EP1190083A2 - Produits de synthese d'adn a base d'eif 4a promoteur de gene - Google Patents

Produits de synthese d'adn a base d'eif 4a promoteur de gene

Info

Publication number
EP1190083A2
EP1190083A2 EP00942269A EP00942269A EP1190083A2 EP 1190083 A2 EP1190083 A2 EP 1190083A2 EP 00942269 A EP00942269 A EP 00942269A EP 00942269 A EP00942269 A EP 00942269A EP 1190083 A2 EP1190083 A2 EP 1190083A2
Authority
EP
European Patent Office
Prior art keywords
promoter
gene
construct
intron
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00942269A
Other languages
German (de)
English (en)
Inventor
David Robert Sir William Dunn Sch. Path. GREAVES
Lindy Thomsen
Ian Richard Catchpole
Martin James Ford
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Glaxo Group Ltd
Original Assignee
Glaxo Group Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9915638.2A external-priority patent/GB9915638D0/en
Priority claimed from GBGB9929547.9A external-priority patent/GB9929547D0/en
Application filed by Glaxo Group Ltd filed Critical Glaxo Group Ltd
Publication of EP1190083A2 publication Critical patent/EP1190083A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/46—Vector systems having a special element relevant for transcription elements influencing chromatin structure, e.g. scaffold/matrix attachment region, methylation free island
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian

Definitions

  • the present invention concerns novel DNA constructs, host cells comprising said constructs, methods and processes for the production of a desired protein, particularly a therapeutically useful protein, DNA vaccines and other medicaments comprising said constructs and methods of gene therapy using said constructs.
  • Eukaryotic Initiation Factor 4A is a 43kD protein with RNA helicase activity that mediates binding of mRNA to the 40S subunit of the ribosome.
  • elF4A Eukaryotic Initiation Factor 4A
  • the two elF4A genes are differentially regulated in the mouse with elF4A, mRNA being expressed at higher levels than the elF4A M mRNA in dividing cells with the elF4A
  • the homologous elF-4AI and elF-4AII genes have been mapped to chromosomes 17p13 and 18p11.2 respectively (4,5).
  • elF-4AI In common with many other 'housekeeping genes' the gene encoding elF-4AI must be expressed in every mammalian cell type at approximately similar levels. Many housekeeping gene promoters do not contain TATA box sequences to direct transcription initiation but rather have GC rich promoters that contain binding sites for the transcription factor Sp1 and initiator elements (6). Many housekeeping gene promoters contain a higher than expected frequency of the dinucleotide CpG and these regions are not as extensively methylated as other CpG dinucleotides elsewhere in the genome (7). Such Methylation Free Islands (MFI) are often associated with transcriptional regulatory regions of genes and are thought to act by maintaining adjacent chromatin regions in an open configuration (8).
  • MFI Methylation Free Islands
  • a DNA construct comprising a transcriptional regulatory sequence operatively linked to a heterologous gene of interest wherein the transcriptional regulatory sequence comprises a transcriptional regulatory polynucleotide which is the elF4A gene promoter, a fragment thereof or a polynucleotide hybridisable thereto.
  • the construct comprises at least one Eif4a gene intron, fragment thereof or polynucleotide hybridisable thereto.
  • the elF4a gene intron is intron 1 , 2, 3, 5, 6, 7 or 9.
  • a host cell comprising a DNA construct as hereinbefore described.
  • a process for the production of a protein of interest comprises the step of culturing said cells as hereinbefore described.
  • a DNA vaccine comprising the construct as hereinbefore described.
  • Methods for the treatment, including prophylatically where appropriate, of diseases or disorders comprising the step of administrating said vaccine are also provided.
  • Gene therapy methods comprising the step of administrating said construct are also provided.
  • the present invention provides DNA constructs that are capable of expressing a gene of interest over a longer time period than provided for by the viral promoters such as the human CMV promoter. Such expression characteristics are particularly beneficial where long term expression is required such as in gene therapy, vaccination treatments and in the commercial production of proteins.
  • the heterologous gene of interest is a gene which does not code for elF4a.
  • the heterologous gene of interest encodes a protein of interest.
  • the construct of the present invention is non- chromosomal e.g. a phage, plasmid, virus, minichromosome or transposon.
  • plasmid is particularly preferred.
  • SEQ.I.D.NO:38 sets forth the sequence of the human elF4A1 promoter from position -526.
  • the polynucleotide is preferably derived from a mammalian source, particularly murine, rattus or human, preferably human.
  • Fragments of the elF4AI promoter may be used in place of, or in addition to the full length promoter sequence so long as they retain the biological characteristic of a promoter when incorporated into constructs of the present invention. Indeed, the present inventors have demonstrated that such fragments may be obtained from the full length elF4AI promoter sequence. Accordingly, such fragments include -526EIF, -371 EIF, -271 EIF, -193EIF, -120EIF, -98EIF, -69EIF and -40EIF.
  • variants of the wild type elF4AI promoter sequence are also encompassed within the present invention. Such variants may be naturally occurring variants which may have a substitution, deletion or insertion of one or more bases. Variants also include non-naturally occurring variants in which one or more bases have been added, substituted, inserted, deleted, rearranged or modified yet retain promoter characteristics. Also encompassed within the scope of the present invention are variants having at least 90% identity with the elF4AI promoter or fragment thereof, e.g. 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity.
  • Hybridisation is preferably under stringent hybridisation conditions.
  • stringent hybridisation conditions is where attempted hybridisation is carried out at a temperature of from about 35°C to about 65°C using a salt solution which is about 0.9 molar.
  • salt solution which is about 0.9 molar.
  • the transcriptional regulatory sequence comprises least one elF4A intron, fragment thereof or polynucleotide hybridisable thereto.
  • the intron is derivable from intron 1 , 2, 3, 5, 6, 7 or 9.
  • a fragment of the intron will retain the transcriptional regulatory function of the intron and is typically at least 15, 20, 50 or 100 nucleotides long.
  • the polynucleotide is derived from intron 1 of the elF4AI gene. It is preferred that the intron polynucleotide is derived from a mammalian source, e.g. murine, rattus or human, preferably human.
  • Variants of the intron sequence in which one or more bases have been added, substituted, inserted, deleted, rearranged or modified yet retain enhancer characteristics are also encompassed within the invention.
  • Variants of the transcriptional regulatory sequence having at least 90% identity e.g. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% are also provided.
  • constructs may comprise a transcriptional regulatory sequence comprising a polynucleotide derivable from the elF4A promoter or fragment thereof and a plurality of elF4AI gene introns.
  • the additional intron sequence may be the same or different from the preceding intron.
  • the polynucleotide comprises the elF4AI promoter sequence or fragment thereof and elF4AI intron sequence or fragment thereof arranged in tandem in forward or reverse orientation.
  • the intron sequence and promoter sequence may be co-terminus or spaced apart.
  • the intron sequence may be upstream or more preferably downstream (in terms of reading frame) of the elF4A promoter sequence.
  • Chimaeric constructs e.g. one in which the polynucleotide comprises the elF4A promoter or fragment thereof derived from a first species and the intron sequence derived from a second species are also envisaged.
  • the promoter sequence is produced by recombinant means, such techniques being standard and well known to those skilled in the art.
  • Constructs of the present invention may further comprise other elements such as a terminator sequence and a selectable marker, bacterial origin of replication, antibiotic resistance gene and a signal peptide gene for secretion if necessary.
  • Constructs of the present invention are preferably incorporated into a host cell for gene expression although cell-free translation systems are not excluded.
  • the incorporation of the constructs may be achieved by methods well known to those skilled in the art, e.g. P1 transduction.
  • Suitable host cells maybe prokaryotic or eukaryotic, preferably eukaryotic, even more preferably mammalian.
  • Host cells may be fully differentiated, pluripotent stem cells or other precursor cells.
  • the present invention is particularly advantageous in directing high level persistent expression of a gene of interest in professional antigen presenting cells such as macrophages and dendritic cells and other cells that have been shown to be refractory to high level, persistent gene expression by viral promoters e.g. prostate and colorectal cancer cells.
  • Host cells transformed by constructs of the present invention may be used in the commercial production of proteins. Generally, a fermentation method is employed which involves submerging the cells in a culture medium contained within a suitable vessel. Following culturing at appropriate conditions, proteins secreted by host cells may be recovered from the culture medium by standard techniques known to those skilled in the art. It is preferred that the protein is recovered to homogeneity. In addition transformed host cells of the present invention maybe utilised in therapeutic strategies for replacing or compensating for cell loss.
  • mammalian host cells for transplantation which maybe autologous or allogenic or less preferred xenogeneic
  • mammalian host cells for transplantation may be transformed ex vivo with a gene construct of the present invention in which the gene of interest encodes dopamine for the treatment of Parkinson's disease although other cell loss diseases or disorders which may benefit from the present invention will be readily apparent to those skilled in the art.
  • the host cells of the invention may be used to treat diseases characterised by clinically significant cell loss particularly neuronal cell loss.
  • Viruses, particularly retroviruses and adenoviruses, incorporating the transcriptional regulatory sequence of the present invention are also envisaged.
  • the gene of interest encodes a prodrug converting enzyme or a suicide gene are also provided.
  • DNA vaccines that may benefit from the present invention include tumour vaccines, hepatitis B and C, HIV, tuberculosis, HPV and HSV vaccines and vaccines directed at modifying chronic inflammatory reactions, such as MS, asthma, RA and Alzheimers, or directed at other biological pathways, such as vaccines for contraception or drug addiction.
  • the inventors have further found that the transcriptional regulatory sequence of the invention can be used to bias the immune response, provoked by a DNA vaccine. Typically the immune response is biased towards Th1 and away from Th2.
  • the present invention therefore provides a method of treatment which method comprises administering to a patient an affective amount of a construct or vaccine according to the invention and obtaining a biased immune response.
  • the invention further provides the use of a construct as defined herein for obtaining an immune response which is biased to Th1.
  • Constructs may be administered in conjunction with a carrier such as, for example, liposomes.
  • a carrier such as, for example, liposomes.
  • liposomes are cationic, for example imidazolium derivatives (WO95/14380), guanidine derivatives (W095/14381 ), phosphatidyl choline derivatives (WO95/35301), piperazine derivatives (W095/14651 ) and biguanide derivatives.
  • the construct may comprise a gene of interest such as CTFR or erythropoetin gene operatively linked to the promoter sequence.
  • a method of correcting or compensating for a disease or disorder whose etiology is characterised by a genetic aberration (such as cystic fibrosis) is provided, which method comprises the step of administrating to a mammalian patient in clinical need thereof a therapeutically effective amount of the construct, preferably incorporated into a carrier.
  • constructs of the present invention may be used in driving high level persistent gene expression in avelolar macrophages.
  • the promoter sequence of the present invention is operatively linked to a gene of interest.
  • Genes of interest include genes encoding for therapeutic or non- therapeutic proteins. Therapeutic proteins include those whose large scale commercial production is hampered by the prohibitive cost of current techniques.
  • the heterologous gene of interest may encode a protein which is not normally expressed in the host cell.
  • genes encoding for proteins such as insulin, sTNFr, interferon- ⁇ , factor VIII, erythropoetin, growth factors and cytokines or therapeutically effective fragments thereof are all examples of genes of interest.
  • the construct of the invention may be used in gene therapy to achieve over-expression of human genes such as VEGF for induction of angiogenesis.
  • Medicaments, particularly pharmaceutical compositions, comprising the construct of the invention, the host cell of the invention or therapeutic proteins produced according to the present invention are also provided.
  • the elf4A promoter is active in all cell types, i.e. it is a ubiquitously active promoter, and gives sustained high level expression in all cell types.
  • isolated forms of introns 1 (SEQ.I.D.NO:31),2 (SEQ.I.D.NO:32),3 (SEQ.I.D.NO:33),5 (SEQ.I.D.NO:34),6 (SEQ.I.D.NO:35),7 (SEQ.I.D.NO: 36) and 9 (SEQ.I.D.NO:37) are provided.
  • isolated we mean that the nucleic acid as described herein exists in a physical milieu distinct from that in which it occurs in nature.
  • the nucleic acid may be isolated with respect to one or more materials it is associated with in the natural state.
  • an isolated polynucleotide comprising or consisting essentially of the sequence as set forth in SEQ.I.D.NO:31 or 32 or 33 or 34 or 35 or 36 or 37 or variant thereof, fragment thereof or polynucleotide hybridisable thereto.
  • a recombinant DNA construct comprising a transcriptional regulatory sequence which regulatory sequence comprises an isolated polynucleotide as described herein is also provided. Isolated polynucleotides as identified herein may be used as enhancer elements in transcriptional regulatory sequences found in recombinant DNA constructs according to the invention.
  • a recombinant DNA construct comprising an transcriptional regulatory sequence operatively linked to a heterologous gene of interest which regulatory sequence comprises or consists essentially of a polynucleotide having a sequence as set forth in SEQ.I.D.NO.38 or variant thereof preferably further comprising a sequence as set forth in any one of SEQ.I.D.NO:31 , 32,33,34,35,36,37 or variant thereof is provided.
  • an isolated polynucleotide having a sequence as set forth in SEQ.I.D.NO.40 at positions -2102 to -1082 or variant thereof.
  • Suitable techniques for introducing the naked polynucleotide or vector into a patient include topical application with an appropriate vehicle.
  • the naked polynucleotide or vector may be present together witt ⁇ a pharmaceutically acceptable excipient, such as phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • particle bombardment which is also known as 'gene gun' technology or Particle Mediated DNA Delivery and is described in US Patent No. 5371015.
  • inert particles such as gold beads
  • are coated with a nucleic acid and are accelerated at speeds sufficient to enable them to penetrate a surface of a recipient (e.g. skin), for example by means of discharge under high pressure from a projecting device.
  • Particles coated with a nucleic acid molecule of the present invention are within the scope of the present invention, as are devices loaded with such particles.
  • Other methods of administering the nucleic acid directly to a recipient include ultrasound, electrical stimulation, electroporation and microseeding which is described in US-5,697,901.
  • a nucleic acid sequence of the present invention may also be administered by means of specialised delivery vectors useful in gene therapy. Gene therapy approaches are discussed for example by Verme et al, Nature 1997, 389:239- 242. Both viral and non-viral systems can be used. Viral based systems include retroviral, lentiviral, adenoviral, adeno-associated viral, herpes viral and vaccinia-viral based systems. Non-viral based systems include direct administration of nucleic acids and liposome-based systems.
  • compositions may be administered as pharmaceutical compositions, which are typically administered in any effective, convenient manner including, for instance, administration by parenteral or other routes, for example topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
  • the pharmaceutical compositions generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications.
  • the compositions are administered in an amount of at least about 1 ⁇ g/kg body weight. In most cases they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most cases, dose is from about 1 ⁇ g/kg to about 1 mg/kg body weight, daily.
  • the dosage will typically be 1 - 10 ⁇ g per administration, for example 1 - 10 ⁇ g prime, followed by at least one boost of 1 - 10 ⁇ g, administered at 1 , 2, 3 or 4 week intervals.
  • the construct may be administered to an individual as an injectable composition, for example as a sterile aqueous dispersion, preferably isotonic.
  • the composition may be formulated for topical application for example in the form of ointments, creams, lotions, eye ointments, eye drops, ear drops, mouthwash, impregnated dressings and sutures and aerosols, and may contain appropriate conventional additives, including, for example, preservatives, solvents to assist drug penetration, and emollients in ointments and creams.
  • Such topical formulations may also contain compatible conventional carriers, for example cream or ointment bases, and ethanol or oleyl alcohol for lotions.
  • Such carriers may constitute from about 1% to about 98% by weight of the formulation; more usually they will constitute up to about 80% by weight of the formulation.
  • the daily dosage level of the active agent will be from 1 ⁇ g/kg to 10 mg/kg, typically around 1 mg/kg.
  • the physician in any event will determine the actual dosage which will be most suitable for an individual and will vary with the age, weight and response of the particular individual.
  • the above dosages are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention.
  • SEQ.I.D.NQ 39 DNA sequence of the promoter and exon 1 of the human eIF4A1 gene. DNA sequences are numbered with the putative transcription site denoted as +1. Potential transcription factor binding sites are underlined. The amino acids encoded by exon 1 are shown.
  • elF4A1 gene sequence was determined by DNA sequencing of the cosmid clone co t sCD68C1 (Jones, E., Quinn, CM., See, C.G., Montgomery, D.S., Ford, M.J., Kolble, K., Gordon, S., and Greaves, D.R. (1998), Genomics 53: 248-250).
  • SEQ.l.D.NO:40 DNA sequence of 5.318 kb upstream of the human elF4A gene. This sequence starts from the 5' Not I site of cosmid cos CD68C1 , at -5280, where the transcriptional start site of the human elF4A gene is +1 , (SEQ.I.D.NO:39). It also includes the promoter and exon 1 sequence shown in SEQ.I.D.NO:39 and ends at the final base of exon 1 , (+37). Regions of homology to Alu I repeat sequences or to the mouse elF4A gene and surrounding sequences are underlined, (see Figure 1 ). The regions cloned and assayed for transcriptional actvity as PCR A (-2102 to -1082) and PCR B (-1107 to -505) are highlighted in bold or italics, respectively, (see Figures 1 and 3).
  • Fig.1 Illustrates the organisation of the human elF4A1 gene. Coding sequence exons of the elF4A1 and CD68 genes are represented by black boxes, introns by white boxes and 3' untranslated regions by shaded boxes. The position of Alu I repeat sequences is shown by horizontal arrows below the line. Vertical lines with arrowheads denote the transcription start sites of the two genes, poly A addition sites are represented by the symbol pA + . Hatched boxes delineate the regions of the human elF4A1 gene sequence which share homology with the murine elF4A1 promoter and the position of the CpG rich methylation free island within intron 1.
  • Fig.2 Mapping the transcriptional regulatory sequences of the elF4A1 promoter.
  • the indicated luciferase reporter plasmids were introduced into CHO, 293 and RAW264.7 cells along with a beta-galactosidase reporter gene plasmid (pcDNA Beta gal) as described below.
  • Cell lysates were prepared 16 hours after transfection and assayed for luciferase and beta galactosidase enzyme activities. Cell lysates were diluted in cell lysis buffer to ensure that all luciferase assays were within the linear range of the enzyme assay.
  • the error bars represent the standard error of the mean of two independent transfection experiments.
  • Fig.3 Transcriptional regulatory sequences in elF4A1 5' flanking sequence. Plasmid DNAs of the indicated plasmids (20 ⁇ g) were introduced into RAW264.7 cells by electroporation along with plasmid DNA (2 ⁇ g) for a beta galactosidase expression vector (pcDNA3 Beta gal). A and A', B and B' represent forward and reverse orientations respectively of the PCR fragments shown in fig.1. Cell lysates were prepared 16 hours after transfection and assayed for luciferase and beta galactosidase enzyme activities. Luciferase enzyme activities are expressed relative to the luciferase activity obtained with the plasmid -40elF luc transfected in the same experiment. Similar results were obtained in two independent experiments.
  • Fig.4 elF4A1 directs high-level expression in macrophage cell lines.
  • Panel A Plasmid DNAs of the indicated plasmids (20 ⁇ g) were introduced into RAW264.7 cells by electroporation along with plasmid DNA (2 ⁇ g) for a beta galactosidase expression vector (pcDNA3 Beta-gal). Cell lysates were prepared 24 hours after transfection and assayed for luciferase and beta-galactosidase enzyme activities. Error bars represent the standard error of the means of two independent experiments.
  • Panel B RAW cells were electroporated with the plasmid hCMVIuc or -271 el F- IVS1 and the co-reporter plasmid pcDNA3 Beta-gal. Cells were harvested at 16, 24, 36, 48, 72 and 96 hours post transfection and cell lysates assayed for luciferase activity. Relative luciferase activities are given as a percentage of the value obtained at 16 hours normalised for beta-galactosidase activity at 16 hours. Similar results were obtained in two independent experiments. Panel C.
  • CHO cells were transfected with the plasmid hCMVIuc or -271 elF- IVS1 and the co-reporter plasmid pcDNA3 Beta-gal.
  • Cells were harvested at 16, 24, 40 and 48 hours post transfection and cell lysates assayed for luciferase activity. Relative luciferase activities are given as a percentage of the value obtained at 16 hours normalised for beta-galactosidase activity at 16 hours. Similar results were obtained in two independent experiments.
  • Fig.5 The plasmid -40 IVS1 (x1) contains one copy of elF4A1 gene intron 1 cloned downstream of the -40 elF4A1 promoter fragment in pGL3Basic and plasmid -40 IVS1 (x2) contains two copies of elF4A1 gene intron 1 cloned downstream of the —40 elF4A1 promoter.
  • the plasmid pGL3Control contains the SV40 promoter and enhancer sequences cloned into the luciferase reporter plasmid pGL3Basic.
  • the indicated plasmid DNAs were introduced into the murine macrophage cell line RAW 264.7, human 293 cells and Chinese Hamster Ovary (CHO) cells along with a beta-galactosidase co-reporter plasmid (pcDNA3 Beta-gal).
  • Cells were harvested 16 hours post transfection and cell lysates assayed for luciferase and beta-galactosidase enzyme activities. Normalised luciferase activities are expressed as fold induction compared to the promoterless vector pGL3Basic.
  • Fig.8 Comparative luciferase activity of elF4A and CMV promoter expression plasmids upon transient transfection into MK cells.
  • Fig.9 Time course of promoter activity in MK cells.
  • Fig.10 Efficacy of CMV and -271 Eif-IVS1 promoters in particle mediated DNA delivery. Serum IgG response (1000 times dilution).
  • Fig.11 Efficacy of CMV and -271elF-IVS1 promoters in particle mediated DNA delivery. Serum IgG response 2 weeks post boost.
  • Fig.12 CD8+ T cell response to pVAd .PR construct with -271elF4a promoter as shown by interferon-gamma ELISPOT assay of splenocytes collected 6 weeks post boost immunisation.
  • Fig.13 CD8+ T cell response to pVAd .PR with -271elF4a promoter as shown by Europium release CTL assay of splencytes collected 6 weeks after boost immunisation.
  • DNA sequence of the human elF-4AI gene was determined on both strands of the plasmid and cosmid templates using a Dye Terminator sequencing kit (ABI Perkin Elmer).
  • Reporter gene plasmids Fragments of the human elF4A1 promoter were PCR amplified to generate a 5' promoter deletion series using cosmid cosCD68C1 as template. Forward PCR primers included a Kpn I site and the reverse primer included a Hind III site, PCR products were digested with Kpn I and Hind III and cloned into the multiple cloning site of the luciferase reporter vector pGL3 Basic (Promega). Forward primers used were:
  • the reverse primer used was
  • Regions of the human elF4AI 5' flanking region which show homology to the mouse elF-4AI 5' flanking sequence were PCR amplified using the primers elFBF 5' ATCTGGTACCGACTGGATTTCCACCAG (SEQ.I.D.NO:10) and elFBR 5' ATCTGGTACCACCCAGGGCCACAGG (SEQ.I.D.NO:11 ).
  • the region of non-homology with the murine elF-4AI 5' flanking region was PCR amplified using the primers
  • PCR products were digested with Kpn I and cloned in both orientations into the Kpn I site of elF-40luc to give the plasmids BelF-40luc, B'elF-40luc, AelF-40luc and A'elF-40luc.
  • Introns of the elF4A1 gene were PCR amplified with the following primers:
  • IVS2R 5' ATCTAAGCTTGAATTCTAGGGGATGCAAAGA SEQ.I.D.NO:16
  • IVS3F 5' ATCTAAGCTTGTATCAAGGGTGAGACC SEQ.I.D.NO:17
  • IVS3R 5' ATCTAAGCTTCATAACCTAAACAAATAAATT SEQ.I.D.NO:18
  • IVS4F 5' ATCTAAGCTTCTCAGCAGGTAAGAGTGG SEQ.I.D.NO:19
  • IVS4R 5' ATCTAAGCTTGAATTCCCTTCTGTATCTGAGCAG SEQ.I.D.NO:20
  • IVS5F 5' ATCTAAGCTTTGCTGGTTTCTCTCTGG SEQ.I.D.NO:21
  • IVS6F 5' ATCTAAGCTTCCCAGGTGAGGGCAGT IVS6F 5' ATCTAAGCTTCCCAGG
  • IVS7F 5' ATCTAAGCTTCGTGGAACGAGAGGTGG SEQ.I.D.NO:25
  • IVS7R 5' ATCTAAGCTTGAATTCCTTCCACTCCTGGAGGTT SEQ.I.D.NO:26
  • IVS8F 5' ATCTAAGCTTTGGTGTGTTTGCCCCCT SEQ.I.D.NO:27
  • PCR fragments were digested with Hindlll and cloned into the unique Hindlll site of plasmid elF-40luc, which lies 3' of the transcription initiation site of the elF4AI gene promoter. Restriction mapping and DNA sequencing was used to identify plasmids containing introns in the correct orientation.
  • Introns 1 , 2 and 3 were excised with Hind III, rendered blunt ended by treatment with Klenow DNA polymerase and cloned into the Kpnl site of - 0elFluc to give the plasmids IVS1elF-40luc, IVS2elF-40luc and IVS3elF-40luc in which the introns are placed 5' of the elF4A1 minimal promoter.
  • the plasmid pGL3 Control contains 195bp of the SV40 promoter cloned 5' of the luciferase reporter gene and 244bp of the SV40 enhancer cloned 3' of the luciferase reporter gene (Promega).
  • the plasmid hCMVIuc was constructed by cloning the Nru I / Hind III CMV promoter fragment from pcDNA3 (InVitrogen) into the Sma I / Hind III polylinker sites of pGL3 Basic (Promega).
  • the 200bp Herpes Simplex Virus 1 thymidine kinase promoter was PCR amplified and cloned into Kpnl/Bg II sites of pGL3 Basic (Promega).
  • the plasmid pcDNA3 Beta gal (14) contains the E.coli lacZ gene cloned into the mammalian expression vector pcDNA3 (InVitrogen).
  • Plasmid DNA for transfection was prepared from 500ml cultures of E.coli grown overnight in LB broth containing 100 ⁇ g ampicillin (Sigma) using a standard NaOH/SDS lysis protocol and centrifugation in CsCI ethidium bromide gradients (12).
  • the murine macrophage cell lines RAW264.7 and P388.D1 , the murine B cell line A20 and the human erythroleukaemic cell line K562 and the human prostate cancer cell line, LNCaP were maintained in RPMI 1640 medium (Life Technologies) supplemented with
  • FCS foetal calf serum
  • CHO K1 and SKOV-3 cells were maintained in Ham's F-12 medium and 293 cells WiDr and
  • COS-1 cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FCS, antibiotics and glutamine. All cells were grown at
  • RAW264.7, P388.D1 , A20 and K562 LNCaP and COS-1 cells were transfected by electroporation. Briefly, cells were grown to confluence in T175 flasks, harvested in Phosphate Buffered Saline (PBS), washed once with PBS and resuspended in Optimem 1 serum free medium (Life Technologies) for RAW cells or RPMI 1640 (no FCS).
  • PBS Phosphate Buffered Saline
  • Optimem 1 serum free medium Life Technologies
  • CHO and 293 cells were grown to 70-80% confluence in 9cm petri dishes, washed twice with Optimem before addition of 5ml of plasmid DNA:cationic lipid complex (5 ⁇ g DNA: 50 ⁇ g Lipofectamine (Life Technologies) in Optimem). After 4-6 hours incubation the medium was aspirated, cells were washed twice with PBS and recovered into complete medium for 16 hours before analysis. SKOV- 3 and WiDr cells were similarly transfected using 5 ⁇ g DNA, 50 ⁇ l lipofectin (Life Technologies)
  • Reporter gene assays Transfected cells were harvested in 500 ⁇ l Reporter Lysis Buffer (Promega) and lysed with one cycle of freeze thaw. Cell lysates were assayed for ⁇ -galactosidase enzyme activity using the colorimetric substrate chlorphenolred ⁇ -D-galactopyranoside (CPRG, Boehringer Mannheim) in a 96 well plate assay in 50mM potassium phosphate buffer (pH7.3) with 2mM MgCl2-
  • Enzyme activity was determined by spectrophotometry at 570nm after 30 minutes incubation at 37°C using dilutions of purified E.coli ⁇ -galactosidase enzyme (Sigma) to generate a standard curve. Luciferase enzyme activity was determined using a Luciferase Assay Kit (Promega) and a Berthold Instruments LB9501 luminometer. All luciferase enzyme assays using transfected cell extracts were within the linear range of the assay.
  • Luciferase reporter plasmids (50ug), were injected into the quadriceps muscles of C57BI/6 mice. Muscles were removed after 72 hours and disrupted in 500ul of reporter lysis " buffer, (Promega), using an IKA Labortechnic Ultra turrax T8 pplytron. Luciferase enzyme activity was determined using a luciferase assay kit, (Promega) and a Dynatech Laboratories ML3000 luminometer. Total protein content was measured in a 96 well format using a Pierce Coomassie Plus Protein Assay Reagent against a standard curve using a Molecular Devices Spectra Max 250 plate reader.
  • Table 1 elF4A1 intron sizes are given in base pairs. The exon/ intron boundary sequences are shown with the exon sequences in upper case and the intron sequences in lower case.
  • the first intron of the elF4A1 gene contains many CpG dinucleotides and has many features of a methylation free island.
  • An analysis of the first intron DNA sequence revealed the presence of many potential binding sites for mammalian transcription factors.
  • elF4A1 intron 1 contains three consensus binding sites for Sp1 , two C/EBP ⁇ sites, two binding sites for each of the ets factors Elk-1 and c- ets-1 and 8 binding sites for the transcription factor GATA-1.
  • the 440 bp third intron of the elF4A1 gene contains a 35bp region containing four overlapping consensus binding sites for GATA 1 and three for GATA2 (SEQ.I.E.NO:39).
  • Homology with the murine elF-4AI promoter sequence ends at position - ⁇ 475 but homology with the murine promoter continues at position -1110 and extends for a further 254 bp to the end of the published murine elF-4AI sequence.
  • the 638 bp region of non-homology with the murine promoter contains an extended dinucleotide repeat sequence CAT) 38 , alternating AT repeats have been shown to be present as interspersed repetitive elements in several eukaryotic genomes (17).
  • Analysis of the elF4A1 5' flanking sequence revealed the presence of Alu I interspersed repeats at positions - ⁇ 4588 and - 3722 relative to the elF4A1 transcription start site (Fig.1).
  • elF4AI promoter directs expression of luciferase
  • a 5' deletion series of the elF4A1 gene promoter was constructed in the luciferase vector pGL3 Basic and plasmid DNAs were introduced into a range of mammalian cell lines by transient transfection.
  • a DNA fragment extending from -526 to + 15 of the elF4A1 gene directs high-level luciferase reporter gene expression in the epithelial cell lines CHO and 293 and in the murine macrophage cell line RAW 264.7 (Fig. 2A-C).
  • the maximal level of luciferase expression is obtained with plasmid -526elFluc and the level of expression is similar to that obtained with the SV40 enhancer/promoter vector pGL3 Control (Fig. 2A).
  • the maximal level of luciferase expression is obtained with the -371elFluc plasmid with the level of luciferase expression being 18 times that obtained with the SV40 enhancer/promoter (Fig. 2B).
  • the - 40eIFIuc plasmid which contains only the TATA box and the -69elFluc plasmid which contains a CCAAT box, an Sp1 site and the TATA box give levels of reporter gene expression only slightly higher than that seen with the reporter gene vector alone (pGL3 Basic).
  • the -98elFluc plasmid which contains an additional 29bp of elF4A1 promoter sequences contains an AP-2 site and directs high-level gene expression in all three cell lines tested.
  • the -120elFluc plasmid directs similar levels of reporter gene expression in 293 cells but significantly reduced levels of reporter gene expression are seen in CHO and RAW 264.7 cells. Addition of elF4A1 sequences 5' of -120 restores high levels of reporter gene expression.
  • PCR primers were designed to amplify human elF4A1 gene sequences 5' of position -1 1 10 that show homology with the murine elF-4AI promoter.
  • a 1018 bp fragment containing elF4A1 gene sequences extending from position -2098 to -1080 was cloned in both orientations 5' of the elF4A1 minimal promoter in the reporter gene vector - ⁇ 40elFluc to give the plasmids BelF-40luc and B'elF- 40luc.
  • a 597bp region of the human elF4A1 promoter that shows no homology with the murine elF-4AI promoter was cloned into the reporter gene vector - 40elFluc to give the plasmids AelF-40luc and A'elF-40luc.
  • the plasmids BelF-40luc and B'elF-40luc give levels of luciferase expression only twofold higher than that obtained using the elF4A minimal promoter (Fig. 3A).
  • Fig. 3B the same plasmids enhance expression between 4 and 6-fold while in RAW cells expression is enhanced 5-fold.
  • elF-4AI promoter present in plasmids AelF-40luc and A'elF-40luc enhances expression up to 27-fold in CHO cells, 13-fold in 293 cells and 5-fold in RAW cells (Fig 3).
  • elF4A1 intron 1 contains a methylation free island and potential binding sites for several ubiquitous transcription factors such as Sp1 , c-ets1 and Elk-1. Potential transcription factor binding sites are found in other introns of the elF4A1 gene.
  • luciferase reporter plasmids in which the first nine introns of the elF4A1 gene were cloned downstream of an elF4A1 minimal promoter fragment and tested their activity in transient transfection assays. The data are summarised in Table 2 showing the fold increase in reporter gene activity compared to the elF4A1 minimal promoter alone (plasmid -40elFluc).
  • Table 2 Effect of elF4A1 introns on transcription from an elF4A1 minimal promoter.
  • introns 4 and 8 seven of nine elF4AI introns tested were shown to enhance expression when cloned downstream of the elF4A1 minimal promoter. In all cell lines tested the greatest enhancement of expression is seen when the 1397bp first intron of the elF4A1 gene is cloned downstream of the elF4A1 minimal promoter. The magnitude of the observed enhancement varies from 30-fold in CHO cells to 480-fold in the murine macrophage cell line P388.D1. Introns 2, 3, 7 and 9 were able to enhance reporter gene expression more than 15-fold.
  • the activity of these introns varied widely between different cell lines, for example, the 83bp elF4A1 intron 7 enhances luciferase expression 25-fold in K562 cells but only 6-fold in CHO and P388.D1 cells.
  • elF4A1 IVS1 3' of the elF4A1 -40 promoter fragment enhances luciferase expression 1700-fold while placing IVS1 5' of the elF4A1 -40 promoter enhances expression 680-fold (Table 3).
  • elF4A1 intron 1 sequences are able to enhance gene expression when placed 5' or 3' of the transcription start site.
  • Table 3 The indicated luciferase reporter plasmids (20 ⁇ g) were electroporated into RAW 264.7 cells with the beta galactosidase reporter plasmid pcDNA3 Beta gal (2 ⁇ g). Cell lysates were prepared 24 hours post transfection and assayed for luciferase and beta galactosidase enzyme activities. The results shown are representative of two independent experiments.
  • the level of luciferase activity obtained with the plasmid -271elFIVS1 is equal to that obtained with the human cytomegalovirus promoter/enhancer in the plasmid hCMVIuc and more than three times that obtained with the SV40 enhancer/promoter in the plasmid pGL3 Control (Fig. 4).
  • FIG. 4A The data of Figure 4A were obtained with RAW cells harvested 24 hours post transfection. RAW cells were transfected with CMV and elF4A1 promoter containing plasmids and a comparison of the level of reporter gene expression over a 96 hour period is shown in Figure 4B.
  • the levels of CMV-driven reporter gene expression in RAW cells declines to less than 10% of initial levels 48 hours post transfection.
  • the level of reporter gene expression obtained in RAW cells with the -271 elF4A1 promoter fragment and elF4A1 intron 1 is ten fold greater than that seen using the CMV promoter/enhancer 72 hours after transfection (Figure 4B).
  • the plasmid -40 IVS1 (x1 ) contains one copy of elF4A1 gene intron 1 cloned downstream of the -40 elF4A1 promoter fragment in pGL ⁇ Basic and plasmid - 40 IVS1 (x2) contains two copies of elF4A1 gene intron 1 cloned downstream of the -40 elF4A1 promoter.
  • the plasmid pGL3Control contains the SV40 promoter and enhancer sequences cloned into the luciferase reporter plasmid pGL3Basic.
  • the indicated plasmid DNAs were introduced into the murine macrophage cell line RAW 264.7, human 293 cells and Chinese Hamster Ovary (CHO) cells along with a beta-galactosidase co-reporter plasmid (pcDNA3 Beta-gal).
  • Cells were harvested 16 hours post transfection and cell lysates assayed for luciferase and beta-galactosidase enzyme activities. Normalised luciferase activities are expressed as fold induction compared to the promoterless vector pGL3Basic (see fig.5).
  • Cloning two copies of elF4A1 intron 1 downstream of the elF4A1 -40 promoter gives an increase in reporter gene expression compared to the level obtained using one copy of intron 1 in all three cell lines tested.
  • the additional increase in reporter gene expression is small in RAW cells (10%) but the second copy of elF4A1 increases gene expression in 293 cells more than five fold.
  • the elF4A promoter and intron 1 direct gene expression in vivo in mouse muscle.
  • In vivo elF4A promoter / intron activity has been determined in mouse muscle by injection of luciferase reporter plasmids, (Fig. 7).
  • the -526 fragment plus intron- 1 shows over three times the activity of the SV40 promoter / enhancer combination in this system.
  • the elF4A promoter and intron 1 are active in cancer cell lines. Plasmids where luciferase expression is driven by the elF4A promoter fragment and intron 1 (IVS-1 ) regions were introduced into a series of cancer cell lines: LNCaP, COS- 1 , WiDr and SKOV-3, ( Figure 6).
  • luciferase activities show that the elF4A promoter and IVS-1 are active in all cell types tested.
  • the -271 and -526 promoter fragments are most active as in other cell types, (see Figs. 2 & 4).
  • the -526 and IVS-1 combination drives almost two fold more luciferase expression than the SV40 promoter / enhancer combination in WiDr, colorectal cancer cells and over 500 fold more expression in LNCaP, prostate cancer cell line.
  • the inventors have also shown that the elF4A promoter is more active in murine keratinocytes than the CMV promoter. Again this demonstrates in a cell line other than an antigen presenting cell that the elf4A promoter is stronger than the CMV promoter. Also murine keratinocytes provide a cell line model for the cell type other than professional APCs that could contribute to the antibody response via the gene gun by expressing antigen in vivo. This example shows a sustained high-level reporter gene expression in keratinocytes using elF4A1 sequences.
  • the murine keratinocyte cell line , MK (Weissman, B.E. and Aaronson, S. A., 1983, Ceil 32, 599-606), was maintained in S-MEM, (Spinner Culture Modified Eagle's Medium) , Life Technologies supplemented with 10% foetal calf serum, Life Technologies, 100 units/ml penicillin, 100ug/ml streptomycin, 2mM glutamine and 4ng/ml human recombinant EGF, (Sigma). Cells were grown at 37°C in a humidified incubator in 5% COg/air mixture.
  • S-MEM Spinner Culture Modified Eagle's Medium
  • MK cells were grown to 80% confluence in 6 well plates, washed twice with 1ml Optimem and transfected with 1 ml of plasmid DNA: cationic lipid complex, (5ug DNA: 30ul Transfast TM, Promega), in Optimem.
  • Cells were generally harvested 48 hours post transfection for luciferase assays or at specific time points for a time course of activity.
  • luciferase assays transfected cells were harvested in 1 ml Passive Lysis Buffer and luciferase activity was determined using a luciferase assay kit, (Promega) and a ML3000 plate luminometer, (Dynatech Laboratories). Total protein content was measured in a 96 well format using Pierce Coomassie Plus Protein Assay Reagent against a standard curve using a Spectra Max 250 plate reader, (Molecular Devices).
  • the relative luciferase activity indicates that the plasmid -271elFIVS1 directs about three times as much luciferase expression as the plasmid hCMVIuc.
  • Figure 8 represents a mean of 4 separate experiments.
  • MK cells were transfected with the plasmid hCMVIuc or -271elF-IVS1 luc. Cells were harvested at 22, 31 and 48 hours post transfection and assayed for luciferase actvity and total protein. Relative luciferase activities, (RLU/ mg protein), are given as a percentage of the value from the first time point for each plasmid transfected.
  • Figure 9 is a mean of 2 experiments and shows that the - 271elF-IVS1 plasmid gives sustained high-level reporter gene expression in MK cells with about a six fold increase in luciferase expression between 22 and 48 hours post transfection. Note that the rapid decline in CMV driven expression seen in RAW cells, (Fig. 4A), is not seen in MK cells.
  • the following example shows that when the elF4A promoter is driving expression of influenza nucleoprotein (NP) antigen in a particle mediated DNA delivery experiment, it produces as good or a better antibody response than an equivalent plasmid with CMV driven NP expression.
  • NP nucleoprotein
  • Plasmids used for DNA vaccination experiments are based upon pVAC1 ,
  • influenza nucleoprotein, (NP), expression plasmid, pVAd .PR, (CMV NP-PR), was constructed by ligating PCR amplified cDNA encoding nucleoprotein of influenza A virus strain PR/8/34 from pAR501 , (a gift from Dr. D.
  • plasmid DNA was propagated in E.coli DH5 ⁇ and prepared using endotoxin-free purification kits, (QIAGEN Ltd., Crawley, UK), and stored at -20°C at approximately 1 mg plasmid DNA / ml in 10mM Tris/EDTA buffer.
  • mice Female C57BI/6 mice were immunised between 6-8 week of age.
  • plasmid DNA was delivered to the shaved target site of abdominal skin by PMDD from two cartridges using the Accell gene "transfer device at 500 lb/in 2 (McCabe WO 95/19799), delivering a total of between 1.0 -1.6 ⁇ g DNA per immunisation.
  • the DNA vaccination regime included a primary immunisation followed by one boost 6 weeks later.
  • Blood samples were collected from the tail vein 1-3 days before immunisation, and at 24 days after primary and 15 days after boost immunisation. Serum was separated and stored at -20°C for subsequent antibody analyses.
  • nucleoprotein (NP) of influenza virus as a glutathione-S-transferase fusion protein for serum antibody ELISA assays
  • the cDNA for nucleoprotein of influenza A virus strain PR/8/34 was cloned as an EcoRI fragment into a modified pUC18 vector. This was then sub-cloned as an EcoRI fragment into pGEX-4T-3 (Pharmacia) and DNA sequence analysis confirmed that this construct would express an in-frame fusion with GST.
  • a one litre culture of E. coli DH5 ⁇ transformed with pGEX flu/NP were grown to a density of OD 600 ⁇ 0.8. Fusion protein expression was induced by the addition of isopropyl-b-D-thiogalactopyranoside to a final concentration of 0.1 mM and growth continued for a further 3 hours at 37°C. Cells were harvested by centrifugation at 7000 rpm for 7 minutes and the pellet resuspended in 30ml of PBS + 1 mM PMSF. Cells were disrupted by sonication at maximum amplitude for 3 x 10s on ice and the insoluble materials were removed by centrifugation at 18,000rpm for 30 minutes.
  • the supernatant was removed and incubated with 1 ml of glutathione-sepharose (Pharmacia) for 1 h at 4°C with gentle agitation.
  • the glutathione-sepharose was collected by centrifugation and washed 3 times with 20ml of ice cold PBS.
  • the fusion protein was eluted by incubation of the sepharose with 7x 1 ml of elution buffer (10mM reduced glutathione (Sigma) in 50 mM Tris-HCI pH 8) for 10minut.es at room temperature.
  • the purified protein was dialysed against 3 litres of PBS to remove the free glutathione and stored at a final concentration of 125 mg/ml in 1 l aliquots at -20°C.
  • Microtitre plates (Nunc Immunoplate F96 maxisorp, Life Technologies) were coated with 10 ⁇ g/ml NP by overnight incubation at 4°C and washed 4 times with washing buffer (PBS containing 5 % Tween 20 and 0.1% sodium azide). This was followed by a 1 hour incubation at 20°C with blocking buffer (5% BSA w/v in PBS), and 4 further washes with washing buffer, before the plates were incubated for 4 hours at 20°C with serum samples serially diluted in blocking buffer.
  • washing buffer PBS containing 5 % Tween 20 and 0.1% sodium azide
  • the NP-specific serum IgG levels were measured before immunisation, and at intervals following the primary and boost immunisations.
  • the construct with the - 271elF4A promoter gave similar responses to those following immunisation with the construct with the CMV promoter (Fig. 10), with equivalent titres for both promoters after the boost immunisation (Fig. 11 ).
  • each cartridge contained 0.5 mg gold coated with between either -0.5, -0.05 or -0.005 ⁇ g pVACI .PR plasmid DNA.
  • empty vector pVACI
  • IFN ⁇ ELISPOT assays 96 well ELISPOT plates (Millipore) were coated with 50 ⁇ l rat anti- mouse IFN ⁇ capture antibody (PharMingen) at 15 ug/ml, on the day prior to the assay. This was incubated overnight at 4°C. Non-specific binding was minimised by blocking with 100 ⁇ l complete RPMI for at least 1 hour at room temperature.
  • a single cell suspension of splenocytes was prepared using ground glass microscope slides (super premium microscope slides, 1.0-1.2 mm thick/twin frost (BDH)). Red blood cells were lysed using a standard lysis buffer (155 mM NH 4 CI, 10 mM KHC0 3 , EDTA). Cells were washed 3 times in complete RPMI, counted and resuspended to give a final density of 4 x 10 5 cells/well. The following treatments were added in triplicate to give a final volume of 200 ⁇ l/well:-
  • Cytokine was finally detected using an alkaline phosphatase substrate kit (Biorad) prepared according to the protocol supplied. The reaction was stopped by washing the plate with H 2 0 and plates left to dry before enumeration of IFN ⁇ producing cells per 10 6 splenocytes by image analysis.
  • Biorad alkaline phosphatase substrate kit
  • Target cells were washed once in HEPES buffer before labelling with ice cold labelling buffer (1 ml/107 target cells for 40 mins on ice with vigorous shaking every 5 minutes). The reaction was stopped by addition of 9 mis repair buffer with a further 5 minute incubation on ice before cells were washed x 2 with repair buffer and x 2 with complete RPMI. Cells were pulsed with 10 ⁇ M cognate peptide for 1 hour at 37°C. (An aliquot was mock pulsed to provide control targets). After washing x 3 with complete RPMI, target cells were plated out at 5 x 10 3 cells/well, plates centrifuged for 3 minutes at 1000 rpm) and incubated at 37°C for 4 hours. Supematants were harvested for measurement of Eu3 + release and fluorescence detected by time-delayed fluorimetry in the presence of 200 ⁇ l enhancement solution (Wallac).
  • % specific cytotoxicity was calculated as:- (test release spontaneous release)/(max. release - spontaneous release) x 100%
  • test release from target cells was measured in the presence of effectors, spontaneous release, in the absence of effectors, and maximum release in the absence of effectors and with the addition of 10% Triton-X100 as a means of causing cell lysis.
  • the nucleoprotein PR specific lgG1 and lgG2a responses were determined according to the antibody ELISA assay and were examined 14 days post-boost immunisation.
  • the ELISA assay results are shown in Table 4. The results show that at dosages of 0.005 and 0.05 ⁇ g/cartridge the construct containing the - 271 EIF4a sequence does not give detectable titres of lgG1 , whereas high titres of lgG2a were detected (>3.60) at all doses of DNA.
  • An lgG2a response can be correlated to a Th1 cell response and an lgG1 response can be correlated to a Th2 cell response.
  • the results shown in Table 4 thus show a reduced Th2 response and a corresponding bias to a Th1 response when the construct contains the -271 EIF4a sequence.
  • Titres were defined as the highest dilution to give optical density of 0.2 at 450 nm. Results are expressed as the log 10 titre for each group.
  • the ELISPOT assay showed that IFN ⁇ positive cells were easily detected following immunisation with the -271 EIF4a promoter-driven construct ( Figure 12).
  • CTL cytotoxic T cell lysis
  • Nan, X., Cross, S. and Bird, A. (1998) Gene silencing by methyl-CpG- binding proteins. Novartis Found Symp 214: 6-16.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Microbiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne de nouveaux produits de synthèse d'ADN, possédant une séquence régulatrice transcriptionnelle comprenant un polynucléotide pouvant être dérivé du promoteur du gène eIF4A1. Dans des modes de réalisation préférés, le polynucléotide comprend également un polynucléotide pouvant être dérivé des introns du gène eIF4A, en particulier l'intron 1. L'invention concerne également des cellules hôtes réceptrices des produits de synthèse. Ces nouveaux produits de synthèse sont utilisés dans la thérapie génique, les vaccins d'ADN et la production commerciale de protéines.
EP00942269A 1999-07-06 2000-07-05 Produits de synthese d'adn a base d'eif 4a promoteur de gene Withdrawn EP1190083A2 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
GBGB9915638.2A GB9915638D0 (en) 1999-07-06 1999-07-06 DNA Constructs
GB9915638 1999-07-06
GBGB9929547.9A GB9929547D0 (en) 1999-12-14 1999-12-14 Dna constructs
GB9929547 1999-12-14
PCT/GB2000/002569 WO2001002594A2 (fr) 1999-07-06 2000-07-05 Produits de synthese d'adn

Publications (1)

Publication Number Publication Date
EP1190083A2 true EP1190083A2 (fr) 2002-03-27

Family

ID=26315727

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00942269A Withdrawn EP1190083A2 (fr) 1999-07-06 2000-07-05 Produits de synthese d'adn a base d'eif 4a promoteur de gene

Country Status (4)

Country Link
EP (1) EP1190083A2 (fr)
JP (1) JP2003504033A (fr)
AU (1) AU5697100A (fr)
WO (1) WO2001002594A2 (fr)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9609261D0 (en) * 1996-05-02 1996-07-03 Isis Innovation Gene expression in monocytes and microphages

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0102594A2 *

Also Published As

Publication number Publication date
WO2001002594A3 (fr) 2001-11-15
AU5697100A (en) 2001-01-22
WO2001002594A2 (fr) 2001-01-11
JP2003504033A (ja) 2003-02-04

Similar Documents

Publication Publication Date Title
KR100379654B1 (ko) 동물세포의형질감염을위한재조합dna바이러스벡터
CN111492056B (zh) 用于细胞的遗传修饰的非整合型dna载体
Mayrhofer et al. Use of minicircle plasmids for gene therapy
KR100795626B1 (ko) 도처에 있는 염색질 개방 요소(유씨오이)를 포함하는폴리뉴클레오티드
KR100490188B1 (ko) 진핵 세포에서의 서열 특이적 ｄｎａ 재조합
EP3515506B1 (fr) Silençage de dux4 par des complexes d'édition de gène recombinant
JP2000516472A (ja) 組織特異的遺伝子発現を与える自己複製型エピソーム性発現ベクター
AU7160296A (en) DNA construct comprising a muscle specific regulatory element for immunization or gene therapy
WO1997011190A9 (fr) Adn de recombinaison contenant un element regulateur a specificite musculaire pour des immunisations ou pour des therapies geniques
Rodríguez Nonviral DNA vectors for immunization and therapy: design and methods for their obtention
JP2006502726A (ja) 改善された免疫療法
CN113302202A (zh) 利用表达胰岛素样生长因子1异构体的脱氧核糖核酸构建体的神经病变的治疗
JP2002523106A (ja) 誘導的発現系
US20050196751A1 (en) Adenoviral vector-mediated delivery of modified steroid hormone receptors and related products and methods
Quinn et al. The human eukaryotic initiation factor 4AI gene (EIF4A1) contains multiple regulatory elements that direct high-level reporter gene expression in mammalian cell lines
WO2022053050A1 (fr) Séquence d'acides aminés pouvant détruire des cellules, et séquence nucléotidique associée et leurs utilisations associées
KR20090090924A (ko) 최적의 진핵 세포 발현 벡터의 개발
WO2001002594A2 (fr) Produits de synthese d'adn
US7351818B2 (en) Method to improve translation of polypeptides by using untranslated regions from heat-shock proteins
JP4642865B2 (ja) 新規制御エレメントを含むベクター
US6605281B1 (en) Human papillomavirus vectors for the episomal transduction of host cells and method of making same
JP2000508904A (ja) チロシンヒドロキシラーゼの遺伝子に由来の発現系
Nordstrom Expression plasmids for non-viral gene therapy
CN114854791A (zh) 一种新型CRISPR-Cas9系统载体及其应用
WO2003038101A1 (fr) Expression genique

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011228

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20040927

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090813