RU2697014C2 - Method for efficient biosynthesis of recombinant proteins in dicot plants using promoter of pro-smamp1 gene from stellaria media - Google Patents

Abstract

FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry, in particular to a DNA fragment for modifying plants in order obtaining recombinant proteins. Also, a DNA section and an expression vector containing said DNA fragment are disclosed. Disclosed is a method of producing recombinant proteins using said DNA fragment.EFFECT: invention enables to obtain recombinant proteins with higher accumulation level thereof.4 cl, 3 dwg, 4 ex

Description

FIELD OF THE INVENTION

The invention relates to the field of biology, biotechnology and genetic engineering of plants, namely, to a method for achieving high expression of target genes and increased accumulation of target protein in plant cells. The present invention can be used to produce recombinant proteins in plants by transient expression in order to efficiently produce protein preparations for the medical, pharmaceutical, veterinary and food industries. The present invention can be used in basic scientific research.

State of the art

Currently, the promoters of many genes that are used in plant genetic engineering systems have been isolated from a wide range of organisms. Promoters for plant biotechnology are based on similar nucleotide sequences, which typically include a transcription initiation site and TATA box as specific cis-active motifs that bind transcription factors.

In recent years, several well characterized promoters have become available for expression of heterologous genes in plants. In plant genetic engineering, the strongest CaMV35S promoter, based on the 35S promoter region of CaMV cauliflower mosaic virus, is most widely used (Potenza et al. 2004). Due to the wide use of CaMV35S in plant vectors, usually all new promoters are compared with it in their efficiency. The full-sized regulatory site for CaMV35S is approaching 3 thousand bp in size. (Odell et al. 1985). However, smaller regions also have promoter activity: a typical CaMV35S promoter used in expression vectors for plant transformation is a 352 bp deletion variant. (Fang et al. 1989). In most cases, the CaMV35S promoter provides a high level of expression of heterologous genes in plants, however, it has a number of significant drawbacks. Due to the viral origin of CaMV35S, infection of transgenic plants with CaMV can lead to silencing of the heterologous gene under the control of CaMV35S (Al-Kaff et al. 2000).

For monocotyledonous plants, strong promoters of plant genes are known which, when transient, are significantly superior in activity to CaMV35S. The Actin1 promoter from rice (Oryza sativa) triggers the transient expression of the gusA reporter gene in rice and corn cells twenty times stronger than CaMV35S (McElroy et al. 1991). The banana ACT1 gene promoter (Musa spp.) Was more than twice as potent as CaMV35S when transiently expressed in banana cells (Hermann et al. 2001).

Strong and constitutive plant promoters have also been found for genetic engineering of dicotyledonous plants, but their superiority over the CaMV35S promoter was not as significant as that of monocotyledonous ones. The promoter of the ACT2 gene of actin from Arabidopsis thaliana was two times stronger during transient expression in Arabidopsis cells than CaMV35S (An et al. 2010). The A. thaliana UBQ1 and UBQ6 promoters are active in all tobacco tissues (Nicotiana tabacum) at the level of the CaMV35S viral promoter (Callis et al. 1990).

Despite the abundance of published data on the activity of promoters of many genes, there is currently a shortage of effective promoters for high-level transient expression of target genes.

In our studies, we drew attention to a group of plant genes that can become a source of new effective promoters for transient expression. It was previously found that the expression of the antimicrobial peptide genes of the weed plant Stellaria media increases when the plant interacts with phytopathogenic fungi and when the plants are treated with methyl jasmonate (Shukurov et al. 2012). The expression of the antimicrobial peptide gene pro-SmAMP1 increased from 10 to 100 times, while reaching the level of expression of the β-actin “housekeeping” gene. The expression of the pro-SmAMP2 gene was more suitable for the definition of constitutive, it did not change so much under the influence of the above factors (2-5 times), but its level was comparable to or higher than the level of expression of β-actin.

In order to search for a new plant promoter for plant biotechnology, the nucleotide sequence of the pro-SmAMP2 gene promoter region from S. media was sequenced and cloned. To study its effectiveness as a promoter in the expression of target genes in heterologous plants by transient expression, two 5'-deletion variants -2160 and -862 bp were created, which also include the 5'-untranslated pro-SmAMP2 region. These deletion variants were fused with the sequence of the gusA reporter gene in the pCambia1381Z plant expression vector and studied by transient expression in Nicotiana benthamiana plant cells. Measurements of GUS activity showed that a deletion variant of -2160 bp pro-SmAMP2 has low efficiency, and the deletion variant is -862 bp comparable in effectiveness with the viral promoter CaMV35S (Strelnikova et al. 2014).

The nucleotide sequence of the 1257 bp pro-SmAMP1 gene promoter region fragment was also determined. Based on the distribution of cis-elements, five 5'-deletion variants -1235, -771, -714, -603 and -481 bp were created. the pro-SmAMP1 promoter, which was fused to the coding region of the gusA reporter gene in the plant expression vector pCambia1381Z. The efficiency of all deletion variants of the pro-SmAMP1 promoter was determined by transient expression in N. benthamiana plants. The activity levels of the GUS reporter protein in extracts from agroinfiltrated plants using all deletion variants of the pro-SmAMP1 promoter were significantly higher than when using the CaMV35S viral promoter (Vysotsky et al. 2016).

For a comparative evaluation of the effectiveness in plants of N. benthamiana, the deletion variant -481 bp was used promoter pro-SmAMP1, deletion variant -495 bp the pro-SmAMP2 promoter (Komakhin et al. 2016) and, as a control, the CaMV35S viral promoter. Using agrobacterial infiltration, it was found that the average activity of the GUS reporter protein was 41600 ± 3400 pmol / mg / min with the pro-SmAMP1 promoter, 28400 ± 2000 pmol / mg / min with the pro-SmAMP2 promoter and 12000 ± CaMV35S 900 pmol / mg / min. Comparative results of transient expression of the gusA reporter gene under the control of the pro-SmAMP1, pro-SmAMP2 and CaMV35S promoters in N. benthamiana plants indicate that the levels of absolute GUS activity when using all promoters were approximately 1.5-4.6 times lower than in our earlier studies (Strelnikova et al., 2014; Vysotsky et al., 2016). Differences in activity levels when using the same promoter variant can be explained by different physiological conditions of plants or agrobacteria at the time of the experiments. Earlier in our studies, transient expression of gusA under the control of different promoters in N. benthamiana was performed in late summer and early fall (Strelnikova et al., 2014; Vysotsky et al., 2016), while experiments in these studies were performed at the end winter and spring. An indirect confirmation of the different physiological state of plants can be that in spring they bloomed 1-1.5 weeks earlier than in autumn. At the same time, in all independent repetitions, the ratio of GUS activity levels when using different promoters remained constant: the most effective deletion variant was -481 bp. of the pro-SmAMP1 promoter, a deletion variant of -495 bp was significantly less effective. of the pro-SmAMP2 promoter and the least effective was the CaMV35S viral promoter (Majarova et al. 2018).

Transient gene expression is often used to produce any recombinant proteins using N. benthamiana plants. This method does not lead to the creation of transgenic plants, the transgene cannot be transmitted in generations of plants and enter the environment through cross-pollination between closely related species; however, work in this way does not create problems with the certification of transgenic plants. Therefore, the transient expression method has the potential for large-scale production of various target recombinant proteins. However, a prerequisite for efficient transient expression is the creation of genetic constructs with promoters of plant genes that provide a high yield of the target protein product.

Disclosure of the invention

The proposed method is based on plant infiltration using Agrobacterium tumefaciens bacterial cells containing genetic constructs with new deletion -388, -364, -328, -276, -226 and -158 bp variants of the pro-SmAMP1 promoter from the woodlice plant (Stellaria media) controlling the target gene, and nos transcription terminator. The method of transient expression of the target gene using new deletion variants of the pro-SmAMP1 promoter provides a statistically higher level of accumulation in the infiltrated plants of the encoded target protein than previously used deletion variants of the pro-SmAMP1 promoter (Vysotsky et al. 2016) from wood lice, pro-SmAMP2 promoter from wood lice (Komakhin et al. 2016; Majarova et al. 2018) and the viral promoter CaMV35S. The nucleotide sequences of the new deletion variants of the promoter region of the pro-SmAMP1 gene used in this method of transient expression of target genes are represented as -388 bp (SEC ID NO 1), -364 bp (SEC ID NO 2), -328 bp (SEC ID NO 3), -276 bp (SEC ID NO 4), -226 bp (SEC ID NO 5) and -158 bp (SEC ID NO 6). The numerical designation -388, -364, -328, -276, -226 and -158 indicates the number of nucleotides of the deletion variant of the promoter relative to the translation initiation site (the ATG initiation codon, in which A is at position +1) and includes 5'-untranslated 39 bp pro-SmAMP1 gene region

The object of the present invention is a DNA sequence length of -388 bp (SEC ID NO 1), which is a variant of the promoter region of the pro-SmAMP1 gene from Stellaria media and includes its 5'-untranslated region. This variant of the pro-SmAMP1 promoter during transient expression in plants provides with a 95% probability a significantly higher level of expression of the target gene than its previously extended version of -481 bp (Vysotsky et al. 2016) and the viral promoter CaMV35S. In addition, the nucleotide sequence of -388 bp (SEC ID NO 1) 93 bp pro-SmAMP1 promoter shorter than the nucleotide sequence of the previously created deletion variant -481 bp the pro-SmAMP1 promoter, which is important when creating genetic constructs with minimized expression cassette size.

Variants of the present invention are also DNA sequences corresponding to deletion variants of the promoter region of the pro-SmAMP1 gene -364 bp in length. (SEC ID NO 2), -328 bp (SEC ID NO 3), -276 bp (SEC ID NO 4), -226 bp (SEC ID NO 5) and -158 bp (SEC ID NO 6), providing with a probability of 95% higher level of expression of the target gene in plants than the deletion variant -481 bp pro-SmAMP1 and the viral promoter CaMV35S. Deletion options -364 bp (SEC ID NO 2), -328 bp (SEC ID NO 3), -276 bp (SEC ID NO 4), -226 bp (SEC ID NO 5) and -158 bp (SEC ID NO 6) of the pro-SmAMP1 promoter is shorter than the previously studied variant of -481 bp the pro-SmAMP1 promoter by 117-323 bp, which is important when creating genetic constructs with a minimized expression cassette size. In general, the DNA region, which is a variant of the promoter region of the pro-SmAMP1 S. media gene, is connected to its 5'-untranslated region, where the DNA fragment has the nucleotide sequence SEC ID NO 1.

Objects of the present invention are also genetic constructs for expression in plants of target genes under the control of the above deletion variants of the pro-SmAMP1 promoter.

The present invention is a method (process) for producing target proteins in plant tissues during transient expression of target genes under the control of any of the -388 bp nucleotide sequences. (SEC ID NO 1), -364 bp (SEC ID NO 2), -328 bp (SEC ID NO 3), -276 bp (SEC ID NO 4), -226 bp (SEC ID NO 5) and -158 bp (SEC ID NO 6) contained in genetic constructs.

The main technical result of the invention is to expand the arsenal of new effective promoters for genetic engineering of plants, using which there is a significantly higher level of accumulation of target proteins during transient expression of target genes.

Brief Description of the Drawings

FIG. 1. The nucleotide sequence of the 5'-flanking promoter region of the pro-SmAMP1 gene -481 bp in size (relative to the ATG translation initiation site, in which A is in position +1) and the distribution of cis-active elements highlighted in color and marked with inscriptions. The 5'-untranslated region is located between the sites of transcription initiation (TSS) and translation initiation (ATG). The broadcast start site is highlighted in red italics. The vertical red arrows and numbers indicate the starting points of the nucleotide sequences of the new 5'-deletion promoter variants. The vertical black arrow and the numbers “-481” mark the starting point of the nucleotide sequence of the previously created 5'-deletion variant -481 bp promoter (Vysotsky et al. 2016).

FIG. 2. Scheme of genetic constructs based on the plant expression vector pCAMBIA 1381Z in which the gusA reporter gene (gus) is controlled by new deletion variants of the pro-SmAMP1 promoter. The p481 genetic construct was created earlier (Vysotsky et al. 2016) and used as a comparative control. The plant expression vector pMOG35SintGUS contains the gusA gene under the control of the CaMV35S viral promoter and is used as a control. Black shows the translated region of the gusA gene; Int - modified castron catalase intron inside the translated region of the gus gene; PIV2 is a modified intron of the potato ST-LS1 gene within the translated region of the gusA gene. The promoters are shown in the form of arrows with corresponding signatures.

FIG. 3. The activity of the reporter protein beta-glucuronidase (GUS) in the leaves of N. benthamiana plants upon transient expression of the gusA gene under the control of various deletion variants of the pro-SmAMP1 promoter and the CaMV35S viral promoter. The horizontal line indicates deletion variants based on the pro-SmAMP1 promoter from the woodlice plant. The vertical lines indicate the confidence interval at the 5% significance level. The numbers below the abscissa axis indicate individual deletion variants of promoters calculated relative to the start of transcription initiation. Beta glucuronidase activity was measured fluorimetrically using 4-methylumbelliferyl-D-glucuronide as a substrate.

The implementation of the invention

The above disclosure describes the invention in general terms. A more complete understanding can be achieved by providing relevant examples. The examples presented here are for illustrative purposes only and are not intended in any way to narrow the scope of this invention within the scope of these examples. Change of form or substitution of equivalents is allowed on the basis of its expediency in appropriate conditions. Although specific terms will be used here, they are used for descriptive purposes only.

Example 1. The selection of new deletion variants of the promoter region of the pro-SmAMP1 gene

This example reveals the features of creating new deletion variants of the pro-SmAMP1 promoter, the nucleotide sequences of which are much smaller than the shortest of the previously obtained variants.

Earlier in the plant, woodlice (S. media), the smallest nucleotide sequence of the fragment of the promoter region of the pro-SmAMP1 antifungal peptide gene -481 bp was determined. (Vysotsky et al. 2016). Bioinformation analysis in PLACE (http://www.dna.affrc.go.jp/PLACE/signalscan.html) and PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) programs showed that this deletion variant of the pro-SmAMP1 promoter contains a conserved TATA box sequence, CAAT motif, and CAN (A / C) (A / C) (C / A) C (C / A) N2A (C / A) sequence characterizing TSS transcription initiation site (in FIG. 1). The combination of these motifs is characteristic of promoters that provide a high level of gene expression in plants (Sawant et al. 1999). In addition, a number of cis-elements and regulatory motifs have been identified that can determine a certain pattern of gene expression. So, regulatory elements responsible for the reaction to light, such as the TGA element, I-box, G-box and LAMP-element, were discovered. In addition, motifs responsible for the response to the action of phytopathogens (S-box, W-box, TGACG motif, etc.), abiotic effects (ARE, ABRE), as well as determining the local nature of expression (GCN4, Skn-I) were found. . It should be noted that the position and number of detected regulatory elements distinguishes the pro-SmAMP1 promoter from the well-known pro-SmAMP2 promoter (Komakhin et al. 2016). For example, the TGA element responsible for the reaction to light has a different position for the pro-SmAMP1 promoter than for pro-SmAMP2. The LAMP element is only in the pro-SmAMP1 promoter.

The efficiency of the deletion variant -481 bp the pro-SmAMP1 promoter during transient expression in N. benthamiana plants was significantly higher than with the CaMV35S viral promoter (Vysotsky et al. 2016). At the same time, the effectiveness of deletion variants of the pro-SmAMP1 promoter, whose nucleotide sequence size was less than -481 bp, remained unclear. relative to the translation initiation site (initiating ATG codon). To detect the minimum active deletion variant of the pro-SmAMP1 promoter containing the minimum number of cis-acting elements, a sequential truncation of the previously created deletion variant -481 bp was performed. from the 5'-end in increments of up to 70 bp, but in such a way as not to introduce gaps in the cis-acting elements detected by computer programs (in Fig. 1). A total of eight new deletion variants of the pro-SmAMP1 promoter were selected.

Example 2. The creation of genetic constructs with new deletion variants of the pro-SmAMP1 promoter

Based on the sequence analysis of the deletion variant, −481 bp pro-SmAMP1 primers were selected to create new shorter deletion variants of the promoter in order to further evaluate their effectiveness so that direct primers in combination with the reverse sequentially restrict cis-acting elements. Eight direct primers and one reverse were selected, bounding the promoter regions designated as -429, -388, -364, -328, -276, -226, -158 and -115 bp The reverse primer was selected directly to the left of the translation initiation site, starting with the nucleotide residue at position -1. The primer sequences are shown below:

-429f - 5'- GAATTCTAGAGCATCGTCAATAAA -3 '

-388f - 5'- GAATTCCAATCTCGATAATACATTTT -3 '

-364f - 5'- GAATTCAAATCACCCGATAACACT -3 '

-328f - 5'- GAATTCTATATAGCCTTTATCTTTATCTCG -3 '

-276f - 5'- GAATTCAGTCTATCCGTATAGACCCT -3 '

-226f - 5'- GAATTCCAAGATATTAAAGTGTGTGT -3 '

-158f - 5'- GAATTCGGTTATCATCAAGCATTT -3 '

-115f - 5'- GAATTCTGCAAACGGCAAACC -3 '

rev - 5'- CCATGGTTTCACTTGATTTTTTTTG -3 '

All forward primers contained the EcoRI restriction site, and the reverse primer contained the NcoI required for cloning into the pCAMBIA 1381Z vector.

The previously created plasmid genetic construct p481 (Vysotsky et al. 2016) was used as a matrix for amplification of new deletion variants of the pro-SmAMP1 promoter.

Using the developed primers, eight new deletion variants of the pro-SmAMP1 promoter were amplified and cloned into the expression vector pCAMBIA 1381Z. A diagram of the structures obtained, respectively designated p429, p388, p364, p328, p276, p226, p158 and p115, is shown in FIG. 2.

The created genetic constructs are intended for transient expression of the target gene in plants of N. benthamiana, which is under the control of the claimed pro-SmAMP1 promoter variants. The gusA reporter gene was used as the target gene, which allows one to evaluate the efficiency of transient expression by the activity of its protein product, the β-glucuronidase enzyme (GUS).

Example 3. Agroinfiltration of plants N. benthamiana

The leaves of the plants were infiltrated with ten variants of A. tumefacien strain GV3101 with plasmid genetic constructs p429, p388, p364, p328, p276, p226, p158 and p115, as well as with pMOG35SintGUS and p481 (Vysotsky et al., 2016) as comparative controls . The genetic construct of pMOG35SintGUS contains the gusA reporter gene under the control of the CaMV35S viral promoter. The p481 construct contains the gusA reporter gene under the control of the previously studied deletion variant -481 bp promoter pro-SmAMP1 (Vysotsky et al. 2016). The obtained agrobacterial strains were grown on LB agar medium with antibiotics of 100 mg / l kanamycin, 100 mg / ml rifampicin and 25 mg / l gentamicin. To carry out agroinfiltration of plants, the strains were grown in LB liquid medium for 24 hours with the addition of antibiotics 100 mg / l kanamycin, 100 mg / ml rifampicin and 25 mg / l gentamicin at a temperature of 28 ° C and 160 rpm. The strain A. tumifaciens GV2260 / C58C1 pLH7000 p19 was grown during the day on LB medium with antibiotics 100 mg / l rifampicin, 50 mg / l spectinomycin, 50 mg / l streptomycin, at a temperature of 28 ° C and 160 rpm. and used to suppress RNA interference in plant cells.

Agrobacteria were diluted to an optical density of 0.6 at a wavelength of 600 nm. The resulting suspensions of GV3101 pMOG35SintGUS, GV3101 p481, GV3101 p429, GV3101 p388, GV3101 p364, GV3101 p328, GV3101 p276, GV3101 p226, GV3101 p158 and GV3101 p115 were mixed with a solution of 1: 1 p19 C19822 C58. The finished mixture of agrobacteria was introduced into the leaves of N. benthamiana plants with a syringe without a needle from the inside of the leaf. After infiltration, the plants were kept at 26 ° C and 16 hours of artificial lighting. On day 7, 10 mg die cuts were taken from the inoculation site and frozen at -70 ° C.

From one die cut from each plant, protein extracts were obtained in which the activity of the enzyme β-glucuronidase was measured. In all analyzed plants, except for those infiltrated with the GV3101 p115 variant, fluorescence of MUG hydrolysis products (4-methylumbelliferyl-β-D-glucuronide Trihydrate, PhytoTechnology Laboratories) with β-glucuronidase protein was detected.

Thus, we obtained N. benthamiana plants infiltrated with agrobacterial strains GV3101 pMOG35SintGUS, GV3101 p481, GV3101 p429, GV3101 p388, GV3101 p364, GV3101 p328, GV3101 p276, GV3101 p226, GV3101p15158.

Example 4. Evaluation of the effectiveness of the pro-SmAMP1 promoter by the activity of the GUS reporter protein in transient expression

The activity levels of the GUS reporter protein in leaves of agroinfiltrated plants of N. benthamiana were compared using different deletion variants of the pro-SmAMP1 promoter and CaMV35S promoter. Initially, a fraction of water-soluble proteins was extracted from each die cut, which was used to determine the fluorescence level of hydrolysis products of the 4MUG substrate obtained as a result of the activity of the GUS reporter protein, and then the concentration of water-soluble proteins was determined in it. The obtained results on the fluorescence of 4MUG hydrolysis products and protein content were used to calculate the level of GUS activity.

Using the results obtained for each die cutting, the level of GUS activity was calculated in pmol 4MU / mg / min (or u.a.) for each individual variant of the genetic construct. A total of 180 samples were analyzed, including using a GV3101 pMOG-35SintGus - 20 pcs., GV3101 p481 - 20 pcs., GV3101 p429 - 20 pcs., GV3101 p388 - 20 pcs., GV3101 p364 - 20 pcs., GV3101 p364 - 20 pcs., GV3101 p276 - 20 pcs., GV3101 p226 - 20 pcs. and GV3101 p158 - 20 pcs. The average level of GUS activity using each deletion variant of the pro-SmAMP1 promoter and the CaMV35S viral promoter is shown in FIG. 3.

As follows from FIG. 3, the average level of GUS activity in plants agroinfiltrated with genetic constructs with various deletion variants of the pro-SmAMP1 promoter ranged from 44,000 to 91,000 units aa. In particular, the deletion variant -481 bp allowed to reach 44297 ± 8431 u.a., option -429 bp - 63433 ± 15521 u.a., option -388 bp - 77774 ± 16380 u.a., option -364 bp - 91273 ± 34068 u.a., option -328 bp - 88625 ± 21868 u.a., option -276 bp - 67034 ± 13495 u.a., option -226 bp - 67798 ± 14436 u.a. and option -158 bp - 71 674 ± 12089 units At the same time, with the use of the CaMV35S viral promoter, only 20,520 ± 3,937 units were achieved. After the “±” sign for each variant, a confidence interval of activity values is presented at p = 05.

As follows from the above results, the values of GUS activity levels using all deletion variants of the pro-SmAMP1 promoter were more than two times higher than the GUS activity levels using the CaMV35S viral promoter with a 95% probability. A comparative analysis showed that the least effective among deletion variants of pro-SmAMP1 is the previously created -481 bp variant. (Vysotsky et al. 2016) and does not statistically significantly differ from it a new deletion variant -429 bp The remaining new deletion variants are -388, -364, -328, -276, -226 and -158 bp the pro-SmAMP1 promoter significantly superior to the -481 bp variant, but they do not differ in effectiveness (Fig. 3).

We previously cloned a pro-SmAMP2 gene promoter from the genome of the dicotyledonous plant S. media. He, like the pro-SmAMP1 gene promoter, is a representative of regulatory elements that control the expression of antimicrobial peptide genes. The expression level of the gus reporter gene in heterologous plants of N. benthamiana using the deletion variant of -862 bp The proSmAMP2 promoter was higher than when using the CaMV35S promoter, but these differences were not statistically significant at p = 05 (Strelnikova et al. 2014).

Upon transient expression of the gus reporter gene in agroinfiltrated N. benthamiana plants, all deletion variants from -1235 to -481 bp (Vysotsky et al. 2016) and from -388 to -158 bp The pro-SmAMP1 promoter from woodlice was significantly more effective than the CaMV35S viral promoter. Each of the new deletion variants -388, -364, -328, -276, -226 and -158 bp The pro-SmAMP1 promoter can be used for transient gene expression and is preferred for creating genetic constructs. All new deletion variants have significantly higher efficiency than the previously studied deletion variant of -481 bp, and the length of their nucleotide sequences is shorter by 93-323 bp For N. benthamiana infiltration, it is preferable to use genetic constructs with deletion variants from -388 to -158 bp than -481 bp promoter pro-SmAMP1. The use of deletion variants of the pro-SmAMP1 promoter for plant biotechnology is priority from the point of view of environmental safety, since they can replace the promoters of viruses, bacteria, or animals in genetic constructs for plant transformation.

Bibliography

1. Al-Kaff N. S., Kreike M. M., Covey S. N., Pitcher R., Page A. M., Dale P. J. (2000) Plants rendered herbicide-susceptible by cauliflower mosaic virus-elicited

suppression of a 35S promoter-regulated transgene // Nat Biotechnol. 18 (9). P. 995-999.

2. An Y.-Q.C., Meagher R.B. (2010) Strong expression and conserved regulation of ACT2 in Arfbidopsis thaliana and Physcomitrella patens // Plant molecular biology reporter. Voi 28. No.3. P. 484-490

3. Fang R.X., Nagy F., Sivasubramaniam S., Chua N.H. (1989) Multiple cis regylatory elements for maximal expression of the cauliflower mosaic virus 35S promoter in transgenic plants // Plant Cell. 1 (1). P. 141-151.

4. Callis J., Raasch J.A., Vierstra R. D. (1990) Ubiquitin extension proteins of Arabidopsis thaliana. Structure, localization, and expression of their promoters in transgenic tobacco. // Journal of Biological Chemistry. Vol. 265. No. 21. P. 12486-12493.

5. Komakhin R.A., Vysotskii D.A., Shukurov R.R., Voblikova V.D., Komakhina V.V., Strelnikova S.R., Vetchinkina E.M., Babakov A.V. (2016) Novel strong promoter of antimicrobial peptides gene pro-SmAMP2 from chickweed (Stellaria media). // BMC Biotechnol. 18; 16 (1): 43. doi: 10.1186 / s12896-016-0273-x.

6. McElroy D., Blowers A.D., Jenes B., Wu R. (1991) Construction of expression vectors based on the rice actin 1 (Act1) 50 region for use in monocot transformation. Mol Gen Genet 231: 150-160.

7. Hermann S., Harding R., Dale J. (2001) The banana actin 1 promoter drives near-constitutive transgene expression in vegetative tissues of banana (Musa spp.) // Plant Cell Reports. Vol. 20. No. 6. P. 525-530.

8. Potenza C., Aleman L., Sengupta-Gopalan C. (2004) Targeting transgene expression in research, agricultural, and environmental pplication: Promoters used in plant transformation // In Vitro CellDevBiol-Plant. 40 (1). P. 1-22.

9. Odell J.T., Nagy F., Chua N.H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter // Nature. 313 (6005). P. 810-812.

10. Sawant S., Singh P., Gupta S., Madnala R., Tuli R. (1999) Conserved nucleotide sequences in highly expressed genes in plants. Journal of Genetics 78: 123-131 doi: 10.1007 / bf02924562.

11. Vysotsky D. A., Strelnikova S. R., Efremova L. N., Vetchinkina E. M., Babakov A. V., Komakhin R. A. (2016) Structural and functional analysis of the new plant promoter pro-SmAMP1 from Stellaria media // Plant Physiology. T. 63. No. 5. with. 705-715.

12. Strelnikova S.R., Voblikova V.D., Shukurov R.R., Babakov A.V., Komakhin R.A. (2014) Study of a new plant promoter of the proSmAMP2 gene from Stellaria media by agrobacterial plant infiltration. Biotechnology: 8-17.

Claims (4)

1. A DNA fragment for plant modification to produce recombinant proteins having a nucleotide sequence selected from the group comprising SEC ID NO 1, SEC ID NO 2, SEC ID NO 3, SEC ID NO 4, SEC ID NO 5 and SEC ID NO 6. 2. The DNA region, which is a variant of the promoter region of the pro-SmAMP1 Stellaria media gene, connected to its 5'-untranslated region, where the DNA region includes a fragment according to claim 1. 3. An expression vector containing the DNA fragment according to claim 1 and a recombinant DNA sequence encoding the target gene of the resulting recombinant protein. 4. A method for the production of recombinant proteins in plants, including plant infiltration using agrobacterial cells containing genetic constructs with the nucleotide sequences of SEC ID NO: 1-6 of the pro-SmAMP1 promoter from Stellaria media plants controlling the target gene and nos transcription terminator.

Images