EP1240356A2 - Systeme d'essai permettant de detecter des analytes, un procede de realisation, et son utilisation - Google Patents
Systeme d'essai permettant de detecter des analytes, un procede de realisation, et son utilisationInfo
- Publication number
- EP1240356A2 EP1240356A2 EP00975889A EP00975889A EP1240356A2 EP 1240356 A2 EP1240356 A2 EP 1240356A2 EP 00975889 A EP00975889 A EP 00975889A EP 00975889 A EP00975889 A EP 00975889A EP 1240356 A2 EP1240356 A2 EP 1240356A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- test system
- pcr
- analyte
- polypeptide
- detector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2458/00—Labels used in chemical analysis of biological material
- G01N2458/10—Oligonucleotides as tagging agents for labelling antibodies
Definitions
- the present invention relates to a test system and a method for the simultaneous parallel detection of different analytes
- the principle of the antigen-antibody reaction is preferably used to identify and quantify proteins, but also other classes of substances such as biopolymers, organic compounds, tumor cells, viruses, bacteria or environmentally harmful substances.
- ELISA Color reactions
- electron-dense corpuscles e.g. colloidal gold
- the antibody is either coupled directly to the amphficator or indirectly by a second antibody that is directed against the primary antibody and labeled with the amphficator.
- Such immunological detection methods So-called immunoassays - can make quantitative statements if one of the reaction partners is coupled to a well-detectable labeling substance in such a way that the immunological properties of the components are retained.
- the avidin / biotin system with high sensitivity has proven to be a particularly advantageous coupling system (cf. B Wilchek M, Bayer EA Avidin-Biotin Technology Meth Enzymol V 184 Academic Press, 1990)
- Streptavidin portion that is able to bind both the Fc part of the antibody and biotinylated DNA.
- the use of such a fusion protein is disadvantageous if the serum or tissue material to be analyzed contains IgG-containing components, since it binds to these in an unspecific manner.
- the commercially available proteins streptavidin and avidin can be used (Ruszicka,
- polypeptide-nucleic acid conjugates are particularly suitable for the detection of analytes.
- the parallel detection of several analytes is made possible simultaneously (multiplexing).
- the invention therefore relates to a test system comprising (a) at least one immobilized analyte on an insoluble carrier, and
- polypeptide detector is conjugated to an amphficator via a linker.
- test system means an in vitro assay with high throughput quality, since a very high sample throughput is achieved. A high sensitivity and sensitivity as well as specificity is achieved.
- Proteins or peptides that bind the substance to be detected with sufficient affinity and therefore detect them.
- scFv Single chain antibody
- natural binding partners or binders produced by combinatorial selection methods which are preferably produced by means of in vitro translation with the provision of polypeptide-nucleic acid conjugates.
- WO 98/3 700 Preferably in WO 98/31700, proteins or peptides are covalently linked to the RNA encoding them during translation and thus inherently carry the genetic information for their synthesis (coupling of phenotype and genotype).
- Conjugate enables the detection of the analyte through specific binding, the conjugate containing the genetic information of the detector in the form of RNA, the information of which, according to the invention, is preferably amplified by means of reverse transcriptase-PCR (short: RT-PCR) - with conversion into a signal. Therefore, the conjugate RNA serves as an amphicator (signal amplification). As an alternative to this, the RNA portion of the conjugate can be transcribed in reverse before use in the immuno-PCR, so that only a PCR is required to amplify the nucleic acid.
- At least one analyte is first immobilized on an insoluble support (e.g. plastic, ceramic, metal, glasses, crystalline materials or (bio) molecular filaments such as cellulose, framework proteins).
- an insoluble support e.g. plastic, ceramic, metal, glasses, crystalline materials or (bio) molecular filaments such as cellulose, framework proteins.
- the analyte is a protein, this is preferably done directly in microtiter plates made of polystyrene, a material that has a high, reproducible protein adsorption capacity, or, for example, on materials whose surfaces have been modified for the covalent immobilization of proteins.
- the analyte can be immobilized by specifically binding capture antibodies (so-called sandwich immuno-PCR). After incubation of the analyte with the nucleic acid-protein conjugate and removal of non-specifically bound material, the nucleic acid is analyzed by RT-PCR or
- PCR or other suitable methods e.g. B. Primer Extension (see Ruano, G, Lewis, ME, Kouri, RE, Anal.Biochem., 1993, 212, 1-6) or SDA (Strand Displacement Amplification) (see Walker, GT, Little, M. C, Nadeau, JG and Shank, DD, Proc. Natl. Acad. 1992, Sei 89, 392-396 and Walker, G. T, Fraiser, MS, Schräm, JL, Little, M. C, Nadeau, JG and Malinowski, DP, Nucleic Acids Res.
- B. Primer Extension see Ruano, G, Lewis, ME, Kouri, RE, Anal.Biochem., 1993, 212, 1-6
- SDA Strand Displacement Amplification
- the amplified products are detected either directly in the reaction vessel or after separation, e.g. B. by means of gel electrophoresis.
- marker substances are either zen built into the nucleic acid, or there is an indirect labeling after the amplification, for example by hybridization of labeled nucleic acid probes.
- labeling methods are chemical, enzyme, protein, hapten, radioactive isotope, non-radioactive isotope, chemiluminescent or fluorescent labeling.
- the detector antibodies are indirectly labeled with biotin-binding molecules such as streptavidin or protein A / streptavidin fusions with the biotinylated DNA.
- biotin-binding molecules such as streptavidin or protein A / streptavidin fusions with the biotinylated DNA.
- nucleic acids are ideally suited as markers for multianalyt assays, since different DNA molecules depend precisely and quantitatively both on the basis of their size and their sequence. can be distinguished from one another, so that an almost infinite number of labels can be created using nucleic acids.
- Domains such as antigens and haptens, hormones, cytokines, pheromones, secondary metabolites, pharmaceuticals, opiates, nucleic acids as well as low to macromolecular organic compounds (e.g. herbicides or pesticides).
- the following example describes the detection of an immobilized antibody against c-myc with the aid of a fusagen and subsequent PCR amplification.
- a 114-mer DNA template (5'-ATGGTGAGCAAGGGCGAGGAGCAAAAGCTTATTT CTGAAGAGGACTTGCTTAAGGGAAACTCACAGGAAGCTGTGTTAAAGTTGCAAG
- ACTGGGATGCACAAGCACCAAAAGCT-3 ' encoding the amino acid sequence of the c-myc epitope encoding, is prepared by solid phase synthesis on the oligonucleotide synthesizer, and then amplified by PCR with primers 5'-1 uM TAATACGACTCACTATAGGGACAATTACTATTTACATTACAATGGTGAGCAAGGG CGAGGAG-3' and 5, -AGCTTTTGGTGCTTGTGCATC-3, as well as 0.02 U / ⁇ l Taq polymerase (Promega) amplified in 10 mM Tris-HCl pH 9.0, 50 mM KCI 0.1% Triton X-100, 2.5 mM MgCl 2 and 0.25 mM dNTPs. A T7 promoter region and a region from the 5 'untranslated sequence of the tobacco mosaic virus genome are introduced as the initiation site for the translation via the 5' primer.
- the double-stranded PCR product is made
- RNA with 1 nmol linker (5'-A 2 CC-Puromycin-3 r ) and 1 nmol splint (5'-TTTTTTTTTTNAGCTTTTGGTGCTTG-3 ') are added and 3 min. denatured at 95 ° C.
- the ligation is carried out for 4 h at room temperature.
- the ligated RNA is separated from unligated RNA via a denaturing polyacrylamide gel and in 0.3 M NaOAc pH 5.2 eluted from the gel overnight. 50 pmol RNA are used to generate the peptide-RNA conjugate using the Retic Lysate In Vitro Translation Kit (Ambion). The cleaning is then carried out using oligo dT cellulose.
- the translation mixture is incubated with 100 ⁇ l oligo dT-cellulose (Pharmacia) in 100 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0, 1 M NaCI and 0.25% Triton X-100 at 4 ° C. and then bound fusion product eluted with ddH 2 O.
- oligo dT-cellulose Pharmacia
- 100 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0, 1 M NaCI and 0.25% Triton X-100 at 4 ° C.
- a 5-fold excess of sapwood is added to the RNA-peptide conjugates.
- the reverse transcription is carried out with 0.007 U / ⁇ l Superscript II Reverse Transcriptase (Gibco BRL) in 25 mM Tris-HCl pH 8.3, 75 mM KCI, 3 mM MgCI 2 , 10 mM DTT and 0.5 mM dNTPs.
- the PCR amplification is carried out in 50 ⁇ l reaction volume with 1 ⁇ M primer 5'- TAATACGACTCACTATAGGGACAATTACTATTTACATTACAATGGTGAGCAAGGG CGAGGAG-3 'and 5'-AGCTTTTGGTGCTTGTGCATC-3' as well as 0.02 U / ⁇ l Taq polymerase (Promega) in 10 mM Tris-HCI pH 9%, 50 mM XCI 0.1%, 50 mM KCI 0.1 2 and 0.25 mM dNTPs for 30 cycles (1 min 95 ° C., 1 min 55 ° C., 1 min 72 ° C.) The samples are analyzed on a 2% agarose gel.
- FIG. 1A shows the principle of immuno-PCR.
- Figure 1 B shows the principle of the invention.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE19959857 | 1999-12-10 | ||
DE19959857A DE19959857C1 (de) | 1999-12-10 | 1999-12-10 | Testsystem zum Nachweis von Analyten sowie ein Verfahren zur Herstellung und Verwendung |
PCT/EP2000/010336 WO2001042494A2 (fr) | 1999-12-10 | 2000-10-20 | Systeme d'essai permettant de detecter des analytes, un procede de realisation, et son utilisation |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1240356A2 true EP1240356A2 (fr) | 2002-09-18 |
Family
ID=7932340
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP00975889A Withdrawn EP1240356A2 (fr) | 1999-12-10 | 2000-10-20 | Systeme d'essai permettant de detecter des analytes, un procede de realisation, et son utilisation |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1240356A2 (fr) |
JP (1) | JP2003528298A (fr) |
AU (1) | AU1385901A (fr) |
CA (1) | CA2393703A1 (fr) |
DE (1) | DE19959857C1 (fr) |
WO (1) | WO2001042494A2 (fr) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005081908A2 (fr) | 2004-02-20 | 2005-09-09 | The Trustees Of The University Of Pennsyvania | Reactifs, kits et procedes pour l'immunodetection d'epitopes sur des molecules |
GB201218909D0 (en) * | 2012-10-22 | 2012-12-05 | Univ Singapore | Assay for the parallel detection of biological material based on PCR |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6083689A (en) * | 1990-10-16 | 2000-07-04 | Bayer Corporation | Sensitive immunoassays utilizing antibody conjugates with replicable DNA templates |
US5665539A (en) * | 1991-07-12 | 1997-09-09 | The Regents Of The University Of California | Immuno-polymerase chain reaction system for antigen detection |
US5922553A (en) * | 1996-11-21 | 1999-07-13 | Trustees Of The University Of Pennsylvania | Method of detecting protein by immuno RNA |
RU2233878C2 (ru) * | 1997-01-21 | 2004-08-10 | Дзе Дженерал Хоспитал Корпорейшн | Способ отбора желательного белка и нуклеиновой кислоты, средства для его осуществления |
WO1999051773A1 (fr) * | 1998-04-03 | 1999-10-14 | Phylos, Inc. | Systemes de proteines adressables |
EP1212452B1 (fr) * | 1999-08-27 | 2013-07-17 | Bristol-Myers Squibb Company | Methodes de codage et de tri de proteines traduites in vitro |
-
1999
- 1999-12-10 DE DE19959857A patent/DE19959857C1/de not_active Revoked
-
2000
- 2000-10-20 EP EP00975889A patent/EP1240356A2/fr not_active Withdrawn
- 2000-10-20 JP JP2001544366A patent/JP2003528298A/ja active Pending
- 2000-10-20 WO PCT/EP2000/010336 patent/WO2001042494A2/fr not_active Application Discontinuation
- 2000-10-20 CA CA002393703A patent/CA2393703A1/fr not_active Abandoned
- 2000-10-20 AU AU13859/01A patent/AU1385901A/en not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO0142494A2 * |
Also Published As
Publication number | Publication date |
---|---|
WO2001042494A3 (fr) | 2002-05-02 |
JP2003528298A (ja) | 2003-09-24 |
WO2001042494A2 (fr) | 2001-06-14 |
CA2393703A1 (fr) | 2001-06-14 |
DE19959857C1 (de) | 2001-06-28 |
AU1385901A (en) | 2001-06-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6489116B2 (en) | Sensitive, multiplexed diagnostic assays for protein analysis | |
US7022479B2 (en) | Sensitive, multiplexed diagnostic assays for protein analysis | |
EP1996941B1 (fr) | Procédé de détection d'une substance à analyser utilisant des sondes de proximité | |
US20110223585A1 (en) | Assay for localized detection of analytes | |
US20020064779A1 (en) | Methods and kits for proximity probing | |
US20050079520A1 (en) | Multiplexed analyte detection | |
WO2017181339A1 (fr) | Procédé et kit pour la détection simultanée d'un ligand de protéine et d'un gène | |
US7074586B1 (en) | Quantitative assay for low abundance molecules | |
CN111505275B (zh) | 一种基于Cas9核酸等温扩增的免疫层析多重基因检测方法 | |
EP1255861A1 (fr) | Procedes et trousses de detection de proximite | |
US5922553A (en) | Method of detecting protein by immuno RNA | |
US6255060B1 (en) | Method of detecting protein by immuno RNA | |
DE19959857C1 (de) | Testsystem zum Nachweis von Analyten sowie ein Verfahren zur Herstellung und Verwendung | |
AU773046B2 (en) | Test system for detecting different markers, and production and use thereof | |
US5871906A (en) | Method for detection of amplified nucleic acid products and related diagnostic assays | |
DE602004008043T2 (de) | Verwendung eines viruses, der ein bindungsteil exprimiert, zur messung von analyten in einer probe | |
KR101989679B1 (ko) | 노닐페놀 에톡실레이트에 특이적으로 결합하는 dna 압타머 및 이의 용도 | |
US20020142361A1 (en) | Biodetection method | |
WO2020171236A1 (fr) | Nouveau procédé d'immuno-pcr utilisant un affichage d'adnc | |
CN100495035C (zh) | 抗原及配体pcr管式检测试剂盒及其制备方法和应用 | |
US20050239078A1 (en) | Sequence tag microarray and method for detection of multiple proteins through DNA methods | |
CN117007789A (zh) | 基于Argonaute的多重免疫层析核酸检测方法 | |
US20180171382A1 (en) | Branched proximity hybridization assay | |
DE10200374A1 (de) | Verfahren zur qualitativ und quantitativ vergleichenden Detektion chemischer Substanzen | |
DE10332620A1 (de) | Verfahren zum Nachweis von Biomolekülen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: AVENTIS RESEARCH & TECHNOLOGIES GMBH & CO KG |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: PHYLOS, INC. |
|
17P | Request for examination filed |
Effective date: 20021104 |
|
17Q | First examination report despatched |
Effective date: 20031007 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20040218 |