EP1349929A2 - Sequences d'adn provoquant l'apoptose - Google Patents

Sequences d'adn provoquant l'apoptose

Info

Publication number
EP1349929A2
EP1349929A2 EP01954041A EP01954041A EP1349929A2 EP 1349929 A2 EP1349929 A2 EP 1349929A2 EP 01954041 A EP01954041 A EP 01954041A EP 01954041 A EP01954041 A EP 01954041A EP 1349929 A2 EP1349929 A2 EP 1349929A2
Authority
EP
European Patent Office
Prior art keywords
clone
gene
nucleic acid
identity
mrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01954041A
Other languages
German (de)
English (en)
Inventor
Stefan Grimm
Nicole SCHÖNFELD
Erik Braziulis
Ursula Cramer
Andreas Gewies
Frank Voss
Thomas Mund
Timur Albayrak
Hendrik Gille
Matthias Klein
Manuel Bauer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Original Assignee
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE10126344A external-priority patent/DE10126344A1/de
Application filed by Max Planck Gesellschaft zur Foerderung der Wissenschaften eV filed Critical Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Publication of EP1349929A2 publication Critical patent/EP1349929A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the invention relates to new apoptosis-associated and in particular apoptosis-inducing nucleic acid sequences, polypeptides encoded thereof and their use for the provision of diagnostic and therapeutic agents.
  • the invention relates to transgenic cell systems and animals and their use for the genetic and / or pharmacological investigation of apoptosis-associated diseases.
  • Apoptosis is the genetically encoded suicide program that is induced in eukaryotic cells under certain physiological or pathological conditions.
  • the induction of apoptosis must be regulated extremely precisely because hyperactivity can lead to degenerative diseases.
  • reduced apoptosis induction can contribute to tumor progression.
  • plasmid pools of 20 clones are used for transfection into the kidney cell line.
  • the transfection of plasmid pools can only achieve a low sensitivity for the screening method, since those expression plasmids which contain apoptosis-inducing genes are present in each case in a low ratio to the expression plasmids which do not carry apoptosis-inducing genes.
  • aliquots which contained only one clone statistically were used instead of plasmid pools in the screening method used for transfection.
  • a particularly effective way of purifying plasmid DNA was used (Neudecker and Grimm, Biotechniques 28 (2000), 107-109).
  • This procedure enables Reduction of lipopolysaccharides by a factor of 900 compared to previously published methods and thus enables for the first time the purification of plasmid DNA for high throughput in the "96 well" format.
  • the use of specially purified DNA for transfection in combination with the use of individual clones instead of plasmid pools enabled a particularly effective and sensitive screening process to be carried out, which made it possible to determine a large number of apoptosis-inducing sequences.
  • the present invention relates to new apoptosis-associated and in particular apoptosis-inducing nucleic acids comprising: (a) the nucleic acids of clones 1 - 1 6 shown in Table 1, in Table 2 or in SEQ ID NO: 1 - 225, and nucleic acids complementary thereto or fragments thereof, (b) nucleic acids corresponding to the sequences according to (a) in the context of the degeneration of the genetic code and (c) nucleic acids hybridizing with the sequences according to (a) or / and (b) under stringent conditions.
  • the nucleic acids according to the invention are apoptosis-associated nucleic acids, ie nucleic acids which are associated with the occurrence of apoptotic processes in a cell, in particular in a mammalian cell.
  • the nucleic acids are preferably apoptosis-inducing nucleic acids, ie nucleic acids which can induce and / or promote apoptotic processes.
  • the nucleic acids according to the invention are particularly preferably dominant apoptosis-inducing nucleic acids which are capable of inducing apoptosis when expressed in a cell and which produce the characteristics characteristic of apoptosis, such as DNA fragmentation, morphological peculiarities etc.
  • the nucleic acids can be in double-stranded or single-stranded form, for example as DNA or RNA.
  • the isolated nucleic acids can develop their cellular effect by expression, in particular by overexpression in cells. This makes them inducible and defines their use as a therapeutic agent.
  • nucleic acids or partial fragments thereof shown in Table 1 or the corresponding sequence protocols with a length of preferably at least 15, particularly preferably at least 20 and most preferably at least 25 nucleotides, variants of these sequences are also covered by the present invention.
  • nucleic acids which correspond to the sequences according to (a) in the context of the degeneration of the genetic code and which code for a polypeptide with the same amino acid sequence nucleic acids are also recorded which are stringent with the sequences according to (a) or / and (b) Hybridize conditions.
  • hybridization under stringent conditions means that after pre-hybridization and hybridization under suitable conditions and washing in 1 ⁇ SSC and 0.1% SDS at 55 ° C., preferably at 62 ° C. and particularly preferably at 68 ° C. and in particular a hybridization signal is also found in 0.2 x SSC and 0.1% SDS at 55 ° C, preferably at 62 ° C and particularly preferably at 68 ° C (see also Sambrook et al., Molecular Cloning. A Laboratory Manual (1 989), Cold Spring Harbor Laboratory Press, 1 .101 -1 .104).
  • the apoptosis-associated nucleic acids according to the invention preferably code for an apoptosis-associated polypeptide or a functional fragment thereof.
  • the nucleic acids can originate from any organism, eukaryotic organisms such as nematodes, for example C. elegans, arthropods such as Drosophila, Cordata and vertebrates, for example mammals, being preferred. Sequences from mammals, for example from the mouse or from humans, are particularly preferred, these sequences optionally being able to be modified by known molecular biological techniques, such as site-specific mutagenesis, PCR, restriction cleavage and ligation.
  • the nucleic acids according to the invention are preferably operatively linked to an expression control sequence so that they can be transcribed and, if necessary, translated in a suitable host cell.
  • Expression control sequences usually comprise a promoter and optionally regulatory sequences such as operators or enhancers. Translation initiation sequences may also be present.
  • Suitable expression control sequences for prokaryotic or eukaryotic host cells are known to the person skilled in the art (see, for example, Sambrook et al., Supra).
  • Another object of the invention is a recombinant vector which contains a nucleic acid according to the invention, preferably in operative linkage with an expression control sequence.
  • the recombinant vector can also contain common elements such as an origin of replication and a selection marker gene.
  • suitable recombinant vectors e.g. Plasmids, cosmids, phages, viruses etc. are known to the person skilled in the art (see e.g. Sambrook et al., Supra).
  • the invention further relates to recombinant cells which can be transformed or transfected with a nucleic acid or a vector according to the invention.
  • the transformation or transfection can be carried out according to known methods, e.g. by calcium phosphate coprecipitation, lipofection, electroporation, particle bombardment or viral infection.
  • the cell according to the invention can contain the recombinant nucleic acid in extrachromosomal or chromosomally integrated form.
  • Another object of the invention is apoptosis-associated polypeptides which are encoded by a nucleic acid according to the invention.
  • Apoptosis-associated polypeptides can be obtained by expression of the apoptosis-associated nucleic acids according to the invention, by chemical synthesis or by combinations of both methods.
  • Another object of the invention is a pharmaceutical composition which contains a nucleic acid according to the invention, a vector according to the invention or a polypeptide according to the invention optionally together with pharmaceutically customary excipients and auxiliaries.
  • the nucleic acids, vectors, cells and polypeptides described above can be used to produce a diagnostic or therapeutic agent, in particular an agent for the diagnosis, therapy or prevention of apoptosis-associated diseases.
  • Apoptosis-associated diseases can be characterized on the one hand by an abnormally reduced apoptosis and thus by hyperproiiferation, for example tumor diseases, autoimmune diseases and viral infections (Thompson, Science 267 (1995), 1456-1462).
  • apoptosis-associated diseases can also be characterized by abnormally increased apoptosis and thus by degenerative symptoms, such as Alzheimer's disease, Huntington's disease, Parkinson's disease, reperfusion damage, stroke and alcohol damage to the liver (Thompson (1995), supra ).
  • the diagnostic application comprises a qualitative and / or quantitative detection of the apoptosis-associated nucleic acid, for example in the form of a transcript, or the polypeptide encoded thereby in a sample, in particular a sample, which was taken from a diseased organism, for example a patient.
  • the detection can be carried out in the usual way, for example by nucleic acid hybridization or amplification reactions such as PCR or by protein detection using antibodies. Numerous techniques for this are known to the person skilled in the art.
  • the detection can also be done by using the isolated genes on a DNA chip. This allows several, eg all genes to be examined simultaneously in one experiment.
  • the therapeutic or preventive application comprises the administration of an active substance to a diseased organism in a sufficient dosage to alleviate or cure the apoptosis-associated disease or to prevent the onset of an apoptosis-associated disease.
  • an apoptosis-associated nucleic acid is administered on a gene therapy vector, for example an adenovirus, a retrovirus, an adeno-associated virus, etc., in order to bring about increased expression of the apoptosis-associated nucleic acid in a diseased target cell.
  • a gene therapy vector for example an adenovirus, a retrovirus, an adeno-associated virus, etc.
  • an antisense nucleic acid can also be administered, for example on a gene therapy vector or also directly, provided that the expression of the apoptosis-associated nucleic acid is to be reduced.
  • apoptosis-associated polypeptides or modulators of the activity of such apoptosis-associated polypeptides can be administered.
  • the active substances are administered by known methods, for example in gene therapy (Anderson, Nature 392 (1998), 25-30) or protein therapy (Schwarze et al., Science 285 (1999), 1569-1572).
  • nucleic acids, vectors, cells and polypeptides according to the invention can also be used to identify new active substances for the therapy or prevention of apoptosis-associated diseases.
  • the use in known cellular or molecular screening assays is conceivable here, in a high throughput format.
  • the invention naturally also relates to the active substances identified by the use of such screening methods or substances derived therefrom.
  • the active substances identified by the screen are able to activate or inhibit signaling pathways which are induced by the expression of the nucleic acids.
  • the present invention further provides transgenic non-human animals which (i) constitutively or inducibly overexpress the gene of a nucleic acid according to the invention or the ANT-1 gene, (ii) the endogenous gene of a nucleic acid according to the invention or the ANT-1 gene in inactivated form Contain form, (iii) contain the endogenous gene of a nucleic acid according to the invention or the ANT-1 gene completely or partially replaced by a mutated gene of a nucleic acid according to the invention or a mutated ANT-1 gene, (iv) conditional and tissue-specific overexpression or underexpression of the gene of a nucleic acid according to the invention or of the ANT-1 gene or (v) have a conditional and tissue-specific knock-out of the gene of a nucleic acid according to the invention or of the ANT-1 gene.
  • the transgenic animal can preferably additionally contain an exogenous gene of a nucleic acid according to the invention or an exogenous ANT-1 gene under the control of a promoter which allows overexpression.
  • the endogenous gene of a nucleic acid according to the invention or the endogenous ANT-1 gene can be overexpressed by activation or / and exchange of the own promoter.
  • the endogenous promoter of the gene of a nucleic acid according to the invention or of the ANT-1 gene preferably has a genetic change which leads to a changed expression of the gene.
  • the genetic modification of the endogenous promoter includes a mutation of individual bases as well as deletion and insertion mutations.
  • a first embodiment relates to a transgenic animal which constitutively or inducibly overexpresses the gene of a nucleic acid according to the invention or the ANT-1 gene.
  • the introduced gene of a nucleic acid according to the invention or the introduced ANT-1 gene can optionally have additional mutations.
  • a second embodiment relates to a transgenic animal which contains the endogenous gene of a nucleic acid according to the invention or the endogenous ANT-1 gene in inactivated form.
  • the inactivation of the gene of a nucleic acid of the invention or of the ANT-1 gene is preferably effected by introducing a knock-out mutation "by homologous recombination or by introducing an antisense construct or an RNAi Kontrukts.
  • ANT-1 gene is completely or partially replaced by a mutated gene of a nucleic acid of the invention or a mutated ANT-1 gene.
  • a fourth embodiment relates to a transgenic animal which has a conditional and tissue-specific overexpression or underexpression of the gene of a nucleic acid according to the invention or of the ANT-1 gene.
  • the transgenic animal has a conditional and tissue-specific knock-out of the gene of a nucleic acid according to the invention or of the ANT-1 gene.
  • the transgenic animal is preferably a mammal, such as a rodent, for example a mouse.
  • Mice have numerous advantages over other animals. They are easy to hold and their physiology is considered a model system for that of humans.
  • the production of such gene-manipulated animals is well known to the person skilled in the art and is carried out by customary methods (Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994), Manipulating the Mouse-Embryo; A Laboratory Manual, 2nd ed., Can Spring Harbor Laboratory, Cold Spring Harbor, NY).
  • the invention further relates to the use of such a transgenic animal for the genetic and / or pharmacological examination of diseases which are associated with excessive or reduced or no expression of a gene of a nucleic acid according to the invention or of an ANT-1 gene.
  • the transgenic animals according to the invention can serve as a model for the diseases associated with the gene of a nucleic acid or ANT-1 gene according to the invention in humans or also in farm animals. For example, the effects of drugs or gene therapies on the course of the disease can be determined. The animals can also be useful for diagnosis or early detection of a disease.
  • a transgenic animal according to the invention which contains the ANT-1 gene can serve as a model for the degenerative heart disease dilatoric cardiomyopathy (DCM).
  • DCM degenerative heart disease
  • This degenerative heart disease is associated with excessive apoptosis in a patient's heart cells.
  • a first indication that the apoptosis inducer ANT-1 plays an important role in the induction of apoptosis in DCM was the observation that the expression pattern of the ANT-1 isoforms in the patient developed very early in the course of DCM Heart shifts. There is an increased expression of ANT-1 mRNA and ANT-1 protein (PCT / EP00 / 0881 2).
  • the ANT-1 gene can be expressed in transgenic mice under the control of the heart-specific ⁇ r-myosin heavy chain promoter (Subramaniam, A. (1 991), J. Biol. Chem. 266 (36), pages 24613-24620) become. This promoter is well characterized and is only activated at the time of birth.
  • the expression construct can be produced, for example, by inserting the ANT-1 gene into the Sall restriction site of the third non-coding exon of the 5.5 kB promoter.
  • the hearts of the transgenic animals according to the invention thus produced should contain some of the cellular ones which are specific to DCM Changes such as fibrinization, apoptosis and hypertrophy, or functional disorders such as left ventricular pressure, end diastolic pressure, contractility, left ventricular ejection fraction and left ventricular filling pressure.
  • cell culture systems in particular human cell culture systems, can also be used for the applications which are described for the transgenic animal.
  • the invention is further illustrated by the following example.
  • sequence listing contains the sequences SEQ ID No. 1-225, which include the T7 sequences, BGH sequences and internal primer sequences of the identified apoptosis-inducing genes of clones 1-124 listed in Table 1.
  • Table 2 shows the sequences of clones 1-124 and 125, 127, 133, 134, 140, 141, 144, 145 and 146.
  • Apoptosis-inducing genes were found by a genetic screen in the human cell line HEK 293T (Grimm and Leder (1997), supra), which is based on the iterative transfection of small expression plasmid pools from a normalized gene library and the subsequent microscopic determination of the programmed cell death the phenotype of the apoptotic cells.
  • the transfection of individual clones from a positive plasmid pool then allows the apoptosis-inducing gene to be determined.
  • This screen was done in a 96-well format. Furthermore, a particularly effective way of purifying the plasmid DNA was used (Neudecker and Grimm, Biotechniques 28 (2000), 107-109).
  • Human HEK 293T cells were supplemented in DMEM with 5% fetal calf serum (Sigma, Deisenhofen, Germany) in a humidified 5% CO 2 atmosphere. For transfections, the cells were placed in 24-well plates and treated with 2 ⁇ g plasmid DNA using the calcium phosphate coprecipitation method as described by Roussel et al. (Mol. Cell. Biol. 4 (1984), 1999-2009).
  • Kidney mRNA from 10 week old CD1 mice was normalized by association of abundant mRNA species with antisense cDNA molecules covalently coupled to latex beads and subsequent separation by centrifugation. After two rounds of hybridization, 200 ng (from originally 2 ⁇ g) of mRNA were obtained and used to prepare a cDNA library using a cDNA synthesis kit (Gibco BRL, Gaithersburg, MD) used.
  • a cDNA synthesis kit Gibco BRL, Gaithersburg, MD
  • the cDNA molecules were inserted into a modified pcDNA3 vector (Invitrogen) under the control of the cytomegalovirus (CMV) promoter in which the neomycin resistance gene had been deleted.
  • CMV cytomegalovirus
  • the DNA was introduced by electroporation into E. coli SURE cells (Stratagene, Corp. La Jolla, CA), which were then immediately frozen.
  • the apoptosis-inducing activity of the transfected nucleic acids was carried out by microscopic determination of the cell phenotype. In the case of apoptotic cells, the optical density of the cells increases because the cytoplasmic nucleus volume ratio decreases and as a result of the breakdown of the cytoskeleton, bubbles form in the cytoplasmic membrane.
  • 96-hole blocks with bacteria were centrifuged for 5 min at 3000 g (Sigma centrifuges, Osterode am Harz, Germany). The supernatant was decanted and the blocks were inverted for 2-3 minutes. Then 1 70 ⁇ ⁇ buffer P1 (50 mM Tris-HCl / 1 OmM EDTA pH 8.0) was added and the bacterial pellets were resuspended by complete vortex treatment for 10 to 20 min. After adding 1 70 ⁇ ⁇ buffer P2 (200 mM NaOH, 1% SDS), the block was sealed with film, mixed by inverting and incubated for 5 min at room temperature. The lysis was terminated by adding 170 ⁇ l of 4 ° C.
  • the supernatant after centrifugation for 10 min at 6000 rpm was placed in 96-hole polyoxymethylene microtiter blocks. 1 50 ul silica suspension was added and incubated for 20 min at room temperature. The plates were centrifuged for 5 minutes at 6000 rpm. The supernatant was carefully decanted and 400 ul acetone (-20 ° C) was added. The plates were again vortexed (30 sec) and centrifuged for 3 min at 6000 rpm. This acetone washing process was repeated once. The plates were first dried at room temperature for 5 minutes and then for 5 minutes in a vacuum chamber.
  • the pellets were resuspended in 75 ul water (60 ° C) and centrifuged at 6000 rpm and 4 ° C for 10 min. The supernatant was stored in a 96-well microtiter plate at -20 ° C.
  • Clone 1 is composed of the following sequences: T7, BGH sequence, internal primer on the left and internal primer on the right (Seq. 1-4). The overall sequence is given under Contig (Seq. 5). Clone 1 shows homology with the following ESTs (expressed sequence tags): uc81 e12.y1 Sugano mouse kidney mkia Mus musculus cDNA clone (Genbank Acc. No AA986577.1
  • Clone 2 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 2 shows homology with the following database entries: Homo sapiens cDNA FLJ20625 fis, clone KAT04008 (DNA Data Bank of Japan (DDBJ) Acc. No AK000632.1 and AK000632) with an identity of 91%; mf71 g09.r1 Soares mouse embryo NbME1 3.5 14.5 Mus musculus cDNA clone (Genbank Acc. No W89554.1 J W89554) with an identity of 99%; G0103H 1 2-3 Mouse E7.5 Embryonic Portion cDNA Library Mus musculus cDNA clone (Genbank Acc. No AW536394.1 j AW536394) with an identity of 99%.
  • Clone 3 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 3 shows homology with EMBL Acc. No X78936
  • Clone 4 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 4 shows homology with Mus musculus mRNA for calcium Channel gamma 5 subunit (CACNG5 gene) (EMBL Acc. No AJ272046.1 J MMU272046) with an identity of 97%.
  • CACNG5 gene calcium Channel gamma 5 subunit
  • Clone 5 shows homology with RefSeq database Acc. No NM_00821 8.1: Muscle hemoglobin alpha, adult chain 1 (Hba-a1), mRNA with one Length of 564bp and an identity of 97% as well as Genbank Acc. No L75940.1 1 MUSALGL: Mus muscle alpha-globin mRNA, complete cds with an identity of 98%.
  • Clone 6 is composed of T7 or R2 and BGH or 4SP6 sequence. The overall sequence is given under Contig. Clone 6 shows homology with the following database entries: Mus musculus domesticus mitochondrial carrier homolog 1 isoform a mRNA, complete cds; nuclear gene for mitochondrial (Genbank Acc. No AF176007.2 J AF176007) with an identity of 99%; Homo sapiens CGI-64 protein mRNA, complete cds (Genbank Acc. No AF151822.1
  • Clone 7 shows homology to Genbank Acc. No AF151893.1
  • AF151893 Homo sapiens CGI-135 protein mRNA, complete cds with an identity of 86%.
  • Clone 8 shows homology to RefSeq Acc. No NM_012504.1: Rattus norvegicus ATPase, Na + K -t-transporting, alpha 1 polypeptide (Atp1 a1), mRNA with an identity of 94%.
  • Clone 9 shows homology to the following database entries: Mus musculus solute carrier family 27 (fatty acid transporter), member 2 (Slc27a2), mRNA (RefSeq Acc. No NM_01 1978.1) with an identity of 99%; Mus muscle fatty acid transport protein 2 mRNA, complete cds (Genbank Acc. No AF072757.1 J AF072757) with an identity of 99%; Mus muscle mRNA for very-long-chain acyl-CoA synthetase (VLACS) (EMBL Acc. No AJ223958.1 J MMAJ3958) with an identity of 99%.
  • VLACS very-long-chain acyl-CoA synthetase
  • Clone 10 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 10 shows homology EMBL Acc. No AL080066.1 J HSM800567: Homo sapiens mRNA; cDNA DKFZp564J 142 (from clone DKFZp564J142) with an identity of 89-95% as well as to DDBJ Acc. No AK001993.1
  • AK001993 Homo sapiens cDNA FLJ1 1 131 fis, clone PLACE 1006325, highly similar to Homo sapiens mRNA; cDNA DKFZp564J142 with an identity of 89-95%.
  • Clone 1 1 shows homology to the following database entries: RefSeq Acc. No NM_009984.1: Mus muscle cathepsin L (Ctsl), mRNA with an identity of 96%; EMBL Acc. No X06086.1 1 MMMEPR: Mouse mRNA for major excreted protein (MEP) with an identity of 96%; Genbank Acc. No J02583.1 j MUSCPR: with an identity of 96%.
  • Clone 12 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 12 shows homology to the following database entries: EMBL Acc. No AL137721.1
  • HSM802233 Homo sapiens mRNA
  • Genbank Acc. No L34839.1 j HUMTUM Homo sapiens over-expressed breast
  • Clone 13 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 13 shows homology to Genbank Acc. No AF151807.1 JAF151807: Homo sapiens CGI-49 protein mRNA, complete cds with an identity of 87-90%. Clone 14 shows homology to Genbank Acc. No AF080469] AF080469: Mus muscle putative glycogen storage disease type 1b protein mRNA, complete cds with an identity of 94%.
  • Clone 15 shows an identity to Genbank Acc. No U31241
  • CGU31241 Cricetulus griseus integral membrane protein CII-3 mRNA, nuclear gene encoding mitochondrial protein, complete cds with an identity of 85% and to Genbank Acc. No S74803JS74803: CII-3 succinate-ubiquinone oxidoreductase complex II membrane-intrinsic subunit [cattle, heart, mRNA with an identity of 83%.
  • Clone 16 is composed of T7 or 4SP6 and BGH sequences. The overall sequence is given under Contig. Clone 16 shows homology to Genbank Acc. No AF116911.1
  • AF116911 Mus musculus thymic dendritic cell-derived factor 1 mRNA, complete cds with an identity of 96% and for RefSeq Acc. No NM_004872.1: Homo sapiens mouse tropomyosin homolog (HSPC001) mRNA with an identity of 89-92%.
  • Clone 17 shows an identity to Genbank Acc. No AF056031 JAF056031: Rattus norvegicus kynurenine 3-hydroxylase mRNA, complete cds with an identity of 90% and EMBL Acc. No Y1.3153JHSKYNU3MO: Homo sapiens mRNA for kynurenine 3-monooxygenase with an identity of 82%.
  • Clone 18 is composed of the T7 and BGH sequences. The overall sequence is given under Contig. Clone 18 shows homology to Genbank Acc. No AW109849.11 AW109849: MT2475 mouse liver, dioxin treated Mus musculus cDNA clone MT24753 'with an identity of 94%; Genbank Acc. No AA277327.1
  • Clone 19 shows homology to DDBJ Acc. No AB005451
  • AB005451 Mus musculus mRNA for RST, complete cds with an identity of 92%.
  • Clone 20 shows homology to Genbank Acc. No AA109018
  • Clone 21 shows homology to the following database entries: Genbank Acc. No M12673JRATGNPAS: RATGNPAS Rat guanine nucleotide-binding protein G-s, alpha subunit mRNA complete cds with an identity of 87% and EMBL Acc. No Y00703
  • MMGTPAMU Mouse uncoupled S49 cells mRNA for stimulatory GTP-binding protein alpha subunit with an identity of 87%; Genbank Acc. No M17525JRATBPGTPD: RATBPGTPD Rat GTP-binding protein (G-alpha-8) mRNA, complete cds with an identity of 87%; Genbank Acc. No AF116268
  • AF116268 Mus musculus G-protein XLAS (Xlas) mRNA, altematively spliced, complete cds with an identity of 94%.
  • Clone 22 shows homology to the following database entries: Genbank Acc. No AF061026
  • AF061026 Mus musculus leucine zipper-EF-hand containing transmembrane protein 1 (Letml) mRNA, complete cds with an identity of 93-95%.
  • Clone 23 shows homology to the following database entries: Genbank Acc. No AA086895JAA086895: mk19c02.r1 Soares mouse p3NMF19.5 Mus musculus cDNA clone 4933465 'similar to WP: F17C11.8 CE05655 and to Genbank Acc. No AA881548
  • Clone 24 shows homology to Genbank Acc. No U22465
  • MMU22465 Mus musculus Na / Pi-cotransporter (NaPi-7) mRNA, complete cds with an identity of 93% and to Genbank Acc. No L33878
  • MUSSPT Mus musculus renal sodium phosphate (Na + / Pi) transporter mRNA complete cds with an identity of 93%.
  • Clone 25 shows homology to Genbank Acc. No AF049882: Rattus norvegicus metastasis suppressor homolog (KAU) mRNA, complete cds and for DDBJ Acc.No D14883
  • MUSC33R2IA Mouse mRNA for C33 / R2 / IA4, complete cds with an identity of 94%.
  • C33-induced apoptosis is mediated by the induction of oxygen radicals, which lead to proapoptotic activation of mitochondria. These oxygen radicals are not generated by the mitochondrial respiratory chain, since cells with a genetic defect in the respiratory chain still respond to C33 expression with apoptosis.
  • the proapoptotic activity of C33 is not dependent on substrate or cell-cell interaction, since suspension cells also become apoptotic by C33.
  • the rapid kinetics of the apoptosis induction of C33 also differs from the previously claimed proapoptotic effects of C33.
  • an extracellular loop in C33 which apparently is responsible for the substrate interaction, is not necessary for the induction of apoptosis.
  • Clone 26 shows homology to Genbank Acc. No U50987
  • BTU50987 Bos taurus succinate-ubiquinone reductase membrane anchor subunit precursor QPs3 mRNA, complete cds with an identity of 86%
  • DDBJ AB006202 Homo sapiens mRNA for cytochrome b small subunit of complex II, complete cds with an identity of 82%.
  • Clone 27 shows homology to Genbank Acc. No M31775
  • MUSCYTB558 Mouse cytochrome beta-558 mRNA, 3 'end with an identity of 88%.
  • Clone 28 shows homology to Genbank Acc. No U76253 J MMU76253: Mus musculus E25B protein mRNA, complete cds with an identity of 88%.
  • Clone 29 shows homology to EMBL Acc. No Z98200.81 HS1 1 1 B22: Human DNA sequence from clone RP1-1 1 1 B22 on chromosome 6q16-21 Contains a novel pseudogene, a pseudogene similar to ribosomal protein L3, ESTs, STSs, GSSs and CpG Islands, complete sequence [ Homo sapiens] with an identity of 85% and Genbank Acc.
  • Clone 30 shows homology to the following database entries: Genbank Acc. No AI1 15883
  • AI31 5450 uj46g05.y1 Sugano mouse liver mlia Mus musculus cDNA clone IMAGE-.1 923032 5 ', mRNA sequence [Mus musculus] with an identity of 89%; Genbank Acc. No AI01 96781 AI01 9678: ua92d1 1 .r1 Soares mouse mammary gland NbMMG Mus musculus cDNA clone 1 364949 5 'with an identity of 89%;
  • Clone 32 shows homology to Genbank Acc. No U071 59
  • MMU071 59 Muscle medium-chain acyl-CoA dehydrogenase mRNA, complete cds with an identity of 94%.
  • Clone 33 shows homology to Genbank Acc. No M761 31 ⁇ MUSEF2: Mouse elongation factor 2 (ef-2) mRNA, 3 'end with an identity of 89)%.
  • Clone 34 shows homology to Genbank Acc. No AF072757 J AF072757: Mus musculus fatty acid transport protein 2 mRNA, complete cds with an identity of 96%.
  • Clone 35 shows homology to EMBL Acc. No X76453 J RNHREV1 07: R.norvegicus (Sprague Dawley) H-rev107 mRNA with an identity of 90% and EMBL Acc. No X92814J HSHREV107: H. sapiens mRNA for rat HREV107-Iike protein with an identity of 85%.
  • Clone 36 shows homology to Genbank Acc. No AW107362.1
  • Clone 37 shows homology to the following database entries: Genbank Acc. No AI31 5920
  • GIANT LARVAE HOMOLOGUE mRNA sequence [Mus musculus] with one Identity of 87%; Genbank Acc. No A1315072 J AI315072: uj ' 23e1 1.x1 Sugano mouse kidney mkia Mus musculus cDNA clone IMAGE: 1920812 3', mRNA sequence [Mus musculus] with an identity of 94%; Genbank Acc.
  • MMHC213L3 Mus musculus major histocompatibility locus class III regions Hsc70t gene, partial cds; smRNP, G7A, NG23, MutS homolog, CLCP, NG24, NG25, and NG26 genes, complete cds; and unknown genes with an identity of 82-96%; Genbank Acc.
  • MMHC425O18 Mus muscle major histocompatibility complex region NG27, NG28, RPS28, NADH oxidoreductase, NG29, KIFC1, Fas-binding protein, BING 1, tapasin, RalGDS-like, KE2, BING4, beta 1, 3-galactosyl transferase, and RPS18 genes with an identity of 82%.
  • Clone 39 shows homology to Genbank Acc. No AA763399 J AA763399: vw53h02.r1 Soares mouse mammary gland NMLMG Mus musculus cDNA clone 1247571 5 'similar to WP: F32D8.4 CE05783 LACTATE DEHYDROGENASE with an identity of 96%.
  • Clone 40 shows homology to Genbank Acc. No U00677
  • U00677 Mus musculus syntrophin-1 gene, complete cds with an identity of 92%.
  • Clone 41 shows homology to Genbank Acc. No AC003043 J AC003043: Homo sapiens chromosome 17, clone HRPC1067M6, complete sequence [Homo sapiens] with an identity of 87% and to Genbank Acc. No AA109006
  • Clone 42 shows homology to Genbank Acc. No U30838
  • MMU30838 Mus musculus voltage dependent anion Channel 2 mRNA, nuclear gene encoding mitochondrial protein, complete cds with an identity of 94% as well as Genabank Acc. No L08666 J HUMPORIN: Homo sapiens porin (por) mRNA, complete cds and truncated cds with an identity of 94%:
  • Clone 43 shows homology to the following database entries: Genbank Acc. No M27071 J MUSDIS2M1 A: Mus muscle protein phosphatase type 1 (dis2m1) mRNA, complete cds with an identity of 92%; Genbank Acc. No U53456
  • MMU53456 Muscle protein phosphatase 1 cgamma (PP1 cgamma) mRNA, complete cds with an identity of 98-100%; EMBL Acc. No X56438 J DMPP1A1: D.melanogaster PP1 -alpha 96A gene for protein phosphatase 1 with an identity of 80%; Genbank Acc.
  • Clone 44 shows homology to Genbank Acc. No U52842
  • MMU52842 Muscle kidney-specific transport protein mRNA, complete cds with an identity of 99% and on DDBJ Acc. No AB004559] AB004559: Rattus norvegicus mRNA for multispecific organic anion transporter, complete cds with an identity of 93%.
  • Clone 45 shows homology to the following database entries: Genbank Acc. No AF080252 J AF080252: Mus muscle serine / threonine protein kinase 51 PK (S) mRNA, complete cds with an identity of 94%; Genbank Acc. No AF080253
  • AF080253 Mus muscle serine / threonine protein kinase 51 PK (L) mRNA, complete cds with an identity of 94%; DDBJ Acc. No AB000449 J AB000449: Homo sapiens mRNA for VRK1, complete cds with an identity of 83%.
  • Clone 46 shows homology to the following database entries: Genbank Acc. No J04806 j MUSOSP: Muscle osteopontin mRNA, complete cds with an identity of 95%; EMBL Acc. No X1 3986
  • MMPONTIN Mouse mRNA for minopontin with an identity of 96%; EMBL Acc. No X 1 61 51
  • MMETA1 Mouse mRNA for early T-lymphocyte activation 1 protein (ETa-1) with an identity of 95%; Genbank Acc.
  • Clone 47 shows homology to DDBJ Acc. No AB006451
  • AB006451 Rattus norvegicus mRNA for Tim23, complete cds with an identity of 94% and Genbank Acc. No AF0301 62 J AF0301 62: Homo sapiens inner mitochondrial membrane translocase Tim23 (TIM23) mRNA, nuclear gene encoding mitochondrial protein complete cds with an identity of 89%.
  • Clone 48 shows homology to DDBJ Acc. No D38549 J HUMHA1025A: Human mRNA for KIAA0068 genes, partial cds with an identity of 86% and to Genbank Acc. No AF072697 J AF072697: Mus muscle SHYC (Shyc) mRNA, complete cds with an identity of 96%.
  • Clone 49 shows homology to Genbank Acc. No U07971 j
  • RNU07971 Rattus norvegicus Sprague-Dawley L-arginine: glycine amidinotransferase mRNA, partial cds with an identity of 85%.
  • Clone 50 shows homology to DDBJ Acc.
  • No AU035342 j AU035342 Sugano mouse brain mncb Mus musculus cDNA clone MNCb-0343, mRNA sequence [Mus musculus] with an identity of 87% and to Genbank
  • Clone 51 shows homology to Genbank Acc. No M22998
  • MUSGLUTRN: MUSGLUTRN Mouse facilitated glucose transport protein mRNA, complete cds with an identity of 93% as well as Genabnk Acc. No S77924J S77924: Glut-1 glucose transporter isoform 1 [mice, embryo, mRNA partial, 321 nt] with an identity of 93%.
  • Clone 52 shows homology to EMBL Acc. No AJ010953
  • HSA010953 Homo sapiens mRNA for putative Ca2 + -transporting ATPase, partial with an identity of 79%.
  • Clone 53 shows homology to Acc. No U94593: Mus muscle uncoupling protein homolog (UCPH) mRNA.
  • Clone 54 shows homology to Acc. No M2731 5.1: Rattus norvegicus mitochondrial cytochrome c oxidase subunits I, II and III, and ATPase subunit 6 genes, complete cds.
  • Clone 55 is composed of the T7 and BGH sequences. The total sequence is given under total sequence.
  • Clone 12 shows homology to the following database entries: Acc. No AL080317.1 1: Human DNA sequence from clone RP5-1 1 12D6 on chromosome 6q21-22.2. Contains the gene for a PUTATIVE novel protein similar to bacterial NARK (nitrite extrusion protein, nitrite facilitator), the 3 'end of the REV3L gene for REV3 (yeast homologHike, catalytic subunit of DNA polymerase zeta (EC 2.7.7.7, POLZ), ESTs, STSs, GSSs and a putative CpG island, complete sequence.
  • Clone 56 shows homology to Acc. No AW106096.1: um23a10.y1 Sugano mouse embryo mewa Mus musculus cDNA clone 1MAGE: 2225370 5 ', mRNA sequence.
  • Clone 57 shows homology to Acc. No NM_000210.1 Homo sapiens integrin, alpha 6 (ITGA6) mRNA.
  • Clone 58 shows homology to Acc. No AW106096. 1: um23a 10.y1 Sugano mouse embryo mewa Mus musculus cDNA clone IMAGE: 2225370 5 ', mRNA sequence.
  • Clone 59 shows homology to Acc. No NM_007748.1: Mus muscle cytochrome c oxidase, subunit VI a, polypeptide 1 (Cox6a1), mRNA.
  • Clone 60 shows homology to Acc. No AC005403.1: Mus musclulus clone UWGC: ma53a068 from 14D1 -D2 (T-Cell Receptor Alpha Locus), complete sequence.
  • Clone 61 shows homology to Acc. No L07095.1: Mus domesticus strain NZB / B1 NJ mitochondrion genome, complete sequence.
  • Clone 62 shows homology to Acc. No NM_0091 55.1: Mus muscle selenoprotein P, plasma, 1 (SeppD, mRNA complete cds.
  • Clone 63 shows homology to Acc. No J03297.1: Mouse ERp99 mRNA encoding an endoplasmic reticulum transmembrane protein.
  • Clone 64 shows homology to Acc. No AF047431 .1: Homo sapiens AAPT1-Iike protein mRNA, partial cds.
  • Clone 65 shows homology to EMBL Acc. No U79287 Human clone 23867 mRNA sequence 1 396 bp.
  • Clone 66 shows homology to Acc. No C88489, AA073437, AI048028 and to ESTs with the DDBJ Acc. No C88489; Genbank Acc. No AA073437; AI048028.
  • Clone 67 shows homology to Acc. No AK001441: Homo sapiens cDNA FLJ 10579 fis, clone NT2RP2003446 2251 bp mRNA and to ESTs with the Acc. No AI663355 and AU080732.
  • Clone 68 shows homology to Acc. No AF005038: Homo sapiens Secretory Carrier Membrane Protein (SCAMP2) mRNA
  • Clone 69 shows homology to Acc. No U44731: Putative purine nucleotide binding protein mRNA muscle.
  • Clone 71 shows homology to Acc. No NM_004256: Homo sapiens organic cationic transporter-like 3 (ORCTL3) mRNA.
  • Clone 72 shows homology to Acc. No AK000559: Homo sapiens cDNA FLJ20552 fis, clone KAT1 1 732.
  • Clone 73 shows homology to Acc. No X89968: Rattus norvegicus mRNA for alpha-soluble NSF attachment protein.
  • Clone 74 shows homology to Acc. No D851 37: Mouse mRNA for PPI gamma (protein phosphatasel gamma).
  • Clone 75 shows homology to Acc. No NM_001089: Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 (ABCA3) mRNA.
  • Clone 76 shows homology to mouse ESTs with the Acc. No AI315969, AI930239, A1666299 and AV141 103.
  • Clone 77 shows homology to Acc. No AB025405: Mus musculus mRNA for sid2895p (Mouse microsomal signal peptidase)
  • Clone 78 shows homology to Acc. No AK000427.
  • the clone is partially homologous to: Homo sapiens cDNA FLJ20420 fis, clone KAT02462.
  • Clone 79 shows homology to Acc. No NM_009127: Mus musculus stearoyl-Coenzyme A desaturase 1 (Scd1)
  • Clone 80 shows homology to Acc. No U21049: Human DD96 mRNA (a gene selectively upregulated in human carcinomas).
  • Clone 81 shows homology to Acc. No AF070626 or AB020980: Homo sapiens clone 24483 unknown mRNA (AF070626), or Homo sapiens mRNA for putative membrane protein (AB020980).
  • Clone 82 shows partial homology to Acc. No U92989: Homo sapiens clone DT1 P1 E1 1 mRNA, CAG repeat region.
  • Clone 83 shows homology to Acc. No AF035208: Mus muscle putative v-SNARE Vtil b mRNA (soluble NSF attachment protein receptor).
  • Clone 84 shows homology to Acc. No NM_012504: Rattus norvegicus ATPase, Na + K + transporting, alpha 1 polypeptide (Atp1 a1), mRNA.
  • Clone 85 shows homology to Acc No NM_007749: Mus musculus cytochrome c oxidase subunit Vllc (Cox7c), mRNA.
  • Clone 86 shows homology to Acc No AF079565: Mus ubiquitin-specific protease UBP41 (Ubp41) mRNA.
  • Clone 87 shows homology to Acc No AJ006341: Mus musculus mRNA for peroxisomal integral membrane protein PMP34.
  • Clone 88 shows homology to Acc No AF223950: Mus musculus TIM22 preprotein translocase (Tim22) mRNA, complete cds; nuclear gene for mitochondrial product.
  • Clone 89 shows homology to Acc No NM_01 1479: Mus muscle serine palmitoyltransferase, long chain base subunit 2 (Sptlc2), mRNA.
  • Clone 90 shows homology to Acc No M23984: Rat mitochondrial proton / phosphate symporter mRNA, complete cds and Acc. No X60036: H. sapiens mRNA for mitochondrial phosphate carrier protein.
  • Clone 91 shows homology to Acc No AF1 13127: Homo sapiens S1 R protein (S1 R) mRNA, complete cds (human cowpox virus homolog).
  • Clone 92 is composed of the T7 and BGH sequences. The entire sequence is shown as a merging of several EST sequences (“EST assembly”) in Contig. Clone 92 shows homology to UniGene Mm.86545.
  • Clone 93 shows homology to human genomic DNA (PAC 69E1 1 on chromosome 1 q23-24).
  • Clone 94 shows homology to Acc No NM_01 1512: Mus musculus surfeit gene 4 (Surf4), mRNA.
  • Clone 95 is composed of the T7 and BGH sequences. The entire sequence is shown as a combination of several EST sequences (“EST assembly”) under total cDNA EST clusters. Clone 95 shows homology to UniGene: Mm.27841 (mouse) and Hs.100132 (human).
  • Clone 96 shows homology to UniGene Hs.133494, Mm.31778 and Rn.1 1778.
  • Clone 97 shows homology to Acc No AF192558: DEFINITION Mus musculus domesticus mitochondrial carrier homolog 1 isoform b (Mtchl) mRNA, complete cds; nuclear gene for mitochondrial product and Acc.
  • No AF192558 / AF192559 Homo sapiens mitochondrial carrier homolog 1 isoform b (MTCH1) mRNA, partial cds; nuclear gene for mitochondrial product.
  • Clone 98 shows homology to Acc No NM_016783: Mus musculus progesterone receptor membrane component (Pgrmc-pending), mRNA.
  • Clone 99 shows homology to Acc No NM_003002: Homo sapiens succinate dehydrogenase complex, subunit D, integral membrane protein (SDHD) mRNA.
  • Clone 100 shows homology to Acc No U95822: Human putative transmembrane GTPase mRNA, partial cds.
  • Clone 101 shows homology to Acc No X99963: M. musculus rhoB gene.
  • Clone 102 shows homology to Acc No AF161 525: Homo sapiens HSPC177 mRNA, complete cds.
  • the gene contains a BH3 domain that is found in many Bcl-2-like genes. Genes with such "BH3-only" domains are pro-apoptotic and have the evolutionarily conserved function of inducing apoptosis. The experiments showed that CGl-135 with Bcl-2 gene family members can interact.
  • the BH3 domain is necessary for efficient apoptosis induction by CGl-135.
  • Clone 103 shows no homology to known sequences.
  • Clone 104 shows homology to Unigene Acc No AW682500.30119 Mm.30119jMm.30119: Mus musculus cDNA with an identity of 91%.
  • Clone 105 shows homology to EMBL Acc No X98475.1 jMMVASP: M. musculus VASP gene with an identity of 90%.
  • Clone 106 shows homology to EMBL Acc No X03369.1
  • RNTUBB15 Rat mRNA for beta-tubulin T beta15 with an identity of 90%.
  • Clone 107 shows homology to Genbank Acc No BE226644.1 JBE226644: ia23h11.y1 Mouse E10 5 12 5 Pancreas cDNA Library Mus musculus cDNA 5 'similar to SW: NUML_BOVIN Q01321 NADH-UBIQUINONE OXIDOREDUCTASE MLRQ SUBUNIT with an identity of 87%.
  • Clone 108 shows homology to Genbank Acc No AF157317.1
  • AF157317 Homo sapiens AD-015 protein mRNA, complete cds with an identity of 83%.
  • Clone 109 shows homology to Genbank Acc No M88136.1
  • CRUSTSTA Cricetulus griseus seryl tRNA synthetase mRNA, partial cds with an identity of 91%.
  • Clone 110 lacks homology to known sequences.
  • Clone 111 shows homology to Genbank Acc No AW106096.27359 j Mm.27359: um23a10.y1 Mus musculus cDNA, 5 'end with an identity of 99%.
  • Clone 112 shows homology to Genbank Acc No AI413025.1
  • Clone 113 shows homology to EMBL Acc No Human DNA sequence from clone RP3-402G11 on chromosome 22q13.31 -13.33 "Contains the MAPK12 gene for mitogen activated protein kinase 12 (SAPK3), the MAPK11 gene for mitogen activated protein kinase 11 (PRKM11) gene KIAA0315, the gene for a novel protein "with an identity of 86%.
  • SAPK3 mitogen activated protein kinase 12
  • PRKM11 mitogen activated protein kinase 11
  • Clone 114 shows homology to DDBJ Acc No AK000823.11 AK000823 Homo sapiens cDNA FLJ20816 fis, clone ADSE00693 with an identity of 88%.
  • Clone 115 shows homology to Genbank Acc No AF007152.11 AF007152 Homo sapiens clone 23649 and 23755 unknown mRNA, partial cds with an identity of 83%.
  • Clone 116 shows homology to EMBL Acc No X66370.1 JRNRPS9 R. norvegicus mRNA for ribosomal protein S9 with an identity of 94%.
  • Clone 117 shows homology to Genbank Acc No BE161116.11 BEI 61116 PM3-HT0424-170200-001-b 11 HT0424 Homo sapiens cDNA with an identity of 100%.
  • Clone 118 shows homology to DDBJ Acc No AK000559.1 JAK000559 Homo sapiens cDNA FLJ20552 fis, clone KAT11732 with an identity of 86%.
  • Clone 119 shows homology to RefSeq Acc No NM_003713.1
  • Clone 120 shows homology to Genbank Acc No M30773.1 (HUMCNR: Human calcineurin B mRNA, complete cds with an identity of 88%.
  • Clone 121 shows homology to RefSeq Acc No NM_013770.1 or Genbank Acc. No AF188712.KAF188712: Mus muscle solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 10 (Slc25a10), mRNA and Mus muscle mitochondrial dicarboxylate carrier mRNA, complete cds; nuclear gene for mitochondrial product with an identity of 98%.
  • Clone 122 shows homology to RefSeq Acc No NM_008525.1: Mus musculus delta-aminolevulinate dehydratase (Lv), mRNA with an identity of 100%.
  • Clone 123 shows homology to Genbank Acc No M59861.
  • KRAT10HCO Rattus norvegicus 10 formyltetrahydrofolate dehydrogenase mRNA, complete cds with an identity of 93%.
  • Clone 124 shows homology to the following database entries: EMBL Acc No X00525.1 (MMRNA02: Mouse 28S ribosomai RNA with an identity of 84%; Genbank Acc. No AF061799.KAF061799: Hydrolagus colliei internal transcribed spacer 1, partial sequence; 5.8S ribosomai RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomai RNA gene, partial-sequence with an identity of 83%; Genbank Acc. No AF061800.1 (AF061800: Squalus acanthias internal transcribed spacer 2; and 28S ribosomai RNA gene, partial sequence with an identity of 83%.
  • Clone 125 shows homology to RefSeq Acc. No NM_007469.1: Mus muscle apolipoprotein Cl (Apod), mRNA as well
  • AK011358.1 AK011358 Mus musculus 10 days embryo cDNA, RIKEN full-length enriched library, clone: 261 0009E08, fill insert sequence with an identity of 1 00%.
  • Clone 1 27 shows homology to Genbank Acc. No AK007676: Mus musculus 10 day old male pancreas cDNA, RIKEN full-length enriched library, clone: 1 81 0032P22, fill insert sequence with an identity of 1 00%; to Genbank Acc. No BC002242: Mus musculus, Similar to sorting nexin 5, clone MGC: 7534, mRNA, complete cds with an identity of 100% and Genbank Acc. No AC008066: Homo sapiens BAC clone RP1 1 -293D9 from 8, complete sequence.
  • Clone 1 33 shows homology to Genbank Acc. No AK01 5068.1 J AK01 5068: Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone: 4930403O06, fill insert sequence with an identity of 90% and to DDBJ Acc. No AK004504.1 1 AK004504: Mus musculus 18 days embryo cDNA, RIKEN full-length enriched library, clone: 1 1 90006A08, fill insert sequence
  • Clone 1 34 shows homology to Genbank Acc. No BC002108.1 ⁇ BC002108: Mus musculus, Similar to ribosomai protein
  • Clone 140 shows homology to DDBJ Acc. No AK008346.1
  • Clone 141 shows no homology to known sequences.
  • Clone 1 44 shows homology to Genbank Acc. No AF006482.1 J AF006482 Mus nucleoside triphosphatase muscle (NTPase) mRNA, complete cds with 99% identity; to Genbank Acc. No AF084569. 1
  • AF084569 Mesocricetus auratus cph proto-oncogene product (cph) mRNA, complete cds with an identity of 90%.
  • Clone 145 shows homology to DDBJ Acc. No AK002787.1 J AK002787 Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone: 0610038B1 2, fill insert sequence with an identity of 1 00%; to DDBJ Acc. No AK010989.1
  • Clone 146 shows homology to Refseq Acc. No NM_025278.1
  • apoptosis-inducing genes identified by the genetic screen are listed in Table 1 (pages 1 - 125) attached as an illustration:
  • Table 1 The information in Table 1 is defined as follows:
  • BLAST Altschul et al. (1,997), Nucleic Acids Res. 25: 3389-3402).
  • partially identical sequences identity of preferably ⁇ 85% are also given, which show allelic variants of the specifically shown sequence or homologous sequences from other species, in particular from humans.
  • PSORT II (Nakai, K. and Kanehisa, M., Genomics 14: 897-91 1 (1 992)) determines possible properties and the localization in the resulting peptide from the sequence Cell with a predicted probability.
  • PSORT II (Nakai, K. and Kanehisa, M., Genomics 14: 897-91 1 (1 992)) determines possible properties and the localization in the resulting peptide from the sequence Cell with a predicted probability.
  • PSORT II (Nakai, K. and Kanehisa, M., Genomics 14: 897-91 1 (1 992)
  • PI-Facs Propidium iodide-Facs “: Detection for apoptosis (Bitzer et al. (1999) J. Virol. 73: 702-708)
  • apoptosis-induced genes identified by the genetic screen (clones 1-124, 125, 127, 133, 134, 140, 141, 144, 145, 146) are listed in Table 2 (pages 1-28) attached as an illustration.
  • BGH sequence AAATATCACA GGGCCNTGNT AGCCTGCTNT TCCCTCTTCT TCTTCTTCTA NTGGAANCCG AAGNTACCAT NNCGNTTCTT ANCAGTTTCT CCTTTCGGCC NCCNACCCAG TGGCATGGAA GAGAGCGAGG CAGCTGGCTT GAATTCCCAT CTTCTGGGGA ACCTTTGCAG CCTGCAGGGG CCTGGCCATC TTCTTTGCGA CATTTCTTAC AGCCTGGANC CATGATCGTG CTGAGCAACA TTGGCAGCCT GGTCTCATGT TTCTGG TACTTTTTGA CAAGAGCCCT CTTTGTCTCT GGATCGCGAC TTCTGTGTAT GGAGCCTCAA TGGCAGCCAC GTTTCCCAGC GGCATCTCCT GGATTGAGCA GTACNCCNCC TTAACTGGGA AATCTGCAGC ATTCTTTGTA ATTGGCTCTG CCCTGGGAGA TATGGCCATTCCAGCGGTGA TCGGAATTCT
  • Running clone number # 13 ACCESS No .: AL080317.11 G ⁇ .5830430 Definition: Human DNA sequence from äone RP5-1 12D6 on chromosome 6q2 -22.2. Contains the gene for a PUTATIVE novel protein similar to bacterial NARK (nitrite extrusion protein, nitrite facilitator), the 3 'end of the REV3L gene for REV3 (yeast homolog) -like, catalytic subunit of DNA polymerase zeta (EC 2.7.7.7, POLZ), ESTs, STSs, GSSs and a putative CpG island, complete sequence.
  • Running clone number # 20 (EST) ACCESS No .: AW106096.1 Gl: 6076832 Definition: um23a10.y1 Sugano mouse embryo mewa Mus musculus cDNA clone
  • BGH sequence GACCTGGCTT TNGCNCGCNN TNCANCCCTA GTCCCCCGGG TTCTCACTCC CTAAGCCCAT CGCAGNCCGG NTNGTGGANC CGCGCGTCCC AGGNTTCGTC CTTNCNCGGC CTNCAAGAAC ATGGCTTGCT TCAGAAAGAA AATAGTTTTG TCTTCTCTAA NAACTTACNT TCAGCTTGTC GAAGATGAAA ATAAAAAGCC CTGGAGAGGA ATAATTTCTT GCNCTTTATG AATCTATTTT TAAAATAAAA AAATTTACCN NCTTTNAATC TTTTTCCTCC TCNCAAAAGN AACCAGTATT TTTGCCTNCC ATTCANTTTG CNNCANTAAG ANNTTTGGAG CCTGAAACCN NAGNCTTTNT NANGGANTNT CNCCTTGGTT CAGCCTGNAG GCAAATCTGA TCAACGGACC TTTATGAGTC ATTTTTCCTA GACATATTCA GAAAACCTAG GAGCTGTGTC AAATGCCTGA ATT
  • LOCUS Mus musculus selenoprotein P, plasma, 1 (Seppl), mRNA complete cds.
  • BGH sequence TTTTTTTTTTNTNGATATTAGNTANGTTTTATTATTTNTTATCTNTATGAGGAAGGGGTATCCCAGACAGGGAGACTGNTGAG
  • Running clone number UI-14 ACCESS No .: NM_004256 Definition: Homo sapiens organic cationic transporter-like 3 (ORCTL3) mRNA.
  • ORCTL3 Homo sapiens organic cationic transporter-like 3
  • T7 sequence TTCACCCCGCTTGGTACCGAGCTCGGATCCCTAGTAACGGCCGCCAGTGTGCTGGAAAGATGGAGCCTGCGTTTCACAGA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des séquences d'acides nucléiques associées à l'apoptose, provoquant notamment l'apoptose, des polypeptides codés par lesdites séquences, et l'utilisation desdites séquences pour la préparation d'agents diagnostiques et thérapeutiques. L'invention concerne par ailleurs des systèmes cellulaires, des animaux transgéniques, et l'utilisation de ceux-ci pour l'étude génétique et/ou pharmacologique de maladies associées à l'apoptose.
EP01954041A 2000-07-14 2001-07-13 Sequences d'adn provoquant l'apoptose Withdrawn EP1349929A2 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DE10034303 2000-07-14
DE10034303 2000-07-14
DE10126344 2001-05-30
DE10126344A DE10126344A1 (de) 2000-07-14 2001-05-30 Apoptose-induzierende DNA-Sequenzen
PCT/EP2001/008170 WO2002006479A2 (fr) 2000-07-14 2001-07-13 Sequences d'adn provoquant l'apoptose

Publications (1)

Publication Number Publication Date
EP1349929A2 true EP1349929A2 (fr) 2003-10-08

Family

ID=26006388

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01954041A Withdrawn EP1349929A2 (fr) 2000-07-14 2001-07-13 Sequences d'adn provoquant l'apoptose

Country Status (3)

Country Link
EP (1) EP1349929A2 (fr)
AU (1) AU2001276406A1 (fr)
WO (1) WO2002006479A2 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8486428B2 (en) 2006-03-27 2013-07-16 Board Of Regents, The University Of Texas System Compositions and methods for making and using acyclic N-halamine-based biocidal polymeric materials and articles
BR112015022872A2 (pt) 2013-03-13 2017-11-07 Harvard College polipeptídeos grampeados e costurados, seu uso, seu método de preparação, composição que os compreende e aminoácido

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1139871A (zh) * 1993-11-30 1997-01-08 Lxr生物技术有限公司 新细胞程序死亡调节蛋白质、编码该蛋白质的dna以及使用该蛋白质的方法
WO2001012660A2 (fr) * 1999-08-17 2001-02-22 Sagami Chemical Research Center Proteines humaines a domaines hydrophobes et adn codant pour ces proteines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0206479A3 *

Also Published As

Publication number Publication date
AU2001276406A1 (en) 2002-01-30
WO2002006479A2 (fr) 2002-01-24
WO2002006479A3 (fr) 2003-07-17

Similar Documents

Publication Publication Date Title
Nuell et al. Prohibitin, an evolutionarily conserved intracellular protein that blocks DNA synthesis in normal fibroblasts and HeLa cells
Levitan et al. par-2, a gene required for blastomere asymmetry in Caenorhabditis elegans, encodes zinc-finger and ATP-binding motifs.
Kleinjan et al. Conserved elements in Pax6 intron 7 involved in (auto) regulation and alternative transcription
DE60132075T2 (de) Wnt-1 verwandte polypeptide und dafür kodierende nukleinsäuren
DE69534733T2 (de) NEUARTIGE AUF p53 ANSPRECHENDE GENE
DE69838905T2 (de) Transkriptionsfaktor islet-brain 1 (ib1)
US6251667B1 (en) Camp-responsive transcriptional enhancer binding protein
Hu et al. A 2.5-Mb transcript map of a tumor-suppressing subchromosomal transferable fragment from 11p15. 5, and isolation and sequence analysis of three novel genes
DE69926764T2 (de) Methoden zur bestimmung von komponenten zur modulation des körpergewichts
US5753434A (en) Methods and compositions for altering sexual behavior
DE69635349T2 (de) Nukleotidsequenzen, proteine, medikamente und diagnoseagentien zur anwendung in krebsbehandlung
EP1469316B1 (fr) Procédé de criblage
WO2003058021A2 (fr) Nouvelles sequences d'adn induisant l'apoptose
WO2002006479A2 (fr) Sequences d'adn provoquant l'apoptose
AU770685B2 (en) Human neurogenin 3-encoding nucleotide sequences
DE10126344A1 (de) Apoptose-induzierende DNA-Sequenzen
US5840532A (en) Neuronal bHLH-PAS domain proteins
DE69838565T2 (de) Nukleinsäuren von CIITA Genen
DE10139874A1 (de) Humane Mater-Proteine
WO2002053729A1 (fr) Proteines bhlh, leurs genes et leurs utilisations
Milhon et al. SmMAK16, the Schistosoma mansoni homologue of MAK16 from yeast, targets protein transport to the nucleolus
DE69823022T2 (de) Neues, menschliches tumorsuppressorgen.
DE60021421T2 (de) APOPTOSE-HEMMENDES POLYPEPTID, FüR DIESES KODIERENDE GENE UND POLYNUKLEOTIDE UND DIESE BEINHALTENDE ZUSAMMENSETZUNGEN
US6825034B2 (en) Human RRN3 and compositions and methods relating thereto
AU2002324283B2 (en) Variants and exons of the GlyT1 transporter

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030114

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20040130

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20051202