Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
  • C12N2710/00011—Details
  • C12N2710/10011—Adenoviridae
  • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
  • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
  • C12N2710/10344—Chimeric viral vector comprising heterologous viral elements for production of another viral vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2830/00—Vector systems having a special element relevant for transcription
  • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
  • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2840/00—Vectors comprising a special translation-regulating system
  • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
  • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

• a wide variety of systems have been suggested for the delivery of genes to mammals, especially human patients, to treat or prevent a number of diseases, including cystic fibrosis, genetic immune deficiencies, hemophilia A, hemophilia B, and many others.
• a number of systems have been evaluated and found wanting from a variety of standpoints including effectiveness of gene delivery and observed levels of gene expression. These systems include non- viral approaches as well as various configurations of viral systems including recombinant vaccinia, herpes, adeno and adeno associated viruses.
• Improved approaches for the delivery of transgenes and the more effective practice of gene therapy, preferably regulated gene therapy, would be of potentially immense clinical value.
• a target gene construct comprising a target gene operably linked to an expression control sequence including a minimal promoter and 12 binding sites for the composite DNA-binding domain known as ZFHD1.
• An optimized bicistronic DNA construct encoding the requiste pair of fusion proteins is also disclosed there.
• the first fusion protein comprises a copy of the ZFHD1 DNA-binding domain linked to three FKBP12 domains in series.
• the second fusion protein comprises an FRB domain derived from human FRAP linked to the p65 transcription activation domain derived from NF-kB.
• the FRB domain may be engineered to contain one or more tions relative to the natrually ofccurring peptide sequence, including at position T2098, among others, which may be replaced, e.g. with Leu. While the operability of the foregoing switch mechanism has been clearly demonstrated (see e.g. Rivera et al, supra), improvements for deploying the switch may be of great additional value.
• this invention provides an improved composition for the in vivo genetic engineering of cells within a mammal.
• the composition is of the type comprising a viral delivery vehicle containing
• a target gene construct comprising a nucleic acid sequence encoding an erythropoietin or growth factor protein operably linked to an expression control sequence comprising 12 ZFHD1 sites;
• the genome of the first such recombinant virus contains the bicistronic nucleic acid construct and the genome of the second recombinant virus contains the target gene construct.
• the genome of the second recombinant virus further comprises a nucleic acid sequence encoding another copy of the FRB T2098L-p65 transcription activation fusion protein.
• adenoviruses lack functional adenoviral El and E3 genes. Becuase the genetic payloads are apportioned among two recombinant viruses, the ratios of the respective viruses may be varied, e.g., such that one virus is present in excess of the other, to achieve optimal results.
• the recombinant viruses may be formulated with one or more pharmaceutically acceptable carriers, stabilizers, buffers or other excipients to provide a pharmaceutical preparation for delivery to mammals, including human patients. Such preparations may be packaged together with a package insert containing information concerning the administration of the viruses to recipient cells or patients.
• This invention thus provides a method for rendering a mammal capable of rapamycin-dependent transcription of an erythropoietin or growth hormone gene which comprises infecting the mammal with an improved composition as described herein.
• the improved composition may be administered to the mammal by intramuscular or intravenous administration. Transcription of an erythropoietin or growth factor target gene in genetically engineered cells within the mammal may then be induced by administering rapamycin to the mammal in an amount sufficient to induce expression of the desired target gene. Expression may be measured indirectly by measuring an increase in concentration of the target gene product in the mammal's serum or other tissues or by measuring an increase in hematocrit or animal growth following administration of rapamycin.
• T2098 FRB domain provides the potential for use of rapamycin analogs in place of rapamycin, and that the use of such analogs may provide further practical advantages.
• FIG. 1 Panel A shows the amount of human growth hormone (hGH) produced by HT1080 cells cotransfected with the adenovirus vector pAd-CMV- TF-1 or the AAV vector pAAV-CMV-TF-1 and one of the following vectors containing a gene encoding hGH: pAd-Z 12 I-hGH-1 (-1); pAd-Z 12 I-hGH-2 (-
• -3-TF1 represents cells transfected with the adenoviral vector pAd-CMV-TF-1 further including the reporter construct Z 12 I-hGH-3. See Table I in Example 1 for the description of these constructs. The numbers on the horizontal axis indicate the amount of hGH produced in each transfection in the absence of rapamycin.
• FIG. 1 Panel B shows the amount of rhesus monkey growth hormone (rmGH) produced by HT1080 cells cotransfected with the adenovirus vector pAd-CMV-TF-1 or the AAV vector pAAV-CMV-TF-1 and one of the following vectors containing a gene encoding rmGH gene: pAd-Z 12 I-rmGH-3 (-3); pAd- Z 12 I-rmGH-3-ADl (-3AD1); pAAV-Z 12 I-rmGH-3 (-3); pAAV-Z 12 I-rmGH-3- s3 (-3-s3); and pAAV-Z 12 I-rmGH-3-ADl (-3AD1) and treated or not with 25 nM rapamycin.
• rmGH rhesus monkey growth hormone
• -3-TF1 represents cells transfected with the adenoviral vector pAd-CMV-TF-1 further including the reporter construct Z 12 I-rmGH-3. See Table I in Example 1 for the description of these constructs. The numbers on the horizontal axis indicate the amount of rmGH produced in each transfection in the absence of rapamycin.
• Figure 2 is a graphic representation of Ad.CMV-hGH-3 (Ad.CG-3),
• Ad.CMV-TFl Ad.TFl
• Ad.Z 12 I-hGH-l Ad.ZG-1
• PAS stands for SV40 late poly A sequence.
• RBG stands for rabbit ⁇ -globin intron and polyA.
• Figure 3 is a histogram representing the amount of human growth hormone (hGH) secreted from A549 cells infected with pAd-CMV-TFl (Ad.TFl), P Ad.Z 12 I-hGH-l (Ad.ZG-1), or Ad.TFl + Ad.ZG-1 in a 6:2 ratio and treated or not with 50 nM rapamycin.
• hGH human growth hormone
• Figure 4 is a histogram representing the amount of human growth hormone (hGH) secreted from 84-31 cells infected with pAAV-CMV-TFl (TF1), pAAV.Z 12 I-hGH-l (ZG-1), or TF1 + ZG-1 in a 6:2 ratio and treated or not with 50 nM rapamycin.
• hGH human growth hormone
• Figure 5 A is a graph showing the level of serum human growth hormone (hGH) in Balb/c nude mice injected i.v. with a high dose (1 x 10 ⁇ viral particles) or a low dose (2 x 10 10 ) of a 1: 1 mixture of Ad.TFl and Ad.ZG- 1, in experiment #1 and #2 (day 0), and injected i.p. with 5 mg/kg rapamycin at various days after viral administration. Also show in the serum level of hGH in a Balb/c mouse injected i.v. with 10 1 1 viral particles of the constitutive vector Ad.CG-3.
• hGH serum human growth hormone
• Figure 5B is a graph showing the level of serum hGH in Balb/c nude mice injected i.v. with 1 x 10' ' viral particles of a 1: 1 mixture of Ad.TFl and Ad.ZG- 1 at day 0 and injected i.p. with various doses of rapamycin at different time points.
• Figure 6 is a graph showing the level of serum hGH in Balb/c nude mice injected i.m. with 1 x 10 11 viral particles of a 1: 1 mixture of Ad.TFl and Ad.ZG-1 at day 0 and injected i.p. with 5 mg/kg of rapamycin at different time points after viral infection or injected i.m. with 1 x 10 1 1 viral particles of
• Figure 7 is a graph showing the hematocrit factor in Balb/c nude mice from one to 15 days after having been injected i.m. with 1 x 10 11 viral particles of pAAV.CMVmEpo (day 0).
• Figure 8 is a graph showing the hematocrit factor in Balb/c nude mice injected i.m.
• FIG. 9 is a graph showing the amount of serum hGH in mice at various times after i.v. injection of different amounts of Ad.CG-3 viral particles (day 0).
• Figure 10 is a graph showing the amount of serum hGH in mice after i.v. injection of various amounts of total viral particles of a mixture of Ad.TFl and Ad.ZGl in a 1: 1 ratio (day 0) and injection of 5mg/kg rapamycin at various times after viral infection.
• Figure 11 is a graph showing the amount of serum hGH in mice after i.v. injection of 1 x 10 1 1 total viral particles of a mixture of Ad.TFl and Ad.ZGl in a 1: 1 ratio (day 0) and injection of various amounts of rapamycin
• Figure 12A shows serum erythropoietin (Epo) levels in two rhesus monkeys (RQ1564 and RQ1748) at various times after an i.m. injection of 10 13 viral particles/kg monkey of pAd-CMV-rmEpo-3.
• Figure 12B shows hematocrit factors in two rhesus monkeys (RQ1564 and RQ1748) at various times after an i.m. injection of 10 13 viral particles/kg monkey of pAd-CMV-rmEpo-3.
• Figure 12C shows serum erythropoietin (Epo) levels in a rhesus monkey (RQ1582) at various times after an i.m. injection of 10 13 viral particles/kg monkey of pAAV-CMV-rmEpo-3.
• Figure 12D shows hematocrit factors in a rhesus monkey (RQ1582) at various times after an i.m. injection of 10 13 viral particles/kg monkey of pAAV- CMV-rmEpo-3.
• Example 1 Bicistronic adenovirus encoding two chimeric proteins
• This Example describes the construction of an adenovirus containing a bicistronic sequence encoding a first chimeric protein having a ligand-binding domain (FRB T2098L) fused to a transcriptional activation domain (from p65) and a second chimeric protein having a ligand-binding domain (copies of FKBP) fused to a DNA-binding domain (ZFHD1).
• the two cistons are separated by an internal ribosome entry sequence (IRES).
• IRS internal ribosome entry sequence
• Expression of the chimeric proteins is under the control of a CMV promoter.
• a rabbit b-globin intron and poly A are located downstream of the bicistronic region.
• This adenovirus referred to as pAd-CMV-TF-l,was constructed as follows.
• a plasmid encoding a chimeric protein comprising the DNA binding domain ZFHD1 fused to three copies of FKBP has been deposited at the ATCC under ATCC Accession No. 97399 and is described in Pomerantz et al. (1995) Science
• amino acids 361-550 is encoded by the following linear sequence:
• CTCAGCCCTGCTGAGTCAGATCAGCTCCTAA (SEQ ID NO: )
• human thymus total RNA (Clontech #64028-1) was reverse transcribed using MMLV reverse transcriptase and random hexamer primer (Clontech 1st strand synthesis kit). This cDNA was used directly in a PCR reaction containing the primer 5'
• the primers were designed to amplify the coding sequence for amino acids 2021-2113 inclusive of human FRAP: a 93 amino acid region containing an 89 amino acid region essentially corresponding to the minimal 'FRB' domain (amino acids 2025-2113) identified by Chen et al. (Proc. Natl. Acad. Sci.
• FRB FKBP-rapamycin binding
• GAL4 This construct was confirmed by restriction analysis (to verify the correct orientation) and DNA sequencing and designated pCGNN-GAL4-lFRB.
• An Xbal-BamHI fragment encoding 1 copy of FRB was recovered from the GAL4 fusion vector and ligated into Xbal-BamHI digested pCGNN to yield pCGNN-lFRB.
• the threonine at position 2098 of this FRAP portion was substituted with a Leucine (and is referred to as R H1 ).
• R H1 Leucine
• An Xbal-BamHI fragment encoding p65 was isolated from pCGNN-p65 and ligated into the Spel-BamHI digested vectors to yield the plasmid pCGNN- lFRB-p65.
• the internal ribosome entry sequence (IRES) from the encephalomyocarditis virus was amplified by PCR from pWZL-Bleo.
• the resulting fragment which was cloned into pBS-SK+ (Stratagene), contains an Xbal site and a stop codon upstream of the IRES sequence and downstream of it, an Ncol site encompassing the ATG followed by Spel and BamHI sites.
• 3FKBP was mutated to an Ncol site and the Xbal site was mutated to a Nhel site using the oligonucleotides
• pAd-CMV-TF-1 To construct pAd-CMV-TF-1, a Bglll-Xhol fragment from pC 5 EN - R H1 -p65-IRES-ZFHDl-3FKBP, comprising the R H1 p65-IRES-ZFHDl- 3xFRBP12 coding region, and the rabbit b-globin intron and polyA, was cloned into into the linker of pAd.CMV-link (Kozarsky K.F. et al. (1993) Curr. Opin.
• pAd-CMV-TF-1 comprises a CMV promoter which drives the expression of two chimeric proteins, one having a DNA binding domain and a second chimeric protein having a transcriptional activation domain.
• Example 2 Bicistronic AAV and p Ad/AAV vectors encoding two chimeric proteins
• pAAV-CMV-TF-1 An adenovirus-associated virus containing a bicistronic sequence encoding a first chimeric protein having a ligand-binding domain (FRB T2098L) fused to a transcriptional activation domain (from p65) and a second chimeric protein having a ligand-binding domain (copies of FKBP) fused to a DNA-binding domain (ZFHDl), is referred to as pAAV-CMV-TF-1, was constructed as follows.
• ZFHDl-3xFRBP12 and the rabbit b-globin intron and polyA, was inserted into pSub201 (Samulski et al. (1987) J. Virol. 61:3096). This insertion was done by first removing from the AAV vector an Xbal fragment located between the ITRs and containing the rap and cap genes of the virus and then inserting the fragment obtained from the pCGNN vector.
• the pAd/AAV vector is a pAd vector having two regions of an adenovirus: 0-1 map units and about 9-16 map units flanking two portions of AAV, one portion containing the 5' ITR and the other portion containing the 3' ITR.
• Example 3 Construction of viral vectors containing a target gene
• viral vectors adenovirus, adeno-associated virus, or hybrid adeno-adeno-associated virus, containing a target gene under the control of a minimal IL-2 promoter upstream of which are 12 copies of a ZFHDl binding site were constructed. These vectors are listed in Table I set forth below.
• pZHWTxl2-IL2-SEAP containing a basal promoter from human interleukin-2 gene (Siebenlist et al. Mol. Cell. Biol. (1986) 6:3042-3049) and 12 tandem copies of a ZFHDl binding sites (Pomerantz et al., 1995) driving expression of a gene encoding secreted alkaline phosphatase (SEAP), was prepared by replacing the Nhel-Hindlll fragment of pSEAP Promoter (Clontech) with the following Nhel-Xbal fragment containing 12 ZFHD binding sites: GCTACTCTAATGATGGGCGCTCGAGTAATGATGGCTCGGTCCTACTAATGA TGGGCGCTCGAGTAATGATGGGCGTCTAGCTAATGATGGGCGCTCGAG TAATGATGGGCGGTCGACTAATGATGGGCGCTCGAGTAATGATGGGCG TCTAGCTAATGATGGGCGCTCGAGTAATGATGGGCGGTCGACTAATGATGGGCGC
• pZHWTxl2-IL2-hGH the activation of which leads to the production of human growth hormone (hGH)
• hGH human growth hormone
• adenoviral, AAV and hybrid adenoviral/ AAV vectors containing other target genes were constructed.
• one adenovirus was created which contained a cDNA encoding human GH (pAd-
• the cDNA was obtained by PCR amplification of RNA from a cell line expressing the human genomic GH gene.
• Other vectors contained a cDNA encoding hGH, upstream of which an intron was inserted (chimeric intron from Promega pCI vector) (pAd-Z 12 I-hGH-3).
• Certain AAV vectors contained, in addition, a "stuffer DNA" to increase the total size of the vector.
• rhesus monkey growth hormone e.g., pAd-Z 12 I-rmGH-3
• murine erythropoietin Epo
• Epo erythropoietin
• rhesus monkey Epo e.g., pAd-Z 12 I-rmEpo-2
• pAd-Z12I-hGH-2 Adenoviral vector containing a hGH cDNA downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA
• Ad-Z12I-hGH-3 Adenoviral vector containing a hGH cDNA with a 5' intron (chimeric intron from Promega pCI vector) downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA
• pAd-Z12I-hGH- hGH cDNA with a 5' intron (chimeric intron from 3-TF1 Promega pCI vector) downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA; followed, head-to-tail, by CMV driving expression of the RHlp65-IRES-ZlF3 transcription factor fusions (with 3'rabbit B-globin intron and polyA)
• pAAV-CMV- CMV driving expression of genomic hGH followed by hGH-l-Sl SV40 late polyA; followed by a 2 kb stuffer containing an internal portion of human placental alkaline phosphatase coding sequence and human growth hormone 3'UTR (4840 bp including ITRs)
• SV40 late polyA followed by a 2 kb stuffer containing an internal portion of human placental alkaline phosphatase coding sequence and human growth hormone 3'UTR (4486 bp including ITRs)
• pAAV-Z12I- AAV vector containing a genomic hGH downstream of 12 hGH-1 ZFHDl binding sites and theminimal IL2 promoter followed by SV40 late polyA pAAV-Z12I- AAV vector containing a genomic hGH downstream of 12 hGH-l-S2 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA; followed by a 2 kb stuffer
• pAAV-Z12I- AAV vector same as pAAV-Z12I-hGH-2-ADl, but hGH hGH-3-ADl cDNA has a 5' intron (chimeric intron from Promega pCI vector) (4761 bp including ITRs)
• pAAV-Z12I- AAV vector containing a hGH cDNA downstream of 12 hGH-2-S3 ZFHDl binding sites and the minimal EL2 promoter; followed by SV40 late polyA; followed by a 2.7 kb stuffer
• pAd-Z12I-rmGH- Adenovirus containing a rmGH cDNA with a 5' intron 3 (chimeric intron from Promega pCI vector) downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA pAd-Z12I-rmGH- Adenovirus containing a rmGH cDNA with a 5' intron 3-AD1 (chimeric intron from Promega pCI vector) downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA; followed, head-to-tail, by CMV driving expression of the RHlp65 activation domain fusion (with 3'rabbit B-globin intron and polyA)
• pAd-Z12I-mEpo-2 Adenoviral vector containing mEpo cDNA downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA
• pAd-Z12I-mEpo-3 Adenoviral vector containing mEpo cDNA with a 5' intron (chimeric intron from Promega pCI vector) downstream of 12 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA
• pAAV-Z12I- AAV vector containing rmEpo cDNA downstream of 12 rmEpo-2-S2 ZFHDl binding sites and the minimal IL2 promoter; followed by SV40 late polyA; followed by a 2 kb stuffer containing an internal portion of human placental alkaline phosphatase coding sequence and human growth hormone 3'UTR
• Example 4 Transfections indicate ligand inducible induction of the target gene
• This example demonstrates rapamycin-induced transcriptional activation of a target gene present on a viral vector in cells cotransfected with a viral vector described above encoding two chimeric proteins, one of which contains a transcriptional activation domain and the other which contains a DNA binding domain.
• HT1080 cells were transiently transfected as follows. 33 ng vector encoding the two chimeric proteins was mixed with 167 ng of vector containing the target gene and 0.75 ⁇ l Superfect reagent (Qiagen) and the volume brought to 50 ⁇ l with MEM medium. This mixture is incubated for 5 minutes at room temperature. Then 150 ⁇ l complete HT1080 medium was added. Two hundred ⁇ l of this mixture was added into a well of a 96 well dish containing 1.5 x 10 4 HT1080 cells and the cells were incubated for 3 hours. The medium was then replaced with fresh medium containing 25 nM rapamycin and the amount of GH secreted in the medium is measured 14-20 hours later using the Nichols hGH kit.
• the presence in cells of an adenoviral, AAV, or hybrid adenovirus/AAV vector encoding two chimeric proteins, one containing a ligand binding domain and a transcriptional activation domain and the other containing a ligand binding domain and a DNA-binding domain results in transcriptional activation of a target gene under the control of a DNA sequence recognized by the DNA binding domain (present on a separate vector) in the presence of a dimerizer that brings the two chimeric proteins together.
• Example 5 Target gene expression following infection of a cell with a virus containing a bicistronic construct and a second virus containing a target gene
• This Example shows that infection of mice with a composition comprising two types of viral particles, a first viral particle containing a bicistronic viral vector encoding two chimeric proteins, and a second viral particle containing a target gene, results in efficient expression of the target gene upon administration of rapamycin to the mouse.
• Ad.TFl which is also referred to as pAd-CMV-TFl is a bicistronic vector in which the expression of two chimeric proteins is under the control of the CMV promoter.
• Ad.ZG-1 which is also referred to as pAd-Z 12 I-hGH-l contains a genomic DNA fragment containing the human growth hormone gene under the control of 12 ZFHDl binding sites.
• a human lung carcinoma cell line that does not support the replication of El-deleted virus was infected with Ad.TFl, Ad.ZG-1 or a combination of Ad.TFl and Ad.ZG- 1 at a multiplicity of infection of 6:2, respectively and treated with 50 nM rapamycin for 24 hours.
• the amount of hGH produced was measured as described above.
• the results, which are presented in Figure 3 show that, whereas the addition of rapamycin to cells infected with only one type of virus did not result in an increase of hGH production, it resulted in an induction of a factor of about 518 in cells coinfected with both types of viruses. Thus, the addition of rapamycin induced transcription of the hGH gene.
• Ratios of Ad.TFl and Ad.ZG-1 of 2:0.02; 2:0.06; 2:0.2; 2:0.6; 2:2; 2:6 and 2:20 were tested. The best induction was achieved with a ratio of Ad.ZG-1: Ad.TFl of 2:20 (264 fold induction). A ratio of Ad.ZG-1: Ad.TFl of 20:2 was also very efficient (with a 120 fold induction).
• Rapamycin also efficiently induces target gene expression in a two virus system using AAV vectors.
• 84-31 cells were infected with the viruses AAV.TF1, AAV.ZG-1 or a combination of these two viruses in a 1:1 ratio.
• 84-31 cells are derived from 293 cells and expresses E4. The trans functions provided in this cell line are necessary to augment AAV transduction in vitro.
• AAV.TF1 and AAV.ZG-1 are identical to pAd.TFl and pAd.ZG-1, described above, except that the viral backbone is AAV. These vectors are further described in Table 1. These vectors were then encapsidated. The cells were incubated with the viral particles and 50 nM rapamycin for 24 hours, at which time point, the amount of hGH in the culture medium was determined. As shown in Figure 4, coinfection of cells with the two types of viruses resulted in a 227 fold increase in the production of hGH following rapamycin treatment.
• Example 6 Rapamycin inducible gene expression following i.v. viral infection
• the adenoviral and AAV vectors were then tested in vivo in mice.
• Six to eight week old Balb/c nude mice were injected intravenously (i.v.) with either a total of 10 1 1 or 2 x 10 10 Ad.ZG-1 and Ad.TFl viral particles in a ratio of 1:1, or 10 11 Ad.CG-3 viral particles, in which the hGH gene is under the control of a constitutive promoter, i.e., the CMV promoter (see Figure 2).
• the viral particles were suspended in 100 ⁇ l PBS for the injection.
• Rapamycin was administered to the mice intraperitoneally (i.p.) at a dose of 5 mg/kg at various times (from 0 to 46 days) after viral administration. Serum hGH level was determined 24 hours after administration of rapamycin and at various time points thereafter. The results, which are shown in Figure 5A, indicate that administration of rapamycin to these mice resulted in a rapid increase in production of hGH, which progressively decreased to near background levels and increased again after readministration of rapamycin. hGH production could efficiently be increased by rapamycin administration at least as late as about 45 days after the viral infection.
• Figure 5B shows that repeated rapamycin administration resulted in induction of hGH production even when the challenge occurs at least 75 days after the viral infection.
• mice of two adenoviruses one containing a target gene under the control of an inducible promoter and the other containing genes encoding two chimeric proteins, and administration of rapamycin which is capable of cross-linking the two chimeric proteins to produce a transcription factor capable of binding to the inducible promoter, resulted in efficient expression of the target gene.
• rapamycin which is capable of cross-linking the two chimeric proteins to produce a transcription factor capable of binding to the inducible promoter
• This example shows that intramuscular (i.m.) administration into mice of two types of viruses, one containing a target gene and the other encoding two chimeric proteins, followed by administration of rapamycin, results in efficient expression of the target gene.
• Ad.ZG-1 and Ad.TFl viral particles in a ratio of 1: 1 or 10" Ad.CG-3 viral particles were administered i.m. to Balb/c mice.
• rapamycin was administered i.p. at a dose of 5 mg/kg and serum hGH levels were determined in all mice 24 hours later and at various time points thereafter.
• administration of rapamycin to the mice resulted in rapid increase of hGH production.
• Mice infected with the constitutive construct, i.e., AdCG-3 constitutively produced high levels of hGH until at least 50 days following viral infection.
• a direct comparison between i.m. and i.v. injection of adenoviruses containing a cDNA encoding the hGH gene under the control of CMV into Balb/c nude mice indicated that levels of hGH produced were higher in the case of an i.v. injection relative to an i.m. injection shortly and up until about 10 days after the injection, after which the level of hGH produced was similar in both cases.
• mice were injected i.m. with 2 x 10n viral particles containing an AAV vector having a cDNA encoding mouse erythropoietin (EPO) under the control of CMV (pAAV-CMV-mEpo-3-S2, set forth in Table 1).
• EPO mouse erythropoietin
• the murine Epo cDNA was cloned from Balb/c mouse kidney polyA+ RNA (Clontech). The gene was sequenced completely and found to differ from the Genbank sequence at only one position - amino acid 8 (which is in the leader sequence)- in the published sequence is a threonine
• the amount of Epo produced at 1, 8, and 15 days (please confirm) after the infection was determined indirectly by determining the hematocrit, i.e., the ratio of the volume of packed red blood cells to the volume of whole blood. An increasing hematocrit ratio is indicative of an increased production of Epo.
• the results, presented in Figure 7, show that increasing amounts of red blood cells were produced until at least 15 days after the viral infection.
• the transgene was expressed from the AAV vector in the injected mice. Similar results were obtained using hGH as the transgene.
• AAV viral particles injected i.m. were also used in the inducible system.
• mice were injected i.m with a total of 2 x 10n viral particles of pAAV-Z 12 I-mEpo-2-S2 (AAV.ZE2) or pAAV-Z 12 I-mEpo-3-S2 (AAV.ZE3) and pAAV-CMV-TFl in a ratio of 1: 1.
• the target gene vectors are further described in Table 1. Rapamycin was administered i.p. to the mice at 1 mg/kg every other day, as indicated in Figure 8 and serum Epo levels were measured indirectly 24 hours later, by determining the hematocrit.
• Example 8 Virus dose-response curves in vivo in a constitutive or inducible system This example investigates the relationship between the amount of virus used to infect a mouse and the level of hGH produced.
• Balb/c mice were injected i.v. with doses of 1.5 x 10 9 , 5 x 10 9 , 1.5 x 10i°, or 5 x 10 10 Ad.CG-3 viral particles and the amount of serum hGH was determined at various times after the viral infection. Measurement of the amount of hGH produced in these mice indicates that the production of hGH is proportional to the amount of virus administered to the mice (see Figure 9) and that hGH production continues at a relatively constant level until at least about 50 days after the viral infection. Similar results were obtained in an inducible expression system. In this case, Balb/c mice were injected i.v.
• mice Balb/c nude mice were infected i.v. with 1 x 10n Ad.ZG-1 and Ad.TFl viral particles in a ratio of 1: 1, various amounts of rapamycin (0.05; 0.15; 0.5; 1.5; 5; and 15 mg/kg) were administered to the mice days after the viral infection, and the amount of hGH was determined.
• various amounts of rapamycin 0.05; 0.15; 0.5; 1.5; 5; and 15 mg/kg
• Figure 11 indicate that there is a direct correlation between the amount of rapamycin administered to the mice and the amount of hGH produced when rapamycin concentration varies from 0.01 to 0.15 mg/kg.
• the level of hGH obtained upon administration of higher rapamyin doses does not significantly change from that obtained with doses of 0.05 and 0.15 mg/kg.
• This Example demonstrates that administration of adenovirus or AAV virus containing a target gene under the control of a constitutive promoter, i.e., CMV, results in efficient expression of the target gene.
• Monkeys were injected in a skeletal muscle with 10 13 viral particles/kg monkey (each monkey had a weight of about 5 kg) of the adenovirus pAd- CMV-rmEpo-3 or the AAV virus pAAV-CMV-rmEpo-3-S2 (see Table 1).
• the serum level of Epo was determined using the human Epo i munoassay kit from R & D System (Cat.# DEP00) and hematocrits were also determined.
• Figure 12A shows that the target gene is efficiently expressed from the adenoviral vector until at least about 19 days after the viral infection.
• Figure 12B shows that the number of red blood cells increased until at least about 24 days after the viral infection. Similar results were obtained with the AAV vector.
• the target gene is also expressed from the AAV vector, although the induction is much slower and weaker than that resulting from the adenoviral vector.
• the number of red blood cells in monkeys injected with the AAV vector also increased, as indicated by the hematocrit factor ( Figure 12D).

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Wood Science & Technology (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Virology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biophysics (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=22131571

Family Applications (1)

Country Status (2)

Cited By (22)

Families Citing this family (4)

Family Cites Families (2)

• 1999
  • 1999-05-10 EP EP99922872A patent/EP1078096A1/de not_active Withdrawn
  • 1999-05-10 WO PCT/US1999/010096 patent/WO1999058700A1/en not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events