AU767285B2 - Chimeric promoters based on the plastocyanin pete promoter from pea - Google Patents

Description

WO 00/56906 PCT/IBO/00317 CHIMERIC PROMOTERS BASED ON THE PLASTOCYANIN PETE PROMOTER FROM PEA

[DESCRIPTION]

The present invention relates to chimeric expression promoters, particularly suitable and adapted for use in the field of plant biotechnology.

In general, expression promoters are well known in the field of biotechnology and genetic manipulation. Insofar as plant biotechnology is more particularly concerned, the degree of expression of a gene coding for a polypeptide that it is desired to produce in a host cell is often dependent on the promoter used. The various promoters that are ubiquitously used are often limited to specific applications or particular cell tissues, simply because of their tissue specificity or expression strength. For example, one might cite the 35S promoter of the cauliflower mosaic virus as being a relatively strong promoter, compared to, say, the promoter originating from the nos gene, both of these promoters being more particularly used in the field of plant biotechnology. There thus exists at the present time a need for new and useful promoters that enable one to overcome the problems inherent in the promoters currently used up until now.

One attempt to solve this problem has been reported in the PCT application published under the number WO 97/20056, which describes increasing the degree of genetic expression through the use of "enhancers", having a positive effect on the activity of the promoter), in known promoters. The "enhancing" nucleotide sequences are rich in A and T bases, the total amount of said bases coomprising more than 50% of the nucleotide sequence of the "enhancer". In particular, the applicants of this PCT application specify the use of an "enhancer" zone originating from the pea plastocyanin promoter.

The expressions used herein and in the claims are intended to have the following meanings WO 00/56906 PCTIB00/00317 "riuclhic acid" means DNA or RNA "nucleic acid sequence" means a single or double-stranded oligomer or polymer, of nucleotide bases read from the extremity towards the 3' extremity, and includes self-replicating plasmids, genes, polymers of DNA or RNA, whether infectious or not, and also DNA or RNA whether functional or not. In the nucleotide notation used in the present application, and unless otherwise mentioned, the left extremity of a single stranded nucleotide sequence is the extremity "derived nucleic acid sequence" means that the sequence derives directly or indirectly from the sequence to which reference is made, for example by substitution, deletion, addition, mutation, fragmentation, and/or synthesis of one or more nucleotides "promoter" or "promoting nucleic acid sequence" means a region of nucleic acid upstream of a start codon for translation and which is implicated in the recognition and binding of polymerase RNA and other proteins involved in transcription "plant promoter" means a promoter that is capable of initiating transcription plant cells "constitutive promoter" means a promoter capable of expressing nucleic acid sequences operably linked to said promoter, in all or nearly all the tissues of the host organism throughout the development of said organism "tissue specific promoter" means a promoter capable of epxressing, in a selective manner, nucleic acid sequences operably linked to said promoter, in certain specific tissues of the host organism "operably or functionally linked" means the linking of the promoter or the promoter nucleic acid sequence, to a nucleic acid sequence, or gene, to be expressed coding for a protein which it is desired to produce, in such a way that the promoter positively inflences or drives transcription of the linked nucleic acid sequence. It must be understood that that the promoter sequence may also include sequences which are WO 00/56906 PCT/IB00/00317 transcribed situated between the transcription start site and the translation start codon "nucleic acid sequence, or gene, to be expressed coding for a polypeptide that it is desired to produce" means a gene or nucleic acid sequence coding for a polypeptide, and preferably and exogenous or heterologous polypeptide, said exogenous polypeptide being more preferably a pharmaceutically, therapeutically or cosmetically active substance, such as a protein, enzyme, inhibitor, receptor, antibody, antigen, therapeutically active fragments thereof. Exemplary heterologous or exogenous therapeutically active substances that may be produced through expression of corresponding genes or nucleic acid sequences in a host cell are structural proteins, such as collagen, iron transfer proteins or transferrins, such as lactoferrin, blood derived proteins, such as hemoglobin, human serum albumin, erythropoietin, growth stimulating factors, proteolytic or anti-proteolytic enzymes, such as alpha-antitrypsine, hormones, secondary metoblites, digestive enzymes, such as gastric lipase, pancreatic lipase, trypsine, chymotrypsine, alcohol dehydrogenase, brain derived neurotrophic factors,cardiac stimulators or modifiers, and blood pressure control agents such as angiotensins; "expression cassette" means nucleotide sequences capable of driving expression of a nucleic acid sequence, or of a gene, coding for a polypeptide which it is desired to produce in a host organism which is compatible with such expression cassette sequences. Such expression cassettes generally comprise at least one promoter and a transcription termination signal, and optionally other factors necessary or useful for expression "vector" means expression systems, for example projectiles coated with DNA, nucleic acid based transport vehicles, nucleic acid molecules adapted for delivering nucleic acid sequences, and circular self-replicating autonomous DNA, for example plasmids, cosmids, phagemids, etc. If a recombinant micro-organism or recombinant cell culture is described as a WO 00/56906 PCT/IB00/00317 host for an "expression vector", this also includes circular extrachromosomal DNA (such as for example, mitochondrial or chloroplast DNA), DNA having been integrated into the host chromosome(s), the vector being either stably replicated by the cells during mitosis as an autonomous structure integrated into the host genome, or maintained in the nucleus or the cytoplasm of the host "plasmid" means a molecule of circular autonomous DNA capable of replication in a cell, and includes both "expression plasmids" and "non-expression plasmids". If a recombinant micro-organism or cell culture is described as a host for an "expression plasmid", this also includes molecules of circular extrachromosal DNA and DNA having been integrated into the host chromosome(s). If the plasmid is maintained by a host cell, the plamsid is either stably replicated by the cells during mitosis as an autonomous structure, or integrated into the host genome "heterologous sequence" or "heterologous nucleic acid sequence" means a sequence orginating from a source or species that is foreign to the environment, or if it originates from the same environment, has been modified with respect to its original form. The modification of the nucleic acid sequencecan occur for example through treatment of the nucleic acid with a restriction enzyme to generate a fragment of nucleic acid capable of beign operably linked to a promoter. The modificaiton can also occur through the use of techniques like site specific mutagenesis "box" means a nucleic acid sequence to which a regulatory function is attributed "like" means that the box and/or nucleic acid sequence with which this latter term is associated, comprises a certain sequence identity or homology with a known box and/or a known nucleic acid sequence indicated as a reference, and preferably a sequence identity of at least 50%, even more preferably a sequence identity of at least 75%, and most preferably a sequence identity of at least 90% with the reference sequence.

The percentage of identity of the sequence is calculated on the basis of a comparison window of at least 6 contiguous nucleotide WO 00/56906 PCT/IBOO/00317 bases."The determination of a comparison window can be carried out by using sequence alignment algorithms in order to determine an homology with the reference sequence, for example the local homology algorithm, the homology alignment algorithm, and the similarity search algorithm, these algorithms also existing as computer programs, and designated by names such as GAP, BESTFIT, FASTA and TFASTA. The percentage of sequence identity is obtained by comparing the reference sequence with the box and/or nucleic acid sequence using one or more of the abovementioned methods "situated" means the position on a nucleic acid sequence of an identified element, as for example a "box", a restriction site, or a codon having a particular function. The position that is given by a number refers to the position of the start of the element in the nucleic acid sequence, in the reading direction of the latter, i.e. in the direction with respect to the position of the transcription start site indicated as +1 "transgenic plant" means a plant having been obtained through the application of genetic manipulation techniques, and includes whole plants obtained by such techniques, their progeny, as well as plant organs, for example, but non limitatively, roots, stems, leaves and leaves, obtained by such techniques. The transgenic plants obtained according to the present invention can also have different degrees of diploidism, and can for example be polyploid, diploid, and haploid "propagule" means an accumulated mass or an association or an aggregation of structured or unstructured plant cells, capable of enabling the regeneration of a whole plant therefrom such associations can for example be in the form of explants, calli, stems, leaves, roots, cuttings, and even seeds.

The present applicant has taken a completely different approach to that taken by the applicant or the previously discussed PCT application. Serendipitously, the present applicant has managed to produce chimeric promoters which fill the need expressed previously, and in particular, enable an increase in the degree of expression of a gene, or a nucleic acid sequence operably linked to said promoter, which codes for a polypeptide that it is desired to produce in a host cell, and preferably in a plant cell, with respect to the existing promoters currently in use.

Furthermore, the present applicant has managed at the same time to produce a family of promoters in such a way as to enable the choice of a promoter most suited to a particular task or application or an environment in which it is intended to be used, and thus is able to control the degree of expression of a gene to be expressed, or a nucleic acid sequence operably linked to said promoter, that codes for a polypeptide which it is desired to produce in the host cell.

Consequently, preferred embodiments of the present invention comprise a chimeric .expression promoter comprising at least one nucleic acid sequence derived from a promoter of the pea plastocyanin gene having the sequence identified under the number SEQ.ID01. Preferably, the chimeric promoter comprising a nucleic acid sequence derived from the promoter of the pea plastocyanin gene is selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, and Furthermore, the present applicant'has noticed that it is possible to build promoters according to the invention, and especially plant promoters, having an interesting promoter activity, whilst at the same having a minimum of regulatory boxes, and in particular at least one box, a "CAAT" box and a "TATA" box, the only condition being that the box be situated upstream of the other boxes, i.e. in the 5' region of the nucleic acid sequence, and that this box be preferentially situated at a certain distance, expressed in nucleotide bases, upstream from the other boxes. Thus, another object of the present invention is a chimeric expression promoter comprising a box operably linked upstream of at least one "CAAT" box, one "TATA" box and a S" transcription initiation site (indicated by +1 in the figures) More preferably, the box is situated between the positions 225 WO 00/56906 PCT/IB00/00317 and -65. with respect to the transcription initiation site Even more preferably, the box is situated between the positions 201 and 115 with respect to the transcription initiationsite (indicated by +1 in the figures). In the most preferred embodiments, the box is situated either at position 201, or at position 115, with respect to the transcription initiation site (indicated as position +1 in the figures).

Advantageously, the box is of plant origin. Preferably, the box is obtained from a promoter of the pea plastocyanin gene. Even more preferably, the box is obtained from the petE promoter of the pea plastocyanin gene.

According to a preferred embodiment of the promoters of the present invention, the promoters further comprise a "nos E like" box operably or functionally linked upstream of the box.

According to another preferred embodiment of the invention, the promoters also comprise at least one "asl" or "asl like" box operably or functionally linked to the box, and preferably two or more such boxes, arranged either contiguously or separately, and most preferably four such boxes. These "asl" or "asl like" boxes may be linked both upstream and downstream of said box, and preferably are linked upstream thereof. In another preferred mode of the invention, one or more of the the "asl" or "asl like" boxes can also be arranged in what is known as inverse order, that is, from the 3' to the 5' direction, and preferably in inverse repeat order.

According to one particularly preferred embodiment of the present invention, the promoters also comprise at least one "as2" box operably or functionally linked to the box, and preferably two or more such boxes, arranged either contiguously or separately, and most preferably four such boxes. These boxes may also preferably be linked both upstream and downstream of said box, and more preferably are linked upstream thereof.

In another preferred mode of the invention, some or all of the boxes can also be arranged in what is known as inverse order, or as inverse repeats as described above.

Finally, and even more preferably, the chimeric promoters as described above comprise at least one nucleic acid sequence selected from the group consisting of the sequences identified in the sequence listing under the 'numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, and Yet another object of the present invention is an expression cassette comprising at least one nucleic acid sequence derived from a promoter of the gene of the pea plastocyanin gene, operably or functionally linked to a gene or a nucleic acid sequence coding for a polypeptide that it is desired to express, said coding nucleic acid sequence being in turn operably or functionally linked to a transcription termination nucleic acid sequence, wherein the nucleic acid sequence derived from the promoter of the pea plastocyanin gene is selected from the sequences identified in the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ.ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, and Another object of the present invention is an isolated promoter nucleic acid sequence, characterized in that the sequence is selected from the group consisting of the sequences identified in S the sequence listing under the numbers SEQ.ID02, SEQ.ID03, SEQ ID04, SEQ.ID05, SEQ.ID06, SEQ.ID07, SEQ.ID08, SEQ.ID09, and Such a sequence may be one obtained through deletion, 25 substitution, addition of one or more nucleic acids to or from the sequence identified in the sequence listing under SEQ.IDO1.

Yet still another object of the present invention relates to desoxynucleotide or desoxynucleoside blocks for the production of promoters of promoter nucleic acid sequences as identified previously. These blocks can be building blocks or "directional" blocks, i.e. sequences that S read in the same direction as the final promoter or promoter nucleic acid sequence sequence, which is from the 5' end of the sequence towards the 3' end of the sequence; and/or "guide" blocks, i.e. sequences whose ends include nucleotide or nucleoside bases that complement with and overlap with the ends of the directional building blocks.

Thus, and most preferably, the directional building block corresponds to at least one sequence selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID11 SEQ.ID12, SEQ.ID13, SEQ.ID14, SEQ.ID16, and SEQ.ID17.

Furthermore, it is preferred to use the guide blocks corresponding to at least one sequence selected from the group consisting of the sequences identified in the sequence listing under the numbers SEQ.ID18, SEQ.ID19, SEQ.ID20, and SEQ.ID21.

Another object of the present invention is a vector comprising a promoter, or a promoter nucleic acid sequence, capable of initiating transcription of a gene or a nucleic acid sequence coding for a polypeptide that it is desired to produce, characterized in that the promoter or the promoter nucleic acid sequence corresponds to a chimeric expression promoter or to a promoter nucleic acid sequence as defined previously.

Preferably, the vector is selected from he group consisting in the binary vectors identified under the numbers pMRT1151, S pMRT1149, pMRT1170.

o o Yet still another object of the present invention is a process o 00 for the production of a chimeric expression promoter or an 0000 isolated promoter nucleic acid sequence such as those defined previously, characterized in that it comprises the steps of carrying out a ligation chain reaction, designated as LCR, to produce a continuous single stranded DNA molecule from at least one directional building block desoxynucleotide or 00 00 o o desoxynucleoside sequence selected from the group consisting in 00030 the directional building blocks Sl, S2, S3, S4, S5, S6, and S7 0oOO0 as identified in the sequence listing under the numbers ooo SEQ.ID11, SEQ.ID12, SEQ.ID13, SEQ.ID14, SEQ.ID15, SEQ.ID16 and o o o0° SEQ.ID17 respectively, and at least one desoxynucleotide or desoxynucleoside guide block for building said promoter nucleic acid sequence or promoter, the guide block being selected from the group consisting in the guide sequences Gl, G2, G3, and G4 9 WO 00/56906 PCT/IB00/00317 also a'process for the expression of a nucleic acid sequence, or gene, coding for a polypeptide that it is desired to produce, in a cell, characterized in that it comprises the following steps transforming the cell with a vector comprising at least one promoter or at least one promoter nucleic acid sequence as defined previously, operably linked to a nucleic acid seqeunce or gene, coding for a polypeptide to be produced, itself operably linked to a transcription terminator signal culturing the cell in conditions enabling the expression of the nucleic acid sequence, or gene, coding for the polypeptide.

Preferably, the cell used in this method is a procaryote or eucaryote cell. Even more preferably, the celle is cell selected from the group consisting of bacterial cells, fungal cells, yeast cells, insect cells, animal cells, and plant cells, and most preferably is a plant cell.

Finally, another object of the present invention is a process for the production of a transgenic plant, or of a propagule, as defined previously, characterized in that the process includes the steps comprising transforming a plant cell with a vector comprising at least one promoter or at least one promoter nucleic acid sequence as defined previously selecting the plant cell having integrated the promoter or promoter nucleic acid sequence into its genome propagating the transformed and selected plant cell, either through culture, or by regeneration of whole chimeric or transgenic plants.

BRIEF DESCRIPTION OF THE FIGURES The present invention will be better understood through the following detailed description of several preferred embodiments given hereafter as best mode, but non-limiting examples, and by referring to the drawings in which Figures I, II and III schematically represent the structures of comparative reference molecular constructs, enabling a comparison between the chimeric expression promoters of the present invention and said reference constructs. In Figure I, WO 00/56906 PCT/IB00/00317 the construction represented contains the reporter gene coding for 8-glucuronidase in the absence of any promoter sequence, and thereby serves as a negative control.

Figure II schematically represents a construct containing the gene coding for B-glucuronidase under the control of the CaMV double 35S promoter (d35S CaMV), also known as the 35S enhanced promoter (ep35S), which serves as a reference control for strong promoters Figure III represents a construct serving as an internal reference for transient expression experiments, and consists in the reporter gene coding for luciferase under control of the CaMV promoter.

Figure IV schematically represents the structure of several preferred embodiments of the chimeric promoters according to the present invention and derived from the whole promoter from the pea plastocyanin gene (petE prom), the latter also being represented. The promoters identified as MPrl098, MPrl097 and MPrl096 were obtained through enzymatic digestion of the whole promoter of the pea plastocyanin gene, whereas the promoters identified as MPrll08, MPrll09, MPrlllO, MPrllll and MPrlll2 were obtained through ligand based PCR (Ib-PCR). The promoters MPr1143 and MPr1153 were respectively obtained through deletion of the "as-2" and "as-l" boxes of promoter MPrllll, and through fusion of the "as-i like" and "nos enhancer like" boxes of MPrll08 upstream of promoter MPrll43. All of the promoters produced were cloned into the vector pMRT1144 between the restriction sites PstI and BamHI in order to obtain transcriptional fusion with the reporter gene uidA which codes for 8-glucuronidase Figure V represents a graph comparing the relative promoter activities of the various constructs after transient expression in tobacco leaves. Three days after bombardment, the leaves were ground and the brute extract obtained clarified by centrifugation. The B-glucuronidase and luciferase activities were measured by fluorimetry on an aliquot of brute extract, and the ratio GUS/LUC activities determined. The histograms WO 00/56906 PCT/IB00/00317 correspbnd to the average of the ratios for a given construct plus or minus Mean Standard Error (MSE) Figure VI represents schematic graphs of a comparison of chimeric promoter activity after stable transformation of tobacco plants. Samples were taken on all primary transformants at 2, 4, 6, 8 and 10 weeks after their transfer to greenhouse and P-glucuronidase activity measured from each sample, ponderated by the total protein content, producing a GUS activity in rlu/mg of protein. At each stage of developement, activities were sorted by decreasing order for each series of primary transformants and compared to each other.

In the various Figures, certain terms and expressions have the following meanings uidA a sequence coding for 8-glucuronidase IV2 a patatin gene intron nos term a terminator from the nopaline synthase gene 35S term a terminator from the 35S RNA of CaMV B the endonuclease restriction site BamHI E the endonuclease restriction site EcoRI H the endonuclease restriction site HindIII P the endonuclease restriction site PstI Sp the endonuclease restriction site SphI as-1 the activating sequence 1 from the CaMV 35S promoter as-2 the activating sequence 2 from the CaMV 35S promoter nos E the activating box from the nopaline synthase promoter D le site of restriction of l'endonucl6ase DraIII H the endonuclease restriction site HindIII P the endonuclease restriction site PstI S the endonuclease restriction site Spel Sp the endonuclease restriction site SphI CAAT a "CAAT" box G a box TATA a "TATA" box WO 00/56906 PCT/IB00/00317 +1 the transcription initiation site "like" means that the sequence is not 100% identical to the reference sequence from which the sequence obtains its name.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Example 1 1. Comparative Constructs (controls) In order to enable a comparis of the chimeric expression promoters described in this application, the uidA gene coding for B-glucuronidase (Jefferson and al., 1986), and also containing the nucleic acid sequence of the IV2 intron of the gene ST-LSI from potato patatin (Vancanneyt and al., 1990) (uidA-IV2) was placed under the control of one of the promoters and the terminator from the nopaline synthase gene (nos term).

This construct was then transferred into Agrobacterium tumefaciens through cloning into the plasmid vector pGEM3Z sold by Promega Corp. (Madison, USA).

1.1. Construction of a negative control identified as pMRT1144.

In order to facilitate cloning, a plasmid vector derived from pGEM3Z, that only possessed the "uidA-IV2/nos term" sequences, in the absence of any promoter sequence, was made. This plasmid was called pMRT1144 and served as a negative control (Fig. I).

The uidA/nos term sequences were introduced into the pGEM3Z plasmid, and the uidA sequence was placed under the control of the whole promoter of the pea plastocyanin gene and the nopaline synthase terminator, was isolated from 5 pg of pGA492-PpetE plasmid. The latter plasmid was obtained by cloning, in the plamsid pGA492-Pem2-uidA, the petE promoter from the pea plastocyanin gene obtained from the plasmid pKHn2 (Pwee and Gray, 1993) in place of the em2 promoter (Gaubier and al., 1993), originating from the bpI221-Pem2 plasmid. The bpI221-Pem2 plasmid was digested with 20 units each of the enzymes HindIII and EcoRI for an hour at 370C. Then, the expression cassette "Pem2/uidA/nos term" was separated by 0.8% agarose gel electrophoresis, electroeluted, precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of WO 00/56906 PCT/IB00/00317 absolute ethanol at -80 0 C for 30 min, centrifuged at 12000 g for min, washed in 70% ethanol, dried, resuspended in water and inserted in between the sites HindIII and EcoRI of the plasmid pGA492 (An, 1986). Ligation was carried out in the presence of 1.0 pl of T4 10X DNA ligase buffer (Amersham) and 2.5 units of T4 DNA ligase (Amersham) at 14 0 C for 16 hours. Viable and competent Escherichia coli DH5abacteria were transformed (Hannahan, 1983). The plasmid DNA of the obtained clones, as selected on Luria-Bertani medium (LB, bactotryptone 10 g/l, yeast extract 5 g/l, NaCl 10 g/l, Agar 15 g/l) supplemented with tetracycline (12 mg/l), was extracted according to the alkaline lysis method of Birnboim and Doly (Birnboim Doly, 1983) and analyzed by enzymatic digestion.

Starting from the thus obtained pGA492-Pem2-uidA plasmid, the promoter Pem2 was deleted via double digestion by HindIII and XbaI. The plasmid fragment of interest was separated by 0.8% agarose gel electrophoresis, electroeluted, precipitated in the the presence of 1/10 volume of 3M sodium acetate pH 4.8 and volumes absolute ethanol at -800C for 30 min, centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, and subjected to the action of a Klenow fragment of DNA polymerase I (New England Biolabs) for 30 min at 37 0 C according to the recommendation of the manufacturer. Then, it was deproteinized by extraction with a volume of phenol, then a volume of phenol chloroform isoamyl alcohol (25:24:1 v/v/v) and finally one volume of chloroform isoamyl alcohol (24:1 precipitated in the presence of 1/10 volume of 3M sodium acetate pH 4.8 and volumes of absolute ethanol at -80 0 C for 30 min, then centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, and resuspended in water. Then it was dephosphorylized for lh at 37 0 C with the help of 10 units of calf intestine alcaline phosphatase (Boehringer Mannheim) according to the recommendation of the manufacturer, deproteinized through extraction with one volume of phenol, then one volume of phenol chloroform isoamyl alcohol (25:24:1 v/v/v) and finally one volume of chloroform isoamyl alcohol (24:1 precipitated WO 00/56906 PCT/IB00/00317 in'the presence of 1/10 volume 3M sodium acetate pH 4.8 and volumes of absolute ethanol at -800C for 30 min then centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried then resuspended in water. The resulting plasmid was called pGA492APem2.

In parallel, the petE promoter (818 base pairs), which corresponds to the promoter of the pea plastocyanine gene, was obtained from the plamsid pKHn2 by digestion with NcoI for 1 h at 37 0 C. The 828 bp promoter fragment was isolated on 0.8% gel agarose, electroeluted, precipitated in the presence of 1/10 volume of 3M sodium acetate pH 4.8 and 2.5 volumes of absolute ethanol at -80 0 C for 30 min, centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, resuspended in water, then subjected to the action of 5 units of Mung Bean nuclease (New England Biolabs) for 30 min at 30 0 C according to the recommendations of the manufacturer, deproteinized by extraction with one volume of phenol, then one volume fo phenol chloroform isoamyl alcohol (25:24:1 v/v/v) and finally one volume of chloroform isoamyl alcool (24:1 precipated in the presence 1/10 volume of 3M sodium acetate pH 4.8 and volumes of absolute ethanol at -800C for 30 min then centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, then resuspended in water. This promoter fragment was inserted into the plasmid pGA492APem2, described previously, in the presence of 1.0 pl of T4 10X DNA ligase buffer (Amersham) and 2.5 units of T4 DNA ligase (Amersham) at 14 0 C for 16 h. Viable ad competent Escherichia coli DH5a bacteria, were transformed. The plasmid DNA of the obtained clones, selected on LB medium supplemented with tetracycline (12 mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion. The resulting plamsid was designated pGA492-petE prom.

IN order to isolate the expression cassette "petE prom/uidA/nos term", 5 pg of the plasmid pGA492-petE prom were digested by PstI (at a 5' site on the plastocyanin gene promoter) and EcoRI (at a 3' site on the terminating sequence) for 1 h at 37 0

C,

WO 00/56906 PCT/IB00/00317 subjected to 0.8% agarose gel electrophoresis and purified on a Qiaquick affinity column (Qiagen, Hilden, Allemagne) according to the manufacturer's recommendations. Meanwhile, 500 ng of pGEM3Z plasmid were simultaneously digested for 1 h at 37°C by EcoRI and PstI (restriction sites present in a multiple cloning site or polylinker), subjected to 0.8% gel electrophoresis, then purified on a Qiaquick affinity column.

Ligation was carried out with 50 ng of the vector pGEM3Z-PstI/EcoRI and 50 ng of the expression cassette "petE prom/uidA/nos term" for one night at 18°C in a reaction medium of 12 pl in the presence of 1.2 pl of T4 10X DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs). Previously prepared viable and competent Escherichia coli DH5a, were transformed by mixing with the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB medium supplemented with ampicillin mg/l), was extracted according to the alkaline lysis method and was analyzed by enzymatic digestion. The obtained plasmid was designated pGEM3Z-petE prom.

In order to insert the 192 bp IV2 intron originating from the potato patatin gene into the uidA coding sequence, an internal portion of this gene (a SnaBI BstBI 710 bp fragment in pGEM3Z-petE prom) was excised then replaced by the equivalent sequence containing the IV2 intron (a SnaBI BstBI 902 bp fragment). To accomplish this, the plasmid pGEM3Z-petE prom was digested for 1 h at 37°C by SnaBI (restriction site located at the +383 bp position upstream of the ATG initiator codon of the uidA gene) then for 1 h at 650C by BstBI (restriction site located at the +1093 bp position). The plasmid comprising the 710 bp deletion was isolated by 0.8% agarose gel electrophoresis, then purified on a Qiaquick affinity column.

The BstBI/SnaBI 902 bp fragment corresponding to the IV2 intron sequence followed by the uidA sequence stretching from position 383 to 1093 bp, was isolated and purified from the plasmid pSCV1.2-GI. This plamsid derives from plamsid pSCV1.2, which in turn derives from plamsid pSCV1 constructed by G.A. Edwards in WO 00/56906 PCT/IB00/00317 1990 according to the methods habitually used in cloning and well known to the skilled person. The binary plamsid pSCV1.2 was obtained by cloning the HindIII fragment bearing the expression cassette "35S prom nptII nos term" (Fromm and al., 1986) at the HindIII site in pSCV1. The expression cassette "35S prom GUS-IV2 35S term" was obtained by digesting the plamsid GUS INT with HindIII for 1 h at 37 0 C as described by Vancanneyt and al. (1990). The DNA fragment corresponding to the expression cassette was isolated on 0.8% agarose gel, electroeluted then precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -800C for min then, centrifuged at 12000 g for 30 min, washed in 70 ethanol, dried and resuspended in water. The protruding extremities of this fragment were blunted with the Klenow fragment of DNA polymerase I (New England Biolabs) for 30 min at 37°C according to the recommendations of the manufacturer, and the fragment was deproteinized by extraction with a volume of phenol, then a volume of phenol chloroform isoamyl alcohol (25:24:1 v/v/v) and finally a volume of chloroform isoamyl alcohol (24:1 precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at for 30 min then, centrifuged at 12000 g for 30 min, washed in ethanol, dried and finally ligated with 20 ng of the plasmid pSCVl.2 previously digested with SmaI for 1 h at 25°C, in the presence of 1.0 pl of T4 10X DNA ligase buffer (Amersham) and units of T4 DNA ligase (Amersham) at 14°C for 16 h.

Previously prepared viable and competent Escherichia coli bacteria were transformed. The plamsid DNA of the obtained clones, selected on LB medium supplemented with ampicillin mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion.

Five micrograms (5 pg) of pSCV1.2-GI plasmid were digested for 1 h at 370C by SnaBI (restriction site located at the position +383 bp upstream of the ATG initiator codon of the uidA gene) then for 1 h at 650C by BstBI (site located at the +1285 bp WO 00/56906 PCT/IB00/00317 position). The 902 bp fragment was isolated by 1.0% agarose gel electrophoresis, then purified on a Qiaquick affinity column.

The ligation was carried out with 20 ng of vector pGEM3Z-petE prom BstBI/SnaBI and 80 ng of the 902 bp fragment BstBI/SnaBI, for 1 night at 180C in a 10 pl reaction medium in the presence of 1.0 pl of T4 10X DNA ligase (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs). Viable and competent Escherichia coli DH5a bacteria, were transformed by half of the ligation reaction mixture. The plamsid DNA obtained from the clones, selected on LB medium supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method and was analyzed by enzymatic digestion. The obtained plasmid was designated pGEM3Z-petE prom/IV2.

In order to eliminate the promoter sequence corresponding to the 818 bp fragment (petE) of the plasmid pGEM3Z-petE prom/IV2, the latter was digested for 1 h at 370C by BamHI then, for 1 h at 37 0 C by PstI, isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column. The protruding extremities of this plasmid were rendered blunt by using utilisant Pfu DNA polymerase (Stratagene, La Jolla, USA) according to the recommendations of the supplier. The ligation was carried out with 10 ng of the thus modified plasmid for 1 night at 180C in a reaction volume of 12 pl, in the presence of 1.2 pl of T4 10X DNA ligase (New England Biolabs) and 400 units of the enzyme T4 DNA ligase (New England Biolabs). Viable and competent Escherichia coli DH5a were transformed with half of the ligation reaction mixture. The plamsid DNA of the obtained clones, selected on LB medium supplemented with ampicillin mg/l), was extracted according to the alkaline lysis method, analyzed by enzymatic digestion, and verified by sequencing according to the method of Sanger et al. (1977). The plasmid obtained was designated pMRT1144 (Fig. I).

1.2. Construction of the positive control promoter MPrl092.

In order to hava available a reference promoter sequence, the "double 35S" cauliflower mosaic virus promoter (CaMV D35S prom), was placed upstream of the uidA-IV2/nos term sequence. The WO 00/56906 PCT/IB00/00317 plasmicipMRT1092 (Fig. II) is a result of the following cloning steps To start with, the 192 bp IV2 intron of the potato patatin gene was inserted into the uidA coding sequence at the +383 bp position as described under section 1.1. A one microgram amount (1 pg) of bpI221 plasmid (Clontech, CA, USA) was digested for 1h30 at 37 0 C by SnaBI, then for lh30 at 65 0 C by BstBI. The plasmid deleted of the 710 bp fragment was isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column.

A twenty nanogram (20 ng) amount of bpI221 BstBI/SnaBI vector and 80 ng of the 902 bp BstBI/SnaBI fragment originating from pSCV1.2-GI as previously described, were ligated for 1 night at 180C in a 10 pl reaction volume, in the presence of 1 pl of T4 10X DNA ligase (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs). Viable and competent Escherichia coli DH5a were transformed with hald of the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB medium supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion. The obtained plasmid was designated bpI221/uidA-IV2.

In a second step, the sequence of the CaMV35S promoter present in the bpI221/uidA-IV2 plasmid was replaced by the "CaMV sequence. This was achieved by digesting the bpI221/uidA-IV2 plamsid for 10h30 at 37°C with 10 units of HindIII, then the sticky ends were rendered blunt by the action of the Klenow fragment of DNA polymerase I (New England Biolabs) for 30 min at 370C according to the recommendations of the manufacturer. After purification of the product of this reaction on a Qiaquick affinity column, the DNA was digesteed for une night at 37°C with 10 units of BamHI. The plasmid fragment, corresponding to the vector deleted of the 828 bp promoter CaMV 35S fragment, was isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column.

CaMV D35S prom was obtained from the plasmid pJIT163D. This WO 00/56906 PCT/IB00/00317 deriveE from the plasmid pJIT163 which in turn derives from the plasmid pJIT160 (Gu6rineau and Mullineaux, 1993). The plasmid pJIT163 has an ATG codon between the HindIII and Sail sites of the polylinker. In order to delete this ATG and thereby obtain the plasmid pJIT163D, the plasmid DNA of pJIT163 was digested by HindIII and SalI, purified by 0.8% agarose gel electrophoresis, electroeluted, precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -800C for 30 min, centrifuged at 12000 g for 30 min, washed in 70% ethanol, dried, subjected to the action of the Klenow fragment of DNA polymerase I (New England Biolabs) for 30 min at 370C according to the recommendations of the manufacturer, deproteinized by extraction with a volume of phenol, then a volume of phenol chloroform isoamyl alcohol (25:24:1 v/v/v) and finally a volume of chloroform isoamyl alcohol (24:1 v/v), precipitated in the presence of 1/10 volume of 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -800C for min, then centrifug6 at 12000 g for 30 min, washed in 70 ethanol, dried and finally ligated in the presence of 1.0 pl of T4 10X DNA ligase (Amersham) and 2.5 units of T4 DNA ligase (Amersham) at 140C for 16 h. Viable and competent Escherichia coli DH5a bacteria were transformed. The plasmid DNA of the obtained clones, selected on LB mdeium supplemented with mg/1), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion.

Ten micrograms (10pg) of plasmid pJIT163D were digested for 10h30min at 37°C with 10 units of KpnI (site siutated in 5' of the promoter), then the sticky ends were rendered blunt by the action of 6 units of T4 DNA polymerase (New England Biolabs) for 30 min at 370C according to the recommendations of the manufacturer. After purification of the product of this reaction on a Qiaquick affinity column, the DNA was digested for one night at 370C with 10 units of BamHI. The resulting 761 bp DNA fragment, corresponding to the promoter CaMV D35S was isolated by 1.0 gel agarose electropheresis, then purified on a Quiaquick affinity column.

WO 00/56906 PCT/IB00/00317 The reaction mixture containing 10 ng of plasmid vector, 100 ng of the 761 bp fragment, 1.0 pl of T4 10X DNA ligase (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs) was subjected to ligation in 10 pl for one night at 18 0 C. Viable and competent Escherichia coli DH5a were trasnformed with half of the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB media supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion. The plasmid obtained was designated pMRT1092 (Fig. II).

1.3. Description of the reference plasmid The plasmid serving as an internal reference for transient expression is pCaMV35Sluc (Torrent et al., 1997) which contains the expression cassette of the luciferase reporter gene (luc) under the control of the RNA 35S Cauliflower Mosaic Virus promoter and terminator.

Example 2.

Construction of plasmids containing deleted promoter sequences from the pea plastocyanine gene.

The whole promoter of the pea plastocyanin gene (Last and Gray, 1989) corresponds to a sequence of 834 bp (SEQ. ID01) starting from position -771 bp to position 63 bp, and in which several potential regulatory sequences have been identified (numbers given with respect to the 5' end towards the 3' end of the sequence, and with respect to the transcription initiation site Fig. IV) a series of inverted repeats, stretching from positions -734 to -607 bp, a 20 bp box (as-l like) having a certain similarity to the activating sequence 1 (as-1) present in the CaMV 35S promoter, and stretching from position -579 to position -559 bp, a 21 bp box (nos enhancer like) having a certain homology to an activating sequence present in the promoter of the nopaline synthase gene of Agrobacterium tumefaciens, and stretching from position -540 to -519 bp, an 8 bp box, stretching from position -201 to position -193 bp, a 14 bp box, stretching from position -83 to position -69 bp, and having a certain similarity to type III boxes found in the promoters of higher plants, a "CAAT" box, at position -63 a "TATA" box, at position \37 the transcription initiation site +1 (position 1) a 5' untranslated region stretching from the +1 position to the 63 bp position.

The plasmid pGEM3Z-petE prom was obtained as described above in section 1.1 of example 1. It corresponds to the plasmid pGEM3Z containing the reporter gene uidA-IV2 under the control of the whole of the pea plastocyanin gene (petE prom, Fig IV, SEQ.IDO1), and serves as a reference promoter for all of the constructions based on the plastocyanin promoter.

In order to study the effects of the different elements, deletions in the 5' region of petE prom were carried out by enzymatic digestion.

2.1. Construction of the promoter MPr1097.

The promoter MPrlO97 derives from the petE promoter by a deletion of the inverted sequence repeats, as well as the as-1 like box borne on the 212 bp Sphl fragment (Fig. IV) In order to do this, five micrograms (5 pg) of the plasmid S pGEM3Z-petE/1V2 were digested for 2 h at 37°C with 20 units of SphI enzyme, isolated by 0.8% agarose gel electrophoresis, then purified on a Qiaquick affinity column.

The ligation was carried out with 25 ng of the thus modified plasmid for one night at 180C in a 10 pg reaction mixture, in the presence of 1 p, of T4 10X DNA ligase (New England Bioiabs) and of 400 units of T4 DNA ligase (New England Biolabs). Viable and competent Escherichia coli DH5a cells were transformed with S. half the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB media supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method, and analyzed by enzymatic digestion. The plasmid obtained was designated pMRT1097 and the promoter sequence WO 00/56906 PCT/IB00/00317 designated MPrl097 (SEQ.ID02) was verified by sequencing.

2.2. Construction of the promoter MPr1096.

The promoter MPrl096 derives from the petE promoter by a deletion of the inverted repeat sequences, the "as-i like" elements and the "nos enhancer like" element borne by two Spel fragments of 403 bp and 105 bp respectively (Fig. IV). In order to do this, 5 micrograms (pg) of plasmid pGEM3Z-petE /IV2 were digested for 2 h at 37 0 C with 20 units of Spel enzyme, isolated by 0.8% agarose gel electrophoresis, and then purified on a Qiaquick affinity column.

The ligation was carried out with 25 ng of the thus modified plasmid for 1 night at 18°C in a 10 pl reaction mixture, in the presence of 1 pl of T4 10X DNA ligase (New England Biolabs) and of 400 units T4 DNA ligase (New England Biolabs). Viable and competent Escherichia coli DH5a cells were transformed with half of the ligation reaction mixture. The plamsid DNA of the obtained clones, selected on LB media supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method, and analyzed by enzymatic digestion. The plasmid obtained was designated pMRT1096 and the promoter sequence MPrl096 (SEQ.ID03) was verified by sequencing.

2.3. Construction of the promoter MPr1098.

In order to obtain a reference minimal promoter sequence based on the petE promoter, the 207 bp promoter MPrl098 was constructed to contain only the "TATA" and "CAAT" boxes (Fig.

IV).

This was accomplished by digesting five micrograms (5 pg) of the plasmid pGEM3Z-petE /IV2 for 2 h at 37 0 C with 1.5 units of DraIII enzyme (1 site present at position -128) and 15 units of PstI enzyme (1 site present in the 5' region of the promoter at position -759 bp). The plasmid thus deleted of the 631 bp fragment PstI/DraIII situated in the 5' region of the petE promoter was isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column. The sticky ends of this fragment were rendered blunt by the action of 6 units of T4 DNA polym6rase (New England Biolabs) for 30 min at 370C according to the recommendations of the manufacturer. After purification of the product of this reaction on a Qiaquick affinity column, ligation was carried out with 25 ng of the thus modified plasmid for 1 night at 18 0 C in a 10 Al reaction mixture, in the presence of 1 pl of T4 10X DNA ligase (New England Biolabs) and of 400 units of T4 DNA ligase (New England Biolabs). Viable and competent Escherichia coli DH5a cells were transformed with half the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB media supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion. The plasmid obtained was dsignated pMRT1098 and the promoter sequence MPrl098 was verified by sequencing (SEQ.ID04).

This sequence corresponds to the minimal pea plastocyanin promoter (Fig. IV) Example 3.

Construction of plasmids containing chimeric promoter sequences.

In addition to the promoters obtained by deletion of certain regions, a series of promoters was synthesized that started out from the basic minimal promoter Mpr1098 using the Ib-PCR technique which combines a ligation chain reaction, designated LCR (Barany, 1991) and producing a single stranded continuous DNA with the help 0oo o0 0 of "directional" oligodesoxynucleotides, with a PCR reaction 0 leading to a double stranded DNA product.

0* o 3.1. Construction of the promoter MPrll08.

ooooo oo5 The promoter MPrll08 (Fig. IV) was created by fusing the 72 bp 0 0 o sequence stretching from position -641 bp to position -569 bp of the petE promoter (SEQ. ID01), and bearing the "as-1 like" and "nos enhancer like" boxes, to the 187 bp minimal promoter sequence of MPrl098 (position -128 to +59 bp, SEQ.ID04) using the Ib-PCR technique.

0000 oooo Continuous single stranded DNA was formed with the help of the o000 0 following directional oligodesoxynucleotides S1 o 00 5' TTCCCTTCAAACACATACAAATTCAGTAGAGAAGAAACTCATTACTCTTGAGAAACCTAG AGGATCCCCG 3' (SEQ.ID11) S2 WO 00/56906 PCT/IB00/00317 cycles,' each consisting in the following one minute at 650C, one minute at 57°C, one minute at 52 0 C, one minute at 48 0 C, one minute at 43°C, and finally ten minutes at 370C. Next, the ligation reaction mixture was purified on a Qiaquick affinity column according to the recommendations of the supplier.

Finally, PCR amplification of the obtained single stranded DNA was carried out in a GeneAmp PCR System 9700 thermocycle in the presence 100 pmol of each of the oligodesoxynucleotide probes GGAATCTGCAGTTGAACACGT 3' and 5 CGGGGATCCTCTAGGTTTCT 3', 50 nmol of each of the dNTP, 10 pl Vent 10X DNA polymerase buffer (New England Biolabs), and 2 units of Vent DNA polymerase (New England Biolabs). The DNA was denatured for 5 min at 940C, subjected to 25 cycles each consisting of a 30 second denaturizing step at 95°C, of a 30 second hybridizing step at 56°C, and of one minute of elongation at 720C, then elongation at 72°C was continued for 5 min.

The DNA fragments of the reaction mixture were digested with units of BamHI for 45 min at 370C, then by 20 units of PstI for 1 h at 37°C, and finally purified on a Qiaquick affinity column.

They were inserted into the plasmid pGEM3Z-petE /IV2 that had been digested with BamHI enzyme for 1 h at 370C, then with PstI enzyme for 1 h at 370C, and subjected to 0.8% agarose gel electrophoresis, purified on a Quiaquick affinity column, dephosphorylated for 1 h at 37°C in the presence of 12 ul of "buffer 3" 10X (New England Biolabs) and of 5000 units of caclf gut alkaline phosphatase (CIP, New England Biolabs), and finally purified on a Quiaquick affinity column. In order to carry out ligation, 25 ng of of the plasmid as treated above were contacted with 100 ng of the DNA fragments obtained by PCR, in the presence of 1.2 pl of T4 10X DNA ligase buffer (New England Biolabs) and 400 units T4 DNA ligase (New England Biolabs) for 1 night at 18°C. Viable and competent Escherichia coli DH5a cells were transformed with half of the ligation reaction mixture. The DNA of the obtained clones, selected on LB media supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method, and analyzed by enzymatic digestion. Two plasmids pMRT1108 and pMRT1109 resulting therefrom were sequenced. The plasmid pMRT1108 contains the expected promoter whereas the plasmid pMRT1109 bears the promoter sequence MPrll09 (SEQ.ID06) which differs from MPr1108 by a deletion of 33 bp in the 5' untranslated region, 11 bp upstream of position +1 (Fig. IV) 3.2. Construction of the promoter MPr111O.

The promoter MPrlllO was created by inserting, at position -99 bp of the MPr1098 promoter (SEQ.ID04), a block of 18 bp 10 containing a box (stretching from positions -204 bp to 186 bp of the petE promoter, SEQ.IDO1) and by fusing to this modified minimal promoter minimal a sequence of 44 bp from the RNA 35S cauliflower mosaic virus promoter (CaMV) containing the as-2 and as-1 elements (Lam, 1989 Lam et al., 1989) (Fig. IV) MPrlllO was synthesized by the Ib-PCR technique.

The continuous single stranded DNA was formed with the help of the following "directional" oligodesoxynucleotides S1

TTCCCTTCAAACACATACAAATTCAGTAGAGAAGAAACTCATTACTCTTGAGAAACCTAG

AGGATCCCCG 3' (SEQ.ID11) S2 oo oo o o 5' CACAAAACCCAATCCACATCTTTATCATCCATTCTATAAAAAATCACCTTCTGTGTGTC .S0 0 TCTCTTTCGA 3' (SEQ.ID12) 0 00 0 00 S5 .o 25 5' CTGTGGCACATCTACATTATCTAAATCTAAGCCACGTCGGAGGATAACATATTCTTCCAC 00 00 ACATCTTAGCCA 3' S6

CATGCTGCAGACTAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCATGCC

ACT 3' (SEQ. ID16) 30 One hundred picomole (100 pmol) of the Sl, S2 and oo. oligodesoxynucleotides were 5' phosphorylated with the help of Go-0 15 units of kinase (Amersham) in the presence of 5 l of o• kinase buffer (Amersham) and 500 pmol of ATP (Sigma), for min at 37 0 C. The phosphorylated oligodesoxynucleotides were 000) purified by extraction with a volume of phenol, then a volume of phenol: WO 00/56906 PCT/IB00/00317 The DNA fragments of the reaction mixture were digested with units of BamHI enzyme for 45 min at 37 0 C then with 20 units of PstI enzyme for 1 h at 37°C, and finally purified on a Qiaquick column. They were inserted into the plasmid pGem3Z-petE /IV2 which had been previously digested by BamHI enzyme for 1 h at 37°C and then by PstI enzyme for 1 h at 37 0 C, subjected to 0.8% agarose gel electrophoresis, purified on a Quiaquick affinity column, dephosphorylated for 1 h at 37 0 C in the presence of 12 pl of "Buffer 3" 10X (New England Biolabs) and of 5000 units of calf intestine alkaline phosphatase (CIP, New England Biolabs), and finally purified on a Quiaquick affinity column. In order to carry out the ligation, 25 ng of the plasmid treated as described above were brought into contact with 100 ng of the DNA fragments obtained by PCR, in.the presence of 1.2 pl of T4 DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs) for 1 night at 180C. Previously prepared viable and competent Escherichia coli DH5a cells were transformed with half of the ligation reaction mixture. The DNA from the obtained clones, selected on LB media supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method and was analyzed by enzymatic digestion. The promoter sequence MPrlllO borne by the plasmid pMRT1110 was verified by sequencing (SEQ.ID07).

3.3. Construction of the promoter MPr1111.

Th promoter MPrllll was created by inserting an 18 bp element containing a box (stretching from positions -204 bp to \186 bp of the petE promoter, SEQ.ID01) at position -99 bp of MPrl098 (SEQ.ID04), and by fusing into this minimal promoter a sequence of 58 bp corresponding to a duplication of the as-2 element (Lam and Chua, 1989) and the as-1 element (Lam et al., 1989) of the CaMV 35S. MPrllll (Fig. IV) was synthesized by the Ib-PCR technique as described previously.

The single stranded continuous DNA was generated using the following "directional" oligodesoxynucleotides Sl

TTCCCTTCAAACACATACAAATTCAGTAGAGAAGAAACTCATTACTCTTGAGAAACCTAG

AGGATCCCCG 3' (SEQ.ID11) S2

CACAAAAACCCCAATCCACATCTTTATCTATCCATTCTATAAAAAATCACCTTCTGTGTGTC

TCTCTTTCGA 3' (SEQ.ID12) S5

CTGTGGCACATCTACATTATCTAAATCTAAGCCACGTCGGAGGATAACATATTCTTCCAC

ACATCTTAGCCA 3' S7

CATGCTGCAGACTAGTGATTGATGTGATATCAAGATTGATGTGATATCTCCACTGACGTA

AGGGATGACGCATGCCACT 3' (SEQ.ID17) One hundred picomole (100 pmol) of the S1, S2 and oligodesoxynucleotides were phosphorylated in the 5' region through the use of 15 units of kinase (Amersham) in the presence of 5 pi1 of 10X kinase buffer (Amersham) and 500 pmol of ATP (Sigma), for 30 min at 37 0 C. The phosphorylated oligodesoxynucleotides were purified by extraction with a volume of phenol, then a volume of phenol chloroform isoamyl alcohol (25:24:1 v/v/v) and finally a volume of chloroform: isoamyl alcohol (24:1 v/v) before being precipitated by 1/10 volume 3M sodium acetate at pH 4.8 and 2.5 volumes of absolute ethanol at -80 0 C for 20 min then centrifuged at 16060 g for min. The precipitated oligodesoxynucleotides were washed in ethanol, dried, then resuspended in water at a concentration of pmol/Al.

25 In order to link up the "directional" oligodesoxynucleotides, the following "guide" oligodesoxynucleotides were used Gl= 5' TGTGTTTGAAGGGAATCGAAAGAGAGACACA 3' (SEQ.ID18) G2= 5' GATTGGGTTTTTGTGTGGCTAAGATGTGTG 3' (SEQ.ID19) G4= 5' TGTAGATGTGCCACAGAGTGGCATGCGT 3' (SEQ.ID21) 0 In order to carry out the LCR reaction, 10 pmol of the e e phosphorylated Sl, S2, S5 and S7 "directional" oligodesoxynucleotides were ligated in the presence of 10 pmol of the "guide" oligodesoxynucleotides GI, G2 and G4, 5 pl of Taq S DNA ligase buffer (New England Biolabs) and 40 units of Taq DNA ligase (New England Biolabs). The ligation reaction was carried out in a GeneAmp PCR System 9700 thermocycle (Perkin WO 00/56906 PCT/IB00/00317 Elmer, Norwalk, USA) and was comprised of one cycle for 1 min at 94°C, and then 8 identical cycles each comprising the following successive steps 1 min at 650C, 1 min at 570C, 1 min at 520C, 1 min at 480C, 1 min at 43°C, and finally 10 min at 370C. Next, the ligation reaction mixture was purified on a Qiaquick column according to the recommendations of the supplier.

Finally, the PCR amplification of the obtained single DNA strand was carried out in a GeneAmp PCR System 9700 thermocycle in the presence of 100 pmol each of the oligodesoxynucleotide probes 5' CATGCTGCAGACTAGTGGATT and 5' CGGGGATCCTCTAGGTTTCT 3', nmol of each of the dNTP, 10 pl of Vent 10X DNA polym6rase buffer (New England Biolabs), and 2 units of Vent DNA polymerase (New England Biolabs). The DNA was denatured for 5 min at 940C, subjected to 25 cycles each comprising a 30 sec denaturing step at 950C, of a 30 sec hybridization step at 560C, and of 1 min of elongation at 720C, then continued elongation at 72°C for 5 min.

The DNA fragments of the reaction mixture were digested with units of BamHI for 45 min at 370C, then by 20 units of PstI for 1 h at 37°C, and finally purified on a Qiaquick column. They were inserted into the plasmid pGEM3Z-petE /IV2, which had been previously digested by BamHI enzyme for 1 h at 370C and then by PstI enzyme for 1 h at 370C, subjected to 0.8% agarose gel electrophoresis, purified on a Quiaquick affinity column, dephosphorylated for 1 h at 370C in the presence of 12 pl of "Buffer 3" 10X (New England Biolabs) and of 5000 units of calf intestine alkaline phosphatase (CIP, New England Biolabs), and finally purified on a Quiaquick affinity column. To carry out the ligation, 25 ng of plasmid as treated above was contacted with 100 ng of the DNA fragments obtained by PCR, in the presence of 1.2 pl of T4 10X DNA ligase buffer (New England Biolabs) and 400 units T4 DNA ligase (New England Biolabs) for 1 night at 18°C. Previously prepared viable and competent Escherichia coli DH5c cells, were transformed with half of the ligation reaction mixture. The DNA from the obtained clones, selected on LB media supplemented with ampicillin (50 mg/1), was WO 00/56906 PCT/IB00/00317 extracted according to the alkaline lysis method and was analyzed by enzymatic digestion. Two resulting plasmids, pMRT1111 and pMRT1112, were sequenced. The plasmid pMRT1111 contains the expected promoter Mprllll (SEQ.ID08), whereas in the plasmid pMRT1112, the promoter MPr11l2 (Fig. IV) differs from MPrllll by a deletion of 35 bp containing the box and stretching from position -127 to position -89 and also a deletion of two bp situated in positions -78 and -76 (SEQ.ID09).

3.4. Construction of the promoter MPr1153.

The promoter MPr1153 (Fig. IV) was obtained by fusing the sequence of 78 bp from the petE promoter stretching from position -582 to position -510 bp (SEQ.ID01) and bearing the "as-1 like" and "nos enhancer like" elements into the promoter MPrl098 which was modified by the adjunction of the 18 bp element containing the box.

To to this, the plasmid pMRT1111 was digested with 20 units of PstI enzyme and 1 unit of DraIII enzyme for 1 h at 370C. The plasmid thus deleted of the 72 bp fragment containing the two "as-2" elements and the "as-l" element of CaMV, was isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column. The 78 bp PstI/DraIII fragment containing the two "as-I like" and "nos enhancer like" elements of the petE promoter was generated by digesting 10 pg of the plasmid pMRT1108 with 20 units of PstI enzyme and 1 unit of DraIII enzyme for 1 h at 370C, then the fragment was isolated by Nu-Sieve 3% agarose gel electrophoresis (FMC, Rockland, USA) and finally purified on a Quiaquick affinity column.

The ligation was carried out with 20 ng of vector pMRT1111 PstI/DraIII and 80 ng of the 78 bp fragment for 1 night at 180C in a reaction mixture of 10 pl in the presence of 1.0 pl of T4 DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs). Previously prepared viable and competent Escherichia coli DH5a cells were transformed with hald of the ligation reaction mixture. The plasmid DNA from the obtained clones, selected on LB media supplemented with ampicillin (50 mg/1), was extracted according to the alkaline lysis method, and analyzed by enzymatic digestion. The plasmid obtained was designated pMRT1153 and the promoter sequence MPr1153 (SEQ.ID8) verified by sequencing.

Construction of the promoter Mpr1143.

The promoter MPr1143 (Fig. IV) was obtained by deleting the 72 bp sequence bearing the "as-2, as-2, as-1" elements of MPrllll.

This was achieved by digesting the plasmid pMRT1111 for 1 h at 37 0 C simultaneously with 20 units of PstI enzyme and 1 unit of DraIII enzyme. The plasmid thus deleted of the 70 bp fragment containing the two as-2 elements and the as-1 element of CaMV were isolated by 0.8% agarose gel electrophoresis, then purified on a Quiaquick affinity column. The ends of this fragment were made blunt by the action of Pfu DNA polymerase (Stratagene, La Jolla, USA) according to the supplier's recommendations. This fragment was religated for 1 night at 18 0 C in a 10 Al reaction mixture containing 20 ng of vector, 1.0 Ml of the T4 10X DNA ligase buffer (New England Biolabs) and 400 units T4 DNA ligase (New England Biolabs). Previously prepared viable and competent Escherichia coli DH5a cells were transformed with half of the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB media supplemented with ampicillin (50 mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion. The promoter sequence MPr1143 (SEQ. ID10) of one of these clones was verified by sequencing.

Example 4 Construction of binary plasmids containing the promoters MPrll51, MPr1149, MPrll70 and MPr1092.

The preparation of the binary vector was the same for each of the expression cassettes containing MPrllll, MPrl098, Mpr1143 and 0 MPrl092. A 25 Mg amount of the plasmid pGA492 (An, 1986) was digested with 80 units of HindIII enzyme for 1 h at 37 0 C, then S purified on a Quiaquick affinity column. The protruding 5' ends of this plasmid were blunted using Pfu DNA polymerase (Stratagene, La Jolla, USA) according to the recommendations of the supplier.

The thus modified plasmid was digested with 80 units of EcoRI enzyme for 1 h at 37 0 C, then the resulting vector WO 00/56906 PCT/IB00/00317 deleted' of a 291 bp fragment was separated on 0.7 agarose gel and purified on a Quiaquick affinity column.

4.1. Production of pMRT1151.

The expression cassette "MPrllll/uidA-IV2/nos term" was inserted at the modified HindIII site of the binary plasmid pGA492.

It was obtained from the plasmid pMRT1111, previously digested with 80 units of PstI enzyme for 1 h at 37 0 C and purified on a Quiaquick affinity column. The protruding 5' ends of this plasmid were blunted using Pfu DNA polymerase (Stratagene, La Jolla, USA) according to the supplier's recommendations. The thus modified plasmid was digested with 80 units of EcoRI enzyme for 1 h at 37°C, then the 2.5 kb DNA fragment corresponding to the expression cassette was separated on 1 agarose gel and purified on a Quiaquick affinity column.

The ligation was carried out by mixing 100 ng of binary plasmid pGA492 prepared as described above and 50 ng of expression cassette for 1 night at 180C, in a 20 pl reaction volume in the presence of 2 pl of the T4 10X DNA ligase buffer (New England Biolabs) and 400 units T4 DNA ligase (New England Biolabs).

Previously prepared viable and competent Escherichia coli cells were transformed with half the ligation reaction mixture.

The plasmid DNA of the obtained clones, selected on LB media supplemented with tetracycline (12 mg/l), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion as well as by gene amplification with the help of the oligodesoxynucleotides 5' ATATGAGACTCTAATTGGATACCGAGGGG 3', selected from the transfer DNA of the binary plasmid and TTGATTTCACGGGTTGGG selected from the expression cassette around the uidA sequence. The resulting clone was designated pMRT1151.

4.2. Production of the binary plasmid pMRT1149.

The expression cassette "MPrll43/uidA-IV2/nos term" was cloned at the modified HindIII site of the binary plasmid pGA492, following the same protocol as for plasmid pMRT1151, with the exception that the expression cassette was isolated from the plasmid pMRT1143. The resulting clone was designated pMRT1149.

WO 00/56906 PCT/IB00/00317 4.3. Production of the binary plasmid pMRT1170.

The expression cassette "petE promoter/uidA-IV2/nos term" was cloned at the modified HindIII site the binary plasmid pGA492 following the same protocol as for plasmid pMRT1151, with the exception that the expression cassette was isolated from the plasmid pGem3Z-petE/IV2 4.4. Production of the binary plasmid pGA492MPrl092.

The promoter fragments MPrl092 and sequence "uidA-IV2/nos term" were inserted into the binary plasmid pGA492 prepared as described above. The fragments.were prepared in the following manner The CaMV D35S promoter was isolated by digesting 10 pg of the plasmid pJIT163A with 40 units of KpnI enzyme for 1 h at 37 OC.

The ends of this linear plasmid were blunted with the help of 6 units of T4 DNA polymerase (New England Biolabs) for 30 min at 370C according to the manufacturer's recommendations. The thus modified plasmid was purified on a Quiaquick affinity column, then redigested with 80 units of HindIII enzyme for 1 h at 37 0

C.

The 743 bp fragment corresponding to the promoter was separated on 0.8 agarose gel, then purified on a Quiaquick affinity column.

The "uidA-IV2/nos term" sequence was obtained by digesting 4 pg of the plasmid pMRT1092 with 40 units of HindIII enzyme and EcoRI enzyme for 1 h. The 2.2 kb fragment corresponding to the sequence "uidA-IV2/nos term" was separated on 0.8 agarose gel, then purified on a Quiaquick affinity column.

The ligation between the three fragments was carried out by mixing 100 ng of binary plasmid, 50 ng of promoter fragment and ng of the fragment corresponding to the sequence "uidA-IV2/nos term" in a reaction volume of 20 pl, in the presence of 2 pl of T4 10X DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs).

The incubation was carried out in a thermocycle by subjecting the ligation mixture to 198 cycles each comprising a 30 sec incubation at 300C, and a 30 sec incubation at 100C. Previously prepared viable and competent Escherichia coli DH5a cells were WO 00/56906 PCT/IB00/00317 transformed with half the ligation reaction mixture. The plasmid DNA of the obtained clones, selected on LB media supplemented with tetracycline (12 mg/1), was extracted according to the alkaline lysis method and analyzed by enzymatic digestion and gene amplification with the help of the oligodesoxynucleotides ATATGAGACTCTAATTGGATACCGAGGGG selected from the transfer DNA of the binary plasmid and 5' TTGATTTCACGGGTTGGG selected from the expression cassette in the "uidA" sequence. One of the clones retained was designated pGA492MPrl092.

4.5 Production of the binary plasmid pMRT1182 The binary plasmid pMRT1182 was obtained by insertion of the promoter fragment CaMV D35S and of the sequence uidA-IV2/term-nos in the binary plasmid pMRT1118. This latter plasmid is described completely in French patent application number FR 99 11112, filed on September 3, 1999, in the name of the present applicant, the specific description of which is incorporated herein by reference. The binary plasmid pMRT1118 (5971 pb) results from the introduction of a T-DNA fragment digested by AvrII enzyme into the AvrII site of another dephosphorylated plasmid also fully described in the previously mentioned prior application to same applicant, and designated pMRT1106, also specifically incorporated herein by reference.

In order to carry out the insertion, the pMRT1106 plasmid DNA pg) was digested with AvrII enzyme, purified with the aid of the QIAquick PCR Purification kit, then dephosphorylated with units of calf intestine alkaline phosphatase (New England Biolabs) in a final reaction mixture volume of 120 pl in the presence of 12 p1 3x 10 buffer (New England Biolabs) at 37 °C for 1 hour, isolated by electrophoresis on A 0.6% agarose gel in TBE buffer, purified with a QIAquick Gel Extraction kit, dephosphorylated a second time with the calf intestine alkaline phosphatase under the conditions mentioned above, and finally purified with a QIAquick PCR Purification kit and transferred to 50 pl de H 2 0.

The PCR ligation reaction was carried out with 32,5 ng of digested dephosphorylated plasmid pMRT1106 and 50 ng of T-DNA WO 00/56906 PCTIIB00/00317 fragments digested in a reaction mixture volume of 10 p1 in the presence of 1 pi T4 10x DNA ligase buffer (New England Biolabs) and 400 units of T4 DNA ligase (New England Biolabs). The ligation comprised 180 cycles each including 2 steps, the first one at 100C for 30 seconds and the second step at 30 0 C for seconds in a q GeneAmp PCR System 9700 thermocycle.

Previously prepared viable and competent Escherichia coli bacteria, were transformed (Hanahan, 1983). The plasmid DNA of the obtained clones, selected on LB media supplemented with kanamycin (50 mg/l), was extracted according to the alkaline lysis method (Birnboim et Doly, 1979) and verified by enzymatic digestion and sequencing. The resulting plasmid was designated pMRT1118.

The promoter CaMV D35S was isolated by digesting 10 pg of plasmid pJIT163A successively with KpnI and HindIII enzymes for 1 hour at 37°C. The 743 bp fragment corresponding to CaMV was separated on 0.8% gel agarose, and then purified on a Qiaquick affinity column. The sequence "uidA-IV2/nos term" was obtained by digesting the plasmid pMRT1092 with 40 units of HindIII and EcoRI enzymes for 1 hour. The 2.2 kb fragment corresponding to the required sequence was separated on 0.8% gel agarose, then purified on a Qiaquick affinity column. In parallel, 10 pg of binary plasmid pMRT1118 were digested successively with KpnI and EcoRI enzymes for 1 hour at 370C. The linearized vector fragment was then dephosphorylated with units of calf intestine alkaline phosphatase (New England Biolabs) in the presence of 3X buffer for 1 hour at 37°C. The ligation was carried out in the presence of 100 ng of binary plasmid, 50 ng of the CaMV D35S fragment and 50 ng of the fragment corresponding to "uidA-IV2/nos term" in a reaction volume of 20 pl, in the presence of T4 (1X) DNA ligase buffer and 400 units of T4 DNA ligase (New England Biolabs). Incubation was carried out by PCR cycles in a "GeneAmp PCR System 9700" thermocycle as described previously. Previously prepared viable and competent Escherichia coli DH5c bacteria were transformed with half of the ligation reaction mixture. The plasmid DNA of WO 00/56906 PCT/IB00/00317 the obtained clones, selected on LB media supplemented with kanamycin (50 mg/1), was extracted according to the alkaline lysis method and analysed by enzymatic digestion. The resulting plasmid was designated pMRT1182.

The plasmids pMRT1151, pMRT1149, pMRT1170 and pMRT1182 were transferred into the strain Agrobacterium tumefaciens LBA4404 according to the technique described by Holsters et al. (1978).

The plasmid DNA of the obtained clones, selected on LB media supplemented with rifampicine (50 mg/l) and tetracycline mg/l), was extracted according to the alkaline lysis method, and modified by adding lysozyme (25 mg/ml) to the cell resuspension buffer. The plasmid DNA obtained was analyzed by enzymatic digestion and by gene amplification with the help of the oligodesoxynucleotides 5' ATATGAGACTCTAATTGGATACCGAGGGG 3' selected from the transfer DNA of the binary plasmid and TTGATTTCACGGGTTGGG 3' selected from the expression cassette around the "uidA" sequence. The Agrobacterium clones obtained were used to carry out Agrobacterium mediated plant genetic transformation.

Example Measure and comparison of the expression levels of the different promoters using transient expression techniques.

5.1 In vitro culture of tobacco, leaf preparation.

The transient expression experiments were carried out on tobacco leaves (Nicotiana tabacum of the cultivar bpD6 aged 6 weeks.

Mature seeds of tobacco cv. bpD6 were sterilised for 10 min in a saturated calcium hypochlorite solution (70 then rinced three times for 5 min in sterile deionized water. The sterile seeds were then placed on MS20 media (Murashige and Skoog, 1962) and incubated for 6 weeks in a culture chamber (constant temperature of 24 0 C, photoperiode 16 h obscurity 8 h light, light intensity of 200 pmol photons.m-2.sec-l).

In order to avoid splitting of the foliar mesophylll cells during transformation, the major leaves of the bpD6 tobacco plants aged 6 weeks were excised from the plant 24 h before gene gun transformation, and placed, lignous face up, on light WO 00/56906 PCT/IB00/00317 plasmolysis BY3 media (MS Salts 4,4 g/l, myoinositol 100 mg/l, thiamine 1 mg/l, KH 2

PO

4 200 mg/l, Saccharose 30 g/l, Sorbitol 45,5 g/l, 2,4 D 1 mg/l, pH 5,8).

5.2. Gold Particle Coating with DNA of the Chimeric Constructions.

Gene gun transformation requires prior coating of DNA onto gold bead spheres of 0,6 mm in diameter, that have been sterilized for 10 min absolute ethanol (99,98 at less than 0,02 water), washed four times in sterile deionized water, and finally preserved for a maximum of 4 weeks maximum at -20 0 C in a glycerol solution.

The concentration of all of the control and experimental plamsids used during transformation was adjusted to 1 mg/ml. In each transformation experiment, an internal reference control (pCaMV35Sluc) was cotransformed in order to normalize the variations in GUS activity between the different experiments (Leckie and al., 1994).

The coating of DNA onto the previously prepared gold beads was carried out in a sterile container under laminar flow conditions. An aliquot of 1,8 mg of sterile beads in suspension in 30 pi of 50 glycerol, was vigourously mixed in a vortexer for 1 min, then for 10 sec with 20 pl of DNA suspension containing 4 pg of one of the plamsids to be tested and 2 pg of the reference plasmid pCaMV35Sluc. Then, 20 p1 of CaClI 2,5 M were added and mixed vigourously for 10 sec. Next, 20 pl of spermidine 0,1 M were added to the mixture and whole mixture was agitated under vortex for 30 further seconds. The coating of DNA onto the beads was continued by incubating the mixture in ice for 15 min, then the coated beads were centrifuged at low velocity for 5 sec and washed twice in absolute ethanol.

After washing, the coated beads were resuspended in 32 p1 of absolute ethanol, subjected to ultrasound three times each for 2 sec, vigourously mixed in the vortexer for 15 sec, then immediately split into 4 identical equal aliqouts on sterile macrocarrier disks used in a Biolistic PDS-1000/He system prepared according to the manufacturer's recommendations WO 00/56906 PCT/IB00/00317 (Bio-Rqd, Hercule, USA). The whole arrangement of macrocarrier support and macrocarrier bearing the deposited beads was left to dry for 5 min.

5.3. Bombardment of foliar tissues of tobacco and transient expression.

The bombardment of tobacco leaves was carried out with the help of a Biolistic PDS-1000/He system following the general manufacturer's recommendations (Bio-Rad, Hercule, USA) with respect to handling and mounting of the different components of the apparatus. Each leaf was bombarded twice succesively using the following conditions helium pressure used to accelerate the beads was equal to 6200 kPa (900 psi).

the plant sample was placed at a distance of 9 cm from the bead acceleration zone.

the bombardment was carried out in a vacuum of 27 mm of mercury.

After bombardment the leaves were left in BY3 medium and incubated for 48 h in the dark in a culture chamber at 24 0

C.

This incubation enables transient expression of the trangenes introduced into the cells.

5.4. Evaluation of the activity of different promoters using histochemical staining.

The revelation of the expression of 8-glucuronidase was carried out by histochemical staining as described by Jeffersson et al.

(1987). After 48 h in the culture chamber, each leaf was cut into two along the axis of the central spine. Half of the leaf was incubated in l-glucuronidase staining buffer 4-chloro, 3-indolyl glucuronide (X-Gluc) 500 mg/l, Triton x100 0.05% in 0.1 M, pH 7.0 phosphate buffer) for 48 h at 37 0

C,

whrereas the other half was frozen in liquid nitrogen, then conserved at -800C.

After staining, the leaves were bleached by dipping them into two 95 ethanol baths for respectively 3 and 12 h, then rinsed in distilled water and dried flat between two sheets of cellophane.

WO 00/56906 PCT/IB00/00317 The promoter activity of the different constructs was evaluated by the number of blue spots revealed on each leaf after two bombardments amounting to 2 pg of DNA bearing the GUS reporter gene.

Three categories of promoters were identified. The leaves bombarded with the promoters MPrl096, MPrl098, MPrll08, MPrll09, MPr1143 and MPr1153 all showed an average of less than blue spots. The leaves bombarded with the promoters petE, MPrl097 and MPrlllO all showed a number of blue spots between and 150. Finally the leaves bombarded with MPrllll and the reference promoter MPrl092 had a very large number of blue spots on average and in general greater than 200.

In conclusion, the chimeric promoters MPrlllO and MPrllll enable expression of permettent d'obtenir une expression of 8-glucuronidase at a level greater than or equal to that of the whole petE promoter and MPrllll shows promoter activity at least as comparable as that obtained by the strong constitutive reference promoter D35S prom.

Quantification of the expression of B-glucuronidase by the different promoters using luminometric enzyme assay.

The frozen leaf halves were ground in a mortar, and the powder was left to defrost in the extraction buffer at 1 ml of buffer for 200 mg of plant tissue (Tris Phosphate 25 mM pH 7.8, Dithiothreitol 2 mM, 1,2-diaminocyclohexane N,N,N',N'-tetracetic acid 2 mM, glycerol 10 Triton xl00 1 The mixture was homogenized then incubated for 15 min in ice before being clarified by centrifugation for 5 min at 16060 g.

The GUS activity was measured on 20 pl crude clarified leaf extract with the help of the detection kit "GUS-Light chemiluminescent reporter gene assay" (Tropix Inc., Bedford, USA) according to the supplier's recommendations. The measurement of light emission was carried out with the help of a Lumat LB 9507 luminometer (EGG-Berthold, Bad Wildbad, Allemagne).

Luciferase activity was measured on 20 pl crude leaf extract WO 00/56906 PCT/IB00/00317 with the help of the detection kit "Luciferase assay system" (Promega Corp., Madison, USA) according to the supplier's recommendations. Light emission measurement was effected with the help of a Lumat LB 9507 luminometer.

The results are reported in Fig. V. For each experiment (one bombarded leaf one crude extract), the ratio between the measured 8-glucuronidase activity and luciferase activity as measure by the luminometer, was calculated. The average of the different experiments for a given construct and mean standard error were determined.

The promoters can be divided into 6 classes ordered on an increasing scale of expression starting from the weakest (class 1) to the strongest (class 6) Class 1 inclues the promoters MPrll08 and MPrll09 (Fig. IV).

The expression conferred by these promoters seems to differ very little from that obtained with the construction pMRT1144 (Fig.

which contains no promoter. The fusion of the "as-1 like" and "nosE like" boxes to the minimal promoter MPrl098 (Fig. IV) to obtain MPrll08, only slightly lowers the average expression promoted by MPrl098. This result seems to suggest that a very slight inhibitor effect is due to these boxes and their position within MPrll08. The promoter MPrll09 confers an essentially identical expression to that obtained with promoter MPrll08. The deletion of the sequence siutated downstream of the transcription initiation site, that is to say the untranslated region, does not appear to modify the expression obtained with MPrll08.

Class 2 comprises promoters MPrl098, MPr1143 and MPrlll2 (Fig.

IV). The promoters MPrl098 and MPr1143 show similar activity.

The promoter Mpr1143 results from the insertion of a box at a distance of 36 bp upstream of the "CAAT" box in the minimal promoter MPrl098. The presence of this box does not appear to have a significant effect on the expression obtained with the promoter MPrl098. The promoter MPrlll2 includes upstream of the "CAAT" box, a duplication of the "as-2" box followed by the "as-l" box originating from the promoter 35S of CaMV. These WO 00/56906 PCT/IB00/00317 element's on their own do not appear to contribute to improving the epxression rate which is essentially identical to that obtained with the promoter MPrl098.

Class 3 includes promoters MPrl096 and MPrl097 (Fig. IV). The expression conferred by these two promoters is identical. The creation of MPrl096 by deletion of the fragments SphI-SpeI bearing the "nosE like" box and SpeI-Spel of MPrl097, bearing a region from the sequence enhancer of the petE promoter (Fig.

IV), does not appear to affect the expression rate. In promoter MPrl096, the presence of the box, preceded by the 31 bp of the petE sequence enhancer and at a distance of 122 bp from the "CAAT" box appears to enable the increase in the expression rate obtained by MPrl098 by a factor of 2.5. It should be noted that in the case of MPrll43, the presence of the box preceded by the 28 bp petE sequence enhancer at a distance of 36 bp from the "CAAT" box does not permit an increase in the rate of expression obtained with MPrl098. It would thus seem that the distance between the and "CAAT" boxes influences the rate of expression.

Class 4 includes promoter petE (Fig. IV) which is used as a reference.

Class 5 comprises the promoter MPrlllO (Fig. IV). The fusion of the as-2 and as-i boxes upstream of the promoter MPr1143 creating the promoter MPrlllO enables a considerable increase in the expression rate that is very much higher than that obtained with the petE promoter (by a factor of It appears that the "as-l" and "as-2" boxes together have an active positive synergic effect with respect to the expression.

Class 6 covers promoters MPrllll (Fig. IV) and MPrl092 (Fig.

The promoter MPrllll confers an expression rate similar to that of the reference double 35S CaMV promoter (MPrl092). The addition of an "as-2" element or box considerably increases the expression rate with respect to that obtained by MPrlllO (by a factor of These elements appear to act synergistically.

The duplication of the "as-2" box also increases this effect.

In conclusion, the chimeric promoter MPrlllO enables an average WO 00/56906 PCT/IB00/00317 express'ion of 3-glucuronidase at a level greater than or equal to the whole petE promoter. The promoter MPrllll has a promoter activity comparable to the average activity obtained with the reference promoter These results are in agreement with those observed after histochemical staining of the bombarded leaves with the same promoters.

The CaMV D35S promoter is commonly reported in the literature as being a strong promoter. The chimeric promoters of the present invention bring an increase in the promoter activity of the GUS reporter gene of the order of 8 to 12 times that of the reference promoter CaMV 35S (Kay and al., 1987).Furthermore, MPrllll constitutes one of the most active and strongest chimeric promoters in tobacco leaves described to date.

The promoters of lesser strength can be used as promoters associated with genes coding for selection agents, for example, in order to confer antibiotic resistance, for example in the same way as promoters of the "nos" type.

Example 6.

Expression of the different promoters in tobacco after stable transformation.

6.1. Stable transformation in tobacco.

The transformation of tobacco (Nicotiana tabacum cultivar bpD6) was carried out by infecting foliar disks isolated from tobacoo plants aged 6 weeks by recombinant Agrobacterium according to the method described by Horsch et al. (1985).

During transformation, the Petri dishes were incubated in a culture chamber under the following conditions temperature of 24 0 C, photoperiod of 8 h darkness 16 h light, luminous intensity of 200 pmol photons.m-2.sec-1 and apart from the initial coculture step, all of the callogenesis, regeneration, and rooting steps were carried out on varying selective media supplemented with Augmentin (400 mg/l) and Kanamycin (200 or 100 mg/1) The different steps and the media were the following a coculture step lasting three, during which the Agrobacteria WO 00/56906 PCT/IB00/00317 infect the plant cells, on a solid MS30 coculture media (media based on MS (Murashige and Skoog, 1962) supplemented with vitamins (Gamborg and al., 1968) 4.4 g/1 (Sigma, M0404), Saccharose 30 g/l, agar 8 g/l (Merck), pH Benzyl Amino Purine at 1 mg/1 and Indole-3 acetic acid at 0,1 mg/1 a bud tip formation step consisting of four weeks in a culture chamber on a solid MS20 regeneration media (Salts and vitamins MS 4,4 g/l (Sigma, M0404), Saccharose 20 g/l, agar 8 g/l (Merck), pH supplemented with Benzyl Amino Purine at 1 mg/l, Indole-3 Acetic acid at 0.1 mg/l, Augmentin at 400 mg/1 and Kanamycine at 200 mg/l.

a development and rooting step lasting three weeks in a culture chamber on MS20 solid development media supplemented with Augmentin at 400 mg/l and Kanamycine 0 at 100 mg/l.

a repotting step into glass pots in a culture chamber on sur solid development media supplemented with Augmentin at 400 mg/l and Kanamycine at 100 mg/l.

6.2. Comparison of chimeric promoter activity after stable expression in tobacco plants.

0-glucuronidase activity was measured in primary transformants 2, 4, 6, 8 and 10 weeks after their transfer to greenhouse. For each plant, 3 samples were taken and pooled together in a test tube. One sample was taken from an "old" leaf (basal foliar level), one from a mature leaf (of a median leaf level), and one on a young leaf located at the apex of the plant.

Each sample was ground with liquid nitrogen in a mortar and the powder was resuspended in extraction buffer (Tris phosphate mM, pH=7.8, dithiothreitol 2 mM, 1,2-diaminocyclohexan, N, N, N',N'-tetracetic acid 2 mM, glycerol 10 Triton X100 1 at a ratio of 1 ml buffer per 200 mg plant powder. The material was homogenized, incubated for 15 min on ice before being clarified by centrifugation at 16060 g for 5 min.

GUS activity was measured on 20 ml of clarified crude extract with the help of the "GUS-Light chemiluminescent reporter gene assay" detection kit (Tropix Inc., Bedford, USA) according to the manufacturer's recommendations. Measurements of light WO 00/56906 PCT/IB00/00317 emission were carried out using the Lumat LB 9507 luminometer (EGG-Berthold, Bad Wildbad, Germany).

Total protein content in crude extract was assessed by the Bradford's technique (Bradford, 1976), using the "Bio-Rad protein assay" reagent (Bio-Rad, Mdnchen, Allemagne) according to the manufacturer's recommendations.

Reporter gene activity in the different categories of plants was analyzed over the population of 20 transformants per construct, and over the whole period of plant growth and development.

Analysis was not performed at the individual level because of random insertion sites and variable copy number in the different transformants of a given category.

The results for the chimeric promoter MPrllll, compared to the original pPetE promoter, the minimal MPr1143 and the reference MPrl092 promoter are presented Fig.VI.

GUS activity in MPrl092 reference plants showed relatively little variation compared to what was observed in plants transformed with plastocyanin-based promoters. Activity decreased slightly between 2 and 4 weeks after transfer of the plants to greenhouse; increased about 4 times at 6 weeks, dropped again at 8 weeks to values observed at 4 weeks and finally increased slightly at 10 weeks. Analysis of plastocyanin-based promoters revealed that whatever promoter or plant considered, GUS activity increased regularly from 2 to 6 weeks after transfer to greenhouse and decreased thereafter till flowering.

This evolution of GUS activity was correlated to plant developement, since the plastocyanin gene is actively expressed in photosynthetic tissues. Activities of pPetE and derived promoter therefore followed active growth of the plants spanning from greenhouse transfer to 6-8 weeks after acclimation, followed by a slower development of the plants from 8 weeks to flowering that occured 10-12 weeks after transfer to greenhouse.

In comparison, the reference MPrl092 promoter, known as a highly active constitutive promoter was less dependent on these developmental associated effects.

WO 00/56906 PCT/IB00/00317 Comparison of transformants bearing the chimeric promoter MPr1143 and the reference MPrl092 showed that whatever stage of development, "MPr1143 plants" exhibited a very low GUS activity compared to "D35S plants". These data revealed that MPr1143 was only able to drive minimal expression of the reporter gene at a basal level and confirmed the results obtained after transient expression experiments showing that the "G box" by itself, inserted into the minimal pPetE sequence was not sufficient to promote expression effectively.

Comparison of the population of transformants bearing the original pPetE promoter to the reference "MPrl092 plants" showed that pPetE was as active as the reference at 2 weeks after transfer of the plants to greenhouse, 3 to 4 times more active during active development (from 2 to 8 weeks). The differences between the two promoters decreased regularly from 6 weeks after transfer and was reversed at 10 weeks since reference plants exhibited an average activity greater than twice that of "pPetE plants". These data did not corroborate those obtained after transient expression, in which pPetE was 2,5 times less active than MPrl092.

Comparison between "MPrllll plants" and those bearing pPetE revealed that MPrllll was on average 2 to 3 times less active than pPetE till 6 weeks and was at least as active thereafter.

At 8 and 10 weeks a few "MPrllll individuals" were indeed more active than "PetE ones". To this extent, stable expression led to a different conclusion compared to transient expression in which MPrllll was on average 2,5 more active than pPetE.

MPrllll was shown to be more active than the reference MPr1092 in the population of primary transformants over a period of growth and development extending form 4 to 8 weeks after transfer of plants to greenhouse, with a maximum of 2 to 3 times more activity at 8 weeks.

On the basis of these time course analyses we can conclude that respective strength of the promoters is not static throughout growth of the plants, and this is probably due to different regulation processes. MPrllll is the promoter that drove WO 00/56906 PCT/IB00/00317 expression of the reporter protein GUS at the highest level 8 weeks after transfer of the plants to greenhouse, and therefore appears to be the best candidate to be used for expression of large quantities of heterologous proteins at this stage of tobacco development.

WO 00/56906 PCT/IB00/00317 Bibliographic references An G. (1986). Development of plant promoter expression vector and their use for analysis of differential activity of nopaline synthase promoter in transformed tobacco cells. Plant Physiol.

81, 86-91.

Barany F. (1991). The ligase chain reaction in a PCR world. PCR Methods Appl. 1, 5-16.

Birnboim H. C. and Doly J. (197-9). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nuc. Ac. Res.

7, 1513.

Bradford M. (1976). A rapid and sensitive method for the detection of microgram quantities of proteins utilising the principle of protein-dye binding. Anal. Biochem. 72, 248-254.

Fromm Taylor L.P. and Walbot V. (1986). Stable transformation of maize after gene transfer by electroporation.

Nature, 319, 791-793.

Gamborg Miller R.A. and Ojima K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Exp.

Cell Res. 50, 151-158.

Gaubier Raynal Hull Huestis Grellet F., Arenas Pages M. and Delseny M. (1993). Two different Em-like genes are expressed in Arabidopsis thaliana seeds during germination. Mol. Gen. Genet. 238, 409-418.

Guerineau and Mullineaux (1993). In Plant molecular biology labfax, Croy R.R.D. BioS Scientific Publishers, Blackwell Scientific Publications.

Jefferson Burgess S.M. and Hirsh D (1986).

B-glucuronidase as a gene-fusion marker. Proc. Nat. Acad. Sci.

USA, 83, 8447-8451.

Jefferson Kavanagh T.A. and Bevan M.W. (1987). GUS fusions 8-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907.

Hanahan D. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557.

WO 00/56906 PCT/IB00/00317 Holsters Dewaele Depicker Messenf Van Montagu M.

and Schell J. (1978). Transfection and transformation of Agrobacterium tumefaciens. Mol. Gen. Genet. 136, 181-187.

Horsch Fry Hoffmann Eiholtz Rogers S.G.

and Fraley R.T. (1985). A simple and general method for transferring genes into plants. Science 227, 129-1231.

Kay Chan Daly M. and McPherson J. (1987). Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236, 1299-1302.

Lam Benfey P. Gilmartin P. Fang R. X. and Chua N. H.

(1989). Site-specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants.

Proc. Natl. Acad. Sci. USA, 86, 7890-7894.

Lam E. and Chua N. H. (1989). ASF-2 a factor that binds to the cauliflower mosaic virus 35S promoter and a conserved GATA motif in Cab promoters. Plant Cell, 1, 1147-1156.

Last D. I. and Gray J. C. (1989). Plastocyanin is encoded by a single-copy gene in the pea haploid genome. Plant Mol. Biol. 12, 655-666.

Leckie Devoto A. and of Lorenzo G. (1994). Normalisation of GUS by LUC activity from the same cell extract reduces transformation variability. Biotechniques 17, 52-56.

Murashige T. and Skoog F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol.

Plant. 15, 473-497.

Pwee K.H. and Gray J.C. (1993). The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants. Plant J. 3, 437-449.

Sanger Nicklen S. and Coulson A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463-5467.

Torrent Alvarez Geli Dalcol I. and Ludevid D.

(1997). Lysine-rich modified g-zein accumulate in protein bodies of transiently transformed maize endosperms. Plant Mol. Biol.

34, 139-149.

Vancanneyt Schmidt O'Connor-Sanchez Willmitzer L.

WO 00/56906 PCT/IB00/00317 and Rocha-Sosa M. (1990). Construction of an intron-containing marker gene Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol. Gen. Genet. 220, 245-250.

EDITORIAL NOTE APPLICATION NUMBER 31853/00 The following Sequence Listing pages 1 to 16 are part of the description. The claims pages follow on pages "53" to "58".

WO 00/56906 PCT/IB00/00317 SEQUENCE LISTING <110> MERISTEM THERAPEUTICS <120> Chimeric promoters, their method of manufacture, and cassettes, vectors and transgenic plants containing them <130> Chimeric Ppc Promoter <140> <141> <160> 22 <170> PatentIn Vers. <210> 1 <211>834 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> Whole sequence of the petE promoter of the pea plastocyanine gene <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 WO 00/56906 WO 0056906PCT/IBOO/0031 7 <400> 1 aagcttgcat gcctgcaggt cgactctaga actagtggat ctatgcaact tacaacgtgc actcgcggag gattggacgt gtgcaactta caacgtacgc attgttcgtc catacaatag 120 tgtagaattg gacatgtgca acttacaaca tgtgcaactt acaacgtgcg ctcgcggagg 180 aatgtgaagt tgaacacgta caacttacgt catttgtgca tgcagaagca tagagctgag 240 cacacaattc ataatttgaa ggacacatga tttgctataa agaactctt agaagtacca 300 caactttgac tgagtttgat atagctaata aagatggagc tcattataat ttgaatggca 360 taatcaagct aaacgaacaa gcttagttaa tcatgttaaa caacaattct ttgtaataat 420 aaattgtctt tcaactagtc caagtttatg agttgattct tcggaataaa ttagaaaata 480 tcttagactt tatacttcat tgattatttc atagagcaag taggagaaat aaaaatatac 540 tagtattatt tactaaaaaa aatctaagcc acgtcggagg ataacatcca acccagccaa 600 tcacagcaat gttcatcaga taacccactt taagcccacg cactctgtgg cacatctaca 660 ttatctaaat cacatattct tccacacatc ttagccacac aaaaacccaa tccacatctt 720 tatcatccat tctataaaaa atcaccttct gtgtgtctct ctttcgattc ccttcaaaca 780 catacaaatt cagtagagaa gaaactcatt actcttgaga aacctagagg atcc 834 <210> 2 <2 11> 623 <212> DNA <213> Artificial Sequence <220> <22 1> promoter <222> <223> Promoter MIr 1097 derived from the promoter petE by a deletion in 5' of the repeated invert sequences as well as the as- I like box borne on fragment SphlI of 212 bp <220> <223> promoter N~r1O97 <300> <3 0 1> Last, D. 1.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301 Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 WO 00/56906 PCT/IB00/00317 <400> 2 aagcttgcat gcagaagcat agagctgagc acacaattca taatttgaag gacacatgat ttgctataaa gaactcttta gaagtaccac aactttgact gagtttgata tagctaataa 120 agatggagct cattataatt tgaatggcat aatcaagcta aacgaacaag cttagttaat 180 catgttaaac aacaattctt tgtaataata aattgtcttt caactagtcc aagtttatga 240 gttgattctt cggaataaat tagaaaatat cttagacttt atacttcatt gattatttca 300 tagagcaagt aggagaaata aaaatatact agtattattt actaaaaaaa atctaagcca 360 cgtcggagga taacatccaa cccagccaat cacagcaatg ttcatcagat aacccacttt 420 aagcccacgc actctgtggc acatctacat tatctaaatc acatattctt ccacacatct 480 tagccacaca aaaacccaat ccacatcttt atcatccatt ctataaaaaa tcaccttctg 540 tgtgtctctc tttcgattcc cttcaaacac atacaaattc agtagagaag aaactcatta 600 ctcttgagaa acctagagga tcc 623 <210> 3 <211> 326 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> The promoter MPr1096 derived from the promoter petE by a deletion in 5' of the repeated invert sequences, of the "as-I like" and enhancer like" elements borne by two Spel 403 bp fragments <220> <223> promoter MPr1096 <300> <301> Last,D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 WO 00/56906 PCT/IB00/00317 <400> 3 aagcttgcat gcctgcaggt cgactctaga actagtatta tttactaaaa aaaatctaag ccacgtcgga ggataacatc caacccagcc aatcacagca atgttcatca gataacccac 120 tttaagccca cgcactctgt ggcacatcta cattatctaa atcacatatt cttccacaca 180 tcttagccac acaaaaaccc aatccacatc tttatcatcc attctataaa aaatcacctt 240 ctgtgtgtct ctctttcgat tcccttcaaa cacatacaaa ttcagtagag aagaaactca 300 ttactcttga gaaacctaga ggatcc 326 <210> 4 <211> 207 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> The promoter MPr1098 of 207 bp only contains the "TATA" and "CAAT" boxes and corresponds to a minimal reference promoter on the promoter petE.

<220> <223> promoter Mpr1098 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 4 aagcttgcat gcctgctctg tggcacatct acattatcta aatcacatat tcttccacac atcttagcca cacaaaaacc caatccacat ctttatcatc cattctataa aaaatcacct 120 tctgtgtgtc tctctttcga ttcccttcaa acacatacaa attcagtaga gaagaaactc 180 attactcttg agaaacctag aggatcc 207 <210> <211> 281 <212> DNA <213> Artificial Sequence <220> WO 00/56906 PCT/IB00/00317 <22'1> promoter <222> <223> The promoter MPrI 108 was created by fusing the 72 bp sequence of the promoter petE bearing the elements "as-I like" and "nos enhancer like" to the minimal promoter sequence of 187bpofMPrl098 <220> <223> promoter MPr 108 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> aagcttgcat gcctgcagtt gaacacgtac aaacttacgt catttgtgca tgcagaagca tagagctgag cacacaattc ataatttgaa cactctgtgg caatctaatt atctaaatca 120 atattcttcc acacatctta gccacacaaa aacccaatcc acatctttat catccattct 180 ataaaaaatc accttctgtg tgtctctctt tcgattccct tcaaacacat acaaattcag 240 tagagaagaa actcattact cttgagaaac ctagaggatc c 281 <210> 6 <211> 250 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> The promoter MPrl 109 differs from MPrI 108 by a deletion of 33 bp in the 5' UTR, 11 bp upstream of the point +1 <220> <223> promoter MPrI 109 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 WO 00/56906 PCTIB00/00317 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 6 aagcttgcat gcctgcagtt gaacacgtac aaacttacgt catttgtgca tgcagaagca tagagctgag cacacaattc ataatttgaa cactctgtgg cacatctaca ttatctaaat 120 cacatattct tccacacatc ttagccacac aaaaacccaa tccacatctt tatcatccat 180 tctataaaaa atcacctttg tgtgtctctc tttcgattcc cttcaaacac atgagaaacc 240 tagaggatcc 250 <210> 7 <211> 280 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> The promoter MPrl 110 was created by inserting at position -99 bp of MPr1098 an element of 18 bp containing a box and by fusing a sequence of 44 bp of the RNA CaMV promoter <220> <223> promoter MPrl 110 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 7 WO 00/56906 PCT/IB00/00317 aagdttgcat gcctgcagac tagtggattg atgtgatatc tccactgacg taagggatga cgcatgccac tctgtggcac atctacatta tctaaatcta agccacgtcg gaggataaca 120 tattcttcca cacatcttag ccacacaaaa acccaatcca catctttat atccattcta 180 taaaaaatca ccttctgtgt gtctctcttt cgattccctt caaacacata caaattcagt 240 agagaagaaa ctcattactc ttgagaaace tagaggatcc 280 <210> 8 <211> 303 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> The promoter MPrl 153 was obtained by fusing a sequence of 78 bp of the promoter petE, stretching from position -582 to position -510 bp modified by adjunction of a box <220> <223> promoter MPr1 153 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 8 aagcttgcat gcctgcagtt gaacacgtac aaacttacgt catttgtgca tgcagaagca tagagctgag cacacaattc ataatttgaa cactctgtgg cacatctaca ttatctaaat 120 ctaagccacg tcggaggata acatattctt ccacacatct tagccacaca aaaacccaat 180 ccacatcttt atcatccatt ctataaaaaa tcaccttctg tgtgtctctc tttcgattcc 240 cttcaaacac atacaaattc agtagagaag aaactcatta ctcttgagaa acctagagga 300 tcc 303 <210> 9 <211> 296 <212> DNA <213> Artificial Sequence <220> <221> promoter WO 00/56906 PCT/IB00/00317 <222> <223> Promoter MPrl 111 created by inserting at -99 bp position of MPrl098, an 18 bp element containing a box and fusing a sequence of 58 bp (duplication of the element as2 and asl) <220> <223> promoter MPrl 11 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301>Pwee,K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 9 aagcttgcat gcctgcagac tagtgattga tgtgatatca agattgatgt gatatctcca ctgacgtaag ggatgacgca tgccactctg tggcacatct acattatcta aatctaagcc 120 acgtcggagg ataacatatt cttccacaca tcttagccac acaaaaaccc aatccacatc 180 tttatcatcc attctataaa aaatcacctt ctgtgtgtct ctctttcgat tcccttcaaa 240 cacatacaaa ttcagtagag aagaaactca ttactcttga gaaacctaga ggatcc 296 <210> <211> 220 <212> DNA <213> Artificial Sequence <220> <221> promoter <222> <223> The promoter MPrI 143 (Fig. II) was obtained by deleting the s6quence of 72 bp bearing the elements "as-2, as-2, as-i" of MPrl 111.

<220> <223> promoter MPrI143 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

WO 00/56906 PCT/IB00/00317 Gray,'John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> aagcttgcat gccgtggcac atctacatta tctaaatcta agccacgtcg gaggataaca tattcttcca cacatcttag ccacacaaaa acccaatcca catctttatc atccattcta 120 taaaaaatca ccttctgtgt gtctctcttt cgattccctt caaacacata caaattcagt 180 agagaagaaa ctcattactc ttgagaaacc tagaggatcc 220 <210> 11 <211> <212> DNA <213> Artificial Sequence <220> <223> Directional building block Sl <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301>Pwee,K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 11 ttcccttcaa acacatacaa attcagtaga gaagaaactc attactcttg agaaacctag aggatccccg <210> 12 <211> <212>DNA <213> Artificial Sequence <220> <223> Directional building block S2 <220> <223> Directional building block oligonucleotide for the construction of promoters by Ib-PCR WO 00/56906 PCT/IB00/00317 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 12 cacaaaaacc caatccacat ctttatcatc cattctataa aaaatcacct tctgtgtgtc tctctttcga <210> 13 <211> 68 <212>DNA <213> Artificial Sequence <220> <223> Directional building block S3 <220> <223> Directional building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 13 cataatttga acactctgtg gcacatctac attatctaaa tcacatattc ttccacacat cttagcca 68 WO 00/56906 PCT/IB00/00317 <210> 14 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> Directional builiding block S4 <220> <223> Directional building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 14 ggaatctgca gttgaacacg tacaaactta cgtcatttgt gcatgcagaa gcatagagct gagcacacaa tt 72 <210> <211>72 <212> DNA <213> Artificial Sequence <220> <223> Directional building block <220> <223> Directional building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> WO 00/56906 PCT/IB00/00317 <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> ctgtggcaca tctacattat ctaaatctaa gccacgtcgg aggataacat attcttccac acatcttagc ca 72 <210> 16 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Directional building block S6 <220> <223> Directional building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 16 catgctgcag actagtggat tgatgtgata tctccactga cgtaagggat gacgcatgcc act 63 <210> 17 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> Directional building block S7 WO 00/56906 PCT/IB00/00317 <220> <223> Directional building block oligonucleotide for the construction of promoters by lb-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 17 catgctgcag actagtgatt gatgtgatat caagattgat gtgatatctc cactgacgta agggatgacg catgccact 79 <210> 18 <211>31 <212> DNA <213> Artificial Sequence <220> <223> Guide building block G1 <220> <223> Guide building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 18 WO 00/56906 PCT/IB00/00317 gtgtttga gggaatcgaa agagagacac a 31 <210> 19 <211>30 <212> DNA <213> Artificial Sequence <220> <223> Guide building block G2 <220> <223> Guide building block oligonucleotide for the construction of promoters by lb-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 19 gattgggttt ttgtgtggct aagatgtgtg <210> <211>33 <212> DNA <213> Artificial Sequence <220> <223> Guide building block G3 <220> <223> Guide building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 WO 00/56906 PCT/IB00/00317 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> cagagtgttc aaattatgaa ttgtgtgctc age 33 <210> 21 <211>28 <212> DNA <213> Artificial Sequence <220> <223> Guide building block G4 <220> <223> Guide building block oligonucleotide for the construction of promoters by Ib-PCR <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 21 tgtagatgtg ccacagagtg gcatgcgt 28 <210> 22 <211> 259 <212>DNA <213> Artificial Sequence <220> <221> Promoter <222> <223> Promoter MPrl 12 differs from MPrl 111 by a deletion of 35 bp containing the box WO 00/56906 PCT/IB00/00317 and stretching from position -127 to position -89 and a deletion of two bp situated at positions -78 and -76 <220> <223> promoter MPrl 112 <300> <301> Last, D. I.

Gray, J. C.

<302> Plastocyanin is encoded by a single-copy gene in the pea haploid genome.

<303> Plant Mol. Biol.

<304> 12 <306> 655-666 <307> 1989 <300> <301> Pwee, K. H.

Gray, John C.

<302> The pea plastocyanin promoter directs cell-specific but not full light-regulated expression in transgenic tobacco plants.

<303> Plant Journal <304> 3 <306> 437-449 <307> 1993 <400> 22 aagcttgcat gcctgcagac tagtgattga tgtgatatca agattgatgt gatatctcca ctgacgtaag ggatgacgca tgccactctg tggcacatct acattatccc acacatctac 120 cacacaaaaa cccaatccac atctttatca tccattctat aaaaaatcac cttctgtgtg 180 tctctctttc gattcccttc aaacacatac aaattcagta gagaagaaac tcattactct 240 tgagaaacct agaggatcc 259

Claims (1)

19-09-03 :53 P IZZEYS ;61732218077 6/ 7 THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS: 1) A chimeric expression promoter including an as-2 box and at least one nucleic acid sequence derived from SEQ.IDO1, wherein the said nucleic acid sequence includes a box, a "CAAT" box, a "TATA" box and -a transcription initiation site. 2) The chimeric expression promoter according to claim---- 1, wherein the box is situated between positions 225 and- 65 with respect to the transcription initiation site 3) The chimeric expression promoter according to claim- 1, wherein the box is situated between positions -201 and -115 with respect to the transcription initiation'site 4) The chimeric expression promoter according to claim 1, wherein the box is situated at position 201 with respect-to the transcription initiation site 5) The chimeric expression promoter according to claim 1, wherein the box is situated at position 115 with respect to the transcription initiation site 6) The chimeric promoter according to any one of claims 1 to 5, wherein it further comprises a "nos E like" box operably or functionally linked upstream of the box. 7) The chimeric promoter according to any one of preceding claims 1 to 6, wherein it further comprises at least one "asl" or "asl like" box operably or functionally linked to the box. 8) The chimeric promoter according to any one of claims 1 to 7, wherein the promoter comprises two or more "asl" or "asl like" boxes, arranged either contiguously or separately. 9) The chimeric promoter according to claim 8 wherein the promoter comprises four "asl or "asl like". boxes. The chimeric promoter according to claim 8 or claim 9, wherein the "asl" or "asl like" boxes are linked either upstream or downstream of said box, and preferably are linked upstream. 53 COMS ID No: SMBI-00423205 Received by IP Australia: Time 11:48 Date 2003-09-19 1 9 0 3 ;I I- 53 P IZ Z Y ;61732218077 7/ 7 11) The chimeric promoter according to any one of preceding claims 7 to 10, wherein one or more of the "asl" or "asl like" boxes is arranged in inverse order, and preferably in inverse repeat order. 12> The chimeric promoter according to any one of claims 1 to 11, wherein at least one "as2" box is operably linked to-- the box. 13) The chimeric promoter according to any one of claims 1 to 12 wherein the promoter comprises at least two or more "as2" boxes, and preferably four "as2" boxes. 14) The chimeric promoter according to claim 13, wherein said "as2" boxes are linked either upstream or downstream of said box, and preferably are linked upstream. 15) The chimeric promoter according to any one of claims 8 to 10, wherein one or more of the "asl" or "asl like" boxes is arranged in inverse order, and preferably in inverse repeat order. 16) The chimeric promoter according to any one of the claims 1 to 15, wherein it comprises at least one nucleic acid sequence selected from the group consisting of the sequences identified under the numbers SEQ.ID07 or SEQ.ID08. 17) An expression cassette comprising at least one nucleic acid sequence derived from a promoter of the pea plastocyanin gene, operably or functionally linked to a nucleic acid sequence to be expressed coding for a polypeptide to be produced, itself operably or functionally linked to a transcription termination nucleic acid sequence, wherein the nucleic acid sequence derived from a promoter of the pea plastocyanin gene is selected from the group consisting of the sequences identified under the numbers SEQ.ID07 or SEQ.ID08. 18) An isolated promoter nucleic acid sequence, wherein the sequence is selected from the group consisting of the sequences identified under the numbers SEQ.ID07 or SEQ.IDO8. 54 COMS ID No: SMBI-00423205 Received by IP Australia: Time 11:48 Date 2003-09-19 16-09-03;14:50 PIZZEYS ;61732218077 6/ 19) A directional desoxynucleotide building block for a chimeric expression promoter or an isolated promoter nucleic acid sequence according to any one of claims 1 to 16 or claim 18, wherein the sequence is selected from the group consisting of the sequences identified under the numbers SEQ.ID11, SEQ.ID12, SEQ.ID13, SEQ.ID14, SEQ.ID15, SEQ.ID16 and SEQ.ID17.--' A guide desoxynucleotide building block for a chimeric expression promoter or an isolated promoter nucleic acid sequence according to any one of claims 1 to 16, or claim 18, wherein the sequence is selected from the group consisting of the sequences identified under the numbers SEQ.ID18, SEQ.ID19, SEQ.ID20 and SEQ.ID21. 21) A vector comprising a promoter, or a promoter nucleic acid sequence, capable of initiating transcription of nucleic acid sequence coding for a polypeptide to be produced, wherein the promoter or the promoter nucleic acid sequence correspond to a chimeric expression promoter or a promoter nucleic acid sequence according to any one of claims 1 to 16 or claim 18. 22) The vector according to claim 21, wherein the vector is the binary vector identified under the number pMRT11S1. S23) A method for the manufacture of a chimeric expression promoter or an isolated promoter nucleic acid sequence according to any one of claims 1 to 16 or claim 18, wherein it comprises the steps consisting of: carrying out a ligation chain reaction, called LCR, that produces a continuous single stranded DNA from at least one directional desoxynucleotide building block selected from the group consisting of the "directional" desoxynucleotides Sl, S2, S3, S6, and $7 identified under the numbers SEQ.ID11, SEQ.ID12, SEQ.ID13, SEQ.ID14, SEQ.ID15, SEQ.ID16 and SEQ.ID17 respectively, and at least one "guide" desoxynucleotide building block, for said promoter nucleic i acid sequence or promoter, selected from the group consisting COMS ID No: SMBI-00417635 Received by IP Australia: Time 14:47 Date 2003-09-16 16-09-03:14:50 PI ZZEYS ;61732218077 7/ of the "guide" desoxynucleotides G1, G2, G3, and G4 identified under the numbers SEQ.ID18, SEQ.ID19, SEQ.ID20 and SEQ.ID21 respectively; carrying out PCR amplification on the single stranded DNA obtained in the -previous step enabling the production of a double stranded DNA corresponding to the chimeric expression promoter or the promoter nucleic acid; optionally isolating the promoter or the promoter nucleic acid sequence. 24) The method according to.claim 23, wherein the desoxynucleotide blocks are phosphorylated before ligation.- The method according to claim 23 or claim 24, wherein the ligation is carried out in the presence of at least one DNA,ligase in a thermocycle, under the following conditions: one cycle of about one minute at about 94°C; eight identical cycles each of which consists of the following steps; one minute at 65*C, one minute at 570C, one minute at 520C, one minute at 480C, one minute at 43°C and ten minutes S.at 37 0 C. 9 26) A transgenic plant having stably integrated into its genome at least one promoter or at least one promoter nucleic acid sequence according to any one of claims 1 to 16, or claim 18 respectively. 27) The transgenic plant according to claim 26, wherein the plant is selected from dicotyledonous species, preferably potato, tobacco, cotton, lettuce, tomato, melon, cucumber, pea, rape, beetroot, or sunflower, or monocotyledonous species, preferably wheat, barley, oat, rice, or corn. 9 9 28) A propagule of a transgenic plant according to any one of claims 26 or 27. 56 COMS ID No: SMBI-00417635 Received by IP Australia: Time 14:47 Date 2003-09-16 16-09-03:14:51 PI ZZEYS ;61732218077 8/ 29) The propagule of a transgenic plant according to claim 28, wherein the propagule is a seed. A aell containing a promoter or a promoter nucleic acid sequence according to any one of claims 1 to 16, or claim 18. 31) The cell according to claim 30, wherein the cell selected from plant cells, human cells, animal cells, insect cells, bacterial cells, algal cells, and fungal cells, and preferably is a plant cell. 32) A method for expressing a nucleic acid sequence, or gene, coding for a polypeptide to be produced, in a cell, wherein said method comprises the steps consisting of: transforming the cell with a vector comprising at least one promoter or at least one promoter nucleic acid according to any one of claims 1 to 16, or claim 18 operably linked to a nucleic acid sequence, or gene, coding for a polypeptide to be produced, itself operably linked to a transcription terminator signal; culturing the transformed cell under conditions enabling the expression of the nucleic acid sequence, or gene, coding for the polypeptide, whereby the polypeptide is produced. 33) The method according to claim 32, wherein the cell is prokaryote or eukaryote cell. 34) The method according to any one of claim 32 or claim 33, wherein the cell is one chosen from the group consisting of microbial cells, fungal cells, insect cells, animal cells, and plant cells. 35) The method according to any one of claims 32 to 34, wherein the cell is a plant cell. 36) The method for the manufacture of a transgenic plant according to claim 26 or claim 27, or of a propagule according 9* to claim 28, wherein the method comprises the steps consisting of: 57 COMS ID No: SMBI-00417635 Received by IP Australia: Time 14:47 Date 2003-09-16 16-09-03;14:51 PI ZZEYS ;6173221 077 9/ transforming a plant cell with a vector comprising at least one promoter or at least one promoter nucleic acid sequence according to any one of claims 1 to 20, or claim 22; selecting the plant cell having integrated the promoter or the promoter nucleic acid sequence; propagating the transformed and selected plant cell, either through culture, or through regeneration of whole- chimeric or transgenic plants. DATED THIS SIXTEENTH DAY OF SEPTEMBER 2003 MERISTEM THERAPEUTICS BY PIZZEYS PATENT AND TRADEMARK ATTORNEYS. e e 58 COMS ID No: SMBI-00417635 Received by IP Australia: Time 14:47 Date 2003-09-16