Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
  • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
  • C12Q2525/10—Modifications characterised by
  • C12Q2525/15—Modifications characterised by incorporating a consensus or conserved sequence
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/16—Primer sets for multiplex assays

Definitions

• the present invention is related to a method and kit comprising reagents for simultaneous detection and/or quantification of multiple homologous nucleic acid sequences on arrays .
• the development of miniaturisation, especially the array technology, allows the simultaneous detection of a great number of nucleotide sequences present in biological samples.
• the array contains on its surface, series of discrete regions bearing capture nucleotide nucleotide sequences able to bind by hybridisation corresponding target nucleotide sequences. If the last ones are labelled, a signal can be detected and measured at the binding location and its intensity gives an estimation of the amount of target sequences present in the sample.
• oligonucleotides Only small oligonucleotides are present on the surface, and are used for sequencing or identifying sequences m a pattern of positive spots corresponding to specific oligonucleotides present on the array. The identification of the target sequence is made by comparison of said pattern with a reference.
• the documents 097/29212 and 098/28444 describe a similar technique with the use of capture nucleotide sequences comprising less than 30 nucleotides allowing an analysis of two different sequences that may differ by a single nucleotide. Small capture nucleotide sequences (between 10 and 20 nucleotides) are preferred since the discrimination between two oligonucleotides differing m one base is higher, when their length is smaller.
• fragments are cut into smaller species and the method should require the use of numerous capture nucleotide sequences m order to obtain a pattern of signals which attest the presence of a given gene ( O97/10364 and 097/27317) .
• short capture sequences are used, preferably about 45 nucleotides, and m practice, between 10 and 25 nucleotides.
• the document 094/22889 describes electronic chips made of preconstructed oligonucleotides bearing a pyrol group used in an electropolymerisation step and allows the formation of a conducting polymer. This method is particularly suitable for the preparation of electronic chips bearing small capture nucleotide sequences.
• the present invention aims to provide a new method to improve the detection and possibly the quantification of nucleotide sequences, preferably multiple homologous sequences, coming from different or the same organism, by hybridisation on single stranded capture nucleotide sequences, and which does not present the drawbacks of the state of the art.
• the inventors have discovered that it is possible to provide a sensitive detection method (possibly combined with a quantification) of multiple nucleotide sequences upon an array, even if said multiple sequences are homologous and are present simultaneously in the sample submitted to the analysis. Until now, either the sensitivity was low or null or there was cross-reactivity between the different (but homologous) target sequences on the same capture nucleotide sequences.
• the present invention is related to an (improved in sensitivity and specificity compared to known techniques) detection and/or quantification method of a nucleotide sequence from at least 4 others homologous sequences, possibly present in a biological sample, by the identification of a portion of its sequence, said method comprising the steps of:
• capture nucleotide sequences having a (single stranded) length comprised between about 40 and about 400 bases, preferably between about 50 and about 350 bases, more preferably between about 100 and about 300 bases, even more preferably between about 120 and about 200 bases, said capture nucleotide sequences being bound to the insoluble solid support according to an array with a density of at least 5 different bound capture nucleotide sequences/cm 2 surface of solid support .
• the method comprises also the step of detecting and/or possibly quantifying a signal (preferably from the label of the target nucleotide sequences) resulting from the formation of double stranded nucleotide sequences resulting from the hybridisation (of the capture and target nucleotide sequences) by base pairing.
• a signal preferably from the label of the target nucleotide sequences
• the labelling is preferably also obtained upon the amplified sequence previously to the denaturation (if the method comprises an amplification step) .
• the biological sample can be any culture medium wherein microorganisms or pollutants are present, or an extract obtained from a plant or an animal (including a human) organ, tissue, cell or biological fluid.
• the various steps of the method according to the invention can be done with various means well known by the person skilled m the art and described m the literature .
• the method according to the invention can be performed by using a specific diagnostic and/or quantification kit comprising at least an insoluble solid support upon which capture nucleotide sequences are disposed (preferably bounded to the solid support by a covalent link) according to an array with a density of at least 5 different bound capture nucleotide sequences / cm 2 surface of the insoluble solid support, said capture nucleotide sequences having a length comprised between about 40 and about 400 bases or preferably a length as above-described.
• the density of the capture nucleotide sequences upon the array of the solid support can be increased, for instance by having more than 10, 20, 50, 100, 1000, 10000 or more capture nucleotide sequences/cm 2 surface of solid support.
• each capture nucleotide sequence is located in a specific area of the support. However, several capture nucleotide sequences can also be present in the same area to obtain specific information.
• the kit according to the invention may also incorporate various media or devices for performing (preferably automatically) the method according to the invention.
• Said kit can be included in an automatic device, such as a high throughput screening apparatus for the detection and/or the quantification of multiple nucleotide sequences present in a biological sample to be analysed.
• Said kit or apparatus can be adapted for performing all the steps or only several specific steps of the method according to the invention.
• the length of the single stranded capture nucleotide sequences is preferably identical to the length of the target nucleotide sequences to be detected and/or quantified or may differ, preferably by less than 50% in total length, more preferably less than 30% in total length, even more preferably less than 10% in total length.
• the method, kit or apparatus according to the invention are suitable for the detection and/or the quantification of target nucleotide sequences which are made of DNA or RNA, including sequences which are partially or totally homologous upon their total length.
• the method according to the invention can be performed even when the different original nucleotide sequences present between them an homology greater than 30%, greater than 60% or even greater than 80% or differ by few bases .
• the capture nucleotide sequences are advantageously covalently bounded (or fixed) upon the insoluble solid support, preferably by one of their extremities as described hereafter.
• the yield of hybridisation is advantageously greater than 10%, 50%, 70%, 80% or 90% or can achieve almost 100%.
• the method, kit and apparatus according to the invention may comprise the use of other bounded capture nucleotide sequences (i.e.
• the solid support according to the invention can be or can be made with materials selected from the group consisting of glasses, electronic devices, silicium or plastic support, compact discs, filters, metallic supports or a mixture thereof.
• said solid support is a single glass plate which may comprise additional means (barcodes, markers, etc.) or media (coating, etc.) for improving the method according to the invention.
• the amplification step(s) used m the method according to the invention is advantageously obtained by well known amplification protocols, preferably selected from the group consisting of PCR, LCR, CPR, NASBA, ICR or Avalanche DNA techniques.
• the length of the target nucleotide sequences to be detected is determined by the conditions of the above- identified amplification protocols determined by the use of specific primers (and possibly blocking nucleotide sequences) for a retro-transcription of the 3 ' or 5 ' end of the original biological nucleotide sequences to be detected and/or quantified, especially if it is a RNA sequence.
• said RNA sequences are 16S and 23S rRNA sequences or 18S and 28S rRNA sequences.
• the target nucleotide sequences to be copied or amplified are obtained from different parts or portions of the corresponding (homologous) DNA or RNA original biological nucleotide sequence.
• the primers used for the amplification preferably bear at their 3 ' end a base specific of one of the homologous sequences .
• the method, kit or apparatus according to the invention is advantageously used for the detection and/or the quantification of different Staphylococci species or variants, preferably the Staphylococcus aureus , the Staphylococcus epidermidis, the Staphylococcus saprophyticus, the Staphylococcus hominis or the Staphylococcus haemolyticus present together or separately m a biological sample, said detection being obtained by detecting the genetic variants of the FemA gene m said different species, preferably by using specific locations m the FemA genetic sequence, as described m the document WO99/16780 incorporated herein by reference.
• the primers and the specific portions of said FemA sequence used for obtaining amplified products are the ones described hereafter m the examples .
• the method according to the invention may also comprise means for obtaining a quantification of target nucleotide sequences by using a standard nucleotide sequence (external or internal standard) which can be brought into contact with the capture nucleotide sequences bounded upon the array of the solid support m the same conditions as said target nucleotide sequences (possibly after amplification or copying) .
• Said method comprises a step of quantification of a signal resulting from the formation of a double stranded nucleotide sequence formed by complementary base pairing between the capture nucleotide sequences and the standard nucleotide sequences and a step of a correlation analysis between the signal resulting from the formation of said double stranded nucleotide sequence and the signal resulting from the double stranded nucleotide sequence formed by complementary base pairing between capture nucleotide sequences and target nucleotide sequences m order to quantify the presence of the original nucleotide sequence to be detected and/or quantified m the biological sample (see also the document W098/11253 incorporated herein by reference) .
• Said standard nucleotide sequence is advantageously included m the kit or apparatus according to the invention, possibly with the media and device (s) necessary for performing the different steps according to the invention, such as the hybridisation and culture media, polymerases, enzymes, standard sequences and labelling molecules.
• Fig. 1 shows the influence of the capture nucleotide sequence length on the yield of hybridisation of target amplicons.
• the target sequences were 155 bases long and 100 fmoles were incubated on a chips containing single stranded capture nucleotide sequences going from 23 to 437 bases long. The length of the capture nucleotide sequence is shown on the figure.
• Fig. 2 schematically represents the FemA detection of 5 different species of Staphylococci. The locations of the 5 pairs of primers used for specific amplification of one of the 5 different sequences belonging to the 5 Staphylococci species are shown on the FemA sequence.
• Fig. 3 schematically represents the detection of rRNA by the copy of small portions of the sequence either at its 5 ' end using one starting nucleotide sequence or along its sequence using both a starting nucleotide sequence and a blocking nucleotide sequence. The small copied sequences are then hybridised on the array of the chips .
• nucleoside t ⁇ phosphate refers to nucleosides present m either DNA or RNA and thus includes nucleosides which incorporate adenme, cytosme, guanme, thymme and uracil or other modified bases (i.e. 8-azaguanme and hypoxanthme) as bases, the sugar moieties being deoxy ⁇ bose or ⁇ bose .
• nucleotide refers to nucleosides present m nucleic acids (either DNA or RNA) compared with the bases of said nucleic acid, and includes nucleotides comprising usual or modified bases as above described.
• references to nucleotide (s) , oligonucleotide (s) and the like include analogous species wherein the sugar- phosphate backbone is modified and/or replaced, provided that its hybridisation properties are not destroyed (the backbone may be replaced by an equivalent synthetic peptide, Peptide Nucleic Acid (PNA) ) .
• PNA Peptide Nucleic Acid
• the primer sequence need not reflect the exact sequence of the template to be amplified or copied provided that under hybridising conditions the primers can be used m a genetic amplification. Mismatched bases can be introduced into the primer sequence to provide altered hybridisation introduced into the primer sequence to provide altered hybridisation stringency (amplification or copying of the same regions of homologous sequences by the same primers) .
• capture or target nucleotide sequences, target nucleic acid, hybridising specifically to, background, quantifying are defined as m WO97/10365, incorporated herein by reference.
• homologous sequences mean nucleotide sequences having the same nucleotide at corresponding positions. They are generally defined as a minimum of homology (or sequence identity) between sequences wherein the percentage of identical nucleotides after the sequences has been optimally aligned taking into account additions or deletions like gaps (for sequences of a given gene, present m genetically different sources like different organisms or for proteins or enzymes of the same family) .
• the degree of homology (or sequence identity) can vary a lot as homologous sequences may be only m one or several portions or all along the complete sequences. The parts or portions of the sequences that are identical m both sequences are said conserved.
• sequences showing a high degree of mvariance or homology are said to be highly conserved.
• Methods of alignment of sequences are based on local homology algorithms which have been computerised and are available as for example (but not limited to) Clustal ® , (Intelligenetics , Mountain Views, California), or GAP ® , BESTFIT ® , FASTA ® and TFASTA ® (Wisconsin Genetics Software Package, Genetics Computer Group Madison, Wisconsin, USA) or Boxshade ® .
• Target DNA sequences are amplified by classical methods like PCR using primers so that small fragments are produced which are then used for hybridisation on an array bearing the corresponding capture nucleotide sequences.
• RNA can be copied and retro- transc ⁇ pted m cDNA and amplified the same way if necessary.
• homology between the sequences to be detected m the sample is not too high (typically between 30 and 60%)
• the homologous sequences are amplified or copied (for instance by using the same primers) and the discrimination is obtained on the array using moderate length capture nucleotide sequences as proposed m the present invention.
• High sensitivity is obtained throughout the use of capture nucleotide sequences of moderate length similar to the sequences to detect.
• the specificity is obtained first during the amplification using specific primers for each sequence to be amplified or copied and secondly on the microarray.
• the different primers are used together m a multiplex PCR amplification before analysis on the biochips .
• primers specific for each target having also at their 3' end a base specific of the sequence to detect so that (m appropriate conditions) only the target sequence bearing the corresponding base will be copied and amplified by the polymerase .
• a semi-consensus multiplex PCR was tested by using a primer common for all sequences and a second primer specific of each homologous sequence. Specific capture nucleotide sequences of moderated length were selected for each sequence m a different part of the overall target sequence.
• multiple capture nucleotide sequences which recognise different parts of a same target are fixed to the array, which contain two or three capture nucleotide sequences binding to different parts of a given amplified sequence.
• the resulting signals for each of these spots are m a given ratio for a given target sequence, while it is different for another sequence which partly cross-reacts as the homology between two sequences is not homogeneous (with some parts being very different while others are more conserved) .
• the assay for RNA present m multiple copies m cells and m large amount like the 16s or 23s rRNA m procaryote cells or the 18s or 28s rRNA m eucaryote cells does not require necessarily amplification.
• the detection based on their hybridisation on microarray is particularly well suited since they show a high degree of homology between different species. It is possible to copy one specific part of the RNA by using a primer to start the copy and a blocking nucleotide sequence which binds to the RNA and stops the copying by the reverse transcriptase (example 5) .
• This blocking oligonucleotide has its 3' end blocked so that it can not be used by the transcriptase to start a copy.
• the most simple 3' block being a deoxy 3' carbon, but others like the presence of a pyrophosphate at the 3 1 carbon or a 2 ' , 3 ' -dideoxycarbon are also working.
• the 5 ' end of this blocking oligonucleotides is also modified like for example by a NH2 group in order to block transcriptase.
• the primer can also bear at its 3' end a base specific of a given sequence, in order to make a more specific copy. Therefore, different specific parts of the rRNA of different organisms can be copied making their detection on the array unequivocal since not only their sequence, but also their location will be specific.
• RNA messenger RNA
• mRNA messenger RNA
• mRNA messenger RNA
• PCR PCR PCR if necessary.
• mRNA messenger RNA
• the development of chemistry allows the covalent fixation to glass of nucleotides bearing a specific functional group (Lamture et al . , Nucleic Acid Res. 22, pp. 2121-2125 (1994)). By using aminoterminal groups present on the oligonucleotides, it is possible to obtain a covalent binding of nucleotides upon aldehyde groups present on the array.
• the capture nucleotide sequences are either chemically synthesised or produced by PCR (amplicons) and bounded to a functionalised glass by a robot and thereafter rendered single stranded.
• the capture nucleotide sequences have complementary sequences related to the target DNA to detect and have a similar, if not identical length. Difference of 50 % in the length still gives a high sensitivity binding.
• the array is constructed with an appropriated automate which deposits the capture nucleotide sequences at a given location which delimitates a spot. Triplicate of each capture nucleotide sequence plus the negative and positive controls (and possible standard sequences) are used.
• the array contains typically between 20 and 100 spots, but arrays going to 400 spots, 1000 or 10000 spots or more are possible. An array with 400 spots per cm 2 is obtained with pins of 0.2 mm at low cost. As the capture nucleotide sequences are present m a sufficient number, it allows the lecture of these spots with a great resolution with known detection apparatus.
• Binding of oligonucleotides sequences can be obtained through covalent or non-covalent binding on these supports m a direct or indirect reaction.
• One common method is to spot the capture nucleotide sequences on a surface where polylysine has been attached on glass or plastic through the binding of biotmylated oligonucleotides on streptavidm coated surfaces or through the use of proteins with binding affinity for oligonucleotides (EP-A-0491059) .
• Gel layers (US-A-5 , 552 , 270 and EP-0535242), copolyme ⁇ sation of acrylamide with vinyl bearing oligonucleotides (US-A-5 , 736 , 257) or other supports, which can be activated for covalent fixation of oligonucleotides, can be used for arrays.
• Plastic like polycarbonate as present on CD was activated m order to fix capture nucleotide sequences and be used as a bio-CD array (W099/35499) .
• Hybridisation between two DNA or RNA chains is a complex process which is initiated by the binding of a few (4-5) nucleotides which recognised themselves m a specific way and once they are bound a very fast process thermodynamically favourable elongation of the binding occurs along the sequence.
• the binding is thus dependent both of kinetic and thermodynamic parameters and experimental conditions can be adapted m order to modify both of them. Temperature accelerates the kinetic process but there is an optimum for the temperature used to obtain a maximum binding of the target .
• the salt concentration modifies the stringency conditions: more salts present m the solution, more easy will be the binding of the two chains.
• Preferred conditions are obtained with targets and capture nucleotide sequences of the same size and of moderate length.
• a very good yield of capture of the target on the capture nucleotide sequences can be obtained even if the targets are double stranded like after PCR amplification.
• the hybridisation of the target DNA is a competitive reaction: the target strand can hybridise on the fixed capture nucleotide sequence but can reassociate m solution with its complementary strand.
• the reaction m solution is always kmetically favourable due to the free movement of molecules m solution.
• the rate of reaction is proportional to the square root of the length of the shorter strand.
• the target sequences can be detected by current techniques. Without labelling, preferred methods are the identification of the target by mass spectrometry now adapted to the arrays (US-A-5, 821, 060) or by intercalating agents followed by fluorescent detection (W097/27329 or Fodor et al . , Nature 364, p. 555 (1993) ) .
• the labelled associated detections are numerous (see review in W0 97/27317) . They are obtained using either already labelled primer or by incorporation of labelled nucleotides during the copying or amplification step. A labelling can also be obtained by ligating a detectable moiety onto the RNA or DNA to be tested (a labelled oligonucleotide ligated at the end of the sequence by a ligase) . Fragment of RNA or DNA can also be incorporate labelled nucleotides at their 5 'OH or 3 'OH ends using a kinase, a transferase or a similar enzyme.
• Labels like fluorescent nucleotide sequences like Cy3 , Cy5 and Cy7 are suitable for analysing an array by using commercially available array scanners (General Scanning of Genetic Microsystem) . Radioactive labelling, cold labelling or labelling with small molecules recognised thereafter by specific ligands (streptavidin or antibodies) are common methods.
• the resulting signal of target fixation on the array is either fluorescent, colorimetric, diffusive, electroluminescent, bio- or chemiluminescent , magnetic, electric like impedometric or voltametric (US-A-5, 312, 527) .
• the two preferred embodiments of the invention are the fluorescent detection or the gold labelling of the bound target in order to obtain a precipitate or silver staining which is then easily detected and quantified by a scanner (EP-99870106.4) .
• the signal obtained for each spot is recorded and the mean of the signal is calculated for identical capture nucleotide sequences.
• at least two and preferably three to five identical spots are present on each array in order to correct for variation which can occur at any step of the process.
• the background value is identified either in the part of the array which has no capture nucleotide sequence or on spots bearing non specific capture nucleotide sequence (negative control).
• a positive control is preferably added (a DNA sequence which is added to the hybridisation solution and in which capture nucleotide sequence is present at least on one spot of the array) , to test for hybridisation step, solutions and conditions used and detection.
• Different positive nucleotide sequences present at various concentrations can also be added to the sample in order to obtain a reference curve for the signal. The various signals of the spots can then be compared to this reference curve.
• Quantification takes into account the hybridisation yield and detection scale on the array (which is identical for target and reference sequences) and the extraction, the amplification (or copying) and the labelling steps.
• Internal standard are used in quantification by the measurement of the target sequence compared to a given sequence (reference) and to which the other values will be compared.
• External standard can also be added to the sample for the quantification. If PCR is used, an internal standard contains at its extremities the same sequences as the target in order to be amplified by the same primers. It can also be of the same length, has the same GC content or even have a large part of its sequence identical to the target in order to be really competitive during the amplification step.
• Example 1 Detection of target nucleotide sequences on an array
• hybridisation solution 5 ⁇ l of hybridisation solution were loaded on glass slides bearing the capture nucleotide sequences.
• This mixture contained : SSC2X, SDS 4%, salmon sperm DNA 100 ⁇ g/ml, 2 nM biotmylated CMV amplicons of 437 bp and 10 nM of biotmylated target amplicons.
• Microarrays were covered with coverslips prewashed with ethanol 100%. Slides were denatured at 95 °C for 5 mm. The hybridisation was carried out at 65° for 2 h. Samples were washed 4 times with Maleic buffer 10 mM pH 7.5, NaCl 15 mM, Tween 0.1%.
• Example 2 Comparison of the sensi tivi ty obtained for hybridisation of a target sequence of medium size (155 bp) on capture nucleotide sequences of various length [0067] The protocols for capture nucleotide sequences immobilisation and silver staining detection are described m example 1. The capture nucleotide sequences and target DNA were obtained by amplification of CMV sequence by PCR using the following primers:
• Plasmid pAT153-E (containing the exon 4 of the MIE gene of HCMV DNA AD169 strain) was amplified by
• PCR in a 100 ⁇ l volume containing 1.5 mM MgCl 2 , 10 mM Tris pH 8.4, 50 mM KC1 , 1 ⁇ M of each primer, 100 ⁇ M of each dNTP, 2.5 U of Taq DNA polymerase Gold and 10 ng of plasmid pAT153-E.
• Samples were first denatured at 94 °C for 10 min to activate the polymerase. Then 40 cycles of amplification were performed consisting of 30 sec at 94 °C, 30 sec at 65 °C and 30 sec at 72 °C and a final extension step of 10 min at 72 °C. Water controls or 100 copies of plasmid DNA were used respectively as negative or positive controls of the amplification.
• PCR of target DNA also includes 100 ⁇ M of biotin-16-dUTP. [0069] The hybridisation step was carried out at 65 °C for 2 h in the presence of 100 fmoles of biotinylated target DNA.
• Example 3 Influence of the capture nucleotide sequence length on the yield of fixation of long target amplicons (437 bp)
• FemA genes corresponding to the different Staphylococcus species were amplified separately by multiplex PCR using the following primers: S. aureus 1 : 5' CTTTTGCTGATCGTGATGACAAA 3'
• S. epidermidis 1 5' TCGCGGTCCAGTAATAGATTATA 3'
• S . epidermidis 2 5' TGCATTTCCAGTTATTTCTCCC 3'
• saprophi ticus 1 5' TAAAATGAAACAACTCGGTTATAAG 3'
• saprophi ticus 2 5' AAACTATCCATACCATTAAGTACG 3'
• hominis 1 5' CGACCAGATAACAAAAAAGCACAA 3'
• Protocols for capture nucleotide sequences immobilisation, hybridisation and silver staining detection are the one described in example 2.
• Example 5 Detection of 16S rRNA from different bacteria by copying of a small portion of the sequence
• a specific sequence of the 16S rRNA sequence of three different bacteria E. coli , Bacteroides distasonis and Bifidobacterium longum was copied using both a starting nucleotide sequence and a blocking nucleotide sequence which hybridises on the 16S rRNA and stops the reverse transcription.
• the copy of a specific sequence was done on 2 ⁇ g of total RNA extracted from different bacteria. The following sequences were used as starting and blocking nucleotide sequences:
• the length of the synthetized cDNA are respectively of 240 bases, 273 bases and 236 bases.
• a nuclease free microtube 0.5 ⁇ g of the starting nucleotide sequence and 2 ⁇ g of the blocking nucleotide sequence were added to 2 ⁇ g total RNA extracted from bacteria. Nuclease free water was added to a final volume of 15 ⁇ l .
• the reverse transcription was conducted by adding the following components to the annealed nucleotide sequence /template : 5 ⁇ l of 5X AMV RT Buffer (250 mM Tris- HC1 pH 8.3, 250 mM KCl , 50 mM MgC12 50 mM DTT and 2.5 mM Spermidine) , 40 units of Rnasin ribonuclease inhibitor ( Promega, Madison, US) , 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 0.65 mM dTTP, 0.35 mM biotin dUTP and 30 units of AMV RT (

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Zoology (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Analytical Chemistry (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Molecular Biology (AREA)
• Immunology (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Apparatus Associated With Microorganisms And Enzymes (AREA)

Priority Applications (1)

Applications Claiming Priority (4)

Publications (1)

Family

ID=8243918

Family Applications (2)

Family Applications Before (1)

Country Status (4)

Families Citing this family (30)

Family Cites Families (7)

• 1999
  • 1999-10-28 EP EP99870226A patent/EP1096024A1/de not_active Withdrawn
• 2000
  • 2000-10-17 AU AU11210/01A patent/AU1121001A/en not_active Abandoned
  • 2000-10-17 WO PCT/BE2000/000123 patent/WO2001031055A2/en not_active Ceased
  • 2000-10-17 JP JP2001533190A patent/JP2003516724A/ja active Pending
  • 2000-10-17 EP EP00972485A patent/EP1224331A2/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events