Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

• the present invention relates to the detection of
• Mycobac teri um tubercul osi s for the diagnosis of tuberculosis in a patient.
• the detection method of the invention is based on the research in a biological sample of a patient of an intein specific for Mycobacteri um tubercul osis.
• the invention also relates to a kit for implementing said method.
• Mycobacteri um tubercul osi s is a strict human pathogen also capable of infecting some animal species living alongside it. It is the agent responsible for human tuberculosis. Infection, mainly by air, most often manifests as a lung infection.
• Tuberculosis is one of the most fatal infections, and it has been reported that the number of deaths increases each year by 10% (Bloom and Murray, Science (1992), 257, 1055-64). Tuberculosis is a public health problem because not only is a large number of children in developing countries already infected or will be infected before reaching adulthood, but tuberculosis is also one of the opportunistic infections developed by immunocompromised patients such as AIDS patients. In addition, many strains of Mycobacterium tuberculosis show resistance to various antibiotics (Shankar et al., Lancet (1990), 335, 423-42), which makes treatment all the more difficult.
• Mycobacteri um tuberculosis corresponding for example to the 16S rRNA subunit have been widely described for detecting tuberculosis infections.
• the object of the present invention is precisely to offer new means of rapid, sensitive and specific diagnosis of an infection by Mycobacterium tuberculosis. This object is achieved according to the invention thanks to the detection of one or more specific inteins of Mycobacterium tuberculosis.
• inteins are protein introns which are integrated into proteins. The protein splicing of these introns is necessary for the survival of the organism to which they belong. Thus inteins have been described in Mycobacterium tuberculosis in the proteins RecA, Ppsl and DnaB.
• US Patent No. 5,795,731 reports a method of screening for antibiotics or antifungals capable of inhibiting protein splicing of the RecA intein from Mycobacteri um tubercul osis, but this document does not relate to a diagnostic method.
• this antibiotic screening method involves the prior cloning of the RecA intein into a reporter gene. It is a relatively cumbersome method to implement which also requires a cell culture step.
• inteins of Myc oba c t eri um tubercul osis are more particularly inteins capable of being present in several types of mycobacteria but whose localization is specific to Mycobacterium tuberculosis.
• the work carried out within the framework of the present invention has made it possible to identify several inteins whose localization is specific for Mycobacteri um tubercul osis. These are, for example, inteins localized at: - the ppsl site (b) of the nucleotide sequence coding for Ppsl (accession no. 2791395),
• the RecA intein from Mycobacterium tuberculosis is localized at the recA site (a) while the RecA inteins from Mycobacterium leprea, M. chitae, M. fallax, M. flavescens, M. gastri, M. thermoresistibile, M. shimoidei, when present, are located at the recA (b) site as shown in Table 1 below.
• the sequence of the recA gene of Mycobacterium tuberculosis without intein is represented in the sequence list in the appendix under SEQ ID No. 1, and the sequence of the corresponding protein is represented in the sequence list in the appendix under SEQ ID No. 2
• This sequence includes without the intein gene 1053 nucleotides.
• the recA site (a) at which the intein of the MyAcobacterium tuberculosis recA gene is inserted is located between the nucleotides at positions 753 and 754.
• the gene sequence of the intein of the recA gene of Mycobacterium tuberculosis comprises 1320 nucleotides and is represented in the sequence list in the appendix under the number SEQ ID No.
• sequence of the recA gene of Mycobacterium tuberculosis comprising the gene for the intein is represented in the sequence list in the appendix under SEQ ID No. 5 and the sequence of the corresponding protein is represented in the sequence list in the appendix under SEQ ID No. 6. This sequence comprises 2373 nucleotides.
• the recA (a) integrin of Mycobacterium tuberculosis appears to be a multifunctional protein, which is not only capable of protein splicing (Davis et al., Cell (1992), 71, 201-10; Kenneth et al., PNAS (1998), 95, 3543-8), but which also has protein ligase activity.
• Another specific Mycobacterium tuberculosis intein is located in the ppsl gene (Table 2).
• the intein of the ppsl gene of Mycobacterium tubercul osi s is localized at the ppsl (b) site, while the inteins of the pp sl gene of Mycobacteri um l eprea and gas tri are localized respectively at ppsl (a) and ppsl (c).
• the sequence of the pps l gene of Mycobac t eri um tuberculosis without intein is shown in the list of sequences in the appendix under SEQ ID No. 7 and the sequence of the corresponding protein is shown in the list of sequences in the appendix under SEQ ID No. 8.
• the sequence of the ppsl gene of Mycobacterium tuberculosis comprises, without the gene for intein, 1464 nucleotides.
• the ppsl (b) site at which the specific intein is inserted is located between the nucleotides at positions 756 and 757.
• the sequence of the intein gene, Mtu Ppsl comprises 1077 nucleotides and is represented in the list of sequences in annex under the number SEQ ID No. 9 and the sequence of the corresponding protein is represented in the sequence list in the annex under the SEQ ID No. 10.
• the sequence of the ppsl gene of Mycobacterium tuberculosis comprising the gene for the intein is represented in the annexed sequence list under SEQ ID No. 11 and the sequence of the corresponding protein is represented in the annexed sequence list under SEQ ID No. 12.
• the gene sequence comprises 2541 nucleotides.
• the integrin localized in ppsl (b) is a multifunctional protein, which is not only capable of protein splicing and therefore of a protein ligase activity and which also has specific endonuclease activity.
• the Ppsl integrin of Mycobacterium tuberculosis specifically cleaves the DNA sequence overlapping its site of insertion into the ppsl gene (site with a length ⁇ to 40 bp) of the nucleotide sequence represented in the sequence list in the appendix under the number SEQ ID No.
• DnaB also has a specific intein localized specifically in Mycobacterium tuberculosis.
• the DnaB intein from Mycoba ct eri um tubercul osi s is localized at the DnaB site (a) (Table 3), while the DnaB inteins from Mycobacterium leprea and M. avium are localized at DnaB (b) .
• the sequence of the dnaB gene of Mycobac t eri um tuberculosis without intein is shown in the list of sequences in the appendix under SEQ ID No. 13 and the sequence of the corresponding protein is shown in the list of sequences in the appendix under SEQ ID N ° 14.
• the sequence of the dnaB gene of Mycobacterium tuberculosis includes without the gene for intein 1377 nucleotides.
• the dnaB site (a) at which the specific intein is inserted is located between the nucleotides at positions 1197 and 1198.
• the Mtu dnaB integrin gene sequence comprises 1248 nucleotides and is represented in the sequence list in the appendix.
• sequence of the corresponding protein being represented in the sequence list in the appendix under the number SEQ ID No. 15.
• the sequence of the dnaB gene of Mycobac teri um tubercul osis comprising the intein gene is represented in the sequence list in the appendix under SEQ ID No. 17. This sequence comprises 2625 nucleotides.
• sequence of the corresponding protein is represented in the sequence list in the appendix under the number SEQ ID No. 18.
• the intein located in DnaB (a) seems to be a multifunctional protein.
• the research carried out in the context of the present invention has therefore enabled the inventors to design a rapid, specific and sensitive diagnostic method for Mycobacterium tuberculosis based on the specific localization of Mycoba c t eri um tuberculosis inteins.
• the subject of the invention is therefore a method for detecting and / or quantifying Mycobacterium tuberculosis in a sample, characterized in that the presence of an intein inserted at a site whose detection is detected in said sample localization is specific for Mycobacterium tuberculosis using a reagent which is specific for said localization, and possibly in that the detected signal is quantified.
• intein By the method of the invention is meant by intein, both the detection of an intein and of several inteins simultaneously or successively.
• the detection of the presence of a localized intein at a site which is specific for Mycobacterium tuberculosis can be carried out by any biological technique known to those skilled in the art, including or not comparison with controls.
• the invention more particularly contemplates hybridization techniques with labeled probes capable of specifically hybridizing with all or part of the gene coding for an intein if the latter is inserted at a site whose localization is specific for Mycobacterium tuberculosis.
• Such probes can be prepared from the sequences of the gene sites where the sequences coding for the inteins in Mycobacterium tuberculosis are inserted. They are preferably labeled probes capable of hybridizing specifically with: part of the sequence coding for the intein, and
• the presence of the recA gene intein is sought at the recA (a) site of Mycobacterium tuberculosis by the hybridization with a labeled probe capable of hybridizing specifically with part of the sequence coding for the recA intein and a region flanking the recA site (a) where said intein is inserted and the localization of which is specific for Mycobacterium tuberculosis.
• sequences in particular specific primers, regions flanking the insertion site of the specific intein of Myc oba cte ri um tuberculosis.
• techniques amplification we can cite for example PCR, NASBA, rolling circle etc ...
• This form of implementation using the diagnosis by amplification of specific inteins of Mycobacteri um tuberculosis has the advantage of being able to control the result. Indeed, a specific function of the intein whose corresponding gene has been amplified can be tested. This function can correspond for example to the endonuclease activity.
• the specific primers described previously for detection by amplification techniques will be chosen so as to subsequently allow expression in vivo or in vitro of said intein in order to be able to test its specific activity which may correspond to its endonuclease activity.
• the detection of an intein whose localization is specific for Mycobac teri um tubercul osi s allows conclusion and diagnosis of Mycobacterium tuberculosis infection.
• inteins As there are several sites for specific insertion of inteins into the genome of Mycobacterium tuberculosis, the detection of at least two of these specific inteins simultaneously makes it possible to increase the specificity of detection.
• at least three inteins localized specifically in the genome of Mycobacteri um tuberculosis are detected simultaneously.
• a preferred form of implementation of the method of diagnosis of Mycobacterium tuberculosis according to the present invention consists in expressing in vi tro the intein inserted at a site whose localization is specific for Mycobacteri um tubercul osi s, then at the detect and / or quantify it using a specific functional test of the activity of said intein expressed in vi tro.
• Ppsl of Mycobacteri um tubercul osis we express in vi tro, from the nucleic acids contained in the sample, the ppsl intein of Mycobacterium tuberculosis if it is present at the ppsl (b) site, then it is detected and / or quantifies it using a specific functional test of the activity of said intein expressed in vi tro.
• the functional test implemented in the method of the invention may be based in particular on: - the endonuclease activity of the specific intein of Mycobacterium tuberculosis; the protein ligase activity of the M. tuberculosis-specific intein;
• the subject of the invention is therefore very particularly a method for detecting and / or quantifying Myc oba ct eri um t uberc ulosis in a sample, characterized in that it comprises the following steps: a) the preparation, from said sample, of nucleic acid molecules comprising a polynucleotide sequence coding at least for an intein inserted at a site whose localization is specific for Mycobacteri um tubercul osis and the control elements necessary for the transcription and in vi tro translation of said intein; b) transcription and in vitro translation of the nucleic acid molecules prepared in step (a); c) detecting and / or measuring a specific intein function expressed in step (b).
• the sample from which the method of the invention is made can be any biological sample capable of containing Myc oba c t e r i um tuberculosis. It can of course be a raw biological sample such as blood, tissue or a body fluid such as sputum, saliva and sputum. These samples can also correspond to products of any DNA or RNA amplification methods or any nucleic acid products resulting from treatment commonly used in the field of biology.
• Mycobacterium is understood to mean both the microorganism Mycobacterium tuberculosis li itself and its genetic information.
• function also means any property of the specific intein, such as an enzymatic activity specific to the intein of Mycobac teri um tuberculosis. As indicated previously, this function can correspond by example to the endonuclease activity of the intein or to the protein ligase activity or to its protein splicing capacity.
• the detection and / or quantification method according to the invention is carried out in the presence of one or more substances capable of modifying the activity of the intein.
• the method of the invention also offers the advantage of being very sensitive. This sensitivity is explained by the multiplying coefficient of steps (b) and (c) corresponding respectively to the transcription, to the translation of the gene or genes prepared in step (a), coding for the intein, then to the detection. and / or measuring the function corresponding to the protein or proteins produced in step (b).
• the method of the invention can pass after the transcription step by a step of amplifying the transcripts by any technique known to those skilled in the art such as NASBA (nucleic Acid Sequence-based Amplification ), or TMA (Transcription Mediated Amplification) before the translation stage.
• the method of the invention is furthermore rapid and reproducible, since all the reactions are carried out in vitro within a few hours.
• the method of the invention not only makes it possible to demonstrate the presence and / or quantify a specific intein of Mycobacterium tuberculosis and therefore to carry out a specific diagnosis of Myc oba ct eri um tubercul osis, but it also makes it possible to characterize said intein . For example, by characterization, defining the spectrum of inhibition of specific intein by specific inhibitors or defining a pH range in which the intein is active. This particular mode of implementing the process of the invention makes it possible to define new antibiotics or substances capable of inhibiting functions of the specific intein and more particularly the protein splicing necessary for the survival of the organism to which it belongs.
• monitoring of an infection with M. tuberculosis can be implemented so as to periodically detect and / or quantify d '' a specific function of the intein in an organism having followed or not treatment with an antibacterial.
• the comparison of the results obtained at different times and their interpretation allows monitoring over time of the evolution of the infection. This type of monitoring allows the practitioner to understand the development of an M infection. tuberculosis. Interpreting the results then offers considerable decision support.
• the invention is more particularly interested in inteins located at:
• intein will also be understood to mean an intein inserted at a site whose localization is specific for Mycobacterium tuberculosis.
• Step (a) of sample preparation When the method of the invention consists in detecting Mycobacterium tuberculosis, a nucleic acid molecule coding for a specific intein is prepared in step (a) so as to be able to express it subsequently in vi tro.
• an amount of nucleic acid molecules is prepared in step (a) proportional to the amount of mycobacteria possibly present in 1 ′ sample.
• the preparation of the sample in step (a) of the method of the invention consists in placing a nucleic acid sequence coding at least for the intein inserted at a site whose localization is specific for Mycobac teri um tubercul osi s under the control of elements necessary for the transcription and in vi tro translation of said gene.
• control sequences of the polynucleotide coding for the specific intein according to the method of the invention are for transcription:
• RNA polymerase promoter optionally a 3' RNA polymerase terminator, and for translation: - a ribosome binding site
• RNA polymerase a translation stop codon followed by a few nucleotides, for example from 5 to 10 nucleotides.
• the promoter (in 5 ') and the terminator (in 3') if it is present, of an RNA polymerase are for example those of the RNA polymerase of phages T7, SP6, Q ⁇ or ⁇ .
• step (a) of the method of the invention consists in preparing the nucleic acid molecule by an amplification reaction of the gene coding for the specific intein, from the nucleic acids. of the sample. It can be an amplification by PCR or by techniques derived from PCR such as for example nested PCR or techniques different from PCR of the NASBA or SDA type or others.
• this preparation uses at least two oligonucleotides or at least two primers, two of which are located respectively at the terminals of the nucleotide sequence coding for the intein inserted at the level of a site whose location is specific to Mycobacteri um tuberculosis.
• primers which can correspond for example:
• RNA polymerase promoter for the sense primer or primers, at least the following elements corresponding to an RNA polymerase promoter, a ribosome binding site, a codon initiating translation in phase with the first codon of the intein gene and the sequence hybridizing at least 5 ′ to the polynucleotide coding for the specific intein, and
• the antisense primer (s) containing at least the following elements comprising the sequence hybridizing at least 3 'to the polynucleotide coding for the specific intein, a translation stop codon followed by a few nucleotides such as for example 5 to 10 and optionally an RNA polymerase terminator.
• the preparation of the nucleic acid molecule of step (a) can be carried out by any other method known to those skilled in the art, such as a restriction cut-off allowing the specific intein of interest to be recovered, followed by ligation. oriented with the control elements necessary for transcription and in vitro translation indicated above.
• these two primers are capable of hybridizing respectively at the terminals of the coding sequence for an inserted intein at a site whose location is specific for Mycobacterium tuberculosis.
• the portions of the primers which hybridize at least to the gene coding for a specific intein have a length of 7 to 150 nt in length, advantageously a length of 7 to 50 and preferably between 10 and 25 nt.
• these primers have a segment of at least 7 contiguous bases which are at least 70% complementary to a target sequence of 7 contiguous nucleotides located on either side of the polynucleotide coding for at least the specific intein of Mycobacterium tuberculosis.
• step (a) of preparation of nucleic acid molecules different forms of implementation of the method of the invention can be carried out. It is possible to combine in a single tube or not at least two detection and / or quantification reactions. One of the detection and / or quantification reactions concerns
• Mycobacterium tuberculosis Mycobacterium tuberculosis.
• the other so-called associated detection and / or quantification reaction concerns an organism or a process which it is useful to detect in parallel with
• Mycobacterium tuberculosis This parallel detection also involves the associated function of an organism or process, expressed in vi tro. This organism can also correspond to a mycobacterium.
• step b) can be simultaneous, which means that the translation phase is carried out simultaneously with the transcription, or broken down into two distinct stages of transcription and translation.
• Decoupling allows the use of different translation extracts depending on the origin of the screened DNA.
• the translation phase of the transcript is advantageously carried out with a translation extract of mycobacterial origin or of an origin close to that of the biological sample on which the method of the invention is practiced.
• the adequacy between the origin of the translation signals of the transcripts and the cell extract is optimized for optimal translation efficiency.
• These extracts are chosen for their ability to translate the transcripts.
• the method of the invention is remarkable in that it implements an adequacy between the punctuation of expression of the transcripts and the translation extracts used.
• These translation extracts are also characterized in that either they do not contain the property sought, or they contain it but that it is not detectable under the test conditions carried out to detect the function sought.
• a particular implementation of the method of the invention consists in using in step (b) a translation extract prepared from a modified bacterial strain.
• This extract can also correspond to a mixture of several translation extracts prepared from bacterial strains modified or not. It may, for example, be an E. coli translation extract overexpressing a chaperone A protein mixed with an E translation translation extract. coli overexpressing a chaperone B protein. Any type of mixture is possible as long as it corresponds to the characteristics described above.
• step (b) with a translation extract can also be carried out with a standard translation extract whatever the origin of the sample, for example an extract of E. coli and / or all (s) ) other cell extract (s) whether or not supplemented with interesting molecules such as those, for example, indicated above (tRNA, chaperone ). It is also possible to add to the translation extract of step (b) one or more substances promoting a more efficient folding or maturation of the expressed proteins, such as, for example, chaperones, detergents, tallow obetains, membrane extracts, etc.
• step (c) The functional test of step (c).
• specific substrates can be considered by those skilled in the art to demonstrate the presence of a specific intein function which may correspond, for example, to the protein ligase, endonuclease and protein splicing functions.
• Those skilled in the art may for example refer to works such as Methods In Enzymology or Annual Review Of Biochemistry, in which a large number of methods for assaying the activity of proteins and for preparing substrates have been described.
• the neosynthesized intein may specifically cleave a polynucleotide, of which the cut will be responsible for a fluorescence emission.
• the protein splicing function can be demonstrated by using, for example during the preparation of the sample by amplification in step (a), the following primers composed for: the sense primer, of an RNA polymerase promoter, of a ribosome binding site, of a part of a reporter gene such as that coding for microperoxidase (Spee et al., (1996) Eur. J. Biochem 241, 215-220 and Hirayama et al.
• the antisense primer of the sequence hybridizing 3 'to the polynucleotide sequence coding for a specific intein, or downstream of the polynucleotide sequence coding for a specific intein or on the polynucleotide sequence coding for a specific intein and on a sequence downstream of the polynucleotide sequence coding for a specific intein, of the other part of the reporter gene for microperoxidase, of a translation stop codon, and optionally of an RNA polymerase terminator.
• the specific intein can then be excised from the neosynthesized protein in step (b) to release the microperoxidase easily detectable by a functional test in step (c).
• the functional test in step (c) may or may not be direct.
• the measurement of the specific intein function expressed in step (b), if necessary, can be read directly in a fluorimetry reader if the measurement of the function uses a substrate corresponding to a fluorophore or colorimetry if the measurement of the function uses a chromophore.
• a fluorimetry reader if the measurement of the function uses a substrate corresponding to a fluorophore or colorimetry if the measurement of the function uses a chromophore.
• Quantification of Mycobacterium tuberculosis according to the invention.
• the invention also relates to a method for quantifying the function corresponding to a specific intein, from the nucleic acids present in said sample, characterized in that it comprises:
• step (c) consisting in measuring the function of the specific intein, then d) comparing the measurement of the function of the specific intein possibly present in the sample carried out in step (c) with a standard value or a set of standard values of said function measured on one or more standard samples according to a measurement method identical or equivalent to that of step 1 (c).
• a standard sample for carrying out step (d) above can be any sample containing:
• step (c) a quantity, advantageously known, of the gene or genes coding for the specific intein which can be transcribed and translated, and which will then be subjected to a transcription and translation treatment as in step (b), then the function of said intein will be measured according to a measurement method identical or equivalent to that of step (c);
• step (c) a quantity, advantageously known, of the specific intein, which will be measured according to a measurement method identical or equivalent to that of step (c); a quantity, advantageously known, of Mycobacterium tuberculosis, which will be measured according to a measurement method identical or equivalent to that of steps (a) (b) and (c).
• the standard sample can come from an identical or different medium from that on which steps (a) to (c) of the method of the invention are carried out. It can be the same medium but taken at a different time.
• Detection and / or quantification can be evaluated in particular with respect to a predetermined threshold or with respect to a standard curve allowing the comparison of the measurements of the specific intein function with those of standard samples.
• the steps of the method of the invention can be carried out successively without interruption by the same operator, advantageously on an automated device integrating each of the steps, or can be carried out discontinuously, possibly by different operators.
• the method of the invention can be advantageously automated if the number of samples to be analyzed is high.
• the nucleic acid samples are then placed on a support which can correspond, for example, to a chip or a titration plate containing several tens to several thousand locations. These supports are designed to allow:
• step a the preparation of the target sequences (step a), - the initiation of the transcription and translation reactions of the specific intein (step b) and the revelation of said intein (step c).
• the invention relates to a device comprising an arrangement of one or more supports, robots and a reader of said supports for carrying out the steps of the method described above.
• the invention therefore also relates to a kit for implementing a method of detection and / or quantification of Mycobac t eri um tubercul osi s described above.
• Said kit comprises in a first embodiment: the means for revealing a function of a specific intein, an RNA polymerase, nucleotide sequences allowing the preparation of the nucleic acid molecules (step a) coding at least for the 'intein, the four nucleotide triphosphates, the mixtures necessary for said preparation, for transcription and translation, possibly controls and what to make the standards.
• a kit according to the invention comprises:
• kits contain at least one labeled probe capable of specifically hybridizing with all or part of the gene coding for an intein if the latter is inserted at a site whose location is specific for Mycobacterium tuberculosis.
• probes can be prepared from the sequences of the gene sites where the sequences coding for the inteins in Mycobacterium tuberculosis are inserted.
• labeled probes are advantageously capable of hybridizing specifically with a part of the sequence coding for the intein, and a region flanking the site where said intein is inserted and whose location is specific to Mycoba ct eri um tuberculosis.
• kits for implementing a method for detecting the presence of a localized intein at a site which is specific for Mycobacterium tuberculosis using amplification techniques contain at least one pair of primers specific for the regions flanking the insertion site of the specific integrin of Mycobacteri um tubercul osis.
• Kits and supports can be considered for detection and / or quantification in addition to M. tuberculosis of one or more other functions associated with one or more other organisms or with one or more processes.
• the description which follows relates to examples of implementations of the invention relating to (i) the specific detection of Mycobacteri um tuberculosis by PCR, and (ii) the specific detection of M. tuberculosis by the function of the intein inserted into the recA site (a) of the RecA protein gene.
• Example 1 Specific detection of Mycobacterium tuberculosis by PCR.
• strains M. chi tae, M. fallax, M. gastri, M. thermoresistible, M. shimoideii were scraped on solid Lôweinstein-Jensen medium and are resuspended in 1 ml of sterile TE buffer (Tris-HCl 10 mM pH 8, EDTA 1 mM). 1 g of 0.1 mm diameter glass ball (BioBlock) is added and the mixture is vortexed for 2 min. for break the mycobacteria. Proteinase K (Sigma) is added to a concentration of 50 ⁇ g / ml final and the mycobacterial suspensions are incubated for 10 min. at 65 ° C and then for 10 min.
• the primers for the PCR amplification reaction were designed so as to be able to hybridize on either side of the recA (a) site in areas conserved for the mycobacterial species. These primers correspond to RecA-3 '(5' AGGATGTCGAACTCGGCCAGCTTGAA 3 ') and to R (a) (5'GCGTCGGTGCGCATGGACGTGCG 3') and are capable of hybridizing to positions 765-791 and 658-681 respectively of the recA gene of Mycobacterium tuberculosis.
• Amplification reactions by PCR are carried out using:
• An amplification product of 133 bp is observed in the cases where the matrix corresponds to M. chi tae, M. fallax, M. gastri, M. thermoresistibile, M. shimoide and M. leprea.
• an amplification product of 1453 bp is observed if the matrix corresponds to M. tuberculosis. Only the matrix corresponding to M. tuberculosis makes it possible to amplify a fragment of 1453 bp corresponding to 133 bp + the size of the intein inserted at the recA (a) site, ie 1320 bp.
• the demonstration of the presence of M. tubercul osi s in a sample can therefore be done using primers specific to the recA (a) insertion site of the RecA intein of this ycobacterium.
• Example 2 Specific detection of M. tuberculosis by the function of the intein inserted into the ppsl (b) site of the Ppsl protein gene.
• a particular embodiment of the invention consists in detecting Mycobacterium tuberculosis by means of the intein inserted into the ppsl (b) site of the Ppsl protein gene.
• the intein gene is amplified by PCR on the genomic DNA of M. tubercul osi s using a set of primers allowing this gene to be placed under the control of the transcription promoter of the. Phage T7 RNA polymerase, a ribosome binding site and an ATG.
• the reverse primer has one or two STOP codons.
• a negative control is produced by carrying out the same PCR on the genomic DNA of a microorganism other than M. tuberculosis.
• Example 3 Detection of a specific Mycobacterium tuberculosis intein using the detection of the endonuclease activity of the Pps1 intein, the corresponding gene of which is inserted specifically at the ppsl (b) site.
• the intein gene is amplified by PCR from genomic DNA with the following primers:
• MtuPpsl-ATG 5 'atgtgcctgcccgccggc 3' and MtuPpsl-3'SS: 5 'gttgtgcacggcgaacccgt 3'
• Genomic DNA is incubated in the presence of 10 pmol of each primer and of Taq DNA polymerase in 10 mM Tris-HCl buffer pH 8.3, 1.5 mM MgCl 2, 50 mM KCl, 0.2 mM dNTP.
• the amplification cycle is: 10 min at 92 ° C + 29 cycles (1 min. At 92 ° C + 1 min. At 55 ° C + 1.5 min at 72 ° C) + 5 min. at 72 ° C to finish.
• the 1077 bp fragment corresponding to the intein gene is purified on 1% TBE gel using the Qiaquick gel extraction kit (Qiagen) and then inserted into the expression vector pCR-T7-CT-topo according to the recommendations of the supplier (Invitrogen ).
• BL21-DE3-pLysS bacteria are transformed with a few ng of the expression plasmid and selected on LB medium containing ampicillin and chloramphenicol.
• a clone is taken up in the same medium and cultured until the exponential growth phase at 37 ° C. before induction of the expression of the intein at IPTG (1 mM). This induction at 37 ° C lasts 2 h 30 min, the cells are then centrifuged and the proteins extracted in 20 mM sodium phosphate buffer by 6 freeze-thaw cycles.
• the protein extract is then recovered by centrifugation of the cellular debris.
• the substrate plasmid is linearized by the enzyme Seal and diluted to the concentration of 100 ng / ⁇ l.
• Two independent substrate preparations are used ( Figure 2).
• Example 4 Diagnosis by PCR of Mycobacteri um tuberculosis by the simultaneous detection of two specific inteins: the ppsl intein and the recA intein.
• the ppsl intein gene is amplified by PCR from genomic DNA from M. gadium and M. tuberculosis with the following primers: ppsl-3 ': 5' gtcgttgttcgaccagttctggatggt 3 'ppsl-5': 5 'catccgcaacacctacgaccgg 3 '
• Genomic DNA of M. gadi um and M. tuberculosis are incubated in the presence of 10 pmol of each primer and of a unit of Taq DNA polymerase in 10 mM Tris-HCl buffer pH 8.3, 1.5 mM MgCl 2 , KC1 50 mM, 0.2 mM dNTP.
• the amplification cycle is: 10 min at 92 ° C + 29 cycles (1 min. At 92 ° C + 1 min. At 50 ° C + 1.5 min at 72 ° C) + 5 min. at 72 ° C to finish.
• the recA intein gene is amplified by PCR from genomic DNA of M. l eprea and M. tuberculosis with the following primers:
• the amplification products were deposited on agarose gel. After migration and coloring with BET, the results presented in FIG. 3 were observed.
• Detection of the ppsl and recA inteins of Mycoba c t eri um t ubercul osi s increases the specificity of detection.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Analytical Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Microbiology (AREA)
• Immunology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=8847151

Family Applications (1)

Country Status (5)

Families Citing this family (2)

Family Cites Families (3)

• 2000
  • 2000-02-17 FR FR0002051A patent/FR2805280B1/fr not_active Expired - Fee Related
• 2001
  • 2001-02-16 US US10/203,927 patent/US20040137511A1/en not_active Abandoned
  • 2001-02-16 WO PCT/FR2001/000475 patent/WO2001061035A1/fr not_active Application Discontinuation
  • 2001-02-16 AU AU2001235709A patent/AU2001235709A1/en not_active Abandoned
  • 2001-02-16 EP EP01907833A patent/EP1257666A1/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events