients with fungicidal activity identifiable via one 40 of the method according to claims 16 to 26.

31. A process for the preparation of an agrochemical composition with a fungicidal action, characterized in that one

45 a) a fungicidal active substance is identified by one of the methods according to claims 16 to 26, and b) the active ingredient identified via (a) or an agriculturally useful salt of the active ingredient identified via (a) is formulated with appropriate auxiliaries.

32. Agrochemical composition with fungicidal activity obtainable by a process according to claim 31.

33. A method for combating harmful fungi, characterized in that the fungi or the materials, plants, soil or seeds to be protected against fungal attack are treated with an effective amount of a fungicidal compound according to claim 19 or an agrochemical composition according to claim 32.