Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6869—Methods for sequencing
  • C12Q1/6872—Methods for sequencing involving mass spectrometry
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/315—Phosphorothioates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/32—Chemical structure of the sugar

Definitions

• the present invention relates to an improved method for the analysis and/or sequencing of oligonucleotides by using Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) methodology.
• MALDI-TOF-MS Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry
• the invention relates to modified ribonucleotides, which reduce or eliminate the signal intensity drop-off during the MALDI analysis and/or sequencing.
• the Human Genome Project is in the final stages of sequencing the human genome.
• One of the post-human genome projects would be to re-sequence a specific site for comparing each different person or species as well as for the determination of Single
• SNPs Nucleotide Polymorphisms
• MALDI-TOF-MS (Smith, L. M., Science, 1993, 262, 530; and Hillenkamp et al., Biological Mass Spectrometry, Burlingame and McCloskey Editors, Elsevier Science Publishers, Amsterdam, 1990, ⁇ p.49-60), has evolved into a rapid, accurate, and sensitive method for the mass analysis of high molecular weight synthetic and biologically important polymers.
• MALDI-TOF-MS represents an advantageous methodology for analyzing and sequencing oligonucleotides as well as for the determination of SNPs.
• MALDI-TOF-MS has the advantage of enabling very fast DNA sequencing and not requiring gels or fluorescent-dyes.
• the stabilization of DNA during the MALDI analysis has been thought to have utility for DNA sequencing or other nucleic acid analyses.
• U.S. Patent No. 5,691,141 describes a method for sequencing DNA, based on the Sanger methodology. This method involves introducing mass modifications into the oligonucleotide primer, the chain-terminating nucleoside triphosphates and/or the chain-elongating nucleoside triphosphates, or by using mass-differentiated tag probes hybridizable to specific tag sequences. As nucleotide modifications, U.S.
• 5,691,141 describes primers modified by glycine residues at the 5 '-position of the sugar moiety of the terminal nucleoside; primers at C-5 of the heterocyclic base of a pyrimidine nucleoside with glycine residues, with ⁇ -alanine residues, with ethylene glycol monomethyl ether, with diethylene glycol monomethyl ether; primers mass-modified at C-8 of the heterocyclic base of deoxyadenosine with glycine or glycylglycine; primers mass-modified at the C-2' of the sugar moiety of 2'-amino-2'-deoxythymidine with ethylene glycol monomethyl ether residues; DNA primers mass-modified in the internucleotidic linkage via alkylation of phosphorothioate groups (according to the procedure described in Slim G. and Gait M.J., Nucleic Acids Research, 1991, vol.19, No.6, 1183-1188); 2'-amin
• Figures 1A and IB referring to oligo DNA comprising S-dNTPs and referred to hereafter as S-DNAs
• Fig.lC and ID referring to phosphodiester DNAs
• S-2'-e-NTPs alpha-phosphorothioate ribonucleotides having a 2'-electronegative substituents referred to hereafter as S-2'-e-NTPs (preferably S-2'-fluoro-ribonucleotides (S-2'-F-NTPs), or S-2'-OH-ribonucleotides (S-NTPs)), and arabino-ribonucleotides (ara-NTPs) can be advantageously used in MALDI-TOF-MS analysis showing a resistance to signal intensity drop-off.
• S-2'-e-NTPs preferably S-2'-fluoro-ribonucleotides (S-2'-F-NTPs), or S-2'-OH-ribonucleotides (S-NTPs)
• arabino-ribonucleotides ara-NTPs
• the present invention refers to a method for MALDI-TOF-MS analysis of RNA sequences, fragments or transcripts (in general oligoribonucleotides) which method utilizes at least one ribonucleotide selected from the group consisting of S-2'-e-ATP, -CTP, -GTP, -UTP and derivatives thereof (preferably S-2'-F-NTPs or S-NTPs).
• the present invention also refer to a method for MALDI-TOF-MS analysis of RNA sequences, fragments or transcripts (in general oligoribonucleotides) which method utilizes at least one ribonucleotide selected from the group consisting of ara-ATP, -CTP, -GTP, -UTP and derivatives thereof.
• the present invention relates to a method for determining DNA nucleotide sequences using the MALDI-TOF-MS comprising: a) providing ribonucleosides triphosphates or alpha-thio-substituted
• chain-elongating ribonucleotides selected from ara-NTPs or S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs) as above defined; b) reacting said chain- elongating ribonucleotides with one or more kinds of 3'-dNTP derivatives (chain terminating ribonucleotides) in the presence of an RNA polymerase and a DNA template comprising a promoter sequence for the RNA polymerase to obtain an oligoribonucleotide transcription product; and c) analyzing said oligoribonucleotide transcription product by MALDI-TOF-MS and determining the sequence of the transcription product and of the DNA template.
• the invention also relates to a method for the determination of SNPs using MALDI-TOF-MS and S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs) or ara-NTPs.
• the invention further refers to a kit for sequencing DNA templates or RNA transcription products by MALDI-TOF-MS, comprising: i) a set of chain-elongating ribonucleotides modified according to the present invention (as above indicated at step a)) for synthesizing a RNA transcription product; ii) one or more chain-terminating ribonucleotides for terminating the synthesis of the RNA transcription product and generating sets of base-specific terminated complementary ribonucleotide transcription fragments; and iii) a RNA polymerase.
• the kit above disclosed can also optionally further comprises (iv) one or more matrices for MALDI-TOF-MS analysis.
• the invention also refers to a kit for the determination of SNPs using MALDI-TOF-MS comprising the elements (i)-(iii) and the optional (iv) as above disclosed.
• Figure 1A and IB UN-MALDI mass spectra of equimolar mixtures of S-D ⁇ A obtained using 3-HPA (panel A) and THAP (panel B) as the matrix, respectively.
• the volume ( ⁇ l) of sample/matrix on the probe tip (A) and (B) was: 0.5/1.0.
• Figure IC and ID UN-MALDI mass spectra of equimolar mixtures of D ⁇ A obtained using 3-HPA (panel C) and THAP (panel D) as the matrix, respectively.
• the volume ( ⁇ l) of sample/matrix on the probe tip (C) and (D) was: 0.5/1.0.
• Figure 2A and 2B UN-MALDI mass spectra of equimolar mixtures of 2'-F-R ⁇ A obtained using 3-HPA (panel A) and THAP (panel B) as the matrix, respectively.
• the volume ( ⁇ l) of sample/matrix on the probe tip (A) and (B) was: 0.8/0.8.
• Figure 2C and 2D UN-MALDI mass spectra of equimolar mixtures of R ⁇ A obtained using 3-HPA (panel C) and THAP (panel D) as the matrix, respectively
• the volume ( ⁇ l) of sample/matrix on the probe tip (C) and (D) was: 0.8/0.8.
• Figure 3 Configuration of (A) deoxy-; (B) ribo-; (C) 2'-fluoro-; (D) arabino-: (E) phosphorothioated deoxy-; (F) phosphorothioated ribo-; (G) phosphorothioated
• 2,5-DHBA panel B as the matrix.
• the volume ( ⁇ l) of sample/matrix on the probe tip was (A): 1.0/1.0, (B): 0.5/1.0.
• the present invention discloses a method for MALDI-TOF-MS analysis and/or sequencing of R ⁇ A sequences, fragments or transcripts (in general oligoribonucleotides) which method utilizes at least one ribonucleotide selected from S-2'-e- ⁇ TPs (preferably
• modified ribonucleotides useful in the MALDI-TOF-MS method according to the present invention are indicated as S-2'-e-NTPs and ara-NTPs, while the oligo comprising the NTPs are indicated as oligo S-2'-e-RNA and oligo ara-RNA, respectively.
• S refers to the alpha-phosphothioate backbone
• substituent "e” refers to a strong electronegative substituent at position 2' of the ribose moiety.
• the electronegative substituent is preferably selected from the group consisting of F, Cl, NH 2 ,
• the ribonucleotide S-2'-e-NTPs comprise different nitrogenous bases, that is adenine, guanine, cytosine, uracil and/or their derivatives. Accordingly, the compound S-2'-e-NTP can be also generally indicated as S-2'-e-ATP, S-2'-e-GTP, S-2'-e-CTP, S-2'-e-UTP.
• Oligo S-RNAs have been disclosed and synthesized by Slim G. and Gait M.J., (Nucleic Acids Research, 1991, vol.19, No.6, 1183-1188) in the study of the mechanism of cleavage of hammerhead ribozymes. However, there has been no disclosure or suggestion of use of this oligo in MALDI systems.
• S-NTPs comprise different nitrogenous bases adenine, guanine, cytosine, uracil and/or their derivatives and are represented as S-ATP, S-CTP, S-GTP, S-UTP and derivatives thereof.
• an oligo comprising at least one kind of S-NTP (formula F of Figure 3) shows a resistance to signal intensity drop-off MALDI-TOF-MS analysis and/or sequencing (Fig.4).
• oligo S-2'-e-RNA a preferred example is the oligo S-2'-F-RNA comprising at least one S-2'-F-NTP selected from the group consisting of S-2'-F-ATP, S-2'-F-CTP, S-2'-F-GTP, S-2'-F-UTP and derivatives thereof.
• the present inventors have further investigated the effect of the introduction of 2'-fluoro ribonucleotides (2'-F-NTPs) into an oligo RNA (2-F'-RNA) and found that the result of MALDI sequencing method using oligo 2'-F-RNA ( Figures 2A and 2B of the present application) does not differ from that of RNA sequences ( Figures 2C and 2D) and does not alleviate signal intensity drop-off for long RNA sequences.
• 2'-fluoro ribonucleotides 2'-F-NTPs
• the 2'-F-RNAs used in the experimental part of the present application were prepared by TriLink BioTechnologies (San Diego, CA), synthesized in form of 2'-fluoro-(C) complicatT.
• the dTTP (which is not 2'-fluoro modified) was employed as starting nucleotide, binding the CPG support.
• the 2'-fluoro-CTPs were added according to the usual and well known technique in the art, described for example in "Current Protocols in Molecular Biology", Vol.I, Section V, Unit 2.11, John Wiley & Sons, Inc. Oligomers of 2'-fluoro-(C) ⁇ 0 T, -(C ) 0 T and -(C ) 30 T were synthesized.
• oligomers were referred to as 2'-F-RNA 10 mer, 20 mer and 30 mer, respectively, even if the real size of these oligomers is 11, 21 and 31 for the presence of T at the 3' end.
• dTTP is not modified and the present invention relates to the 2'-electronegative- and ara-substituents.
• the oligomer of Figures 6 will be referred to 1-10 mer, 1-20 mer and 1-30 mer, even if their real size is 1-11, 1-21 and 1-31, because of the presence of T at the 3' end.
• Figures 5 and 6 clearly show that the introduction of the alpha-phosphorothio group in combination with the fluoro substituent at position 2' of the ribose is particularly useful and efficient in the MALDI-TOF-MS analysis and/or sequencing showing a resistance to the signal intensity drop-off.
• oligos comprising 2'-epimer-ribonucleotides (also known both as arabino-NTPs and ara-NTPs)(formula D of Figure 3) show a resistance to signal intensity drop-off in MALDI-TOF-MS analysis and/or sequencing.
• These ribonucleotides comprise the different nitrogenous bases adenine, guanine, cytosine, uracil and/or their derivatives as described for compound S-2'-e-RNA.
• the resistance to signal intensity drop-off is shown in Figure 8 for ORNs (oligoribonucleotides) ara-RNA.
• Ara-RNA can be prepared, for example, according to Beardsley, G. P., et al., Nucleic Acids Res., 1988, 16, 9165-9176; Tang, W., et al., Anal. Chem., 1997, 69, 302-312.
• the ara-RNA was disclosed in Tang et al., but it was observed that the arabino-nucleosides showed base loss peaks as in Figures 3B, 4, 6B, and 8 (of the Tang et al. document). This indicated that the stabilization by this modification was less than complete (see page 311, left column, lines 16-20 of the Tang et al. document). Therefore, the ara-RNA was considered not useful for MALDI-TOF-MS analysis or sequencing.
• an ara-RNA ladder comprising ara-ribonucleotides, preferably in the presence of 3-HPA as MALDI matrix, show resistance to signal intensity drop-off using MALDI-TOF-MS analysis or sequencing.
• oligoribonucleotide sequence products which can be defined as S-2'-e-RNA (preferably S-2'-F-RNA or S-RNA) and ara-RNA.
• An oligoribonucleotide sequence product (ORN), according to the present invention, can be any ORN comprising the alpha-thio and/or arabino modified ribonucleotides according to the invention, such as, for example, an oligoribonucleotide ladder, an oligoribonucleotide fragment or complete sequence of a gene, a RNA transcript product of an Expressed Sequence Tag (EST) or a full-length RNA sequence, a fragment of a RNA transcript of t-RNA, r-RNA, m-RNA or a primer.
• EST Expressed Sequence Tag
• RNA fragment such as a ladder can be prepared, for example, by providing at least one kind of the alpha-thio and/or arabino modified ribonucleotide according to the invention in order to form an ORN according to the standard technologies known in the art (for instance by chemical incorporation of modified ribonucleotides or by the Transcriptional Sequencing (TS) method below described). Accordingly, the present invention also refers to RNA sequences or fragments or transcript products (oligoribonucleotides) comprising ribonucleotides alpha-thio and/or arabino modified according to the invention, as above described.
• RNA sequence comprising said ribonucleotides particularly useful for MALDI-TOF-MS analysis and/or sequencing.
• Figure 5 shows that all the oligomers (10 mer, 20 mer and 30 mer) have a clear resistance to the signal drop-off compared to Figure 4, wherein oligo 30 mer show in 3-HPA a signal drop-off effect.
• S-2'-F-RNA is particularly stable and resistant to base loss and exhibits lower background noise than S-RNA.
• Comparison between Figure 5 and Figure 2A,B clearly show an improved resistance to signal drop-off for 20 mer and 30 mer ladders of 2'-F-RNAs.
• Figure 6 is an UV-MALDI-TOF-MS mass spectra for fragments of 1-10 mer (panel A), fragments of 1-20 mer (panel B) and fragments 1-30 mer (panel C).
• the panels of Figure 6 show that the resolution of the peaks was good and the method has proved to efficiently sequence the provided fragments.
• Figure 8 shows that ara-RNA 10 mer, 20 mer and 30 mer ladders, preferably in presence of matrix 3-HPA, have a resistance to signal drop-off and therefore ara-NTPs can be efficiently used in MALDI-TOF-MS analysis and/or sequencing.
• the matrices employed in the MALDI-TOF-MS method according to the present invention can be selected from the matrices usually employed in MALDI methodology, for example 3-HPA, THAP, 2,5-DHBA (Zhu, Y. F., et al., Rapid Commun. Mass Spectrometry, 1996, 10, 383-388; Tang, W., et al., Anal. Chem., 1997, 69, 302-312).
• the selection of a specific matrix in particular experimental conditions could be important in MALDI methodology for obtaining a good resolution of the signal and a resistance to signal drop-off.
• the selection of the matrix 3-HPA is considered preferably advantageous.
• TS transcriptional sequencing
• MALDI-TOF-MS MALDI-TOF-MS
• TS involves a method for determining the DNA nucleotide sequence of a DNA template, comprising I) providing ribonucleoside-5 '-triphosphates (also known as chain-elongating ribonucleotides) selected from the group consisting of ATP, GTP, CTP, UTP and derivatives thereof; II) reacting said ribonucleotides with one or more 3'-dNTP derivatives (chain-terminating ribonucleotides) in presence of RNA polymerase and the DNA template fragment or sequence comprising a promoter sequence for the RNA polymerase; and III) separating the resulting RNA transcription products and determining the ribonucleotide sequence of the RNA transcript (and of the DNA template).
• ribonucleoside-5 '-triphosphates also known as chain-elongating ribonucleotides
• the present invention relates to a method comprising the steps of: a) providing ribonucleotides, such as S-2'-e-NTPs (preferably S-2'-F-NTPs, S-2'-Cl-NTPs, S-2'-NH 2 -NTPs, S-2'-N 3 -NTPs or S-NTPs) or ara-NTPs; b) reacting the ribonucleotides of step a) with one or more kinds of 3'-dNTP derivatives in the presence of RNA polymerase and a DNA template comprising a promoter sequence for the RNA polymerase to obtain an oligoribonucleotide transcription product; c) analyzing said oligoribonucleotide transcription product by MALDI-TOF-MS and determining the transcription product sequence and DNA template sequence.
• S-2'-e-NTPs preferably S-2'-F-NTPs, S-2'-Cl-NTPs, S-2'-NH 2
• the oligoribonucleotide transcription product can be preferably purified before applying the MALDI step (Wu, Q. et al., Rapid Commun. Mass Spectrum., 1996, 10, 835-838).
• the DNA template can be subjected to an amplification step before performing TS, as disclosed in US 6,074,824.
• the S-2'-e-NTPs are selected from the group consisting of S-2'-e-ATP, S-2'-e-GTP, S-2'-e-CTP, S-2'-e-UTP, and derivatives thereof (wherein "e” is preferably F, Cl, NH 2 , N 3 or OH); and the ara-NTPs are selected from the group consisting of ara-ATP, ara-GTP, ara-CTP, ara-UTP and derivatives thereof.
• the 3'-dNTP derivatives are selected from the group consisting of 3'-dATP, 3'-dGTP, 3'-dCTP, 3'-UTP and derivatives thereof, having the modification as above disclosed S-2'-e-, S-, and arabino.
• they correspond to the modified ribonucleotides according to the present invention having a deoxy at 3 '-position, so that they terminate the ribonucleotide transcript synthesis.
• They can also be indicated as S-2'-e-3'-dNTPs, S-3'-dNTPs, ara-3' -dNTPs or derivatives thereof.
• the RNA polymerase can be any RNA polymerase able to incorporate S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs), or ara-NTPs or derivatives thereof and S-2'-e-3 '-dNTPs (preferably S-3'-F-dNTPs or S-3'-dNTPs), ara-3'-dNTPs or derivatives thereof (Padilla, R.; Sousa R. Nucleic Acids Res. 1999, 27, 1561-1563; and Griffiths, A. D., et al, Nucleic Acids Res. 1987, 15, 4145-4162).
• S-2'-e-NTPs preferably S-2'-F-NTPs or S-NTPs
• ara-NTPs or derivatives thereof preferably S-2'-e-3 '-dNTPs or S-3'-dNTPs
• S-2'-e-3 '-dNTPs preferably S-3'-F-dNTPs or
• RNA polymerases examples include T7, T3, Kll, SP6 and BA14 RNA polymerases (Hyone-Myong Eun, "Enzymology Primer for Recombinant DNA Technology” Academic Press, Inc., 1996, Chapter “RNA Polymerases”).
• RNA polymerases having mutations as described in WO 99/02729, showing an enhanced ability for incorporating NTPs and/or 3 '-NTPs.
• mutant RNA polymerases are, for example, T7 RNA polymerase having at least one of the mutations F644Y, L665P, F667Y, F644Y/L665P, F644Y/F667Y, L665P/F667Y and F644Y/L665P/F667Y; a T3 RNA polymerase having at least one of the mutations F645Y, L666P, F668Y, F645Y/L666P, F645Y/F668Y, L6656/F668Y and F645Y/L666P/F668Y; a Kll RNA polymerase having at least one of the mutations L668P, F690Y, L688P/F690Y.
• the RNA polymerase is a T7 RNA polymerase having the mutations F644Y and/or F667Y.
• T7 RNA polymerase Y639F described in Padilla, R. and Sousa, R., Nucleic Acids Res., 1999, 27, 1561-1563.
• RNA transcript fragments are prepared according to the TS methodology known in the art (see reference above cited) and comprising the modified ribonucleotides according to the present invention, said RNA transcript fragments can be sequenced using MALDI-TOF-MS methodology.
• the transcripts S-2'-e-RNA (preferably S-2'-F-RNA or S-RNA) which are produced by T7 RNA polymerase have only Rp-thiophosphodiester linkage. In order to maintain the Rp-S-linkage, they show the ability to resist to RNA cleavage, nucleaseSl, nucleasePl, RNaseTl and RNaseA (Padilla, R.; Sousa R. Nucleic Acids Res. 1999, 27, 1561-1563; Dahm, S. C, et al., Biochemistry 1993, 32, 13040-13045; Loverix, S., et al., J. Chemistry & Biology 2000, 7, 651-658).
• the present invention also relates to a method for the determination of SNPs using MALDI-TOF-MS and S-2'-e-NTPs (preferably S-2'-F-NTPs or S-NTPs) or ara-NTPs.
• the method for determining SNPs can be realized using the TS method and applying MALDI-TOF-MS as above described.
• At least two alleles (or one allele and a wild type) of the same gene or gene fragment have to be sequenced.
• one or more alleles are sequenced and compared to an already known sequenced allele (or to the wild type).
• the sequences or fragment transcripts (oligoribonucleotides) analyzed for polymorphism are subjected to accurate purification, in order to remove unwanted nucleic acid products from the spectrum. Further, the size of the oligoribonucleotides to be analyzed have to be within the range of the mass-spectrometry able to assure the necessary mass resolution and accuracy (see US 5,965,363).
• the template DNA can be amplified, using specific primers, according to techniques known in the art.
• a target sequence that is a sequence that one intends to analyze and sequence comprising the presumed polymorphism
• the target sequence for example corresponding to an exon or shorter
• the transcription product is prepared and the masses of each of the reduced-length (amplified or not) target oligoribonucleotide(s) is determined using MALDI-TOF-MS.
• This method can be used to detect polymorphism in a single target nucleic acid by detecting variability in mass as compared to a wild type target nucleic acid or other alleles of said target nucleic acid.
• the method can also be used to detect polymorphisms in a set of different target nucleic acids comprising (optionally also comprising amplifying each of said target nucleic acids) reducing the length and/or isolating a target oligonucleotide, using the TS method and determining the masses of the transcription products, comprising the incorporated ribonucleotides of the present invention, by MALDI-TOF-MS.
• the invention further refers to a kit for sequencing a DNA template or a RNA transcription product by MALDI-TOF-MS, comprising: i) a set of chain-elongating ribonucleosides triphosphates or alpha-phosphothioated for synthesizing a RNA transcription product, said chain-elongating ribonucleosides selected from the group consisting of
• S-2'-e-NTPs preferably S-2'-F-NTPs or S-NTPs
• ara-NTPs ii) one or more chain-terminating ribonucleotide for terminating the synthesis of the RNA transcription product and generating sets of base-specific terminated complementary ribonucleotide transcription fragments; and iii) a RNA polymerase.
• the kit above disclosed can also optionally further comprise: iv) a set of primers suitable for amplification of the template or target DNA; and v) one or more matrix for MALDI-TOF-MS analysis.
• a matrix can be selected, for example, among those described in Zhu, Y. R, et al., Rapid Commun. Mass Spectrometry, 1996, 10, 383-388; Tang, W., et al., Anal. Chem., 1997, 69, 302-312.
• the present invention also refers to a kit for the determination of SNPs using
• MALDI-TOF-MS comprising the same elements (i)-(iii) and the optional elements
• Mass spectra were obtained on a Bruker Reflex III time-of-flight mass spectrometer, equipped with a 337 nm N 2 laser giving a 2 ns pulse width and operated in linear, positive-ion detection mode at 28.5 kN (IS/1) with a delayed extraction voltage of 20.8 kN (IS/2).
• the laser power setting employed for the samples was 25-30 % of the full laser power.
• Sweet spots on the surfaces of the matrix and sample mixture crystallized were searched and shot to gain the best spectrum in all experiments. Clear crystals were favored over white muddy color crystals. Each spectrum consisted of the sum of 50 shots.
• MALDI-TOF-MS was performed as described according to the state of the art literature.
• RNA sequences of the RNA were the same to the DNA with the difference that T was U in the RNA and are defined as 10 mer: (GAUCUCAGCU) (SEQ ID NO:4), 20 mer: (GAUCUCAGCUCUAAUGCGGU) (SEQ ID NO:5), and 30 mer: (GAUCUCAGCUCUAAUGCGGUUCGAUAAAUC) (SEQ ID NO:6).
• S-DNA and S-RNA were synthesized as phosphorothioate substituted the DNA and the RNA with amine at 3' end for adding positively charged tag, respectively.
• the dTTP is not 2'-modified and was not considered for the purpose of the present invention. Only the 2'-F-CTPs were counted for the numbering of the oligomers. Therefore, even is the oligomers synthesized are 11, 21 and 31 mer, they were referred to as 10 mer, 20 mer and 30 mer.
• the lOmer 5'- 2'-fluoro CCCCCCCCT -3' (SEQ ID NO:7);
• the 20mer 5'- 2'-fluoro CCCCCCCCCCCCCCCCT -3' (SEQ ID NO:8);
• the 30mer 5'- 2'-fluoro CCCCCCCCCCCCCCCCCCCCT -3' (SEQ ID NO:9).
• oligonucleotides as stock solution were dissolved with TE buffer (lOmM Tris-Cl pH 8.0, ImM EDTA pH8.0). MilliQ water was employed at any other dilution step.
• Figures 1C,D and Figures 2C,D and 2A,B show that equimolar mixtures of the 10, 20 and 30mer for each of the three different 2' groups were prepared and analyzed using two different matrices in MALDI.
• signal intensity drop-off with increasing mass range was a positive trend.
• the behavior of the oligonucleotide ladders were repeated as the same trend with 3-HPA and THAP.
• Figures ID , 2D and 2B the spectra of 30mer in DNA, RNA and 2' -F-RNA ladder using THAP show that the trend of stability to bass loss was followed as the order 2'-F-RNA > RNA > DNA.
• S-2'-fluoro-(C) n T (S-2'F-RNA) ( Figure 3G) as phosphorothioate substituted 2'-fluoro-(C) n T (SEQ ID NO: 7-9) was also prepared by TriLink BioTechnologies.
• the numbering of oligomers length was 10 mer, 20 mer and 30 mer, and the presence of T at the 3' end was not considered for reason of numbering.
• the crude oligomers represented in Figure 6, are indicated as 1-10 mer, 1-20 mer and 1-30 mer, because the T at position 3' end was not considered for reason of numbering.
• the crude S-2'-F-(C) n Ts (S-2'-F-RNAs) were synthesized and processed by ethanol precipitation to remove excess salt and exchanged to the sodium salt form (as purchased from TriLink Biotechnologies, San Diego, CA). Crude lOmer, 20mer, 30mer S-2'-F-RNA were not subjected to purification. Therefore, the crude lOmer, 20mer, 30mer S-2'-F-RNA contained 1-lOmer, l-20mer, l-30mer S-2'-F-RNA, respectively. These crude oligoribonucleotides were used for the experiment reported in Figure 6.
• Figures 6A and 6B show that the lOmer and the 20mer of the crude S-2'-F-RNA were analyzed in 3-HPA.
• a comparison with the spectra of 2'-F-RNA ladder as a control was performed.
• the signal intensity of the 20mer was assigned as 20 when the intensity of the lOmer was 100.
• the intensity decreased five times with increasing the mass about two times.
• the intensity of the 18mer was assigned as 62 when the intensity of the 9mer was 100.
• CNME alpha-cyano-4-hydroxycinnamic acid methyl ester
• Figures 7A,B show spectra of these oligo CH 3 S-RNA.
• a number of shorter spectra instead of the expected intact parent ion peak were observed.
• the control spectra of those were shown in Figures 4A,B as spectra of S-RNA.
• Arabinonucleic acids were mentioned more stable toward snake venom phosphodiesterase (SNDPE) hydrolysis than the ribonucleic acid derivatives; i.e., ara-R ⁇ A > R ⁇ A > 2'-F-R ⁇ A (Noronha, A. M., et al., J. Biochemistiy 2000, 39, 7050-7062). Since the present inventors focused on a trend of sugar-phosphate in oligonucleotide, the order in stability to SNDPE hydrolysis was investigated to suit stability to fragmentation in MALDI analysis. The behavior of the ara-R ⁇ A ladder in MALDI analysis was further certified in the matrices 3-HPA and THAP.
• Figure 8A shows that extremely sharp signal peaks and the resistance to signal intensity drop-off with increasing mass range were observed using 3-HPA. The signal intensity of each peak was almost even.
• Ara-RNA ladder in matrix THAP was also resistant among the 20 mer and the 30 mer as shown in Figure 8B.
• the ara-RNA ladder exhibited resistance to signal intensity drop-off with increasing mass range as shown in Figure 8A and 8B. It has been understood that phosphorothioate-substitution of RNA made backbone cleavage difficult. The effect was investigated to prove that the backbone cleavage at the sugar-phosphate would become one of the key roles toward decreasing signal intensity with increasing mass range in MALDI analysis.
• Fig.8 preferably Fig.8A, shows that, contrary to the disclosure in the state of the art, ara-NTPs are able to resist signal intensity drop-off using MALDI-TOP-MS.
• RNA transcript fragments of a specific template DNA fragment or sequence can be produced with TS methodology disclosed in the references as above indicated.
• the RNA transcript fragments can be treated with an amount of desalting acid solution and can be recovered substantially free from contaminants.
• the transcripts are then mixed with a matrix and crystallized.
• the RNA sequence is determined by MALDI-TOF-MS, according to the methodology known in the art.
• the sequence of the template DNA bases are then determined according to the transcript RNA bases.

Applications Claiming Priority (3)

Publications (1)

Family

ID=22953683

Family Applications (1)

Country Status (4)

Families Citing this family (7)

Family Cites Families (1)

• 2001
  • 2001-12-06 CA CA002430648A patent/CA2430648A1/en not_active Abandoned
  • 2001-12-06 JP JP2002548185A patent/JP2004518420A/ja active Pending
  • 2001-12-06 EP EP01999673A patent/EP1364058A2/de not_active Withdrawn
  • 2001-12-06 WO PCT/JP2001/010689 patent/WO2002046468A2/en active Search and Examination

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events