EP1224331A2 - Methode und kit zum auffinden und/oder zur quantifizierung von multiplen homologen nukleinsäuresequenzen auf arrays - Google Patents

Methode und kit zum auffinden und/oder zur quantifizierung von multiplen homologen nukleinsäuresequenzen auf arrays

Info

Publication number
EP1224331A2
EP1224331A2 EP00972485A EP00972485A EP1224331A2 EP 1224331 A2 EP1224331 A2 EP 1224331A2 EP 00972485 A EP00972485 A EP 00972485A EP 00972485 A EP00972485 A EP 00972485A EP 1224331 A2 EP1224331 A2 EP 1224331A2
Authority
EP
European Patent Office
Prior art keywords
nucleotide sequences
sequences
capture
target
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00972485A
Other languages
English (en)
French (fr)
Inventor
José REMACLE
Nathalie Zammatteo
Françoise De Longueville
Isabelle Alexandre
Sandrine Hamels
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Eppendorf Array Technologies SA
Original Assignee
Facultes Universitaires Notre Dame de la Paix
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Facultes Universitaires Notre Dame de la Paix filed Critical Facultes Universitaires Notre Dame de la Paix
Priority to EP00972485A priority Critical patent/EP1224331A2/de
Publication of EP1224331A2 publication Critical patent/EP1224331A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/15Modifications characterised by incorporating a consensus or conserved sequence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Definitions

  • the present invention is related to a method and kit comprising reagents for simultaneous detection and/or quantification of multiple homologous nucleic acid sequences on arrays .
  • the development of miniaturisation, especially the array technology, allows the simultaneous detection of a great number of nucleotide sequences present in biological samples.
  • the array contains on its surface, series of discrete regions bearing capture nucleotide nucleotide sequences able to bind by hybridisation corresponding target nucleotide sequences. If the last ones are labelled, a signal can be detected and measured at the binding location and its intensity gives an estimation of the amount of target sequences present in the sample.
  • oligonucleotides Only small oligonucleotides are present on the surface, and are used for sequencing or identifying sequences m a pattern of positive spots corresponding to specific oligonucleotides present on the array. The identification of the target sequence is made by comparison of said pattern with a reference.
  • the documents 097/29212 and 098/28444 describe a similar technique with the use of capture nucleotide sequences comprising less than 30 nucleotides allowing an analysis of two different sequences that may differ by a single nucleotide. Small capture nucleotide sequences (between 10 and 20 nucleotides) are preferred since the discrimination between two oligonucleotides differing m one base is higher, when their length is smaller.
  • fragments are cut into smaller species and the method should require the use of numerous capture nucleotide sequences m order to obtain a pattern of signals which attest the presence of a given gene ( O97/10364 and 097/27317) .
  • short capture sequences are used, preferably about 45 nucleotides, and m practice, between 10 and 25 nucleotides.
  • the document 094/22889 describes electronic chips made of preconstructed oligonucleotides bearing a pyrol group used in an electropolymerisation step and allows the formation of a conducting polymer. This method is particularly suitable for the preparation of electronic chips bearing small capture nucleotide sequences.
  • the present invention aims to provide a new method to improve the detection and possibly the quantification of nucleotide sequences, preferably multiple homologous sequences, coming from different or the same organism, by hybridisation on single stranded capture nucleotide sequences, and which does not present the drawbacks of the state of the art.
  • the inventors have discovered that it is possible to provide a sensitive detection method (possibly combined with a quantification) of multiple nucleotide sequences upon an array, even if said multiple sequences are homologous and are present simultaneously in the sample submitted to the analysis. Until now, either the sensitivity was low or null or there was cross-reactivity between the different (but homologous) target sequences on the same capture nucleotide sequences.
  • the present invention is related to an (improved in sensitivity and specificity compared to known techniques) detection and/or quantification method of a nucleotide sequence from at least 4 others homologous sequences, possibly present in a biological sample, by the identification of a portion of its sequence, said method comprising the steps of:
  • capture nucleotide sequences having a (single stranded) length comprised between about 40 and about 400 bases, preferably between about 50 and about 350 bases, more preferably between about 100 and about 300 bases, even more preferably between about 120 and about 200 bases, said capture nucleotide sequences being bound to the insoluble solid support according to an array with a density of at least 5 different bound capture nucleotide sequences/cm 2 surface of solid support .
  • the method comprises also the step of detecting and/or possibly quantifying a signal (preferably from the label of the target nucleotide sequences) resulting from the formation of double stranded nucleotide sequences resulting from the hybridisation (of the capture and target nucleotide sequences) by base pairing.
  • a signal preferably from the label of the target nucleotide sequences
  • the labelling is preferably also obtained upon the amplified sequence previously to the denaturation (if the method comprises an amplification step) .
  • the biological sample can be any culture medium wherein microorganisms or pollutants are present, or an extract obtained from a plant or an animal (including a human) organ, tissue, cell or biological fluid.
  • the various steps of the method according to the invention can be done with various means well known by the person skilled m the art and described m the literature .
  • the method according to the invention can be performed by using a specific diagnostic and/or quantification kit comprising at least an insoluble solid support upon which capture nucleotide sequences are disposed (preferably bounded to the solid support by a covalent link) according to an array with a density of at least 5 different bound capture nucleotide sequences / cm 2 surface of the insoluble solid support, said capture nucleotide sequences having a length comprised between about 40 and about 400 bases or preferably a length as above-described.
  • the density of the capture nucleotide sequences upon the array of the solid support can be increased, for instance by having more than 10, 20, 50, 100, 1000, 10000 or more capture nucleotide sequences/cm 2 surface of solid support.
  • each capture nucleotide sequence is located in a specific area of the support. However, several capture nucleotide sequences can also be present in the same area to obtain specific information.
  • the kit according to the invention may also incorporate various media or devices for performing (preferably automatically) the method according to the invention.
  • Said kit can be included in an automatic device, such as a high throughput screening apparatus for the detection and/or the quantification of multiple nucleotide sequences present in a biological sample to be analysed.
  • Said kit or apparatus can be adapted for performing all the steps or only several specific steps of the method according to the invention.
  • the length of the single stranded capture nucleotide sequences is preferably identical to the length of the target nucleotide sequences to be detected and/or quantified or may differ, preferably by less than 50% in total length, more preferably less than 30% in total length, even more preferably less than 10% in total length.
  • the method, kit or apparatus according to the invention are suitable for the detection and/or the quantification of target nucleotide sequences which are made of DNA or RNA, including sequences which are partially or totally homologous upon their total length.
  • the method according to the invention can be performed even when the different original nucleotide sequences present between them an homology greater than 30%, greater than 60% or even greater than 80% or differ by few bases .
  • the capture nucleotide sequences are advantageously covalently bounded (or fixed) upon the insoluble solid support, preferably by one of their extremities as described hereafter.
  • the yield of hybridisation is advantageously greater than 10%, 50%, 70%, 80% or 90% or can achieve almost 100%.
  • the method, kit and apparatus according to the invention may comprise the use of other bounded capture nucleotide sequences (i.e.
  • the solid support according to the invention can be or can be made with materials selected from the group consisting of glasses, electronic devices, silicium or plastic support, compact discs, filters, metallic supports or a mixture thereof.
  • said solid support is a single glass plate which may comprise additional means (barcodes, markers, etc.) or media (coating, etc.) for improving the method according to the invention.
  • the amplification step(s) used m the method according to the invention is advantageously obtained by well known amplification protocols, preferably selected from the group consisting of PCR, LCR, CPR, NASBA, ICR or Avalanche DNA techniques.
  • the length of the target nucleotide sequences to be detected is determined by the conditions of the above- identified amplification protocols determined by the use of specific primers (and possibly blocking nucleotide sequences) for a retro-transcription of the 3 ' or 5 ' end of the original biological nucleotide sequences to be detected and/or quantified, especially if it is a RNA sequence.
  • said RNA sequences are 16S and 23S rRNA sequences or 18S and 28S rRNA sequences.
  • the target nucleotide sequences to be copied or amplified are obtained from different parts or portions of the corresponding (homologous) DNA or RNA original biological nucleotide sequence.
  • the primers used for the amplification preferably bear at their 3 ' end a base specific of one of the homologous sequences .
  • the method, kit or apparatus according to the invention is advantageously used for the detection and/or the quantification of different Staphylococci species or variants, preferably the Staphylococcus aureus , the Staphylococcus epidermidis, the Staphylococcus saprophyticus, the Staphylococcus hominis or the Staphylococcus haemolyticus present together or separately m a biological sample, said detection being obtained by detecting the genetic variants of the FemA gene m said different species, preferably by using specific locations m the FemA genetic sequence, as described m the document WO99/16780 incorporated herein by reference.
  • the primers and the specific portions of said FemA sequence used for obtaining amplified products are the ones described hereafter m the examples .
  • the method according to the invention may also comprise means for obtaining a quantification of target nucleotide sequences by using a standard nucleotide sequence (external or internal standard) which can be brought into contact with the capture nucleotide sequences bounded upon the array of the solid support m the same conditions as said target nucleotide sequences (possibly after amplification or copying) .
  • Said method comprises a step of quantification of a signal resulting from the formation of a double stranded nucleotide sequence formed by complementary base pairing between the capture nucleotide sequences and the standard nucleotide sequences and a step of a correlation analysis between the signal resulting from the formation of said double stranded nucleotide sequence and the signal resulting from the double stranded nucleotide sequence formed by complementary base pairing between capture nucleotide sequences and target nucleotide sequences m order to quantify the presence of the original nucleotide sequence to be detected and/or quantified m the biological sample (see also the document W098/11253 incorporated herein by reference) .
  • Said standard nucleotide sequence is advantageously included m the kit or apparatus according to the invention, possibly with the media and device (s) necessary for performing the different steps according to the invention, such as the hybridisation and culture media, polymerases, enzymes, standard sequences and labelling molecules.
  • Fig. 1 shows the influence of the capture nucleotide sequence length on the yield of hybridisation of target amplicons.
  • the target sequences were 155 bases long and 100 fmoles were incubated on a chips containing single stranded capture nucleotide sequences going from 23 to 437 bases long. The length of the capture nucleotide sequence is shown on the figure.
  • Fig. 2 schematically represents the FemA detection of 5 different species of Staphylococci. The locations of the 5 pairs of primers used for specific amplification of one of the 5 different sequences belonging to the 5 Staphylococci species are shown on the FemA sequence.
  • Fig. 3 schematically represents the detection of rRNA by the copy of small portions of the sequence either at its 5 ' end using one starting nucleotide sequence or along its sequence using both a starting nucleotide sequence and a blocking nucleotide sequence. The small copied sequences are then hybridised on the array of the chips .
  • nucleoside t ⁇ phosphate refers to nucleosides present m either DNA or RNA and thus includes nucleosides which incorporate adenme, cytosme, guanme, thymme and uracil or other modified bases (i.e. 8-azaguanme and hypoxanthme) as bases, the sugar moieties being deoxy ⁇ bose or ⁇ bose .
  • nucleotide refers to nucleosides present m nucleic acids (either DNA or RNA) compared with the bases of said nucleic acid, and includes nucleotides comprising usual or modified bases as above described.
  • references to nucleotide (s) , oligonucleotide (s) and the like include analogous species wherein the sugar- phosphate backbone is modified and/or replaced, provided that its hybridisation properties are not destroyed (the backbone may be replaced by an equivalent synthetic peptide, Peptide Nucleic Acid (PNA) ) .
  • PNA Peptide Nucleic Acid
  • the primer sequence need not reflect the exact sequence of the template to be amplified or copied provided that under hybridising conditions the primers can be used m a genetic amplification. Mismatched bases can be introduced into the primer sequence to provide altered hybridisation introduced into the primer sequence to provide altered hybridisation stringency (amplification or copying of the same regions of homologous sequences by the same primers) .
  • capture or target nucleotide sequences, target nucleic acid, hybridising specifically to, background, quantifying are defined as m WO97/10365, incorporated herein by reference.
  • homologous sequences mean nucleotide sequences having the same nucleotide at corresponding positions. They are generally defined as a minimum of homology (or sequence identity) between sequences wherein the percentage of identical nucleotides after the sequences has been optimally aligned taking into account additions or deletions like gaps (for sequences of a given gene, present m genetically different sources like different organisms or for proteins or enzymes of the same family) .
  • the degree of homology (or sequence identity) can vary a lot as homologous sequences may be only m one or several portions or all along the complete sequences. The parts or portions of the sequences that are identical m both sequences are said conserved.
  • sequences showing a high degree of mvariance or homology are said to be highly conserved.
  • Methods of alignment of sequences are based on local homology algorithms which have been computerised and are available as for example (but not limited to) Clustal ® , (Intelligenetics , Mountain Views, California), or GAP ® , BESTFIT ® , FASTA ® and TFASTA ® (Wisconsin Genetics Software Package, Genetics Computer Group Madison, Wisconsin, USA) or Boxshade ® .
  • Target DNA sequences are amplified by classical methods like PCR using primers so that small fragments are produced which are then used for hybridisation on an array bearing the corresponding capture nucleotide sequences.
  • RNA can be copied and retro- transc ⁇ pted m cDNA and amplified the same way if necessary.
  • homology between the sequences to be detected m the sample is not too high (typically between 30 and 60%)
  • the homologous sequences are amplified or copied (for instance by using the same primers) and the discrimination is obtained on the array using moderate length capture nucleotide sequences as proposed m the present invention.
  • High sensitivity is obtained throughout the use of capture nucleotide sequences of moderate length similar to the sequences to detect.
  • the specificity is obtained first during the amplification using specific primers for each sequence to be amplified or copied and secondly on the microarray.
  • the different primers are used together m a multiplex PCR amplification before analysis on the biochips .
  • primers specific for each target having also at their 3' end a base specific of the sequence to detect so that (m appropriate conditions) only the target sequence bearing the corresponding base will be copied and amplified by the polymerase .
  • a semi-consensus multiplex PCR was tested by using a primer common for all sequences and a second primer specific of each homologous sequence. Specific capture nucleotide sequences of moderated length were selected for each sequence m a different part of the overall target sequence.
  • multiple capture nucleotide sequences which recognise different parts of a same target are fixed to the array, which contain two or three capture nucleotide sequences binding to different parts of a given amplified sequence.
  • the resulting signals for each of these spots are m a given ratio for a given target sequence, while it is different for another sequence which partly cross-reacts as the homology between two sequences is not homogeneous (with some parts being very different while others are more conserved) .
  • the assay for RNA present m multiple copies m cells and m large amount like the 16s or 23s rRNA m procaryote cells or the 18s or 28s rRNA m eucaryote cells does not require necessarily amplification.
  • the detection based on their hybridisation on microarray is particularly well suited since they show a high degree of homology between different species. It is possible to copy one specific part of the RNA by using a primer to start the copy and a blocking nucleotide sequence which binds to the RNA and stops the copying by the reverse transcriptase (example 5) .
  • This blocking oligonucleotide has its 3' end blocked so that it can not be used by the transcriptase to start a copy.
  • the most simple 3' block being a deoxy 3' carbon, but others like the presence of a pyrophosphate at the 3 1 carbon or a 2 ' , 3 ' -dideoxycarbon are also working.
  • the 5 ' end of this blocking oligonucleotides is also modified like for example by a NH2 group in order to block transcriptase.
  • the primer can also bear at its 3' end a base specific of a given sequence, in order to make a more specific copy. Therefore, different specific parts of the rRNA of different organisms can be copied making their detection on the array unequivocal since not only their sequence, but also their location will be specific.
  • RNA messenger RNA
  • mRNA messenger RNA
  • mRNA messenger RNA
  • PCR PCR PCR if necessary.
  • mRNA messenger RNA
  • the development of chemistry allows the covalent fixation to glass of nucleotides bearing a specific functional group (Lamture et al . , Nucleic Acid Res. 22, pp. 2121-2125 (1994)). By using aminoterminal groups present on the oligonucleotides, it is possible to obtain a covalent binding of nucleotides upon aldehyde groups present on the array.
  • the capture nucleotide sequences are either chemically synthesised or produced by PCR (amplicons) and bounded to a functionalised glass by a robot and thereafter rendered single stranded.
  • the capture nucleotide sequences have complementary sequences related to the target DNA to detect and have a similar, if not identical length. Difference of 50 % in the length still gives a high sensitivity binding.
  • the array is constructed with an appropriated automate which deposits the capture nucleotide sequences at a given location which delimitates a spot. Triplicate of each capture nucleotide sequence plus the negative and positive controls (and possible standard sequences) are used.
  • the array contains typically between 20 and 100 spots, but arrays going to 400 spots, 1000 or 10000 spots or more are possible. An array with 400 spots per cm 2 is obtained with pins of 0.2 mm at low cost. As the capture nucleotide sequences are present m a sufficient number, it allows the lecture of these spots with a great resolution with known detection apparatus.
  • Binding of oligonucleotides sequences can be obtained through covalent or non-covalent binding on these supports m a direct or indirect reaction.
  • One common method is to spot the capture nucleotide sequences on a surface where polylysine has been attached on glass or plastic through the binding of biotmylated oligonucleotides on streptavidm coated surfaces or through the use of proteins with binding affinity for oligonucleotides (EP-A-0491059) .
  • Gel layers (US-A-5 , 552 , 270 and EP-0535242), copolyme ⁇ sation of acrylamide with vinyl bearing oligonucleotides (US-A-5 , 736 , 257) or other supports, which can be activated for covalent fixation of oligonucleotides, can be used for arrays.
  • Plastic like polycarbonate as present on CD was activated m order to fix capture nucleotide sequences and be used as a bio-CD array (W099/35499) .
  • Hybridisation between two DNA or RNA chains is a complex process which is initiated by the binding of a few (4-5) nucleotides which recognised themselves m a specific way and once they are bound a very fast process thermodynamically favourable elongation of the binding occurs along the sequence.
  • the binding is thus dependent both of kinetic and thermodynamic parameters and experimental conditions can be adapted m order to modify both of them. Temperature accelerates the kinetic process but there is an optimum for the temperature used to obtain a maximum binding of the target .
  • the salt concentration modifies the stringency conditions: more salts present m the solution, more easy will be the binding of the two chains.
  • Preferred conditions are obtained with targets and capture nucleotide sequences of the same size and of moderate length.
  • a very good yield of capture of the target on the capture nucleotide sequences can be obtained even if the targets are double stranded like after PCR amplification.
  • the hybridisation of the target DNA is a competitive reaction: the target strand can hybridise on the fixed capture nucleotide sequence but can reassociate m solution with its complementary strand.
  • the reaction m solution is always kmetically favourable due to the free movement of molecules m solution.
  • the rate of reaction is proportional to the square root of the length of the shorter strand.
  • the target sequences can be detected by current techniques. Without labelling, preferred methods are the identification of the target by mass spectrometry now adapted to the arrays (US-A-5, 821, 060) or by intercalating agents followed by fluorescent detection (W097/27329 or Fodor et al . , Nature 364, p. 555 (1993) ) .
  • the labelled associated detections are numerous (see review in W0 97/27317) . They are obtained using either already labelled primer or by incorporation of labelled nucleotides during the copying or amplification step. A labelling can also be obtained by ligating a detectable moiety onto the RNA or DNA to be tested (a labelled oligonucleotide ligated at the end of the sequence by a ligase) . Fragment of RNA or DNA can also be incorporate labelled nucleotides at their 5 'OH or 3 'OH ends using a kinase, a transferase or a similar enzyme.
  • Labels like fluorescent nucleotide sequences like Cy3 , Cy5 and Cy7 are suitable for analysing an array by using commercially available array scanners (General Scanning of Genetic Microsystem) . Radioactive labelling, cold labelling or labelling with small molecules recognised thereafter by specific ligands (streptavidin or antibodies) are common methods.
  • the resulting signal of target fixation on the array is either fluorescent, colorimetric, diffusive, electroluminescent, bio- or chemiluminescent , magnetic, electric like impedometric or voltametric (US-A-5, 312, 527) .
  • the two preferred embodiments of the invention are the fluorescent detection or the gold labelling of the bound target in order to obtain a precipitate or silver staining which is then easily detected and quantified by a scanner (EP-99870106.4) .
  • the signal obtained for each spot is recorded and the mean of the signal is calculated for identical capture nucleotide sequences.
  • at least two and preferably three to five identical spots are present on each array in order to correct for variation which can occur at any step of the process.
  • the background value is identified either in the part of the array which has no capture nucleotide sequence or on spots bearing non specific capture nucleotide sequence (negative control).
  • a positive control is preferably added (a DNA sequence which is added to the hybridisation solution and in which capture nucleotide sequence is present at least on one spot of the array) , to test for hybridisation step, solutions and conditions used and detection.
  • Different positive nucleotide sequences present at various concentrations can also be added to the sample in order to obtain a reference curve for the signal. The various signals of the spots can then be compared to this reference curve.
  • Quantification takes into account the hybridisation yield and detection scale on the array (which is identical for target and reference sequences) and the extraction, the amplification (or copying) and the labelling steps.
  • Internal standard are used in quantification by the measurement of the target sequence compared to a given sequence (reference) and to which the other values will be compared.
  • External standard can also be added to the sample for the quantification. If PCR is used, an internal standard contains at its extremities the same sequences as the target in order to be amplified by the same primers. It can also be of the same length, has the same GC content or even have a large part of its sequence identical to the target in order to be really competitive during the amplification step.
  • Example 1 Detection of target nucleotide sequences on an array
  • hybridisation solution 5 ⁇ l of hybridisation solution were loaded on glass slides bearing the capture nucleotide sequences.
  • This mixture contained : SSC2X, SDS 4%, salmon sperm DNA 100 ⁇ g/ml, 2 nM biotmylated CMV amplicons of 437 bp and 10 nM of biotmylated target amplicons.
  • Microarrays were covered with coverslips prewashed with ethanol 100%. Slides were denatured at 95 °C for 5 mm. The hybridisation was carried out at 65° for 2 h. Samples were washed 4 times with Maleic buffer 10 mM pH 7.5, NaCl 15 mM, Tween 0.1%.
  • Example 2 Comparison of the sensi tivi ty obtained for hybridisation of a target sequence of medium size (155 bp) on capture nucleotide sequences of various length [0067] The protocols for capture nucleotide sequences immobilisation and silver staining detection are described m example 1. The capture nucleotide sequences and target DNA were obtained by amplification of CMV sequence by PCR using the following primers:
  • Plasmid pAT153-E (containing the exon 4 of the MIE gene of HCMV DNA AD169 strain) was amplified by
  • PCR in a 100 ⁇ l volume containing 1.5 mM MgCl 2 , 10 mM Tris pH 8.4, 50 mM KC1 , 1 ⁇ M of each primer, 100 ⁇ M of each dNTP, 2.5 U of Taq DNA polymerase Gold and 10 ng of plasmid pAT153-E.
  • Samples were first denatured at 94 °C for 10 min to activate the polymerase. Then 40 cycles of amplification were performed consisting of 30 sec at 94 °C, 30 sec at 65 °C and 30 sec at 72 °C and a final extension step of 10 min at 72 °C. Water controls or 100 copies of plasmid DNA were used respectively as negative or positive controls of the amplification.
  • PCR of target DNA also includes 100 ⁇ M of biotin-16-dUTP. [0069] The hybridisation step was carried out at 65 °C for 2 h in the presence of 100 fmoles of biotinylated target DNA.
  • Example 3 Influence of the capture nucleotide sequence length on the yield of fixation of long target amplicons (437 bp)
  • FemA genes corresponding to the different Staphylococcus species were amplified separately by multiplex PCR using the following primers: S. aureus 1 : 5' CTTTTGCTGATCGTGATGACAAA 3'
  • S. epidermidis 1 5' TCGCGGTCCAGTAATAGATTATA 3'
  • S . epidermidis 2 5' TGCATTTCCAGTTATTTCTCCC 3'
  • saprophi ticus 1 5' TAAAATGAAACAACTCGGTTATAAG 3'
  • saprophi ticus 2 5' AAACTATCCATACCATTAAGTACG 3'
  • hominis 1 5' CGACCAGATAACAAAAAAGCACAA 3'
  • Protocols for capture nucleotide sequences immobilisation, hybridisation and silver staining detection are the one described in example 2.
  • Example 5 Detection of 16S rRNA from different bacteria by copying of a small portion of the sequence
  • a specific sequence of the 16S rRNA sequence of three different bacteria E. coli , Bacteroides distasonis and Bifidobacterium longum was copied using both a starting nucleotide sequence and a blocking nucleotide sequence which hybridises on the 16S rRNA and stops the reverse transcription.
  • the copy of a specific sequence was done on 2 ⁇ g of total RNA extracted from different bacteria. The following sequences were used as starting and blocking nucleotide sequences:
  • the length of the synthetized cDNA are respectively of 240 bases, 273 bases and 236 bases.
  • a nuclease free microtube 0.5 ⁇ g of the starting nucleotide sequence and 2 ⁇ g of the blocking nucleotide sequence were added to 2 ⁇ g total RNA extracted from bacteria. Nuclease free water was added to a final volume of 15 ⁇ l .
  • the reverse transcription was conducted by adding the following components to the annealed nucleotide sequence /template : 5 ⁇ l of 5X AMV RT Buffer (250 mM Tris- HC1 pH 8.3, 250 mM KCl , 50 mM MgC12 50 mM DTT and 2.5 mM Spermidine) , 40 units of Rnasin ribonuclease inhibitor ( Promega, Madison, US) , 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 0.65 mM dTTP, 0.35 mM biotin dUTP and 30 units of AMV RT (

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
EP00972485A 1999-10-28 2000-10-17 Methode und kit zum auffinden und/oder zur quantifizierung von multiplen homologen nukleinsäuresequenzen auf arrays Withdrawn EP1224331A2 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP00972485A EP1224331A2 (de) 1999-10-28 2000-10-17 Methode und kit zum auffinden und/oder zur quantifizierung von multiplen homologen nukleinsäuresequenzen auf arrays

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP99870226A EP1096024A1 (de) 1999-10-28 1999-10-28 Verfahren und Reagentiensatz zum Auswählen und/oder Quantifizieren von multiplen homologen Nukleinsäuresequenzen unter Verwendung von Sondenanordnungen
EP99870226 1999-10-28
PCT/BE2000/000123 WO2001031055A2 (en) 1999-10-28 2000-10-17 Method and kit for the screening and/or the quantification of multiple homologous nucleic acid sequences on arrays
EP00972485A EP1224331A2 (de) 1999-10-28 2000-10-17 Methode und kit zum auffinden und/oder zur quantifizierung von multiplen homologen nukleinsäuresequenzen auf arrays

Publications (1)

Publication Number Publication Date
EP1224331A2 true EP1224331A2 (de) 2002-07-24

Family

ID=8243918

Family Applications (2)

Application Number Title Priority Date Filing Date
EP99870226A Withdrawn EP1096024A1 (de) 1999-10-28 1999-10-28 Verfahren und Reagentiensatz zum Auswählen und/oder Quantifizieren von multiplen homologen Nukleinsäuresequenzen unter Verwendung von Sondenanordnungen
EP00972485A Withdrawn EP1224331A2 (de) 1999-10-28 2000-10-17 Methode und kit zum auffinden und/oder zur quantifizierung von multiplen homologen nukleinsäuresequenzen auf arrays

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP99870226A Withdrawn EP1096024A1 (de) 1999-10-28 1999-10-28 Verfahren und Reagentiensatz zum Auswählen und/oder Quantifizieren von multiplen homologen Nukleinsäuresequenzen unter Verwendung von Sondenanordnungen

Country Status (4)

Country Link
EP (2) EP1096024A1 (de)
JP (1) JP2003516724A (de)
AU (1) AU1121001A (de)
WO (1) WO2001031055A2 (de)

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7875440B2 (en) 1998-05-01 2011-01-25 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US7501245B2 (en) 1999-06-28 2009-03-10 Helicos Biosciences Corp. Methods and apparatuses for analyzing polynucleotide sequences
US6818395B1 (en) 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US7875442B2 (en) 2000-03-24 2011-01-25 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
US7829313B2 (en) 2000-03-24 2010-11-09 Eppendorf Array Technologies Identification and quantification of a plurality of biological (micro)organisms or their components
JP2004523243A (ja) 2001-03-12 2004-08-05 カリフォルニア インスティチュート オブ テクノロジー 非同期性塩基伸長によってポリヌクレオチド配列を分析するための方法および装置
WO2004001412A1 (ja) * 2002-06-24 2003-12-31 Canon Kabushiki Kaisha 標準プローブを持つdnaマイクロアレイ及び該アレイを有するキット
CN100494399C (zh) * 2003-06-30 2009-06-03 清华大学 一种基于dna芯片的基因分型方法及其应用
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
US8227192B2 (en) 2003-11-26 2012-07-24 Advandx, Inc. Peptide nucleic acid probes for analysis of certain Staphylococcus species
EP1709198B1 (de) 2003-11-26 2013-08-14 AdvanDx, Inc. Peptid-nukleinsäure-sonden zur analyse bestimmter staphylococcus spezies
FR2864550B1 (fr) * 2003-12-29 2006-02-24 Commissariat Energie Atomique Puce d'analyse avec gamme etalon, trousses et procedes d'analyse.
WO2005080605A2 (en) 2004-02-19 2005-09-01 Helicos Biosciences Corporation Methods and kits for analyzing polynucleotide sequences
US7635562B2 (en) 2004-05-25 2009-12-22 Helicos Biosciences Corporation Methods and devices for nucleic acid sequence determination
US7476734B2 (en) 2005-12-06 2009-01-13 Helicos Biosciences Corporation Nucleotide analogs
DE102004025710A1 (de) * 2004-05-26 2005-12-22 Eppendorf Ag Verfahren zur taxonspezifischen Zellidentifizierung und Zellsortierung auf grampositive Bakterien und Vorrichtungen hierfür
US7338763B2 (en) * 2004-06-02 2008-03-04 Eppendorf Array Technologies S.A. Method and kit for the detection and/or quantification of homologous nucleotide sequences on arrays
US7220549B2 (en) 2004-12-30 2007-05-22 Helicos Biosciences Corporation Stabilizing a nucleic acid for nucleic acid sequencing
US7482120B2 (en) 2005-01-28 2009-01-27 Helicos Biosciences Corporation Methods and compositions for improving fidelity in a nucleic acid synthesis reaction
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
ATE389035T1 (de) 2005-09-13 2008-03-15 Eppendorf Array Tech Sa Verfahren zum nachweis von homologen sequenzen, welche sich durch eine base unterscheiden, auf einem mikroarray
US7397546B2 (en) 2006-03-08 2008-07-08 Helicos Biosciences Corporation Systems and methods for reducing detected intensity non-uniformity in a laser beam
EP1935496A1 (de) 2006-12-22 2008-06-25 Eppendorf Array Technologies SA Vorrichtung und/oder Verfahren zur Detektion erweiterter Nukleotidsequenzen auf Mikro-Arrays
EP2077336A1 (de) 2007-12-19 2009-07-08 Koninklijke Philips Electronics N.V. Vorrichtung und Verfahren zur parallelen quantitativen Analyse mehrerer Nukleinsäuren
EP2138232A1 (de) 2008-06-23 2009-12-30 Koninklijke Philips Electronics N.V. Nachweis eingefangender Aliquoten amplifizierter Nukleinsäuren
EP2138588A1 (de) 2008-06-23 2009-12-30 Koninklijke Philips Electronics N.V. Messung der Schmelzkurve während der Amplifizierung
EP2138587A1 (de) 2008-06-23 2009-12-30 Koninklijke Philips Electronics N.V. Nukleinsäureamplifikation unter Verwendung von Temperaturzonen
WO2011011535A2 (en) 2009-07-21 2011-01-27 Gen-Probe Incorporated Methods and compositions for quantitative detection of nucleic acid sequences over an extended dynamic range
EP2441520A1 (de) 2010-10-12 2012-04-18 Eppendorf AG Echtzeitverstärkungs- und Mikroarray-basierte Erkennung von Nukleinsäuretargets in einem Fluss-Chip-Assay

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4888278A (en) * 1985-10-22 1989-12-19 University Of Massachusetts Medical Center In-situ hybridization to detect nucleic acid sequences in morphologically intact cells
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
EP0656068B1 (de) * 1992-07-24 1999-12-15 University Of South Australia Vervielfältigungs- und detektionsprozess
WO1997027317A1 (en) * 1996-01-23 1997-07-31 Affymetrix, Inc. Nucleic acid analysis techniques
US6228575B1 (en) * 1996-02-08 2001-05-08 Affymetrix, Inc. Chip-based species identification and phenotypic characterization of microorganisms
WO1998011253A2 (fr) * 1996-09-09 1998-03-19 Remacle Jose Procede et trousse de diagnostic et/ou de quantification par hybridation de type sandwich de sequences d'acides nucleiques sur support solide
JP2001518283A (ja) * 1997-09-26 2001-10-16 ユニヴェルシテ カトリク ド ルヴァン ブドウ球菌株の同定のための遺伝子配列、診断及び/又は定量法及び装置

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0131055A2 *

Also Published As

Publication number Publication date
WO2001031055A3 (en) 2001-12-20
WO2001031055A2 (en) 2001-05-03
EP1096024A1 (de) 2001-05-02
JP2003516724A (ja) 2003-05-20
AU1121001A (en) 2001-05-08

Similar Documents

Publication Publication Date Title
WO2001031055A2 (en) Method and kit for the screening and/or the quantification of multiple homologous nucleic acid sequences on arrays
US7205104B2 (en) Identification of biological (micro) organisms by detection of their homologous nucleotide sequences on arrays
US7202026B2 (en) Identification of a large number of biological (micro)organisms groups at different levels by their detection on a same array
WO2001032672A1 (en) Preparation of nucleic acid samples
US20080085515A1 (en) Identification of multiple biological (micro) organisms by detection of their nucleotide sequences on arrays
EP1788098A1 (de) Entwurf von Fängerproben für den hochempfindlichen Nachweis von Amplifikationsprodukten
US7816502B2 (en) Authentication of biologic materials using DNA-DNA hybridization on a solid support
US20070117106A1 (en) Identification and/or quantification method of nucleotide sequence (s) elements specific of genetically modified plants on arrays
EP1290228B1 (de) Umgekehrter nachweis zur identifizierung und/oder quantifizierung von nukleotid-zielsequenzen mittels biochips
SK287793B6 (sk) Spôsob stanovenia molekúl nukleových kyselín
EP1612282B1 (de) Sondensatz und Substrat zum Nachweis von Nukleinsäuren
US20070298423A1 (en) Identification of multiple biological (micro) organisms by specific amplification and detection of their nucleotide sequences on arrays
EP1602735A2 (de) Verfahren und Kit für die Detektion und/oder Quantifizierung der homologen Nukleotidsequenzen auf einem Array
EP1136566A1 (de) Methode und Kit zum Nachweis und/oder Quantifizierung von homologen Sequenzen mittels Arrays
WO2007133740A1 (en) Method for identification of novel physical linkage of genomic sequences
EP1593745B1 (de) Personalisierte Mikroarrays and ihre Verwendung zum Nachweis von Zielmolekülen
EP1723260A2 (de) Repräsentation von nukleinsäure unter verwendung von spaltprodukten der typ iib restriktionsendonuklease
WO2003048727A2 (en) Identification of rearrangements in nucleic acid molecules
US20100099860A1 (en) Capture molecules for the detection of amplicons with high sensitivity
US20060281112A1 (en) Design of capture molecules for the detection of amplicons with high sensitivity
WO2007132001A1 (en) Design of capture molecules for the detection of amplicons with high sensitivity
US20050250109A1 (en) Customized micro-array construction and its use for target molecule detection
EP1762628B1 (de) Verfahren zum Nachweis von homologen Sequenzen, welche sich durch eine Base unterscheiden, auf einem Mikroarray
EP2027289A1 (de) Konstruktion von einfangmolekülen zum nachweis von amplifikaten mit hoher empfindlichkeit
EP1113080A2 (de) Persöhnliche Genbibliothek

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020430

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20031030

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EPPENDORF ARRAY TECHNOLOGIES SA (EAT)

17Q First examination report despatched

Effective date: 20031030

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20071009