Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants

Definitions

• the present invention relates to chimeric expression promoters, particularly suitable and adapted for use in the field of plant biotechnology.
• expression promoters are well known in the field of biotechnology and genetic manipulation. Insofar as plant biotechnology is more particularly concerned, the degree of expression of a gene coding for a polypeptide that it is desired to produce in a host cell is often dependent on the promoter used.
• the various promoters that are ubiquitously used are often limited to specific applications or particular cell tissues, simply because of their tissue specificity or expression strength. For example, one might cite the 35S promoter of the cauliflower mosaic virus as being a relatively strong promoter, compared to, say, the promoter originating from the nos gene, both of these promoters being more particularly used in the field of plant biotechnology.
• nucleic acid sequence means a single or double-stranded oligomer or polymer, of nucleotide bases read from the 5' extremity towards the 3 ' extremity, and includes self-replicating plasmids, genes, polymers of DNA or RNA, whether infectious or not, and also DNA or RNA whether functional or not.
• the left extremity of a single stranded nucleotide sequence is the 5' extremity ;
• derived nucleic acid sequence means that the sequence derives directly or indirectly from the sequence to which reference is made, for example by substitution, deletion, addition, mutation, fragmentation, and/or synthesis of one or more nucleotides ;
• promoter or "promoting nucleic acid sequence” means a region of nucleic acid upstream of a start codon for translation and which is implicated in the recognition and binding of polymerase RNA and other proteins involved in transcription ;
• plant promoter means a promoter that is capable of initiating transcription plant cells ;
• constitutive promoter means a promoter capable of expressing nucleic acid sequences operably linked to said promoter, in all or nearly all the tissues of the host organism throughout the development of said organism ;
• tissue specific promoter means a promoter capable of epxressing, in a selective manner, nucleic acid sequences operably linked to said promoter, in certain specific tissues of the host organism ;
• "operably or functionally linked” means the linking of the promoter or the promoter nucleic acid sequence, to a nucleic acid sequence, or gene, to be expressed coding for a protein which it is desired to produce, in such a way that the promoter positively inflences or drives transcription of the linked nucleic acid sequence.
• the promoter sequence may also include sequences which are transcribed situated between the transcription start site and the translation start codon ;
• nucleic acid sequence, or gene, to be expressed coding for a polypeptide that it is desired to produce means a gene or nucleic acid sequence coding for a polypeptide, and preferably and exogenous or heterologous polypeptide, said exogenous polypeptide being more preferably a pharmaceutically, therapeutically or cosmetically active substance, such as a protein, enzyme, inhibitor, receptor, antibody, antigen, therapeutically active fragments thereof.
• heterologous or exogenous therapeutically active substances that may be produced through expression of corresponding genes or nucleic acid sequences in a host cell are structural proteins, such as collagen, iron transfer proteins or transferrins, such as lactoferrin, blood derived proteins, such as hemoglobin, human serum albumin, erythropoietin, growth stimulating factors, proteolytic or anti-proteolytic enzymes, such as alpha-antitrypsine, hormones, secondary metoblites, digestive enzymes, such as gastric lipase, pancreatic lipase, trypsine, chymotrypsine, alcohol dehydrogenase, brain derived neurotrophic factors, cardiac stimulators or modifiers, and blood pressure control agents such as angiotensins;
• structural proteins such as collagen, iron transfer proteins or transferrins, such as lactoferrin
• blood derived proteins such as hemoglobin, human serum albumin, erythropoietin, growth stimulating factors
• expression cassette means nucleotide sequences capable of driving expression of a nucleic acid sequence, or of a gene, coding for a polypeptide which it is desired to produce in a host organism which is compatible with such expression cassette sequences.
• Such expression cassettes generally comprise at least one promoter and a transcription termination signal, and optionally other factors necessary or useful for expression ;
• vector means expression systems, for example projectiles coated with DNA, nucleic acid based transport vehicles, nucleic acid molecules adapted for delivering nucleic acid sequences, and circular self-replicating autonomous DNA, for example plasmids, cosmids, phagemids, etc.
• a recombinant micro-organism or recombinant cell culture is described as a host for an "expression vector", this also includes circular extrachromosomal DNA (such as for example, mitochondrial or chloroplast DNA) , DNA having been integrated into the host chromosome ( s ) , the vector being either stably replicated by the cells during mitosis as an autonomous structure integrated into the host genome, or maintained in the nucleus or the cytoplasm of the host ;
• circular extrachromosomal DNA such as for example, mitochondrial or chloroplast DNA
• Plasmid means a molecule of circular autonomous DNA capable of replication in a cell, and includes both "expression plasmids" and “non-expression plasmids". If a recombinant micro-organism or cell culture is described as a host for an "expression plasmid", this also includes molecules of circular extrachromosal DNA and DNA having been integrated into the host chromosome (s) . If the plasmid is maintained by a host cell, the plamsid is either stably replicated by the cells during mitosis as an autonomous structure, or integrated into the host genome ;
• heterologous sequence or “heterologous nucleic acid sequence” means a sequence orginating from a source or species that is foreign to the environment, or if it originates from the same environment, has been modified with respect to its original form.
• the modification of the nucleic acid sequence can occur for example through treatment of the nucleic acid with a restriction enzyme to generate a fragment of nucleic acid capable of beign operably linked to a promoter.
• the modificaiton can also occur through the use of techniques like site specific mutagenesis ;
• box means a nucleic acid sequence to which a regulatory function is attributed ;
• box and/or nucleic acid sequence with which this latter term is associated comprises a certain sequence identity or homology with a known box and/or a known nucleic acid sequence indicated as a reference, and preferably a sequence identity of at least 50%, even more preferably a sequence identity of at least 75%, and most preferably a sequence identity of at least 90% with the reference sequence.
• the percentage of identity of the sequence is calculated on the basis of a comparison window of at least 6 contiguous nucleotide bases.
• the determination of a comparison window can be carried out by using sequence alignment algorithms in order to determine an homology with the reference sequence, for example the local homology algorithm, the homology alignment algorithm, and the similarity search algorithm, these algorithms also existing as computer programs, and designated by names such as GAP, BESTFIT, FASTA and TFASTA.
• sequence alignment algorithms for example the local homology algorithm, the homology alignment algorithm, and the similarity search algorithm, these algorithms also existing as computer programs, and designated by names such as GAP, BESTFIT, FASTA and TFASTA.
• the percentage of sequence identity is obtained by comparing the reference sequence with the box and/or nucleic acid sequence using one or more of the abovementioned methods ;
• - “situated” means the position on a nucleic acid sequence of an identified element, as for example a "box", a restriction site, or a codon having a particular function.
• the position that is given by a number refers to the position of the start of the element in the nucleic acid sequence, in the reading direction of the latter, i.e. in the direction 5'->3' with respect to the position of the transcription start site indicated as +1 ;
• transgenic plant means a plant having been obtained through the application of genetic manipulation techniques, and includes whole plants obtained by such techniques, their progeny, as well as plant organs, for example, but non limitatively, roots, stems, leaves and leaves, obtained by such techniques.
• the transgenic plants obtained according to the present invention can also have different degrees of diploidism, and can for example be polyploid, diploid, and haploid ;
• “propagule” means an accumulated mass or an association or an aggregation of structured or unstructured plant cells, capable of enabling the regeneration of a whole plant therefrom ; such associations can for example be in the form of explants, calli, stems, leaves, roots, cuttings, and even seeds.
• the present applicant has taken a completely different approach to that taken by the applicant or the previously discussed PCT application. Serendipitously, the present applicant has managed to produce chimeric promoters which fill the need expressed previously, and in particular, enable an increase in the degree of expression of a gene, or a nucleic acid sequence operably linked to said promoter, which codes for a polypeptide that it is desired to produce in a host cell, and preferably in a plant cell, with respect to the existing promoters currently in use.
• the present applicant has managed at the same time to produce a family of promoters in such a way as to enable the choice of a promoter most suited to a particular task or application or an environment in which it is intended to be used, and thus is able to control the degree of expression of a gene to be expressed, or a nucleic acid sequence operably linked to said promoter, that codes for a polypeptide which it is desired to produce in the host cell.
• one of the objects of the present invention is a chimeric expression promoter comprising at least one nucleic acid sequence derived from a promoter of the pea plastocyanin gene having the sequence identified under the number SEQ.IDOl.
• the chimeric promoter comprising a nucleic acid sequence derived from the promoter of the pea plastocyanin gene is selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, SEQ.ID10, and SEQ.ID11.
• promoters according to the invention and especially plant promoters, having an interesting promoter activity, whilst at the same having a minimum of regulatory boxes, and in particular at least one "G” box, a “CAAT” box and a “TATA” box, the only condition being that the "G” box be situated upstream of the other boxes, i.e. in the 5' region of the nucleic acid sequence, and that this "G” box be preferentially siutated at a certain distance, expressed in nucleotide bases, upstream from the other boxes.
• another object of the present invention is a chimeric expression promoter comprising a "G" box operably linked upstream of at least one "CAAT” box, one "TATA” box and a transcription initiation site (indicated by +1 in the figures). More preferably, the "G” box is situated between the positions - 225 and -65 with respect to the transcription initiation site (+1). Even more preferably, the "G” box is situated between the positions - 201 and - 115 with respect to the transcription initiation site (indicated by +1 in the figures). In the most preferred embodiments, the "G” box is situated either at position - 201, or at position - 115, with respect to the transcription initiation site (indicated as position +1 in the figures ) .
• the "G” box is of plant origin.
• the "G” box is obtained from a promoter of the pea plastocyanin gene.
• the "G” box is obtained from the petE promoter of the pea plastocyanin gene.
• the promoters further comprise a "nos E like” box operably or functionally linked upstream of the "G" box.
• the promoters also comprise at least one "asl” or “asl like” box operably or functionally linked to the "G” box, and preferably two or more such boxes, arranged either contiguously or separately, and most preferably four such boxes.
• These "asl” or “asl like” boxes may be linked both upstream and downstream of said "G” box, and preferably are linked upstream thereof.
• one or more of the the “asl” or “asl like” boxes can also be arranged in what is known as inverse order, that is, from the 3' to the 5' direction, and preferably in inverse repeat order.
• the promoters also comprise at least one "as2" box operably or functionally linked to the "G" box, and preferably two or more such boxes, arranged either contiguously or separately, and most preferably four such boxes. These boxes may also preferably be linked both upstream and downstream of said "G" box, and more preferably are linked upstream thereof. In another preferred mode of the invention, some or all of the boxes can also be arranged in what is known as inverse order, or as inverse repeats as described above.
• the chimeric promoters as described above comprise at least one nucleic acid sequence selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, SEQ.ID10, and SEQ.ID11.
• Yet another object of the present invention is an expression cassette comprising at least one nucleic acid sequence derived from a promoter of the gene of the pea plastocyanin gene, operably or functionally linked to a gene or a nucleic acid sequence coding for a polypeptide that it is desired to express, said coding nucleic acid sequence being in turn operably or functionally linked to a transcription termination nucleic acid sequence, wherein the nucleic acid sequence derived from the promoter of the pea plastocyanin gene is selected from the sequences identified in the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, SEQ.ID10, and SEQ.ID11.
• Another object of the present invention is an isolated promoter nucleic acid sequence, characterized in that the sequence is selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, SEQ.ID10, and SEQ.ID11.
• Such a sequence may be one obtained through deletion, substitution, addition of one or more nucleic acids to or from the sequence identified in the sequence listing under SEQ.IDOl.
• Yet still another object of the present invention relates to desoxynucleotide or desoxynucleoside blocks for the production of promoters of promoter nucleic acid sequences as identified previously. These blocks can be :
• - building blocks or "directional" blocks i.e. sequences that read in the same direction as the final promoter or promoter nucleic acid sequence sequence, which is from the 5' end of the sequence towards the 3' end of the sequence;
• guide blocks i.e. sequences whose ends include nucleotide or nucleoside bases that complement with and overlap with the ends of the directional building blocks.
• the directional building block corresponds to at least one sequence selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID12, SEQ.ID13, SEQ.ID14, SEQ.ID15, SEQ.ID16, SEQ.ID17, and SEQ.ID18.
• the guide blocks corresponding to at least one sequence selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID19, SEQ.ID20, SEQ.ID21, and SEQ.ID22.
• Another object of the present invention is a vector comprising a promoter, or a promoter nucleic acid sequence, capable of initiating transcription of a gene or a nucleic acid sequence coding for a polypeptide that it is desired to produce, characterized in that the promoter or the promoter nucleic acid sequence corresponds to a chimeric expression promoter or to a promoter nucleic acid sequence as defined previously.
• the vector is selected from the group consisting in the binary vectors identified under the numbers pMRT1151, pMRT1149, pMRT1170.
• Yet still another object of the present invention is a process for the production of a chimeric expression promoter or an isolated promoter nucleic acid sequence such as those defined previously, characterized in that it comprises the steps of : - carrying out a ligation chain reaction, designated as LCR, to produce a continuous single stranded DNA molecule from at least one directional building block desoxynucleotide or desoxynucleoside sequence selected from the group consisting in the directional building blocks SI, S2, S3, S4, S5, S ⁇ , and S7 as identified in the sequence listing under the numbers SEQ.ID12, SEQ.ID13, SEQ.ID14, SEQ.ID15, SEQ.IDl ⁇ , SEQ.ID17 and SEQ.ID18 respectively, and at least one desoxynucleotide or desoxynucleoside guide block for building said promoter nucleic acid sequence or promoter, the guide block being selected from the group consisting in the guide sequences Gl, G2, G3, and G4 identified in the sequence listing under
• the desoxynucleotide or desoxynucleoside building blocks are phosphorylated before ligation.
• the ligation is carried out in the presence of at least one DNA ligase in a thermocycle, under the following conditions :
• transgenic plant having stably integrated into its genome at least one promoter or at least one promoter nucleic acid sequence as previously defined.
• the transgenic plant is selected from dicotyledonous species, such as for example, and preferably, potato, tobacco, cotton, lettuce, tomato, melon, cucumber, peas, rapeseed, beetroot, and sunflower, and/or from monocotyledous species, such as for example, and preferably, wheat, barley, oats, rice and corn.
• Another object of the present invention is a transgenic plant propagule, wherein propagule has the definition defined previously, and preferably the propagule is a seed.
• Yet another object of the present invention is a cell containing a promoter or a promoter nucleic acid sequence as previously defined.
• the cell is a procaryote or eucaryote cell, and even more preferably is a cell chosen from the group consisting of bacterial, insect, animal, human, fungal, algal, yeast and plant cells, and most preferably is a plant cell.
• a process for the expression of a nucleic acid sequence, or gene, coding for a polypeptide that it is desired to produce, in a cell characterized in that it comprises the following steps :
• transforming the cell with a vector comprising at least one promoter or at least one promoter nucleic acid sequence as defined previously, operably linked to a nucleic acid seqeunce or gene, coding for a polypeptide to be produced, itself operably linked to a transcription terminator signal ;
• the cell used in this method is a procaryote or eucaryote cell.
• the celle is cell selected from the group consisting of bacterial cells, fungal cells, yeast cells, insect cells, animal cells, and plant cells, and most preferably is a plant cell.
• Another object of the present invention is a process for the production of a transgenic plant, or of a propagule, as defined previously, characterized in that the process includes the steps comprising : - transforming a plant cell with a vector comprising at least one promoter or at least one promoter nucleic acid sequence as defined previously ;
• Figures I, II and III schematically represent the structures of comparative reference molecular constructs, enabling a comparison between the chimeric expression promoters of the present invention and said reference constructs.
• the construction represented contains the reporter gene coding for ⁇ -glucuronidase in the absence of any promoter sequence, and thereby serves as a negative control.
• FIG. II schematically represents a construct containing the gene coding for ⁇ -glucuronidase under the control of the CaMV double 35S promoter (d35S CaMV) , also known as the 35S enhanced promoter (ep35S), which serves as a reference control for strong promoters ;
• d35S CaMV CaMV double 35S promoter
• ep35S 35S enhanced promoter
• Figure III represents a construct serving as an internal reference for transient expression experiments, and consists in the reporter gene coding for luciferase under control of the 35S CaMV promoter.
• FIG. IV schematically represents the structure of several preferred embodiments of the chimeric promoters according to the present invention and derived from the whole promoter from the pea plastocyanin gene (petE prom) , the latter also being represented.
• the promoters identified as MPrl098, MPrl097 and MPrl096 were obtained through enzymatic digestion of the whole promoter of the pea plastocyanin gene, whereas the promoters identified as MPrll08, MPrll09, MPrlllO, MPrllll and MPrlll2 were obtained through ligand based PCR (lb-PCR).
• the promoters MPrll43 and MPrll53 were respectively obtained through deletion of the "as-2" and “as-1” boxes of promoter MPrllll, and through fusion of the "as-1 like” and “nos enhancer like” boxes of MPrllO ⁇ upstream of promoter MPrll43. All of the promoters produced were cloned into the vector pMRT1144 between the restriction sites Pstl and BamHI in order to obtain transcriptional fusion with the reporter gene uidA which codes for ⁇ -glucuronidase ; - Figure V represents a graph comparing the relative promoter activities of the various constructs after transient expression in tobacco leaves. Three days after bombardment, the leaves were ground and the brute extract obtained clarified by centrifugation.
• the ⁇ -glucuronidase and luciferase activities were measured by fluorimetry on an aliquot of brute extract, and the ratio GUS/LUC activities determined.
• the histograms correspond to the average of the ratios for a given construct plus or minus Mean Standard Error (MSE) ;
• FIG. VI represents schematic graphs of a comparison of chimeric promoter activity after stable transformation of tobacco plants. Samples were taken on all primary transformants at 2, 4, 6, 8 and 10 weeks after their transfer to greenhouse and ⁇ -glucuronidase activity measured from each sample, ponderated by the total protein content, producing a GUS activity in rlu/mg of protein. At each stage of developement, activities were sorted by decreasing order for each series of primary transformants and compared to each other.
• - uidA a sequence coding for ⁇ -glucuronidase
• - IV2 a patatin gene intron
• - nos term a terminator from the nopaline synthase gene ;
• - 35S term a terminator from the 35S RNA of CaMV ;
• - B the endonuclease restriction site BamHI ;
• - Sp the endonuclease restriction site Sphl
• - as-1 the activating sequence 1 from the CaMV 35S promoter ;
• - as-2 the activating sequence 2 from the CaMV 35S promoter ;
• - TATA a "TATA" box
• - +1 the transcription initiation site
• the uidA gene coding for ⁇ -glucuronidase (Jefferson and al . , 1986), and also containing the nucleic acid sequence of the IV2 intron of the gene ST-LS1 from potato patatin (Vancanneyt and al . , 1990) ( uldA-IV2) was placed under the control of one of the promoters and the terminator from the nopaline synthase gene ⁇ nos term) .
• This construct was then transferred into Agroba cteri um tumefaciens through cloning into the plasmid vector pGEM3Z sold by Promega Corp. (Madison, USA) .
• a negative control identified as pMRT1144.
• pMRT1144 a plasmid vector derived from pGEM3Z, that only possessed the " uidA-IV2 / nos term" sequences, in the absence of any promoter sequence, was made.
• This plasmid was called pMRT1144 and served as a negative control (Fig. I).
• the uidA/ nos term sequences were introduced into the pGEM3Z plasmid, and the ui A sequence was placed under the control of the whole promoter of the pea plastocyanin gene and the nopaline synthase terminator, was isolated from 5 ⁇ g of pGA492-Ppet£ plasmid.
• the latter plasmid was obtained by cloning, in the plamsid pGA492 -Pem2- uidA, the petE promoter from the pea plastocyanin gene obtained from the plasmid pKHn2 ( Pwee and Gray, 1993) in place of the em2 promoter (Gaubier and al . ,
• the bpI221-Pem2 plasmid was digested with 20 units each of the enzymes Hindlll and EcoRI for an hour at 37°C.
• the expression cassette "Pem2/ uidA/ nos term" was separated by 0.8% agarose gel electrophoresis, electroeluted, precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -80°C for 30 min, centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, resuspended in water and inserted in between the sites Hindlll and EcoRI of the plasmid pGA492 (An, 1986) .
• Ligation was carried out in the presence of 1.0 ⁇ l of T4 10X DNA ligase buffer (Amersham) and 2.5 units of T4 DNA ligase (Amersham) at 14 °C for 16 hours. Viable and competent Escheri chia coli DH5 ⁇ bacteria were transformed (Hannahan, 1983).
• the plasmid DNA of the obtained clones as selected on Luria-Bertani medium (LB, bactotryptone 10 g/1, yeast extract 5 g/1, NaCl 10 g/1, Agar 15 g/1) supplemented with tetracycline (12 mg/1), was extracted according to the alkaline lysis method of Birnboim and Doly (Birnboim & Doly, 1983) and analyzed by enzymatic digestion. Starting from the thus obtained pGA492-PemJ-ui A plasmid, the promoter Pem2 was deleted via double digestion by Hindlll and Xbal.
• the plasmid fragment of interest was separated by 0.8% agarose gel electrophoresis, electroeluted, precipitated in the the presence of 1/10 volume of 3M sodium acetate pH 4.8 and 2.5 volumes absolute ethanol at -80°C for 30 min, centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, and subjected to the action of a Klenow fragment of DNA polymerase I (New England Biolabs) for 30 min at 37°C according to the recommendation of the manufacturer.
• the petE promoter (818 base pairs), which corresponds to the promoter of the pea plastocyanine gene, was obtained from the plamsid pKHn2 by digestion with Ncol for 1 h at 37°C.
• the 828 bp promoter fragment was isolated on 0.8% gel agarose, electroeluted, precipitated in the presence of
• This promoter fragment was inserted into the plasmid pGA492 ⁇ Pem2, described previously, in the presence of 1.0 ⁇ l of T4 10X DNA ligase buffer (Amersham) and 2.5 units of T4 DNA ligase (Amersham) at 14 °C for 16 h. Viable ad competent Escherichia coli DH5 ⁇ bacteria, were transformed. The plasmid DNA of the obtained clones, selected on LB medium supplemented with tetracycline (12 mg/1), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion. The resulting plamsid was designated pGA492-petE prom.
• Ligation was carried out with 50 ng of the vector pGEM3Z-PstI/EcoRI and 50 ng of the expression cassette "petE prom/uidA/nos term" for one night at 18 °C in a reaction medium of 12 ⁇ l in the presence of 1.2 ⁇ l of T4 10X DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs).
• Previously prepared viable and competent Escherichia coli DH5 ⁇ were transformed by mixing with the ligation reaction mixture.
• the plasmid DNA of the obtained clones selected on LB medium supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method and was analyzed by enzymatic digestion.
• the obtained plasmid was designated pGEM3Z-petE prom.
• pGEM3Z-petE prom In order to insert the 192 bp IV2 intron originating from the potato patatin gene into the uidA coding sequence, an internal portion of this gene (a SnaBI / BstBI 710 bp fragment in pGEM3Z-petE prom) was excised then replaced by the equivalent sequence containing the IV2 intron (a SnaBI / BstBI 902 bp fragment).
• the plasmid pGEM3Z-petE prom was digested for 1 h at 37°C by SnaBI (restriction site located at the +383 bp position upstream of the ATG initiator codon of the uidA gene) then for 1 h at 65°C by BstBI (restriction site located at the +1093 bp position) .
• the plasmid comprising the 710 bp deletion was isolated by 0.8% agarose gel electrophoresis, then purified on a Qiaquick affinity column.
• This plamsid derives from plamsid pSCV1.2, which in turn derives from plamsid pSCVl constructed by G.A. Edwards in 1990 according to the methods habitually used in cloning and well known to the skilled person.
• the binary plamsid pSCV1.2 was obtained by cloning the Hindlll fragment bearing the expression cassette "35S prom / nptll / nos term" ( Fromm and al., 1986) at the Hindlll site in pSCVl .
• the expression cassette "35S prom / GUS-IV2 / 35S term” was obtained by digesting the plamsid p35S GUS INT with Hindlll for 1 h at 37 °C as described by Vancanneyt and al. (1990).
• the DNA fragment corresponding to the expression cassette was isolated on 0.8% agarose gel, electroeluted then precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -80°C for 30 min then, centrifuged at 12000 g for 30 min, washed in 70 % ethanol, dried and resuspended in water.
• the ligation was carried out with 20 ng of vector pGEM3Z-petE prom BstBI/SnaBI and 80 ng of the 902 bp fragment BstBI/SnaBI, for 1 night at 18 °C in a 10 ⁇ l reaction medium in the presence of 1.0 ⁇ l of T4 10X DNA ligase (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs) . Viable and competent Escherichia coli DH5 ⁇ bacteria, were transformed by half of the ligation reaction mixture.
• the obtained plasmid was designated pGEM3Z-petE prom/IV2.
• the latter was digested for 1 h at 37 °C by BamHI then, for 1 h at 37°C by Pstl, isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column.
• the plamsid DNA of the obtained clones selected on LB medium supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method, analyzed by enzymatic digestion, and verified by sequencing according to the method of Sanger et al . (1977).
• the plasmid obtained was designated pMRT1144 (Fig. I) .
• the 192 bp IV2 intron of the potato patatin gene was inserted into the uidA coding sequence at the +383 bp position as described under section 1.1.
• a one microgram amount (1 ⁇ g) of bpl221 plasmid (Clontech, CA, USA) was digested for lh30 at 37°C by SnaBI, then for lh30 at 65°C by BstBI.
• the plasmid deleted of the 710 bp fragment was isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column.
• the plasmid DNA of the obtained clones selected on LB medium supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion.
• the obtained plasmid was designated bpI221/uidA-IV2.
• the sequence of the CaMV35S promoter present in the b ⁇ I221/uidA-IV2 plasmid was replaced by the "CaMV D35S" sequence.
• the DNA was digesteed for une night at 37 °C with 10 units of BamHI.
• the plasmid fragment, corresponding to the vector deleted of the 828 bp promoter CaMV 35S fragment was isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column.
• the plasmid pJIT163 has an ATG codon between the Hindlll and Sail sites of the polylinker.
• the plasmid DNA of pJIT163 was digested by Hindlll and Sail, purified by 0.8% agarose gel electrophoresis, electroeluted, precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -80°C for 30 min, centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, subjected to the action of the Klenow fragment of DNA polymerase I (New England Biolabs) for 30 min at 37°C according to the recommendations of the manufacturer, deproteinized by extraction with a volume of phenol, then a volume of phenol : chloroform : isoamyl alcohol (25:24:1 v/v/v) and finally a volume of chloroform : isoamyl alcohol (24:1 v/v), precipitated in the presence of 1/10 volume of 3M sodium
• Ten micrograms (lO ⁇ g) of plasmid pJIT163D were digested for 10h30min at 37°C with 10 units of Kpnl (site siutated in 5' of the promoter) , then the sticky ends were rendered blunt by the action of 6 units of T4 DNA polymerase (New England Biolabs) for 30 min at 37 °C according to the recommendations of the manufacturer. After purification of the product of this reaction on a Qiaquick affinity column, the DNA was digested for one night at 37 °C with 10 units of BamHI.
• the resulting 761 bp DNA fragment, corresponding to the promoter CaMV D35S was isolated by 1.0 % gel agarose electropheresis, then purified on a Quiaquick affinity column.
• the reaction mixture containing 10 ng of plasmid vector, 100 ng of the 761 bp fragment, 1.0 ⁇ l of T4 10X DNA ligase (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs) was subjected to ligation in 10 ⁇ l for one night at 18°C. Viable and competent Escherichia coli DH5 ⁇ were trasnformed with half of the ligation reaction mixture.
• the plasmid DNA of the obtained clones selected on LB media supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion.
• the plasmid obtained was designated pMRT1092 (Fig. II).
• pCaMV35Sluc The plasmid serving as an internal reference for transient expression is pCaMV35Sluc (Torrent et al., 1997) which contains the expression cassette of the luciferase reporter gene (luc) under the control of the RNA 35S Cauliflower Mosaic Virus promoter and terminator.
• pCaMV35Sluc Torrent et al., 1997) which contains the expression cassette of the luciferase reporter gene (luc) under the control of the RNA 35S Cauliflower Mosaic Virus promoter and terminator.
• luc luciferase reporter gene
• the plasmid pGEM3Z-petE prom was obtained as described above in section 1.1 of example 1. It corresponds to the plasmid pGEM3Z containing the reporter gene uidA-IV2 under the control of the whole of the pea plastocyanin gene (petE prom, Fig IV, SEQ.IDOl), and serves as a reference promoter for all of the constructions based on the plastocyanin promoter.
• the ligation was carried out with 25 ng of the thus modified plasmid for one night at 18°C in a 10 ⁇ l reaction mixture, in the presence of 1 ⁇ l of T4 10X DNA ligase (New England Biolabs) and of 400 units of T4 DNA ligase (New England Biolabs) .
• Viable and competent Escherichia coli DH5 ⁇ cells were transformed with half the ligation reaction mixture.
• the plasmid obtained was designated pMRT1097 and the promoter sequence designated MPrl097 (SEQ.ID02) was verified by sequencing.
• the promoter MPrl096 derives from the petE promoter by a 5 ' deletion of the inverted repeat sequences, the "as-1 like” elements and the “nos enhancer like” element borne by two Spel fragments of 403 bp and 105 bp respectively (Fig. IV) .
• 5 micrograms ( ⁇ g) of plasmid pGEM3Z-petE /IV2 were digested for 2 h at 37°C with 20 units of Spel enzyme, isolated by 0.8% agarose gel electrophoresis, and then purified on a Qiaquick affinity column.
• the ligation was carried out with 25 ng of the thus modified plasmid for 1 night at 18°C in a 10 ⁇ l reaction mixture, in the presence of 1 ⁇ l of T4 10X DNA ligase (New England Biolabs) and of 400 units T4 DNA ligase (New England Biolabs) .
• Viable and competent Escherichia coli DH5 ⁇ cells were transformed with half of the ligation reaction mixture.
• the plasmid obtained was designated pMRT1096 and the promoter sequence MPrl096 (SEQ.ID03) was verified by sequencing.
• the 207 bp promoter MPrl098 was constructed to contain only the "TATA” and "CAAT” boxes (Fig. IV) .
• the plasmid obtained was dsignated pMRT1098 and the promoter sequence MPrl098 was verified by sequencing (SEQ.ID04). This sequence corresponds to the minimal pea plastocyanin promoter (Fig. IV).
• SEQ.ID04 sequence corresponds to the minimal pea plastocyanin promoter (Fig. IV).
• the promoter MPrllO ⁇ was created by fusing the 72 bp sequence stretching from position -641 bp to position -569 bp of the petE promoter (SEQ. ID01), and bearing the "as-1 like” and “nos enhancer like” boxes, to the 187 bp minimal promoter sequence of MPrl098 (position -128 to +59 bp, SEQ.ID04) using the lb-PCR technique.
• the phosphorylated oligodesoxynucleotides were purified by extraction with a volume of phenol, then a volume of phenol : chloroform : isoamyl alcohol (25:24:1 v/v/v) and finally a volume of chloroform : isoamyl alcohol (24:1 v/v), before being precipitated with 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -80°C for 20 min then centrifuged at 16060 g for 30 min.
• the precipitated oligodesoxynucleotides were washed with 70% ethanol, dried, then resuspended in water at a concentration of 10 pmol/ ⁇ l.
• the reaction involved the steps consisting of one cycle for one minute at 94 °C, and of 8 identical subsequent cycles, each consisting in the following : one minute at 65°C, one minute at 57°C, one minute at 52°C, one minute at 48°C, one minute at 43°C, and finally ten minutes at 37°C.
• the ligation reaction mixture was purified on a Qiaquick affinity column according to the recommendations of the supplier.
• PCR amplification of the obtained single stranded DNA was carried out in a GeneAmp PCR System 9700 thermocycle in the presence 100 pmol of each of the oligodesoxynucleotide probes 5 ' GGAATCTGCAGTTGAACACGT 3 ' and 5 CGGGGATCCTCTAGGTTTCT 3 ' , 50 nmol of each of the dNTP, 10 ⁇ l Vent 10X DNA polymerase buffer (New England Biolabs), and 2 units of Vent DNA polymerase (New England Biolabs).
• the DNA was denatured for 5 min at 94°C, subjected to 25 cycles each consisting of a 30 second denaturizing step at 95°C, of a 30 second hybridizing step at 56°C, and of one minute of elongation at 72°C, then elongation at 72°C was continued for 5 min.
• the DNA fragments of the reaction mixture were digested with 20 units of BamHI for 45 min at 37°C, then by 20 units of Pstl for 1 h at 37 °C, and finally purified on a Qiaquick affinity column. They were inserted into the plasmid pGEM3Z-petE /IV2 that had been digested with BamHI enzyme for 1 h at 37 °C, then with Pstl enzyme for 1 h at 37°C, and subjected to 0.8% agarose gel electrophoresis, purified on a Quiaquick affinity column, dephosphorylated for 1 h at 37 °C in the presence of 12 ⁇ l of "buffer 3" 10X (New England Biolabs) and of 5000 units of caclf gut alkaline phosphatase (CIP, New England Biolabs), and finally purified on a Quiaquick affinity column.
• the plasmid pMRT1108 contains the expected promoter (SEQ.ID05), whereas the plasmid pMRT1109 bears the promoter sequence MPrll09 (SEQ.ID06) which differs from MPrll08 by a deletion of 33 bp in the 5' untranslated region, 11 bp upstream of position +1 (Fig. IV).
• the promoter MPrlllO was created by inserting, at position -99 bp of the MPrl098 promoter (SEQ.ID04), a block of 18 bp containing a "G" box (stretching from positions -204 bp to -186 bp of the petE promoter, SEQ.IDOl) and by fusing to this modified minimal promoter minimal a sequence of 44 bp from the RNA 35S cauliflower mosaic virus promoter (CaMV) containing the as-2 and as-1 elements (Lam, 1989 ; Lam and al . , 1989) (Fig. IV) .
• MPrlllO was synthesized by the lb-PCR technique.
• the continuous single stranded DNA was formed with the help of the following "directional" oligodesoxynucleotides :
• One hundred picomole (100 pmol) of the SI, S2 and S5 oligodesoxynucleotides were 5' phosphorylated with the help of 15 units of kinase (Amersham) in the presence of 5 ⁇ l of 10X kinase buffer (Amersham) and 500 pmol of ATP (Sigma), for 30 min at 37°C.
• the phosphorylated oligodesoxynucleotides were purified by extraction with a volume of phenol, then a volume of phenol : chloroform : isoamyl alcohol (25:24:1 v/v/v) and finally a volume of chloroform : isoamyl alcohol (24:1 v/v), before being precipitated with 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes absolute ethanol at -80°C for 20 min then centrifuged at 16060 g for 30 min. Les precipitated oligodesoxynucleotides were washed in 70% ethanol, dried, then resuspended in water at une concentration of 10 pmol/ ⁇ l.
• PCR ammplification of the single stranded DNA obtained previously was carried out dans in a GeneAmp PCR System 9700 thermocycle in the presence of 100 pmol of each of the following oligodesoxynucleotide probes 5' CATGCTGCAGACTAGTGGATT 3', and 5' CGGGGATCCTCTAGGTTTCT 3', of 50 nmol of each of the dNTP, of 10 ⁇ l of Vent 10X DNA polymerase buffer(New England Biolabs), and of 2 units Vent DNA polymerase (New England Biolabs).
• the DNA was denatured for 5 min at 94 °C, subjected to 25 cycles each composed of 30 sec of a denaturing step at 95°C, of 30 sec of a hybridization step at 56°C, and of 1 min of elongation at 72°C, then elongation at 72 °C was continued for 5 min.
• the DNA fragments of the reaction mixture were digested with 20 units of BamHI enzyme for 45 min at 37°C then with 20 units of Pstl enzyme for 1 h at 37°C, and finally purified on a Qiaquick column.
• the promoter sequence MPrlllO borne by the plasmid pMRTlllO was verified by sequencing (SEQ.ID07).
• Th promoter MPrllll was created by inserting an 18 bp element containing a "G" box (stretching from positions -204 bp to ⁇ 186 bp of the petE promoter, SEQ.IDOl) at position -99 bp of MPrl098 (SEQ.ID04), and by fusing into this minimal promoter a sequence of 58 bp corresponding to a duplication of the as-2 element (Lam and Chua, 1989) and the as-1 element (Lam et al., 1989) of the CaMV 35S.
• MPrllll (Fig. IV) was synthesized by the lb-PCR technique as described previously.
• One hundred picomole (100 pmol) of the Si, S2 and S5 oligodesoxynucleotides were phosphorylated in the 5' region through the use of 15 units of kinase (Amersham) in the presence of 5 ⁇ l of 10X kinase buffer (Amersham) and 500 pmol of ATP (Sigma), for 30 min at 37°C.
• the ligation reaction was carried out in a GeneAmp PCR System 9700 thermocycle (Perkin Elmer, Norwalk, USA) and was comprised of one cycle for 1 min at 94 °C, and then 8 identical cycles each comprising the following successive steps : 1 min at 65°C, 1 min at 57°C, 1 min at 52°C, 1 min at 48°C, 1 min at 43°C, and finally 10 min at 37°C.
• the ligation reaction mixture was purified on a Qiaquick column according to the recommendations of the supplier.
• PCR amplification of the obtained single DNA strand was carried out in a GeneAmp PCR System 9700 thermocycle in the presence of 100 pmol each of the oligodesoxynucleotide probes 5 ' CATGCTGCAGACTAGTGGATT 3 ' , and 5 ' CGGGGATCCTCTAGGTTTCT 3 * , 50 nmol of each of the dNTP, 10 ⁇ l of Vent 10X DNA polymerase buffer (New England Biolabs), and 2 units of Vent DNA polymerase (New England Biolabs).
• the DNA was denatured for 5 min at 94°C, subjected to 25 cycles each comprising a 30 sec denaturing step at 95°C, of a 30 sec hybridization step at 56°C, and of
• the DNA fragments of the reaction mixture were digested with 20 units of BamHI for 45 min at 37°C, then by 20 units of Pstl for 1 h at 37°C, and finally purified on a Qiaquick column. They were inserted into the plasmid pGEM3Z-petE /IV2, which had been previously digested by BamHI enzyme for 1 h at 37 °C and then by Pstl enzyme for 1 h at 37°C, subjected to 0.8% agarose gel electrophoresis, purified on a Quiaquick affinity column, dephosphorylated for 1 h at 37 °C in the presence of 12 ⁇ l of "Buffer 3" 10X (New England Biolabs) and of 5000 units of calf intestine alkaline phosphatase (CIP, New England Biolabs), and finally purified on a Quiaquick affinity column.
• the plasmid pMRTllll contains the expected promoter Mprllll (SEQ.ID08), whereas in the plasmid pMRT1112, the promoter MPrlll2 (Fig. IV) differs from MPrllll by a deletion of 35 bp containing the "G" box and stretching from position -127 to position -89 and also a deletion of two bp situated in positions -78 and -76 (SEQ.ID09).
• the promoter MPrll53 (Fig.
• the plasmid pMRTllll was digested with 20 units of Pstl enzyme and 1 unit of Drain enzyme for 1 h at 37°C.
• the 78 bp Pstl/Dralll fragment containing the two "as-1 like” and “nos enhancer like” elements of the petE promoter was generated by digesting 10 ⁇ g of the plasmid PMRT1108 with 20 units of Pstl enzyme and 1 unit of Drain enzyme for 1 h at 37 °C, then the fragment was isolated by
• the plasmid obtained was designated pMRT1153 and the promoter sequence MPrll53 (SEQ.ID10) verified by sequencing. 3.5.
• the promoter MPrll43 (Fig. IV) was obtained by deleting the 72 bp sequence bearing the "as-2, as-2, as-1" elements of MPrllll. This was achieved by digesting the plasmid pMRTllll for 1 h at 37 °C simultaneously with 20 units of Pstl enzyme and 1 unit of Drain enzyme.
• the plasmid thus deleted of the 70 bp fragment containing the two as-2 elements and the as-1 element of CaMV were isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column. The ends of this fragment were made blunt by the action of Pfu DNA polymerase (Stratagene, La Jolla, USA) according to the supplier's recommendations. This fragment was religated for 1 night at 18 °C in a 10 ⁇ l reaction mixture containing 20 ng of vector, 1.0 ⁇ l of the T4 10X DNA ligase buffer (New England Biolabs) and 400 units T4 DNA ligase (New England Biolabs).
• the preparation of the binary vector was the same for each of the expression cassettes containing MPrllll, MPrl098, Mprll43 and MPrl092.
• a 25 ⁇ g amount of the plasmid pGA492 (An, 1966) was digested with ⁇ 0 units of Hindlll enzyme for 1 h at 37°C, then purified on a Quiaquick affinity column.
• the protruding 5' ends of this plasmid were blunted using Pfu DNA polymerase (Stratagene, La Jolla, USA) according to the recommendations of the supplier.
• the thus modified plasmid was digested with ⁇ O units of EcoRI enzyme for 1 h at 37 °C, then the resulting vector deleted of a 291 bp fragment was separated on 0.7 % agarose gel and purified on a Quiaquick affinity column.
• the ligation was carried out by mixing 100 ng of binary plasmid pGA492 prepared as described above and 50 ng of expression cassette for 1 night at 18°C, in a 20 ⁇ l reaction volume in the presence of 2 ⁇ l of the T4 10X DNA ligase buffer (New England Biolabs) and 400 units T4 DNA ligase (New England Biolabs) .
• T4 10X DNA ligase buffer New England Biolabs
• T4 DNA ligase New England Biolabs
• the plasmid DNA of the obtained clones was extracted according to the alkaline lysis method and analyzed by enzymatic digestion as well as by gene amplification with the help of the oligodesoxynucleotides 5' ATATGAGACTCTAATTGGATACCGAGGGG 3', selected from the transfer DNA of the binary plasmid and 5' TTGATTTCACGGGTTGGG 3', selected from the expression cassette around the uidA sequence.
• the resulting clone was designated pMRT1151.
• the expression cassette "MPrll43/uidA-IV2/nos term" was cloned at the modified Hindlll site of the binary plasmid pGA492, following the same protocol as for plasmid pMRT1151, with the exception that the expression cassette was isolated from the plasmid pMRT1143. The resulting clone was designated pMRT1149. 4.3. Production of the binary plasmid pMRT1170.
• the promoter fragments MPrl092 and sequence "uidA-IV2/nos term" were inserted into the binary plasmid pGA492 prepared as described above.
• the fragments were prepared in the following manner :
• the CaMV D35S promoter was isolated by digesting 10 ⁇ g of the plasmid pJITl63 ⁇ with 40 units of Kpnl enzyme for 1 h at 37 °C. The ends of this linear plasmid were blunted with the help of 6 units of T4 DNA polymerase (New England Biolabs) for 30 min at 37°C according to the manufacturer's recommendations.
• the thus modified plasmid was purified on a Quiaquick affinity column, then redigested with 80 units of Hindlll enzyme for 1 h at 37°C.
• the 743 bp fragment corresponding to the promoter was separated on 0.8 % agarose gel, then purified on a Quiaquick affinity column.
• the "uidA-IV2/nos term” sequence was obtained by digesting 4 ⁇ g of the plasmid pMRT1092 with 40 units of Hindlll enzyme and EcoRI enzyme for 1 h. The 2.2 kb fragment corresponding to the sequence "uidA-IV2/nos term” was separated on 0.8 % agarose gel, then purified on a Quiaquick affinity column.
• the ligation between the three fragments was carried out by mixing 100 ng of binary plasmid, 50 ng of promoter fragment and 50 ng of the fragment corresponding to the sequence "uidA-IV2/nos term" in a reaction volume of 20 ⁇ l, in the presence of 2 ⁇ l of T4 10X DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs) .
• the incubation was carried out in a thermocycle by subjecting the ligation mixture to 198 cycles each comprising a 30 sec incubation at 30°C, and a 30 sec incubation at 10°C.
• Previously prepared viable and competent Escherichia coli DH5 ⁇ cells were transformed with half the ligation reaction mixture.
• the plasmid DNA of the obtained clones was extracted according to the alkaline lysis method and analyzed by enzymatic digestion and gene amplification with the help of the oligodesoxynucleotides 5 ' ATATGAGACTCTAATTGGATACCGAGGGG 3 ' , selected from the transfer DNA of the binary plasmid and 5 ' TTGATTTCACGGGTTGGG 3 ' , selected from the expression cassette in the "uidA" sequence.
• One of the clones retained was designated pGA492MPrl092.
• the binary plasmid pMRT1182 was obtained by insertion of the promoter fragment CaMV D35S and of the sequence uidA-IV2/term-nos in the binary plasmid pMRTlll ⁇ . This latter plasmid is described completely in French patent application number FR 99 11112, filed on September 3, 1999, in the name of the present applicant, the specific description of which is incorporated herein by reference.
• the binary plasmid pMRTlll ⁇ (5971 pb) results from the introduction of a T-DNA fragment digested by Avrll enzyme into the Avrll site of another dephosphorylated plasmid also fully described in the previously mentioned prior application to same applicant, and designated pMRT1106, also specifically incorporated herein by reference.
• the pMRT1106 plasmid DNA (5 ⁇ g) was digested with Avrll enzyme, purified with the aid of the « QIAquick PCR Purification » kit, then dephosphorylated with 50 units of calf intestine alkaline phosphatase (New England Biolabs) in a final reaction mixture volume of 120 ⁇ l in the presence of 12 ⁇ l 3x 10 buffer (New England Biolabs) at 37 °C for 1 hour, isolated by electrophoresis on a 0.6% agarose gel in TBE buffer, purified with a « QIAquick Gel Extraction » kit, dephosphorylated a second time with the calf intestine alkaline phosphatase under the conditions mentioned above, and finally purified with a « QIAquick PCR Purification » kit and transferred to 50 ⁇ l de H0.
• the PCR ligation reaction was carried out with 32,5 ng of digested dephosphorylated plasmid pMRT1106 and 50 ng of T-DNA fragments digested in a reaction mixture volume of 10 ⁇ l in the presence of 1 ⁇ l T4 lOx DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs) .
• the ligation comprised 160 cycles each including 2 steps, the first one at 10°C for 30 seconds and the second step at 30°C for 30 seconds in a « GeneAmp PCR System 9700 » thermocycle.
• the promoter CaMV D35S was isolated by digesting 10 ⁇ g of plasmid ⁇ JIT163 ⁇ successively with Kpnl and Hindlll enzymes for 1 hour at 37 °C. The 743 bp fragment corresponding to CaMV D35S was separated on 0.8% gel agarose, and then purified on a Qiaquick affinity column. The sequence "uidA-IV2/nos term" was obtained by digesting the plasmid pMRT1092 with 40 units of Hindlll and EcoRI enzymes for 1 hour. The 2.2 kb fragment corresponding to the required sequence was separated on 0.8% gel agarose, then purified on a Qiaquick affinity column.
• the ligation was carried out in the presence of 100 ng of binary plasmid, 50 ng of the CaMV D35S fragment and 50 ng of the fragment corresponding to "uidA-IV2/nos term" in a reaction volume of 20 ⁇ l, in the presence of T4 (IX) DNA ligase buffer and 400 units of T4 DNA ligase (New England Biolabs). Incubation was carried out by PCR cycles in a "GeneAmp PCR System 9700" thermocycle as described previously. Previously prepared viable and competent Escherichia coli DH5 ⁇ bacteria were transformed with half of the ligation reaction mixture.
• the plasmids pMRT1151, pMRT1149, pMRT1170 and pMRT1182 were transferred into the strain Agrobacterium tumefaciens LBA4404 according to the technique described by Holsters et al. (1978).
• the plasmid DNA of the obtained clones selected on LB media supplemented with rifampicine (50 mg/1) and tetracycline (5 mg/1), was extracted according to the alkaline lysis method, and modified by adding lysozyme (25 mg/ml) to the cell resuspension buffer.
• the plasmid DNA obtained was analyzed by enzymatic digestion and by gene amplification with the help of the oligodesoxynucleotides 5' ATATGAGACTCTAATTGGATACCGAGGGG 3' selected from the transfer DNA of the binary plasmid and
• the transient expression experiments were carried out on tobacco leaves (Nicotiana tabacum L.) of the cultivar bpD6 aged 6 weeks. Mature seeds of tobacco cv. bpD6 were sterilised for 10 min in a saturated calcium hypochlorite solution (70 g/1), then rinced three times for 5 min in sterile deionized water. The sterile seeds were then placed on MS20 media (Murashige and Skoog, 1962) and incubated for 6 weeks in a culture chamber (constant temperature of 24 °C, photoperiode 16 h obscurity / 8 h light, light intensity of 200 ⁇ mol photons .m-2. sec-1 ) .
• the major leaves of the bpD6 tobacco plants aged 6 weeks were excised from the plant 24 h before gene gun transformation, and placed, lignous face up, on light plasmolysis BY3 media (MS Salts 4,4 g/1, myoinositol 100 mg/1, thiamine 1 mg/1, KH 2 P0 200 mg/1, Saccharose 30 g/1, Sorbitol 45,5 g/1, 2,4 D 1 mg/1, pH 5,8).
• Gene gun transformation requires prior coating of DNA onto gold bead spheres of 0,6 mm in diameter, that have been sterilized for 10 min absolute ethanol (99,98 %, at less than 0,02 % water) , washed four times in sterile deionized water, and finally preserved for a maximum of 4 weeks maximum at -20°C in a 50% glycerol solution.
• the coating of DNA onto the previously prepared gold beads was carried out in a sterile container under laminar flow conditions. An aliquot of 1,8 mg of sterile beads in suspension in 30 ⁇ l of 50 % glycerol, was vigourously mixed in a vortexer for 1 min, then for 10 sec with 20 ⁇ l of DNA suspension containing 4 ⁇ g of one of the plamsids to be tested and 2 ⁇ g of the reference plasmid pCaMV35Sluc. Then, 20 ⁇ l of CaCl : 2,5 M were added and mixed vigourously for 10 sec. Next, 20 ⁇ l of spermidine 0, 1 M were added to the mixture and whole mixture was agitated under vortex for 30 further seconds. The coating of DNA onto the beads was continued by incubating the mixture in ice for 15 min, then the coated beads were centrifuged at low velocity for 5 sec and washed twice in absolute ethanol.
• the coated beads were resuspended in 32 ⁇ l of absolute ethanol, subjected to ultrasound three times each for 2 sec, vigourously mixed in the vortexer for 15 sec, then immediately split into 4 identical equal aliqouts on sterile macrocarrier disks used in a Biolistic PDS-1000/He system prepared according to the manufacturer's recommendations (Bio-Rad, Hercule, USA) .
• the whole arrangement of macrocarrier support and macrocarrier bearing the deposited beads was left to dry for 5 min.
• the plant sample was placed at a distance of 9 cm from the bead acceleration zone.
• the leaves were bleached by dipping them into two 95 % ethanol baths for respectively 3 and 12 h, then rinsed in distilled water and dried flat between two sheets of cellophane.
• the promoter activity of the different constructs was evaluated by the number of blue spots revealed on each leaf after two bombardments amounting to 2 ⁇ g of DNA bearing the GUS reporter gene.
• Three categories of promoters were identified.
• the leaves bombarded with the promoters MPrl096, MPrl098, MPrllO ⁇ , MPrll09, MPrll43 and MPrll53 all showed an average of less than 30 blue spots.
• the leaves bombarded with the promoters petE, MPrl097 and MPrlllO all showed a number of blue spots between 50 and 150.
• the leaves bombarded with MPrllll and the reference promoter MPrl092 had a very large number of blue spots on average and in general greater than 200.
• the chimeric promoters MPrlllO and MPrllll enable expression of per electrical d'rus une expression of ⁇ -glucuronidase at a level greater than or equal to that of the whole petE promoter ; and MPrllll shows promoter activity at least as comparable as that obtained by the strong constitutive reference promoter D35S prom. 5.5. Quantification of the expression of ⁇ -glucuronidase by the different promoters using luminometric enzyme assay.
• the frozen leaf halves were ground in a mortar, and the powder was left to defrost in the extraction buffer at 1 ml of buffer for 200 mg of plant tissue (Tris Phosphate 25 mM pH 7.8, Dithiothreitol 2 mM, 1, 2-diaminocyclohexane N,N,N',N'-tetracetic acid 2 mM, glycerol 10 %, Triton xlOO
• the GUS activity was measured on 20 ⁇ l crude clarified leaf extract with the help of the detection kit "GUS-Light chemiluminescent reporter gene assay” (Tropix Inc., Bedford, USA) according to the supplier's recommendations.
• the measurement of light emission was carried out with the help of a Lumat LB 9507 luminometer (EGG-Berthold, Bad Wildbad, entrée) .
• the promoters can be divided into 6 classes ordered on an increasing scale of expression starting from the weakest (class 1) to the strongest (class 6) :
• the promoters MPrl09 ⁇ and MPrll43 show similar activity.
• the promoter Mprll43 results from the insertion of a "G" box at a distance of 36 bp upstream of the "CAAT” box in the minimal promoter MPrl098. The presence of this box does not appear to have a significant effect on the expression obtained with the promoter MPrl098.
• the promoter MPrlll2 includes upstream of the "CAAT” box, a duplication of the "as-2" box followed by the "as-1" box originating from the promoter 35S of CaMV. These elements on their own do not appear to contribute to improving the epxression rate which is essentially identical to that obtained with the promoter MPrl09 ⁇ .
• promoters MPrl096 and MPrl097 (Fig. IV).
• the expression conferred by these two promoters is identical.
• the creation of MPrl096 by deletion of the fragments Sphl-Spel bearing the "nosE like" box and Spel-Spel of MPrl097, bearing a region from the sequence enhancer of the petE promoter (Fig. IV), does not appear to affect the expression rate.
• promoter MPrl096 the presence of the "G" box, preceded by the 31 bp of the petE sequence enhancer and at a distance of 122 bp from the "C7 ⁇ AT" box appears to enable the increase in the expression rate obtained by MPrl098 by a factor of 2.5.
• - Class 5 comprises the promoter MPrlllO (Fig. IV).
• the fusion of the as-2 and as-1 boxes upstream of the promoter MPrll43 creating the promoter MPrlllO enables a considerable increase in the expression rate that is very much higher than that obtained with the petE promoter (by a factor of 1.4). It appears that the "G”, "as-1” and “as-2” boxes together have an active positive synergic effect with respect to the expression.
• the promoter MPrllll confers an expression rate similar to that of the reference double 35S CaMV promoter (MPrl092) .
• the addition of an "as-2" element or box considerably increases the expression rate with respect to that obtained by MPrlllO (by a factor of 1.7). These elements appear to act synergistically.
• the duplication of the "as-2" box also increases this effect.
• the chimeric promoter MPrlllO enables an average expression of ⁇ -glucuronidase at a level greater than or equal to the whole petE promoter.
• the promoter MPrllll has a promoter activity comparable to the average activity obtained with the reference promoter D35S.
• the CaMV D35S promoter is commonly reported in the literature as being a strong promoter.
• the chimeric promoters of the present invention bring an increase in the promoter activity of the GUS reporter gene of the order of 8 to 12 times that of the reference promoter CaMV 35S (Kay and al., 1987) .
• MPrllll constitutes one of the most active and strongest chimeric promoters in tobacco leaves described to date.
• the promoters of lesser strength can be used as promoters associated with genes coding for selection agents, for example, in order to confer antibiotic resistance, for example in the same way as promoters of the "nos" type.
• Example 6 Expression of the different promoters in tobacco after stable transformation.
• tobacco (Nicotiana tabacum L., cultivar bpD6) was carried out by infecting foliar disks isolated from tobacoo plants aged 6 weeks by recombinant Agrobacterium according to the method described by Horsch et al. (1985). During transformation, the Petri dishes were incubated in a culture chamber under the following conditions : temperature of 24°C, photoperiod of 8 h darkness / 16 h light, luminous intensity of 200 ⁇ mol photons .m-2.
• a bud tip formation step consisting of four weeks in a culture chamber on a solid MS20 regeneration media (Salts and vitamins MS 4,4 g/1 (Sigma, M0404), Saccharose 20 g/1, , agar ⁇ g/1
• ⁇ -glucuronidase activity was measured in primary transformants 2, 4, 6, 8 and 10 weeks after their transfer to greenhouse. For each plant, 3 samples were taken and pooled together in a test tube. One sample was taken from an "old" leaf (basal foliar level), one from a mature leaf (of a median leaf level), and one on a young leaf located at the apex of the plant.
• the material was homogenized, incubated for 15 min on ice before being clarified by centrifugation at 16060 g for 5 min.
• GUS activity was measured on 20 ml of clarified crude extract with the help of the "GUS-Light chemiluminescent reporter gene assay" detection kit (Tropix Inc., Bedford, USA) according to the manufacturer's recommendations. Measurements of light emission were carried out using the Lumat LB 9507 luminometer (EGG-Berthold, Bad Wildbad, Germany) .
• Reporter gene activity in the different categories of plants was analyzed over the population of 20 transformants per construct, and over the whole period of plant growth and development. Analysis was not performed at the individual level because of random insertion sites and variable copy number in the different transformants of a given category.
• GUS activity in MPrl092 reference plants showed relatively little variation compared to what was observed in plants transformed with plastocyanin-based promoters. Activity decreased slightly between 2 and 4 weeks after transfer of the plants to greenhouse; increased about 4 times at 6 weeks, dropped again at 8 weeks to values observed at 4 weeks and finally increased slightly at 10 weeks. Analysis of plastocyanin-based promoters revealed that whatever promoter or plant considered, GUS activity increased regularly from 2 to 6 weeks after transfer to greenhouse and decreased thereafter till flowering.
• MPrllll is the promoter that drove expression of the reporter protein GUS at the highest level 8 weeks after transfer of the plants to greenhouse, and therefore appears to be the best candidate to be used for expression of large quantities of heterologous proteins at this stage of tobacco development.
• Gaubier P. Raynal M., Hull G., Huestis G.M., Grellet F.
• CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236, 1299-1302. Lam E., Benfey P. N. , Gilmartin P. M. , Fang R. X. and Chua N. H.
• ASF-2 a factor that binds to the cauliflower mosaic virus 35S promoter and a conserved GATA motif in Cab promoters. Plant Cell, 1, 1147-1156.
• Plastocyanin is encoded by a single-copy gene in the pea haploid genome. Plant Mol. Biol. 12,
• pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants. Plant J. 3, 437-449.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biochemistry (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Biomedical Technology (AREA)
• General Health & Medical Sciences (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Microbiology (AREA)
• Cell Biology (AREA)
• Botany (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicinal Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=9543560

Family Applications (1)

Country Status (7)

Families Citing this family (15)

Family Cites Families (1)

• 1999
  • 1999-03-22 FR FR9903635A patent/FR2791358B1/fr not_active Expired - Fee Related
• 2000
  • 2000-03-20 JP JP2000606765A patent/JP2002539795A/ja not_active Withdrawn
  • 2000-03-20 CA CA002366228A patent/CA2366228A1/en not_active Abandoned
  • 2000-03-20 CN CN 00807947 patent/CN1351669A/zh active Pending
  • 2000-03-20 WO PCT/IB2000/000317 patent/WO2000056906A1/en not_active Application Discontinuation
  • 2000-03-20 EP EP00909573A patent/EP1163351A1/de not_active Withdrawn
  • 2000-03-20 AU AU31853/00A patent/AU767285B2/en not_active Ceased

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events