EP1045898A2 - Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines - Google Patents

Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines

Info

Publication number
EP1045898A2
EP1045898A2 EP99904073A EP99904073A EP1045898A2 EP 1045898 A2 EP1045898 A2 EP 1045898A2 EP 99904073 A EP99904073 A EP 99904073A EP 99904073 A EP99904073 A EP 99904073A EP 1045898 A2 EP1045898 A2 EP 1045898A2
Authority
EP
European Patent Office
Prior art keywords
cell
cells
transgene
insulin
receptor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99904073A
Other languages
German (de)
English (en)
Inventor
Samuel A. Clark
Anice E. Thigpen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Betagene Inc
Original Assignee
Betagene Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Betagene Inc filed Critical Betagene Inc
Publication of EP1045898A2 publication Critical patent/EP1045898A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0018—Culture media for cell or tissue culture
    • C12N5/0037—Serum-free medium, which may still contain naturally-sourced components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/507—Pancreatic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C12N2500/22—Zinc; Zn chelators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C12N2500/24—Iron; Fe chelators; Transferrin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/32—Amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/38—Vitamins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/40—Nucleotides, nucleosides, bases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/46—Amines, e.g. putrescine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/90—Serum-free medium, which may still contain naturally-sourced components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C12N2510/02—Cells for production
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/70—Polysaccharides
    • C12N2533/74—Alginate

Definitions

  • the present invention relates generally to the fields of biochemistry and engineering of eukaryotic cells. More particularly, it provides compositions and methods for genetically engineering cells for their use in regulated secretion.
  • Diabetes is a long-term, currently incurable disorder that is associated with greatly increased risks for developing additional pathologic conditions resulting from poor glycemic control.
  • the chronic, short-term risks include hypoglycemia, infections, and disorders associated with hyperglycemia such as ketoacidosis.
  • the long-term complications resulting from hyperglycemia can include vascular disease, visual impairment, nephropathy, and neuropathy. Because ofthe high incidence of diabetes, and the irreversible damage that is incurred with many of the associated complications, the cost of treatment surpasses any other single disease in the United States. In 1992, more than $92 billion was spent on direct and indirect costs for treatment with about $37 billion (-40%) of that going to hospital care.
  • diabetes health care In contrast, only a small portion of the costs associated with diabetes health care was for prescription drugs. In 1992, the combined cost of insulin and oral hypoglycemic agents was about $1.2 billion; constituting only 1.3% of total costs (ADA 1996). The relative small portion ofthe diabetes health care budget that is spent on drugs is indicative of two factors: (1) there are relatively few drugs available for the treatment of diabetes, and (2) the drugs that are available are not effective in achieving proper glycemic control and thereby preventing the long-term complications associated with the disease.
  • Insulin was the first therapeutic drug that was prescribed for the treatment of diabetes. It was introduced in 1922 for the treatment of IDDM, and dramatically reduced the mortality rate in this patient population (Joslin Diabetes Manual). Basic insulin replacement therapy has been revised and improved with formulations and purity, and with the provision of recombinant insulin.
  • insulin injection therapy has undesirable side-effects and limitations.
  • the individuals at greatest risk for hypoglycemia are those being treated for diabetes with insulin and sulfonylureas. It is estimated that about 10% of insulin-treated patients experience coma each year, and 25 - 30% have severe hypoglycemia as defined by significant neuroglycopenia. About 4% of deaths in patients with insulin-dependent diabetes mellitus (IDDM) result from hypoglycemia. Because hypoglycemia has potentially devastating short- term consequences, it is the single-most limiting factor in maintaining glycemic control. Insulin- treated patients are as fearful of severe hypoglycemia as they are of advanced diabetic complications such as blindness and kidney failure.
  • IDDM insulin-dependent diabetes mellitus
  • insulin and/or insulin-secretagogues such as the sulfonylurea drugs have an greatly increased risk for hypoglycemia for two reasons.
  • insulin dosing is not optimal with regard to quantity, timing, absorption, and regulation, and secondly, diabetes, and particularly IDDM, often is complicated by a failure of the counter-regulatory system to sense and correct hypoglycemia.
  • This invention is directed towards providing glycemic control in the treatment of diabetes.
  • the present invention provides compositions and methods of comprising engineered human neuroendocrine cell lines having a regulated secretory pathway. Certain aspects of the invention provide glycemic sensing mechanisms to a population of genetically engineered cells.
  • the present invention provides an immortalized neuroendocrine cell that stably secretes a polypeptide hormone, wherein the cell comprises an expression region having a first transgene operably linked to a first promoter active in eukaryotic cells, wherein expression ofthe transgene increases the sensitivity of the cell to a modulator of secretion of the hormone.
  • the modulator is an inhibitor of the secretion of the hormone.
  • the modulator is an activator ofthe secretion of the hormone.
  • the term "regulator” has the same meaning as the term "modulator”.
  • a modulator as used herein is any agent that is able to affect the secretory function ofthe cell. The modulator may inhibit or stimulate the secretion.
  • the inhibitor of the secretion increases the sensitivity of the cell to glucose counter-regulation by a glucose counter-regulatory hormone.
  • the hormone is selected from the group consisting of growth hormone, prolactin, placental lactogen, luteinizing hormone, follicle-stimulating hormone, chorionic gonadotropin, thyroid-stimulating hormone, leptin, adrenocorticotropin (ACTH), angiotensin I, angiotensin II, ⁇ -endorphin, ⁇ -melanocyte stimulating hormone ( ⁇ -MSH), cholecystokinin, endothelin I, galanin, gastric inhibitory peptide (GIP), glucagon, insulin, amylin, lipotropins, GLP-1, neurophysins and somatostatin.
  • growth hormone prolactin, placental lactogen, luteinizing hormone, follicle-stimulating hormone, chorionic gonadotropin, thyroid-stimulating hormone
  • the glucose counter-regulation is mediated by a molecule selected from the group consisting of epinephrine, norepinephrine, pancreatic polypeptide and cortisol.
  • the first transgene is selected from the group consisting of ⁇ 2-adrenergic receptor, somatostatin receptor, pancreatic polypeptide receptor, and glucocorticoid receptor.
  • the first transgene may encode a receptor selected from the group consisting of sulfonyl urea receptor, GLP-1 receptor, muscarinic receptor, GIP receptor, calcium channel receptor, voltage gated receptor.
  • the cell may further comprise a second transgene.
  • the second transgene may be different from the first transgene and selected from the group consisting of ⁇ 2-adrenergic receptor, pancreatic polypeptide receptor, somatostatin receptor and glucocorticoid receptor.
  • the second transgene may encode insulin, GLUT-2 or glucokinase.
  • the cell further comprises a third transgene.
  • the second and third transgenes are (i) insulin and GLUT-2, (ii) insulin and glucokinase or (iii) GLUT-2 and glucokinase.
  • the cell comprises a fourth transgene.
  • the second, third and fourth transgenes are insulin, GLUT-2 and glucokinase.
  • the promoter is a constitutive promoter, an inducible promoter, or a tissue specific promoter.
  • the constitutive promoter is CMV IE.
  • the expression region further comprises a polyadenylation signal.
  • the expression region further comprises a selectable marker gene.
  • the selectable marker gene may be selected from the group consisting of hygromycin resistance, neomycin resistance, puromycin resistance, bleomycin resistance, blasticidin resistance, mycophenolic resistance and zeocin resistance.
  • a second promoter active in eukaryotic cells is located upstream of and operably linked to the selectable marker gene.
  • an IRES is located between the first transgene and the selectable marker.
  • the cell is an insulinoma cell.
  • the insulinoma cell may be a rat insulinoma cell or a human insulinoma cell.
  • the cell is derived from a ⁇ TC, RIN, HIT, BHC, CM, TRM, TRM6, AtT20, PC 12, BG 49/206, BG40/110, BG-H03, BG 498/45, BG 498/20, NCI-H810 (CRL-5816), BON, NES2Y, NCI-H508 (CLL-253), HEPG2 or HAP5 cell.
  • the cell is a pancreatic ⁇ cell
  • the cell is a rat pancreatic ⁇ cell.
  • the cell is a hum.an pancreatic ⁇ cell.
  • the cell is selected from the group consisting of ⁇ G HOI, ⁇ G H02, ⁇ G H03, ⁇ G H04, ⁇ G H05, ⁇ G H06, ⁇ G H07, ⁇ G H08, ⁇ G H09, ⁇ G H10, ⁇ G HI 1, ⁇ G H12, ⁇ G H13, ⁇ G H14, ⁇ G H15, ⁇ G H16, ⁇ G H17, ⁇ G H18, ⁇ G H19, ⁇ G H20, ⁇ G H21, ⁇ G H22, BON and ⁇ G H25.
  • the cell is selected from the group consisting of ⁇ G/498/20, ⁇ G/498/44, ⁇ G/498/45, ⁇ G
  • an immortalized neuroendocrine cell that stably secretes glucagon
  • the cell comprises an expression region having a first transgene operably linked to a first promoter active in eukaryotic cells, wherein expression of the transgene increases the sensitivity ofthe cell to glucose counter-regulation by a glucose counter-regulatory hormone.
  • the glucose counter-regulation is mediated by epinephrine, norepinephrine and vasopressin.
  • the first transgene is ⁇ l-adrenergic receptor, ⁇ -adrenergic receptor or arginine vasopressin receptor.
  • the comprises a second transgene.
  • the second transgene is glucagon.
  • the first transgene is ⁇ -adrenergic receptor and the second transgene is ⁇ l-adrenergic receptor.
  • the cell is further defined as encapsulated in an implantable device.
  • a method of treating a subject with diabetes comprising providing to the subject an immortalized neuroendocrine cell that stably secretes a polypeptide hormone, wherein the cell comprises an expression region having a first transgene operably linked to a first promoter active in eukaryotic cells, wherein expression of the transgene increases the sensitivity ofthe cell to a modulator of secretion ofthe hormone.
  • the modulator is an inhibitor ofthe secretion ofthe hormone.
  • the modulator is an activator of the secretion of the hormone.
  • the inhibitor of the secretion increases the sensitivity of the cell to glucose counter-regulation by a glucose counter-regulatory hormone.
  • the cell comprises a second transgene. More particularly, the second transgene encodes insulin, GLUT-2 or glucokinase.
  • a method of treating a subject with diabetes comprising providing to the subject an immortalized neuroendocrine cell that stably secretes insulin, wherein the cell comprises an expression region having a first transgene operably linked to a first promoter active in eukaryotic cells, wherein expression ofthe transgene increases the sensitivity ofthe cell to glucose counter regulatory hormone.
  • Another embodiment contemplates a method of treating hypoglycemia comprising providing to the subject an immortalized neuroendocrine cell that stably secretes glucagon, wherein the cell comprises an expression region having a first transgene operably linked to a first promoter active in eukaryotic cells, wherein expression of the transgene increases the sensitivity of the cell to glucose counter-regulation by a glucose counter-regulatory hormone.
  • the glucose counter-regulation is mediated by epinephrine, norepinephrine and vasopressin.
  • the hypoglycemia is insulin-induced hypoglycemia. In preferred embodiments, the insulin is injected.
  • a method of providing a cell to an animal comprising providing to the animal an engineered neuroendocrine cell having a regulated secretory pathway to the animal.
  • the cell is a lung, gastrointestinal, pancreatic, pituitary, cecum, colon, thyroid, bladder, insulinoma, neuroectodermal, gastric or hepatic cell.
  • the cell comprises an expression construct comprising a first transgene encoding a therapeutic polypeptide, wherein the transgene is under the transcriptional control of a first promoter.
  • the cell is or ⁇ G H04.
  • the cell is selected form the group consisting of ⁇ G 498/20, ⁇ G 498/44, ⁇ G 498/45, ⁇ G 793/28 and ⁇ G 796/15.
  • the transgene encodes a selectable marker.
  • the transgene encodes a therapeutic protein.
  • the therapeutic protein is selected from the group consisting of a hormone, an amidated polypeptide, a growth factor and a secreted enzyme.
  • the expression construct further comprises a second transgene that encodes a selectable marker.
  • the transgene encodes a hormone selected from the group consisting of growth hormone, prolactin, placental lactogen, luteinizing hormone, follicle- stimulating hormone, chorionic gonadotropin, thyroid-stimulating hormone, leptin, adrenocorticotropin (ACTH), .angiotensin I, angiotensin II, ⁇ -endorphin, ⁇ -melanocyte stimulating hormone ( ⁇ -MSH), cholecystokinin, endothelin I, galanin, gastric inhibitory peptide (GIP), glucagon, insulin, amylin, lipotropins, GLP-1, neurophysins and somatostatin.
  • a hormone selected from the group consisting of growth hormone, prolactin, placental lactogen, luteinizing hormone, follicle- stimulating hormone, chorionic gonadotropin, thyroid-stimulating hormone, leptin, adrenocorticotropin (ACT
  • the cell secretes insulin in response to glucose.
  • the expression of the first transgene increases the sensitivity of the cell to glucose counter-regulation by a glucose counter-regulatory hormone.
  • the glucose counter-regulation is mediated by epinephrine, norepinephrine, glucocorticoids, pancreatic polypeptide and vasopressin.
  • the regulated secretory pathway has a secretory function that is dependent on a regulator wherein the regulator is selected from the group consisting of calcium ions, cAMP, calmodulin, phosphorylation, dephosphorylation, membrane polarization, triglycerides, NO, NADH, glucose, ATP, ADP, fatty acids and NADPH.
  • the cell is responsive to a modulator of secretion. It is contemplated that the modulator may inhibit the secretion or alternatively may stimulate the secretion. It is specifically contemplated that the cell may be non-responsive to modulators of secretion.
  • the first transgene encodes an exogenous receptor.
  • the receptor may be selected from the group consisting of ⁇ -adrenergic receptor, ⁇ -adrenergic receptor, potassium inward rectifying channel, sulfonylurea receptor, GLP-1 receptor, growth hormone receptor, arginine vasopressin receptor, luteinizing hormone receptor, corticotropin receptor, urocortin receptor, pancreatic polypeptide receptor, glucocorticoid receptor, somatostatin receptor, muscarinic receptor, calcium channel, voltages-gated channel, BK channel and leptin receptor.
  • the transgene encodes a growth factor
  • it may be selected from the group consisting of epidermal growth factor (EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), vascular endothelial cell growth factor (VEGF), transforming growth factor- ⁇ (TGF- ⁇ ), hepatocyte growth factor (HGF) and insulinlike growth factor 1 (IGF-1).
  • EGF epidermal growth factor
  • PDGF platelet-derived growth factor
  • FGF fibroblast growth factor
  • VEGF vascular endothelial cell growth factor
  • TGF- ⁇ transforming growth factor- ⁇
  • HGF hepatocyte growth factor
  • IGF-1 insulinlike growth factor 1
  • the transgene encodes an amidated polypeptide selected from the group consisting of calcitonin, calcitonin gene related peptide (CGRP), ⁇ -calcitonin gene related peptide, hypercalcemia of malignancy factor (1-40) (PTH-rP), parathyroid hormone- related protein (107-139) (PTH-rP), parathyroid hormone-related protein (107-111) (PTH-rP), cholecystokinin (27-33) (CCK), galanin message associated peptide, preprogalanin (65-105), gastrin I, gastrin releasing peptide, glucagon-like peptide (7-36 amide) (GLP-l(7-36 amide)), pancreastatin, pancreatic polypeptide, peptide YY, PHM, secretin, vasoactive intestinal peptide (VIP), oxytocin, vasopressin (AVP), vasotocin, enkephalins
  • the transgene encodes GLP-1 (7-36 amide).
  • the transgene encodes a secreted enzyme selected from the group consisting of adenosine deaminase, galactosidase, glucosidase, lecithinxholesterol acyltransferase (LCAT), factor IX, sphingolipase, lysosomal acid lipase, lipoprotein lipase, hepatic lipase, pancreatic lipase related protein, pancreatic lipase and uronidase.
  • the transgene encodes LCAT.
  • the selectable marker is selected from the group consisting of hygromycin phosphotransferase resistance, neomycin phosphotransferase resistance, blasticidin deaminase, puromycin acetyltransferase resistance, bleomycin resistance, mycophenolic resistance, zeocin, guanisin phosphoribosyl transferase (gpt), dihydrofolate reductase (DHFR), and histadinol dehydrogenase.
  • the selectable marker is a negative selectable marker selected from the group consisting of cytosine deaminase, HSV-thymidine kinase, GLUT-2 and nitroreductase.
  • the second transgene that encodes the selectable marker is flanked by LoxP sites.
  • the cell comprises a second expression construct comprising a transgene that encodes a selectable marker, wherein the transgene is under the tianscriptional control of a second promoter.
  • the promoter is selected from the group consisting of the CMV, SV40 IE, RSV LTR, GAPHD, MMLV-LTR and RIPl promoters.
  • the cell is cytokine resistant.
  • the cell is encapsulated in a biocompatible coating or placed in a selectively permeable membrane in a protective housing.
  • the expression construct is a viral vector and the providing is achieved by viral infection.
  • the expression construct is formulated in a liposome and the providing is achieved by cellular uptake of the liposome.
  • the viral vector is selected from the group consisting of a retroviral, adenoviral, vaccinia viral, lenteviral, herpesviral and adeno-associated viral vector.
  • Also provided is a method of providing a polypeptide to an animal comprising providing to the animal an engineered human neuroendocrine cell that has a regulated secretory pathway, wherein the cell expresses a first polypeptide.
  • the cell is contacted with an expression construct comprising a transgene operably linked to a promoter functional in eukaryotic cells, wherein the tr.ansgene encodes the polypeptide.
  • Also contemplated is a method of providing insulin to an animal in need of insulin comprising providing to the animal a first engineered human neuroendocrine cell that has a regulated secretory pathway, wherein the cell expresses a gene encoding insulin.
  • the cell secretes insulin in response to glucose.
  • the cell further comprises a hexokinase IV transgene or a GLUT-2 transgene.
  • the insulin is provided by contacting the cell with an expression construct comprising an insulin- encoding gene operably linked to a promoter functional in eukaryotic cells.
  • the method further comprises providing a second polypeptide.
  • the cell expresses a second polypeptide.
  • the second polypeptide may be selected from the group consisting of a hormone, a receptor, an amidated polypeptide, a receptor, a selectable marker and a growth factor.
  • the genes for the insulin and the second polypeptide are separated on the same polynucleotide by an internal ribosome entry site.
  • the animal is a human.
  • the cell expresses human insulin.
  • Another aspect of the present invention provides a method of treating diabetes in an animal comprising providing to the animal a therapeutically effective amount of a cell population of engineered human neuroendocrine cells that have a regulated secretory pathway, wherein the cells express .an insulin-encoding transgene.
  • the cell is contained within a selectively semi-permeable device, the device being connected to the vasculature ofthe animal.
  • the cell population is positioned into a selectively permeable membrane within .an implantable device.
  • the biocompatible coating is a semi- permeable capsule.
  • the cell population is microencapsulated.
  • the cell population is encapsulated in a hydrogel coating.
  • the cell population is encapsulated in an alginate coating.
  • the cell population is fiber seeded into a semi-permeable fiber.
  • the cell population is positioned in a tubular semi-permeable membrane positioned within a protective housing.
  • each end of the tubular membrane is attached to an arterial graft that extends beyond the housing and joins the device to a vascular system as a arteriovenous shunt.
  • a biocompatible device comprising a cell population of engineered human neuroendocrine cells having a regulated secretory pathway.
  • the cell population is contained within a selectively permeable device, the device being connectable to the vasculature of an animal.
  • the cells secrete a polypeptide selected from the group consisting of a hormone, an amidated polypeptide, and a growth factor.
  • the cells comprise a transgene encoding the polypeptide.
  • the cells secrete insulin in response to glucose.
  • Another aspect ofthe present invention provides an engineered human cell line that has a regulated secretory pathway, the cell comprising a transgene encoding a therapeutic polypeptide.
  • the transgene is introduced to the cell by contacting the cell with an expression construct comprising the gene operably linked to a promoter functional in eukaryotic cells.
  • the cell is selected from the group consisting of ⁇ G/498/20, ⁇ G/498/44, ⁇ G/498/45, ⁇ G 636/17 and ⁇ G 636/11.
  • FIG. 1 Multiple signaling pathways are involved in the regulation of insulin secretion. Insulin secretion is regulated by fuels .and hormones, and is subject to regulation as well by synthetic compounds. The various modulators exert effects via specific cell surface receptors, metabolic pathways, and ion fluxes. Most changes in secretion are mediated through changes in intracellular calcium.
  • FIG. 2. Schematic summary of how engineered cell lines can facilitate in vitro and in vivo testing of candidate compounds that modulate insulin secretion. Compounds can be screened for their effects on secretory function using primary islets, enriched populations of beta cells, and engineered cell lines. Information from these screens can be used to elucidate potentially novel drug targets and to enrich for compounds that impact secretory function. Encapsulated cells can be transplanted into rodents or other mammals for pre-clinical in vivo testing of candidate compounds.
  • FIG. 3 Engineered beta-cell lines respond to a variety of secretagogues.
  • ⁇ G 49/206 cell lines were plated, cultured for 48 hrs, rinsed and washed two times (20 min. each) in HEPES Buffered Biological Salt Solution (HBBSS).
  • HBBSS HBBSS supplemented with secretagogue(s) was added to each well and allowed to incubate for 2 hours.
  • Medium was harvested from each well, assayed for insulin, and the amount of insulin secreted per hour, normalized to cell number, was determined. Normalization for cell number was achieved by staining with the neutral red, a viability dye.
  • FIG. 4 The response of engineered ⁇ -cell lines to secretagogues is stable over time and population doublings.
  • ⁇ G 49/206 cells were tested for stability of secretogogue responsiveness by monitoring insulin secretion over several population doublings (PD) ranging from PD12 to PD105.
  • PD population doublings
  • Cells were plated, cultured for 48 hrs, .and washed two time (30 min. each) in a HBBSS. Insulin secretion was stimulated with glucose alone (Basal +) or in the absence or presence of glucose (presence indicated by "+") with IBMX.
  • the stimulatory cocktail contains a mixture of secretagogues (BetaGene media supplemented with 10 mM glucose, 10 M glutamine, leucine, and arginine, lOO ⁇ M carbachol, and lOO ⁇ M IBMX).
  • FIG. 5 Secretagogue-stimulated insulin secretion of engineered RIN cell lines is maintained in microbeads.
  • ⁇ G 49/206 cells were encapsulated in 50 ⁇ l alginate beads, cultured in BetaGene medium for 72 hrs, and tested for secretagogue-responsive insulin secretion. Following washes in HBBSS, cells were stimulated with glucose, glucose plus IBMX, or a Stimulatory Cocktail (BetaGene supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, lOO ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES). As shown, glucose plus IBMX resulted in an 8-fold stimulation in insulin secretion, which is comparable to the fold stimulation observed with adherent cultures.
  • FIG. 6 Engineered RIN cells retain secretory responsiveness in a 96-well format. ⁇ G
  • 49/206 cells were plated and assayed in 48-well dishes (100,000/well) as described in the legend to FIG. 3.
  • 30,000 ⁇ G 49/206 cells were plated and cultured for 48 hrs. in 150 ⁇ l of BetaGene Medium/ 2.5% FCS; washed twice, 20 min each, in 200 ⁇ l in HBBSS, and cells stimulated with glucose or glucose plus IBMX.
  • FIG. 7 Overexpression of the alpha2-adrenergic receptor in RIN cell lines confers an increased sensitivity to Clonidine in vitro.
  • ⁇ G 265/2 .and ⁇ G 265/4 cell lines that overexpress transgenic alpha2-adrenergic receptor, were compared to the parental cell line ( ⁇ G 18/3E1) for the capacity of Clonidine to inhibit stimulated insulin secretion.
  • Cell lines were plated, cultured for 48 hrs, .and washed two times (30 min. each) in a basal medium (RPMI medium/ without glucose/0.5% BSA/ 20 mM HEPES/ 100 ⁇ m diazoxide).
  • Clonidine was potently inhibitory of stimulated insulin secretion in both the ⁇ G 265/2 and ⁇ G 265/4 cell lines resulting in a 60% and 30% reduction, respectively.
  • the parental ⁇ G 18/3E1 cell lines was resistant to the inhibitory effects at all concentrations of Clonidine tested.
  • FIG. 8 Engineered RIN cell lines that express transgenic alpha2-adrenergic receptor are more sensitive than human islets to Clonidine. ⁇ G 265/2 cells and human islets were encapsulated in alginate microbeads and stimulated to secrete insulin in 0, 1, 10, 100, or 1000 nM Clonidine. Washes and stimulations were performed as described in the legend to FIG. 7. At 10 nM Clonidine, human islets were refractory to Clonidine; whereas, insulin secretion from ⁇ G 265/4 cells was inhibited by about 35%.
  • FIG. 9 Overexpression of the alpha2-adrenergic receptor in RIN cell lines confers an increased sensitivity to Clonidine in vivo.
  • ⁇ G 265/2 cell lines were encapsulated in alginate beads and injected intraperitoneally (IP) into Zucker diabetic, fatty rats. Following 4-5 days of in vivo growth and normalization of blood glucose, rats were injected IP with Clonidine (50 ⁇ g/kg), or Yohimbine (75 ⁇ g/kg). 20 minutes post-injection blood samples were taken to determine the levels of human insulin and rat C-peptide in the plasma. Yohimbine had no effect on human insulin or rat C-peptide levels. Clonidine injection resulted in a 50% reduction of human insulin and rat C-peptide in plasma.
  • FIG. 10A and FIG. 10B Engineered beta-cell lines lose stimulated insulin secretion, but maintain basal insulin secretion in the absence of fetal bovine serum.
  • FIG. 10A ⁇ G 18/3E1 cells were encapsulated in alginate and maintained for one week in culture in BetaGene medium with or without FBS supplement. Beads were washed with basal medium and treated with a cocktail (BetaGene supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, 100 ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES) to stimulate insulin secretion.
  • a cocktail BetaGene supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, 100 ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES
  • FIG. 10B compares the effects of different lots of BetaGene Medium and FBS on cellular growth. As shown, lots 7E183 is equivalent to lot 7H3299 with respect to support of cellular growth, and 9 days of FBS-depletion diminishes growth ofthe cells by 10 - 20%.
  • FIG. 11A and FIG. 11B Over-expression of somatostatin receptor (SSTRV) in ⁇ G
  • SS-28 somatostatin
  • a cell line expressing high levels of the tr.ansgenic SSTRV receptor ( ⁇ G 603/11) was compared to a non-expressing cell line, ⁇ G 603/7 (FIG. 11A).
  • 50 pM SS-28 was potently inhibitory of glucose-stimulated insulin secretion from ⁇ G 603/11 , but had no effect on ⁇ G 603/7 insulin secretion.
  • Secretion studies were performed with HBBSS supplemented with varying concentrations of SS-28 in the absence or presence of 10 mM glucose. As shown in FIG.
  • 5 nM SS-28 inhibits insulin secretion from ⁇ G 603/11 when cells were stimulated with BetaGene Medium in the absence of glucose and in a stimulatory cocktail (BetaGene Media supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, lOO ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES).
  • FIG. 12A and FIG. 12B Efficient processing of overexpressed human proinsulin in engineered human neuroendocrine cells. Immunoreactive insulin was measured from HPLC- fractionated samples prepared from ⁇ G 498/20. Peaks were identified by migration position of standards.
  • FIG. 12A is the analysis of insulin content extracted from the cells
  • FIG. 12B is the analysis of insulin secreted into the media.
  • FIG. 13A and FIG. 13B Regulated secretion from engineered human cell lines.
  • Insulin secretion from ⁇ G 498/20 was measured in a two hour static incubation assay at basal conditions (0 mM) or stimulated conditions: 10 mM glucose (10 mM); 10 mM glucose + 100 ⁇ M IBMX (IBMX + lOmM); 100 ⁇ M carbachol (carb); 100 ⁇ M carbachol + 10 mM glucose (carb + 10 mM); 10 nM PMA (PMA); 10 nM PMA + 10 mM glucose (PMA + glucose); RPMI Medium + 100 ⁇ M diazoxide + BSA (RPMI + Diaz); or a stimulatory cocktail (RPMI medium supplemented with 10 mM glucose; BSA; 10 mM each arginine, leucine, glutamine; 100 ⁇ M carbachol, and 100 ⁇ M IBMX).
  • 10 mM glucose 10 mM
  • 10 mM glucose + 100 ⁇ M IBMX IBMX + lOmM
  • cell line ⁇ G 498/45 created by transfection of BG H03 with a plasmid conferring resistance to neomycin and encoding human insulin
  • 793, 794, and 796 cell lines are resistant to mycophenolic acid, puromycin, and hygromycin, respectively.
  • the data show the presence of a regulated secretory pathway in the progenitor cell line (498/45) and the maintenance of this capacity through a second round of engineering (793, 794, .and 796 cell lines).
  • the increase in stimulated secretion over basal secretion ranges from about 6- to 15-fold among the various clones.
  • FIG. 14A, FIG. 14B, and FIG. 14C Correction of Diabetes in Rodents.
  • Unengineered, parental cells ( ⁇ G H03) or low doses of ⁇ G 498/20 cells failed to affect hyperglycemia.
  • doses of ⁇ G 498/20 ranging from 15 to 25 million cells per 100 gm body weight completely corrected hyperglycemia in nude and immune-competent hosts; and i lDDM and NIDDM.
  • FIG. 15 Human C-peptide levels in the serum of rats implanted with ⁇ G 498/20 or the parental ⁇ G H03 correlate with cell number. As shown, implantation of ⁇ G 498/20 cells into STZ-diabetic Wistar rats elevates human C-peptide levels in the serum with the highest dose of cells (25 million/ 100 gm body weight) producing the highest level of serum human C-peptide levels for the longest period of time. The drop in C-peptide to levels below about 3 ng/ml with both cell doses of ⁇ G 498/20 correlate with increases in blood glucose shown in FIG. 14B. ⁇ G H03 cells do not produce detectable levels of human C-peptide.
  • FIG. 16A and 16B Implantation into diabetic rodents with ⁇ G 498/20 cells improves glucose tolerance. Following an overnight fast, animals were given a glucose bolus, and blood glucose levels were monitored. As shown both STZ-treated Wistar rats (FIG. 16A) and ZDF rats (FIG. 16B) show a dose dependent improvement in glucose tolerance when implanted with ⁇ G 498/20 versus implants with the unengineered parental cell line, ⁇ G H03.
  • FIG. 17A and 17B Cell-based delivery of insulin via encapsulated ⁇ G 498/20 cells reduces glycated hemoglobin (GHb) in diabetic rodents.
  • STZ-treated Fisher nudes (FIG. 17A) or STZ-treated Wistar rats (FIG. 17B) that were implanted with ⁇ G 498/20 cells experienced about 58% and 33% reduction, respectively, in % glycated hemoglobin as compared to control diabetic animals implanted with the unengineered parental cell line ⁇ G H03.
  • FIG. 18A and FIG. 18B ⁇ G H03 and ⁇ G 498/20 cells are resistant to the effects of cytokines.
  • FIG. 18 A ⁇ G H03 and ⁇ G 498/20 cells were incubated in BetaGene medium supplemented with various human cytokines as indicated for 48 hours. Tested cytokines had no impact on viability as assessed by comparing cytokine- treated cultures to untreated controls.
  • FIG. 18B ⁇ G 498/20 cells were tested for the maintenance of secretory function in presence of cytokines (IL-lb 15 ng/ml; IFN 200 units/ml; TNF ⁇ and TNF ⁇ each at 10 ng/ml).
  • Insulin secretion was stimulated by incubating the cells in HBBSS containing 0.1% BSA and supplemented with 10 mM glucose, or 10 mM glucose plus either 100 ⁇ M carbachol or 10 nM PMA.
  • Two sets of cultures were exposed to cytokines for 24 hours, prior to secretion studies (24h cytokines, .and 24h cytokines + HBBSS + cytokines); .and two sets of cultures were supplemented with cytokines for the 2 hr secretion period (HBBSS + cytokines, and 24h cytokines + HBBSS + cytokines).
  • the control culture (HBBSS) was not exposed to cytokines.
  • the secretory function of ⁇ G 498/20 cells was unaffected by short or long-term exposure to cytokines.
  • FIG. 19 Engineered ⁇ G H04 fail to secrete insulin from the regulated secretory pathway.
  • Transgenic CMV-insulin/ SV40-Neo
  • clonal derivatives of ⁇ G H04 known to secrete hum.an insulin were tested for the capacity to secrete human insulin from the regulated secretory pathway.
  • basal conditions HBSS with no glucose
  • stimulated conditions HBSS + 25 mM KC1 + 2.5 mM Forskolin + 50 ⁇ M IBMX
  • the ⁇ G H04 clones 707/55, 707/63, 707/76, 707/94, and 707/96.
  • the clonal line derived from ⁇ G H03 there was a robust response to the aforementioned secretagogue cocktail, with about a 5 -fold difference between basal and stimulated secretion.
  • FIG. 20 Major components of the counter-regulatory and sympathetic responses to hypoglycemia.
  • Sympathetic activation involves both stimulation of adrenaline secretion from the adrenal medulla, and increased release of noradrenaline (and adrenaline) from sympathetic nerve endings, which act directly in sympathetically innervated tissues (e.g. the liver and arterioles) and also spill over into the circulation.
  • Vasopressin has weak counter-regulatory effects on its own, but acts synergistically with the other hormones (figure adapted from "Textbook of Diabetes", 2nd. Edn. John C. Pickup and Gareth William Eds., Blackwell Sciences, Publ., 1997).
  • FIG. 21 General mechanisms for modulating secretion from the regulated secretory pathway.
  • secretion from the regulated secretory pathway can be modulated by the transgenic expression of cellular proteins that act as positive regulators of secretion (oval with a "+”) or negative regulators (oval with "-").
  • cellular proteins that act as positive regulators of secretion (oval with a "+") or negative regulators (oval with "-”).
  • Typically such proteins function as receptors at the cell surface.
  • Each class of receptor is subject to activation (ACT.) or inhibition (INH.) of activity by the binding of receptor-specific ligands, and such ligands can be physiological or pharmacological agents.
  • the modulation in receptor activity by ligand binding is tianslated through intracellular signaling to stimulate or inhibit the secretion of peptide hormones from the regulated secretory pathway.
  • FIG. 22 A Two-Step method for creating human neuroendocrine cell lines.
  • Primary tissues such as human islets; or neuroendocrine tumors, such as insulinomas, can be induced to proliferate through transgenic expression of growth-promoting proteins.
  • a preferred protocol for such engineering is to selectively direct gene expression with the use of tissue-specific promoters and to provide transgenes via infection with recombinant adenovirus.
  • the cell population of interest is subject to enhanced rates of immortalization via infection with recombinant retroviruses.
  • FIG. 23 Total insulin release from a human insulinoma.
  • a freshly excised human insulinoma, about 1 cm was processed and initially plated into two tissue culture wells, 9.6 cm each. The cells that survived were subsequently aliquoted into a variety of culture conditions. At the times indicated, tissue culture media samples were obtained from each of the cell samples, and insulin was measured by RJA. The insulin output from the different samples was summed to give total output.
  • FIG. 24 Maintenance of human islets in BetaGene Medium supplemented with various concentrations of glucose. . Islets were cultured in BetaGene Medium with 3.9, 7.8 and 22 mM glucose for A2 weeks. The secretory responses to glucose concentrations of 3.9 mM, 22 mM and 22 mM +50 ⁇ M IBMX were then compared. Although lower glucose was less deleterious than the higher concentration, both resulted in impaired secretory response.
  • FIG. 25 Maintenance of human islets in BetaGene Medium supplemented with various concentrations of fetal bovine serum.
  • the serum requirements of human islets were tested in long term (2 month) cultures supplemented with various amounts of serum, 1%, 3.5%, or 10%) FBS and 5% horse serum (ES).
  • ES horse serum
  • insulin secretion from islets cultured in 10% FBS exhibited lower response to glucose or to a stronger mixed secretagogue stimulus.
  • the sustained insulin output from human islets with 1% FBS supplementation suggested that human islets also may secrete insulin and survive under serum-free conditions
  • FIG. 26 Comparison of commonly used medias to BetaGene Medium in the maintenance of human islets. Islets were cultured for 2-3 months with BetaGene Medium, Medium 199, alpha MEM, or CMRL, all with equivalent glucose, and 0.1 % BSA. In four independent islet isolations the insulin output was the highest with islets cultured in BetaGene Medium. In contrast, CMRL performed the poorest, essentially with no islet survival past 2 months with all 4 isolations studied.
  • FIG. 27 Long-term culture of human islets in BetaGene Medium restores and maintains glucose-stimulated insulin secretion.
  • the capacity of BetaGene Medium to sustain the dose-responsive nature of the insulin secretory response was evaluated with continuous cultures. Human islets were stimulated with varied glucose concentrations at intervals to monitor secretory changes that may occur with time. A common finding was an initially poor response (shown at 1 week), with increased function with time of culture in BetaGene Medium (6 weeks and 13 weeks), and a maintained capability to secrete insulin in response to glucose for times >4 months.
  • FIG. 28A and 28B Processing of proinsulin to mature insulin is enhanced by culturing human islets in BetaGene Medium. Insulin content was extracted from HI21 and fractionated by HPLC. Initially, 99% of the insulin was unprocessed insulin, with only 29 ng mature insulin/1000 IEQ (FIG. 28 A). The mature insulin content was increased 18-fold to 512 ng/lOOOIEQ after 4 weeks of culture in BetaGene Medium; this represents >90% of the insulin content (FIG. 28B).
  • FIG. 29A and FIG. 29B Modified RIP activity in transiently transfected RIN cells.
  • FIG. 29A A schematic representation of the types of modified RIP promoters.
  • FIG. 29B Modified RIP promoter - human growth hormone (hGH) constructs were transiently transfected into RIN cells. After 48 to 96 hours, hGH protein levels in the medium were determined by a radioimmunoassay. As shown in the figure, the modified RIP promoters, FFE3/-415RIP and FFE6/-415RIP, were approximately 5-fold stronger than the RIP (-415RIP) promoter by itself.
  • hGH human growth hormone
  • FIG. 30A, FIG. 30B and FIG. 30C Modified RIP activity in stably transfected RIN cells.
  • the CMV promoter, RIP promoter, and several modified RIP promoters were fused to insulin and were stably transfected into RIN cells.
  • FIG. 30 A Insulin mRNA levels for each promoter construct were determined by Northern blot and quantitated with a phosphoimager. Cyclophilin mRNA levels were also determined by a phosphoimager as a control for Northern blot loading differences.
  • FIG. 30B Insulin protein levels secreted into the culture medium were determined by a radioimmunoassay.
  • FIG. 30C The CMV promoter, RIP promoter, and several modified RIP promoters were fused to insulin and were stably transfected into RIN cells.
  • FIG. 30 A Insulin mRNA levels for each promoter construct were determined by Northern blot and quantitated with a phosphoimager. Cyclophilin mRNA levels were
  • Insulin protein levels within the cell were determined by a radioimmunoassay after breaking open the cells by sonication. In all three cases, be it insulin mRNA levels, secreted insulin protein, or insulin protein content inside the cell, the modified RIP promoters were significantly stronger than the RIP promoter by itself. The FFE6 modified RIP promoters approach the activity ofthe very strong CMV promoter.
  • FIG. 31 Mitogenic signal pathways in ⁇ -cells. Mitogenic pathways are shown for insulin-like growth factor- 1 (IGF-1) and for growth hormone (GH).
  • IGF-1 insulin-like growth factor- 1
  • GH growth hormone
  • the IGF-1 /IGF-1 receptor complex can signal cell mitogenesis via two pathways but in ⁇ cells it does so primarily through the IRS pathway. Mitogenic stimulation of ⁇ cells by GH is through the JAK/STAT pathway.
  • FIG. 32 IGF-1 stimulation of ⁇ cell growth in the presence of increasing glucose concentrations IGF-1 (10 nM) was added to INS1 cells incubated at different glucose concentrations. As judged by [ H]-thymidine incorporation glucose alone can initiate INS1 cell growth in a dose-dependent manner reaching a maximum of approximately 10-fold at 18 mM glucose. The effect of glucose on INS1 cell growth is potentiated by IGF-1 reaching a maximum of INS 1 cell growth at 15mM glucose.
  • FIG. 33 Growth hormone stimulation of ⁇ cell growth in the presence of increasing glucose concentrations.
  • rGH (lOnM) was added to INS1 cells incubated at different glucose concentrations.
  • the action of rGH like that of IGF-1, requires a background of glucose to exert its effects.
  • the rGH has little effect on cell growth until a threshold of 6mM glucose and reaches a maximum at 15 mM glucose where there is an approximately 50-fold increase in [ 3 HJ- thymidine incorporation over that at 0 mM glucose.
  • FIG. 34 Additive effects of IGF-1 and rGH on ⁇ cell growth.
  • INS1 cells were incubated with either 10 nM IGF-1 alone, lOnM rGH alone, or both lOnM IGF-1 and lOnM rGH at increasing glucose concentrations.
  • both IGF-1 and rGH potentiate the effect of glucose on INS 1 cell growth to approximately the same degree.
  • An additive effect on cell growth is observed when both growth factors are added to INS1 cells at the same time.
  • FIG. 35 Adenoviral overexpression of IRS-1, IRS-2, and SV40 large T-antigen in
  • INS1 cells INS1 cells.
  • INS1 cells were infected with either AdV- ⁇ Gal, AdV-IRS-1, AdV-IRS-2, or AdV- largeT-antigen (Tag) for 1 hour. After 1 hour, the cells were washed and incubated another 24 hours.
  • IGF-1 (10 nM) was added to the INS1 cells in the presence of either 3 mM or 15 mM glucose.
  • Adenoviral-mediated overexpression of IRS-2 in INS 1 cells in the presence of 10 nM IGF-1 and 15 mM glucose resulted in an approximately 200-fold increase in [ H]-thymidine incorporation compared to uninfected cells plus no glucose.
  • FIG. 36 BetaGene Medium enhances growth of an engineered, human neuroendocrine cell line.
  • the BG785/5 cell line was derived from BGH04 cells which were derived and routinely cultured in RPMI w/FBS. The growth rate of BG785/5 cells in BetaGene and RPMI media, with FBS or SF, is shown.
  • FIG. 37 BetaGene Medium enhances secretory function of an engineered, rodent neuroendocrine cell lines (BG170-hGH).
  • the hum.an growth hormone (hGH) output of cells grown in BetaGene Medium with FBS was approx. 5 times greater than growth hormone output from cells in RPMI w/FBS.
  • the hGH output of BetaGene Medium w/SF was more than 5 times that of RPMI w/SF.
  • BetaGene Medium maintains secretory function of BG 18 E1 cell line.
  • the insulin secretory function of BG18/3E1 cells was maintained when cells were cultured in BetaGene Medium supplemented with 5%, 2%, or 1% FBS.
  • the secretory impairment at plateau phase under these conditions may be due to decreased biosynthesis or processing of insulin rather than an impairment of secretion.
  • FIG. 39 Growth in BetaGene Medium maintains regulated secretion from the BG
  • BetaGene supplemented with minerals, minerals and amino acids, amino acids, or 2% FBS The ability to respond to a secretagogue cocktail is shown for various SF- and 2% FBS- supplemented cultures in BetaGene Medium. This demonstrates that the capability of the regulated secretory pathway has been maintained, only the absolute output has been affected in both unstimulated and stimulated states, while the fold response is maintained.
  • FIG. 40 BetaGene Medium enhances production of GLP-1 from an engineered, rodent neuroendocrine cell line.
  • the capability of BetaGene medium to sustain processing and secretion of a peptide that yields proteolytically cleaved and amidated products was evaluated by measuring GLP-1 (amidated and non-amidated) production.
  • FIG. 41 Ascorbate-2-phosphate supplemented media enhances insulin production of an engineered human neuroendocrine cell line.
  • a suspension culture of BG498/45 cells (PD33) were plated in varying concentrations of ascorbate or A-2-P. Samples were collected for insulin assay and medium changed after 2 and 5 days of culture. In the initial 2 days of culture ascorbate altered insulin output by reducing insulin about 20%, only at the highest concentration. In the final 3 days cells, high concentrations of ascorbate were cytotoxic, while A400 ⁇ M concentrations of both ascorbate and A-2-P enhanced insulin secretion. The highest concentration of A-2-P did not inhibit insulin output.
  • FIG. 42 Media supplementation with ascorbate-2-phosphate can effect increased amidation activity with cultured cells.
  • Production of .amidated and nonamidated GLP1 was determined by immunoassay of secreted cell products from cells cultured 1 day in RPMI medium (with 2% FBS) supplemented with varying concentrations of A-2-P.
  • the dose-response shows half-max. and maximal amidation activity with Al .and 10-100 ⁇ M of A-2-P.
  • the amount of amidated GLP-1 plateaued from 25-1000 ⁇ M. Concentrations of 10 mM consistently (4 separate experiments) resulted in slight decreases in amidated GLP-1, with a similar tendency to reduce non-amidated GLP-1 output.
  • FIG. 43 Optimal Copper Concentration for PAM Activity.
  • BG191/26 cell monolayers in T25 flasks were changed to RPMI medium ⁇ copper, or BG Medium ⁇ additional copper (the latter medium contains 5 nM copper).
  • Medium samples were collected after 24 h and the GLP-1 species were separated and quantified by HPLC.
  • the results show that supplementing RPMI (which has no copper in its formulation) increases the output of amidated GLP-1.
  • Further supplementation of BG medium with copper to 250 and 500 nM does not increase amidated GLP-1, whereas 1 ⁇ M copper tends to decrease amidated GLP-1.
  • FIG. 44 Lack of Cytotoxic Effect of ascorbate-2-phosphate on Primary Human Islets.
  • Human islets encapsulated in alginate beads were set up in 24 well plates with A50 islet equivalents/well and cultured in BetaGene Medium with or without added A-2-P and copper.
  • Secretory function and glucose-sensing was determined by incubating the islets with different concentrations of glucose for 90 minutes (from 2.2 to 22 mM). This glucose dose-response test was performed immediately before adding ascorbate to the cultures and at 2 week intervals. In the first 2 weeks 500 ⁇ M A-2-P, and 1 ⁇ M copper was supplemented. In the second 2 weeks ascorbate was increased to 2 mM, copper was kept at 1 ⁇ M.
  • A-2-P did not impair function as indicated by sensing of glucose, and the maintenance of maximal insulin secretion indicates that there is minimal toxicity of A-2-P for these culture times.
  • FIG. 45 Two sequential rounds of bulk culture growth, bulk cryopreservation, and thaws do not alter secretory function. ⁇ G18/3El cells which had been grown in bulk cultures were tested for maintained secretory performance. This was determined by assaying insulin secretory response (y-axis) to a secretagogue cocktail ("Swiss") after (x-axis): one bulk culture production and one freeze/thaw (Cl F/T); at harvest after one bulk culture production (Cl PostBulk); at seeding of second bulk culture after one bulk and one freeze/thaw (Cl Seed C2); harvest from second bulk culture (Post C2); and after second bulk culture and second bulk freeze and thaw (C2 F/T). Insulin secretory response from these cells was unaltered by bulk culture and freezing; neither unstimulated (Basal) nor secretagogue-induced (“Stim”) secretion was altered.
  • Basal unstimulated
  • Stim secretagogue-induced
  • FIG. 46 Insulin output of cells in defined Betagene Medium. Comparison of insulin output from encapsulated ⁇ G18/3El cells in defined BetaGene Medium ( ⁇ GM) with output of cells in BetaGene Medium supplemented with FBS ( ⁇ BM+) or select media with and without FBS. Aginate-encapsulated ⁇ G18/3El cells were cultured in 24 well plates in BetaGene Medium without ( ⁇ GM) or with FBS ( ⁇ GM+); in MEM without (MEM) or with FBS (MEM+); in a mixture of F12 and MEM without (F12/MEM) or with (F12/MEM+) FBS. Media samples were collected at intervals and assayed for insulin, and growth was determined by assay of viable cell mass terminally.
  • MEM+ was 50+5% of ⁇ GM+ and F12/MEM+, which were equivalent; MEM was ⁇ 10%, F12/MEM was 50+5%, and ⁇ GM was 80+8%. Insulin output of ⁇ GM+ was the best, with F12/MEM+ and ⁇ GM essentially equivalent.
  • FIG. 47 Switching cells to Defined BetaGene Medium increases insulin output. A portion of unsupplemented cultures of ⁇ G18/3El cells of figure 46 were continued an additional 3 days. Half of the cells cultured in F12/MEM (no FBS) were switched to defined ⁇ GM for the final 3 days. Switching to defined BetaGene Medium more than doubled insulin output, indicating that BetaGene Medium can compensate for insufficiencies of other defined media.
  • IDM Insulin-dependent diabetes mellitus
  • the present invention provides an engineered human neuroendocrine cell having a regulated secretory pathway. More particularly, the engineered cell is a derived from a human lung carcinoma known as ⁇ G H03 and is shown herein to have potential as the long-sought candidate for an appropriate human cell line for allotransplantation. A number of established human cell lines were examined as potential starting materials for the cell-based delivery of insulin and other peptide hormones.
  • ⁇ G H03 (ATTC number, CRL-5816; NCI-H810) is a lung cell line established from a large cell carcinoma that expresses a variety of proteins that are characteristic of neuroendocrine cells including synaptophysin, peptide-amidating enzyme peptidylglycine a-amidating monooxygenase (PAM), prohormone convertase 1/3, (PCI/3) and prohormone convertase 2 (PC2).
  • PAM peptide-amidating enzyme peptidylglycine a-amidating monooxygenase
  • PCI/3 prohormone convertase 1/3
  • PC2 prohormone convertase 2
  • ⁇ G H03 was shown to be sensitive to antibiotics
  • the engineered ⁇ G H03 cell provide a major advantage over engineered rodent cells in that cells transplanted within a species (allograft) are generally less susceptible to immunological destruction than cells transplanted across species (xenograft).
  • xenograft tissue including recombinantly engineered cells generated by the methods of U.S. Patent No. 5,427,940, are generally intended for use in transplantation into diabetic animals and patients in the context of a selectively permeable capsule or device, the use of tissue from other species can still result in an immunological reaction. It is well-established that xenografts .are much more difficult to protect from destruction by the host immune system than allografts (Gill and Wolf, 1995). An additional limitation that recently has been realized regarding the use of non-human islets and tissues in transplantation, is the hazard of epizootic events, the introduction and propagation of animal pathogens in the human population. Given these concerns, human cell lines, particularly b -cell lines that retain key functional characteristics, are considered a preferred biologic for the cell-based delivery of insulin.
  • the cell lines described herein may therefore be administered to a subject in need thereof.
  • the cells themselves would likely be encapsulated within the biocompatible device, and would generally release one or more molecules, such as peptides, proteins, cytokines and the like, which would be small enough to diffuse through the semipermeable membrane, these released factors would be capable of initiating an immune response in the host animal or patient.
  • the present invention provides stable human neuroendocrine cells lines with a phenotypic integrity that allows them to be used to deliver therapeutic peptides and to be used as screening tools for the identification of novel substances that can be employed in the modulation of secretory function that is manifest in a number of diseased states including diabetes.
  • a particular aspect of the present invention provides compositions and methods of providing glycemic sensing mechanisms to a population of genetically engineered cells. Indirect glycemic sensing is provided to the cells by conferring increased sensitivity to glucose counter-regulatory hormones. More particularly, the present invention provides methods and compositions for engineering indirect glucose sensing and glucose counter regulation capacity into cells.
  • the present invention further provides methods and compositions that will allow one of skill in the art to engineer secretory cells so that they are immortalized. Further, these cells are engineered to ensure that glucose sensing and responsiveness is maintained over a period of time i.e. indefinitely.
  • the components for such a system, and methods of making and using such cell lines are set forth in detail below.
  • Glucose is the predominant fuel source for the central nervous system (CNS); yet tissues of the CNS are incapable of synthesizing glucose and can store the metabolic fuel for only minutes.
  • the concentration of glucose in the CNS is maintained by the tight regulation of plasma glucose levels which are kept within a narrow range (70-150 mg/dL or 3.9 - 8.3 mMol/L) by the interplay among multiple molecules and signaling pathways within the glucoregulatory system.
  • Glucoregulatory failure caused by insulin deficiency and resulting in hyperglycemia is the common affliction of diabetes mellitus.
  • hypoglycemia is a relatively rare clinical disorder except when it occurs as a side effect of diabetes treatment.
  • hypoglycemic effects of insulin and sulfonylureas cannot be overlooked and need to be remedied.
  • ⁇ -cells could be engineered to express human glucagon, and made responsive to epinephrine by the expression of ⁇ l- or ⁇ -adrenergic receptors or vasopressin receptors.
  • ⁇ -cells could be engineered in such a manner as to decrease the secretion of insulin in response to hypoglycemia.
  • the ⁇ -cells generally are engineered to express receptors for agents that will suppress the secretion of insulin, for example glucocorticoid receptors, pancreatic polypeptide receptors, somatostatin receptors and ⁇ 2-adrenergic receptors.
  • the present invention is directed towards diabetes therapy that will balance the hyperglycemic effects of loss of ⁇ -cell function and the hypoglycemic effects of insulin therapies, thereby normalizing plasma glucose.
  • the present invention describes the augmentation of the glucose counter-regulatory system wherein genetically engineered cell lines that have been transplanted into diabetic patients have an enhanced response to hypoglycemic signals, and consequently respond with a decrease in insulin secretion and/or an increase in glucagon secretion.
  • FIG. 21 schematically illustrates this concept and extends the principles ofthe present invention to enhancing the control of regulated secretion through mechanisms distinct from the glucose counter-regulatory system.
  • secretion from the regulated secretory pathway can be modulated via the installation of cell- surface receptors that act as positive regulators of secretion (oval with a "+”) or negative regulators (oval with "-").
  • Each class of receptor is subject to activation (ACT.) or inhibition (INH.) of activity by the binding of receptor-specific ligands.
  • ligands could be physiological or pharmacological agents.
  • the glucose counter-regulatory system largely is embodied in use of cell-surface receptors that act as negative regulators of secretion in concert with ligands that activate their activity.
  • this mode of regulation include the following receptor/ligand pairs: alpha2-adrenergic receptor/epinephrine or Clonidine; somatostatin receptor/somatostatin or Octreotide; glucocorticoid receptor/glucocorticoids.
  • Each of these receptor/ligand pairs would function to inhibit secretion of the polypeptide hormone such as insulin from the cell, and could serve to protect patients treated with transplanted, insulin-secreting cells from hypoglycemia.
  • An additional mode of regulation that could decrease the frequency and/or severity of hypoglycemic episodes in patients receiving insulin from cell-based, in vivo delivery could be achieved through the inhibition of receptors that function as positive regulators of secretion.
  • the sulfonylurea receptor functions to increase secretion of insulin from the pancreatic beta-cell, and its activity is altered by increases in beta-cell glucose metabolism and various postprandial signals.
  • This receptor which normally functions as a positive modulator of secretion, also could be exploited to decrease insulin secretion when provided with a ligand such as diazoxide.
  • a naturally occurring peptide that may function as a ligand of the sulfonylurea receptor is alpha endosulfine. This peptide has been shown to bind and modulate SUR activity and enhance insulin secretion (Heron et al., 1998).
  • This form of therapy is currently administered to NIDDM patients as a means to increase insulin secretion from the endogenous pancreatic beta-cell.
  • tr.ansplanted, insulin-secreting cell lines that express endogenous SUR or transgenic SUR could likewise be stimulated to increase secretion by the administration of a sulfonylurea or Prandin.
  • Such administration could be timed with food intake to minimize postprandial hyperglycemia and could mechanistically provide an appropriate regimen of insulin dosing.
  • the following table classifies receptors as positive or negative modulators of secretion and identifies ligands that can act either as inhibitors or activators of secretion.
  • the regulation of secretion from neuroendocrine cell lines that have been engineered for peptide production could be enhanced by the use of endogenous receptors or transgenic receptors. Such receptors would be subject to modulation of activity by naturally occurring or pharmacologic agents. In the case of cell-based insulin delivery, the final impact of these manipulations would be on glycemia, and would decrease the frequency and/or severity of hypoglycemic episodes and or hyperglycemic excursions.
  • Receptor Class Ligands for minimizing Ligands for minimizing hypoglycemia hyperglycemia Receptor Class Ligands for minimizing hypoglycemia hyperglycemia
  • Glucocorticoid Glucocorticoids Activator Pancreatic Polypeptide Pancreatic Polypeptide Activator The regulatory mechanisms that maintain systemic glucose balance involve hormonal, neural and substrate factors. Just as insulin secretion from the ⁇ -cell is complexly regulated, there are multiple hormones and peptides (in addition to insulin) that are involved in the regulation of plasma glucose concentrations including glucagon, epinephrine, cortisol and pancreatic polypeptide. Many of these molecules mediate their effects by direct effects on the pancreatic beta-cell, while others mediate their effects at the levels of hepatic glucose metabolism, dietary glucose absorption, and indirect endocrine effects. The interplay between these signals in maintaining normal glucose balances is discussed in further detail herein below.
  • Glucoregulatory hormones include insulin, glucagon, epinephrine, and cortisol.
  • Insulin is the major hormone responsible for lowering plasma glucose concentrations (Service, 1983: Marks and Rose, 1981; Cryer, 1988; Cryer et al, 1989). It inhibits glucose synthesis and stimulates glucose utilization (Rizza et al, 1981).
  • Pancreatic ⁇ -cells secrete insulin into the hepatic portal circulatory system for effects on the liver and at various peripheral organs. Overall, insulin inhibits gluconeogenesis and glycogenolysis at the liver and converts the liver into an organ of glucose uptake.
  • Glucose raising or "glucose counter-regulatory hormones” include glucagon (X03991, J04040), epinephrine, norepinephrine, pancreatic polypeptide, vasopressin (AF032388, U04357, L22206) and cortisol.
  • Glucagon is secreted by the ⁇ -cells ofthe pancreatic islets into the hepatic circulation, its physiological site of action being the liver (Service, 1983: Marks and Rose, 1981; Cryer, 1988; Cryer et al, 1989). It potently activates gluconeogenesis and glycogenolysis and mediates a transient increase of hepatic glucose production within minutes. Even in the event of sustained glucagon release, hepatic glucose production returns to basal rates in approximately 90 minutes although the hormone continues to support glucose production (Rizza and Gerich, 1979).
  • Glucagon-induce hyperglycemia is transient because the glucagon-induced increase in glycogenolysis does not persist, an effect likely to be due to the glucose induced insulin secretion coupled with the autoregulatory effects of hyperglycemia (Cherrington et al, 1981).
  • Epinephrine is an adrenomedullary hormone that also mediates a hyperglycemic effect. It has a dual role in that it stimulates hepatic glucose production and limits glucose utilization. The direct and indirect actions of epinephrine are mediated through the ⁇ - and ⁇ -adrenergic mechanisms in humans (Rizza et al, 1980; Berk et al, 1985; Clutter et al, 1988). The ⁇ - adrenergic limitation of insulin secretion is an action of epinephrine.
  • pancreatic polypeptide is secreted by the PP-cells of pancreatic islet cells and has a hyperglycemic effect. The pancreatic content of this polypeptide is of a similar order of magnitude as that of glucagon and insulin.
  • arginine vasopressin which increases in response to hypoglycemia (FIG. 1). The mechanisms of altered and defective counter-regulation of glucose in patients with IDDM have been reviewed by Cryer (1988) and Cryer et al. (1989).
  • IDDM patents Absent or blunted glucagon secretory response to hypoglycemia and to physiological decreases in glucose are apparent in most IDDM patent. To the extent that glucagon secretory response are deficient such patients are dependent on epinephrine to promote hyperglycemia. Altered glucose counter-regulation and defective glucose counter-regulation seen in IDDM patients are the result of disease-related deficiency in glucagon secretory response and of combined defects in the glucagon and epinephrine secretory responses to hypoglycemia, respectively. Intensive insulin therapy of these individuals places them at a substantial risk of severe hypoglycemia.
  • glucagon plays a central role in promoting glucose recovery in hypoglycemia.
  • Epinephrine compensates largely for deficient glucagon secretion. Glucose recovery from insulin-induced hypoglycemia fails to occur in the absence of both glucagon and epinephrine.
  • glucose counter-regulation can become totally disrupted by combined deficiencies in glucagon and epinephrine.
  • the present invention provides a secretory cell that may be employed in the treatment, prevention or alleviation of hypoglycemia and/or diabetes.
  • a secretory cell that may be employed in the treatment, prevention or alleviation of hypoglycemia and/or diabetes.
  • Such cells will be especially useful in singular or combination therapy of IDDM in which the glucose counter-regulatory system has been compromised.
  • immortalized secretory cells that have a stable neuroendocrine phenotype will be used to provide a counter to the hypoglycemic effects of insulin by providing hyperglycemic factors or novel ways to inhibit insulin secretion. In particular embodiments, this will entail the expression and secretion of glucagon.
  • the present invention will entail the surface expression ⁇ - or ⁇ -adrenergic receptors which will promote the hyperglycemic effects of epinephrine and epinephrine-related compounds, e.g., norepinephrine on insulin-secreting cells.
  • the present invention will in particular aspects employ cell lines to secrete hormones or express polypeptides that will be useful in glucose regulation and counter-regulation, in order to achieve a physiologically normal glucose concentration in disorder such as diabetes.
  • cells will be engineered to be phenotypically like pancreatic ⁇ -cells in that they are glucagon secretory cells.
  • Such cells may be engineered to express and secrete glucagon, or will have express receptors that will augment, increase or otherwise enhance the production of endogenous glucagon, in response to hypoglycemia.
  • cells will be engineered to be phenotypically like pancreatic ⁇ -cells.
  • Such cells will express and secrete insulin, and regulators of insulin secretion, such as GLUT-2 and glucokinase.
  • these cells will be engineered to express polypeptides that will suppress, decrease or otherwise down-regulate insulin production or action in response to hypoglycemia.
  • the ⁇ -cells will have glucose sensing capacity in the form of GLUT-2 and glucokinase expression as described in U.S. Patent 5,427,940.
  • the cell can be a pancreatic ⁇ -cell or a cell that is a glucagon secreting cell.
  • the regulated pathway of the ⁇ cell encompasses both acute regulation of polypeptide secretion (i.e., a large increment between the unstimulated and stimulated states) and the complete processing of polypeptide.
  • secretory granules allow the storage of insulin as a depot at the plasma membrane that can be released within seconds of arrival of a fuel-derived or hormonal signal, and also serve as the site of conversion of proinsulin to insulin by virtue of their high concentrations of the relevant convertases PCI (also known as PC3) and PC2.
  • PCI also known as PC3
  • PC2 the relevant convertases
  • the presence of secretory granules and retention of proinsulin processing capacity represent a major advantage of insulinoma and other neuroendocrine cell lines relative to cells less specialized for secretion of peptide hormones such as hepatoma cells or fibroblasts.
  • a second parameter is that the cell may be equipped with a capacity for secretagogue sensing and responsiveness.
  • the cells able to sense the glucose concentration of their environment are preferred.
  • U.S. Patent 5,427,940 (incorporated herein by reference) described engineering this capacity into cells.
  • engineered cell lines retain phenotypic and genotypic stability. This includes both genes that are inserted or deleted during the course of engineering and key endogenous genes. As discussed below, this is a significant limitation on current technology.
  • a variety of host cells are contemplated to be useful as the starting cells that will be engineered to provide the therapeutic expression of the polypeptides discussed herein.
  • secreted polypeptides such as glucagon it will be desirable, for the polypeptide to be released from cells in response to the hypoglycemic environment of the cell.
  • insulin secreting cells it will be desirable to provide these cells with glucose and counter- regulatory sensing capacities such that in hypoglycemic conditions the insulin secretion can be down-regulated.
  • the polypeptide is a receptor
  • the cells employed as starting materials may be established cell lines that are engineered to express the desired proteins.
  • a cell line that is immortalized and retains the characteristics of the primary cell would be a preferred material as well.
  • the attempts at immortalization of human pancreatic ⁇ cells have resulted in cell lines that do not retain the defining properties of the primary ⁇ cell, such as the capacity to synthesize insulin and secrete it from the regulated secretory pathway.
  • Regulated secretory cells present a natural bioreactor containing specialized enzymes involved in the processing and maturation of secreted proteins. These processing enzymes include endoproteases (Steiner et al, 1992) and carboxypeptidases (Flicker, 1988) for the cleavage of prohormones to hormones and PAM, an enzyme catalyzing the amidation of a number of peptide hormones (Eipper et al, 1992a). Similarly, maturation and folding of peptide hormones is performed in a controlled, stepwise manner with defined parameters including pH, calcium and redox states.
  • a subset of cells are able to secrete proteins through a specialized regulated secretory pathway.
  • Proteins destined for secretion by either mechanism are targeted to the endoplasmic reticulum and pass through the Golgi apparatus.
  • Constitutively secreted proteins pass directly from the Golgi to the plasma membrane in vesicles, fusing and releasing the contents constitutively without the need for external stimuli.
  • This external stimuli can vary depending on cell type, optimal concentration of secretagogue and dynamics of secretion. Proteins can be stored in secretory gr.anules in their final processed form. In this way, a large intracellular pool of mature secretory product exists which can be released quickly upon secretagogue stimulation.
  • a cell specialized for secreting proteins via a regulated pathway also can secrete proteins via the constitutive secretory pathway. Many cell types secrete proteins by the constitutive pathway with little or no secretion through a regulated pathway.
  • secretory cell defines cells specialized for regulated secretion, and excludes cells that are not specialized for regulated secretion.
  • the regulated secretory pathway is found in secretory cell types such as endocrine, exocrine, neuronal, some gastrointestinal tract cells and other cells of the diffuse endocrine system.
  • the origin ofthe starting cells for use in the present invention thus include human tissues and tumors of neuroendocrine lineages that have a well defined regulated secretory pathway.
  • Neuroendocrine cells such as pancreatic ⁇ cells, pancreatic ⁇ -cells and pituitary cells are preferred for use in the present invention. Examples of such cells are shown in Table 2 (Pearse and Takor, 1979; Nylen and Becker, 1995).
  • the neuroendocrine cells of the invention preferably will secrete one or more of the endogenous secretory polypeptides listed herein in Table 2.
  • Stable ⁇ cells that secrete glucagon will be preferred in certain aspects of the invention, with cells that secrete correctly processed human glucagon being more preferred. Also preferred will be those cells that express receptors for providing control of glucagon secretion.
  • the stable ⁇ cells of the invention also may advantageously be engineered to express ⁇ 2 adrenergic receptors, pancreatic polypeptide receptors, vasopressin receptors, glucocorticoid receptors and the like.
  • engineered ⁇ -cells will further express insulin as well as glucose sensing genes such as GLUT-2 and glucokinase as described in U.S. Patent 5,427,940.
  • pancreatic ⁇ -cells also are preferred for use in the present invention. These cells will be engineered for glucagon expression and secretory capacity into the starting cells disclosed herein above. Alternatively, the endogenous glucagon secretion of the a glucagon-secretory cell will be augmented using stimulation by epinephrine and epinephrine related molecules such as norepinephrine and Clonidine. Such epinephrine stimulatory phenotype may be engineered into the glucagon secretory cell by providing the cell with the ability to express an adrenergic receptor. More particularly, the cell will express an ⁇ - adrenergic receptor, in even more preferred embodiments the cell will express an ⁇ l adrenergic receptor.
  • regulated secretory pathway means that the rate of secretion of a polypeptide can be stimulated or inhibited by external stimuli, commonly referred to as secretagogues.
  • a secretagogue is a substance that stimulates the secretion of a polypeptide.
  • Secretagogues can be physiological in nature, e.g., glucose, amino acids, or hormones, or pharmacological, e.g., IBMX, forskolin, or sulfonylureas.
  • Polypeptides destined for the regulated secretory pathway are stored in intracellular storage vesicles known as secretory granules.
  • glucose counter-regulation is a term that refers to the effects on the glucose metabolism that are opposite to those mediated by insulin. As such glucose counter-regulation refers to the correction of hypoglycemia or the prevention of hypoglycemia. Thus, a factor that mediates glucose counter-regulation reduces insulin secretion and raises the glucose level from hypoglycemic toward hyperglycemic, but more preferably towards the normal physiological glucose levels.
  • a glucose counter-regulatory hormone is defined as one that responds to hypoglycemia either with alterations in the plasma levels or activity. Most often it is envisioned that such hormones will increase in levels or activity in response to hypoglycemia. These hormones can include those known to be directly glucose counter-regulatory such as epinephrine, glucagon, pancreatic polypeptide, vasopressin, and cortisol , and also includes hormones that are glucose counter-regulatory by indirect mechanisms such as growth hormone, various neuropeptides, ACTH, somatostatin, and so on. It also is within the scope of this invention to engineer secretory functions into cells for novel mechanisms of glycemic control.
  • the effect of overexpression of various receptors and/or channels on insulin-secreting cells may improve the regulation of secretion to minimize inappropriate release of the peptide under hypoglycemic conditions.
  • alpha-2 adrenergic receptor (ATTC number 59303, HPalpha2GEN Genbank accession numbers M18415, M23533, incorporated herein by reference), glucagon-like peptide I receptor (Genbank accession numbers: L23503, U10037, U01156, U01104: each incorporated herein by reference), somatostatin receptor V (mouse Genbank accession number AF004740; human Genbank accession numbers: L14865, L14856, M81830, M96738, M81829, L07833 each incorporated herein by reference), SUR channel (Genbank accession numbers L78207, U63455, L78243, incorporated herein by reference), KIR channel, pancreatic polypeptide receptor (Genbank accession numbers: Z66526, U42387, U42389 each incorporated herein by reference), muscarinic receptor (Genbank accession numbers: X52068, XI 5264,
  • Glucose is the most important stimulator of insulin secretion, not only because of its potent direct effects but also because it is permissive for the stimulatory action of a wide array of other secretagogues. While there is good evidence to suggest that glucose exerts its effect through its own metabolism, resulting in the creation of signals that appear to work through modulation of ion channel activities and influx of extracellular Ca 2+ , the exact nature of the metabolic coupling factors remains unknown. The magnitude of the insulin secretory response appears to be related to the rate of ⁇ -cell glucose metabolism, and both parameters are sharply increased in response to modest increments in extracellular glucose concentrations within the physiological range of 4 to 8 mM.
  • ⁇ -cells are equipped with the glucose transporter GLUT-2 and the glucose phosphorylating enzyme glucokinase which have kinetic properties, particularly a relatively low affinity for glucose, that are ideal for modulation of glucose responsiveness at the relatively high concentrations of the sugar encountered in the circulation (Newgard and McGarry 1995).
  • Glucose Responsive Cells are equipped with the glucose transporter GLUT-2 and the glucose phosphorylating enzyme glucokinase which have kinetic properties, particularly a relatively low affinity for glucose, that are ideal for modulation of glucose responsiveness at the relatively high concentrations of the sugar encountered in the circulation (Newgard and McGarry 1995).
  • the secretory cells may respond to changes in the circulating glucose concentration.
  • the most obvious example of a secretory cell type that is regulated in this fashion is the ⁇ cell of the pancreatic islets of Langerh-ans, which releases insulin and amylin in response to elevated blood glucose concentration.
  • the ⁇ -cells release glucagon in response to diminished glucose concentration.
  • the physiological norm for plasma glucose concentration ranges between about 70mg/dL and 150mg/dL.
  • the glycemic threshold for the activation of the glucose counter- regulatory systems lies within or just below this physiological range.
  • a preferred vehicle may be one ofthe several cell lines derived from islet ⁇ cells that have emerged over the past two decades. While early lines were derived from radiation- or virus-induced tumors (Gazdar et al, 1980, Santerre et al, 1981), more recent work has centered on the application of transgenic technology (Efrat et al, 1988; Miyazaki et al, 1990).
  • a general approach taken with the latter technique is to express an oncogene, most often SV40 T-antigen, under control of the insulin promoter in transgenic animals, thereby generating ⁇ cell tumors that can be used for propagating insulinoma cell lines (Efrat et al, 1988; Miy.az.aki et al, 1990). While insulinoma lines provide an advantage in that they can be grown in essentially unlimited quantity at relatively low cost, most exhibit differences in their glucose- stimulated insulin secretory response relative to normal islets.
  • RINm5F cells which were derived from a radiation-induced insulinoma and which in their current form are completely lacking in any acute glucose- stimulated insulin secretion response (Halban et al, 1983).
  • RIN 1046-38 cells are also derived from a radiation-induced insulinoma but can be shown to be glucose responsive when studied at low passage numbers (Clark et al, 1990). This response is maximal at subphysiological glucose concentrations and is lost entirely when these cells are cultured for more than 40 passages (Clark et al, 1990).
  • GLUT-2 and glucokinase are expressed in low passage RIN 1046-38 cells but are gradually diminished with time in culture in synchrony with the loss of glucose-stimulated insulin release (Ferber et al, 1994).
  • Restoration of GLUT-2 and glucokinase expression in RIN 1046-38 cells by stable transfection restores glucose-stimulated insulin secretion (Ferber et al, 1994), .and the use of these genes as a general tool for engineering of glucose sensing has been described in a previously issued patent (Newgard, US Patent 5,427,940).
  • RIN 1046-38 cells transfected with the GLUT-2 gene alone are maximally glucose responsive at low concentrations of the sugar (approximately 50 ⁇ M), but the threshold for response can be shifted by preincubating the cells with 2-deoxyglucose, which when converted to 2-deoxyglucose-6- phosphate inside the cell serves as an inhibitor of low K m hexokinase, but not glucose activity (Ferber et al, 1994).
  • INS-1 insulinoma cell line
  • This line was isolated by propagating cells freshly dispersed from an X-ray induced insulinoma tumor in media containing 2- mercaptoethanol. Consistent with the finding of physiological glucose responsiveness, a recent report indicates that INS-1 cells express GLUT-2 and glucokinase as their predominant glucose transporter and glucose phosphorylating enzyme, respectively (Marie et al, 1993). INS-1 cells grow very slowly and require 2-mercaptoethanol. It remains to be determined whether glucose responsiveness and expression of GLUT-2 and glucokinase are retained with prolonged culturing of these cells, or growth in vivo.
  • ⁇ TC cells Cell lines derived by transgenic expression of T-antigen in ⁇ cells (generally termed ⁇ TC cells) also exhibit variable phenotypes (Efrat et al, 1988; Miyazaki et al, 1990; Whitesell et al, 1991; Efrat et al, 1993). Some lines have little glucose-stimulated insulin release or exhibit maximal responses at subphysiological glucose concentrations (Efrat et al, 1988; Miyazaki et al, 1990; Whitesell et al, 1991), while others respond to glucose concentrations over the physiological range (Miyazaki et al, 1990; Efrat et al, 1993).
  • Glucose-unresponsive lines such as MIN-7 were found to express GLUT-1 rather than GLUT-2 as their major glucose transporter isoform, while MIN-6 cells were found to express GLUT-2 and to exhibit normal glucose-stimulated insulin secretion (Miyazaki et al, 1990). More recently, Efrat and coworkers demonstrated that their cell line bTC-6, which exhibits a glucose-stimulated insulin secretion response that resembles that of the islet in magnitude and concentration dependence, expressed GLUT-2 and contained a glucokinase :hexokinase activity ratio similar to that of the normal islet (Efrat et al, 1993).
  • AtT- 20 cell is derived from ACTH secreting cells of the anterior pituitary.
  • a decade ago, Moore et al demonstrated that stable transfection of AtT-20 cells with a construct in which a viral promoter is used to direct expression of the human proinsulin cDNA resulted in cell lines that secreted the correctly processed and mature insulin polypeptide (Moore et al, 1983).
  • Insulin secretion from such lines can be stimulated by agents such as forskolin or dibutyryl cAMP, with the major secreted product in the form of mature insulin.
  • AtT- 20 cells express the glucokinase gene (Hughes et al, 1991; Liang et al, 1991) and at least in some lines, low levels of glucokinase activity (Hughes et al, 1991 and 1992; Quaade et al, 1991), but are completely lacking in GLUT-2 expression (Hughes et al, 1991 and 1992).
  • AtT-20ins cells The studies with AtT-20ins cells are important because they demonstrate that neuroendocrine cell lines that normally lack glucose-stimulated peptide release may be engineered for this function.
  • Other cell lines that are characterized as neuroendocrine, but lacking in endogenous glucose response include PC 12, a neuronal cell line (ATCC CRL 1721) and GH3, an anterior pituitary cell line that secretes growth hormone (ATCC CCL82.1).
  • these lines do exhibit other properties important for this invention such as a regulated secretory pathway, expression of endopeptidases required for processing of prohormones to their mature hormone products, and post-translational modification enzymes.
  • neuroendocrine cell lines are useful for the essential aspect of this invention. Some or all of these lines also will be useful for glucose-regulated product delivery, using the methods described in U.S. Patent 5,427,940 to generate such responsiveness.
  • the present invention uses stable human secretory cells by transforming a non-stable secretory cell such that it is immortalized and retains its phenotype through numerous cell culture passages.
  • Such cell lines of the present invention are functionally defined as having maintained a regulated secretory pathway, being stable to in vitro culture and, preferably, as being amenable to further engineering.
  • the present section describes the production of these cells for use in the production of the heterologous polypeptides for the therapeutic purposes ofthe present invention.
  • the human secretory or neuroendocrine cell will be "culturable,” i.e., it will be capable of growing in vitro .and producing the desired endogenous secretory polypeptide with a demonstrated regulated secretory pathway.
  • a "stable, transformed" human regulated secretory cell in the context of the present invention will be a cell that exhibits in vitro growth for at least twenty population doublings.
  • the resultant human regulated secretory cell also will maintain the required differentiated phenotype after transformation, i.e., it will exhibit the phenotypic properties of a demonstrable regulated secretory pathway, secretory storage granules, the capacity for peptide processing, and will produce the selected endogenous secretory polypeptide.
  • the stable human secretory cell is a ⁇ cell.
  • the human ⁇ cells of the present invention will exhibit the capacity to grow in vitro, with a minimum of at least about 20 population doublings, or preferably, of about 30, about 40, about 50, about 60, about 70, or about 80 population doublings. Even more preferably, the resultant human ⁇ cells of the invention will have even further increments of population doublings up to and including a completely transformed state wherein the cells grow in perpetuity.
  • the human glucagon-secreting cells ofthe present invention also will exhibit the capacity to produce biologically active human glucagon.
  • the glucagon produced may be comprised entirely of mature glucagon; or entirely of the biological precursor of mature glucagon, termed proglucagon; or of all possible mixtures of proglucagon, glucagon, and processing intermediates that are produced in the course of conversion of proglucagon to glucagon.
  • proglucagon biological precursor of mature glucagon
  • processing intermediates that are produced in the course of conversion of proglucagon to glucagon.
  • the preferred embodiment of the present invention are cells that produce primarily or exclusively mature glucagon, cells that produce proglucagon also will be useful in various embodiments. Such cells are useful per se, particularly as any form of glucagon can be obtained in vitro, purified and converted to mature glucagon.
  • glucagon is an exemplary secretory protein
  • the stable hum-an neuroendocrine cell line may be engineered to
  • Cells that produce primarily or exclusively immature glucagon also are useful in that the capacity to produce mature glucagon can be re-engineered into the cells themselves, in which instances the stable cells can then be used in vivo.
  • the glucagon secretion will be observed in the range of 1.0 mMol/L to 4.0 mMol/L glucose. This secretory response will more preferably occur with a threshold for response of 3.9 mM/L glucose, with maximal secretion stimulated by 3.0mM L glucose, as occurs in normal human islets. Cell lines with glucose dose responses occurring over a higher or lower range also will have significant utility, given that any regulated glucagon production will be useful.
  • the ⁇ cells of the present invention generally will exhibit a minimal insulin content of about 5 ng/million cells, but may contain as much as, or even more insulin than, normal isolated human islets, which have approximately 1-10 ⁇ g/million cells. It will be understood that the cells of the present invention may contain any amount of insulin within the above-specified ranges, such as about 10 ng insulin/million cells, about 50 ng, about 100 ng, about 200 ng, about 500 ng, about 1000 ng (1 ⁇ g), about 2 ⁇ g, about 5 ⁇ g, about 10 ⁇ g, about 20 ⁇ g, about 50 ⁇ g, about 75 ⁇ g, up to and including about 100 ⁇ g insulin/million cells. It will be understood that any and all integers within these ranges will define .an insulin content that may be present within the stable human ⁇ cells ofthe invention.
  • the ⁇ cells of the present invention may be defined as cells having an insulin content of between about 10%, about 20%, about 30%, about 40%, about 50%), about 60%, about 70%, about 80%, about 90%, up to and including about 100% of normal hum.an islet content, which is about 1-10 ⁇ g/million cells.
  • the ⁇ cells of the present invention preferably will exhibit enhanced insulin secretion when exposed to one or more secretagogues selected from IBMX, carbachol, amino acids, and glucose, or when exposed to a secretory "cocktail" of such compounds.
  • the human ⁇ cells more preferably will exhibit enhanced insulin secretion when exposed to glucose, and will most preferably exhibit enhanced insulin secretion when exposed to 10 mM glucose.
  • the increase in insulin secretion in response to a non-glucose secretagogue or cocktail thereof should be at least about 1.1 times or about 1.5 times that observed in cells incubated in the absence of the secretagogue or secretory cocktail. However, in preferred embodiments, the increase in insulin secretion in response to a non-glucose secretagogue or cocktail thereof should be at least about double that observed in cells incubated in the absence of the secretagogue or secretory cocktail. In more preferred embodiments, a higher increase will be observed, up to and including a 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 300-fold or even about a 500-fold enhancement.
  • the ⁇ cells of the present invention preferably will exhibit a glucose-stimulated insulin secretion (GSIS) response.
  • GSIS glucose-stimulated insulin secretion
  • This increase in secretion should be at least about 1.1 times or about 1.5 times that observed in cells incubated in the absence of glucose. More preferred are increases in secretion of at least about double that observed in cells incubated in the absence of glucose, with even more preferred increases being higher, up to and including a 3 -fold, 5 -fold, 10-fold, 20-fold, 50-fold, 100-fold, 200-fold, 300-fold or even about a 500-fold enhancement, including all increments therebetween.
  • glucose responsive insulin secretion will be observed in the range of 1.0 to 20 mM glucose.
  • GSIS response will more preferably occur with a threshold for response of 3-5 mM glucose, with maximal secretion stimulated by 10-20 mM glucose, as occurs in normal human islets.
  • Cell lines with glucose dose responses occurring over a higher or lower range also will have significant utility, given that any regulated insulin production will be useful.
  • Many secretory cells have a secretory response not originally in the range observed for normal human islets, nevertheless these cells still will be useful as such cells will be amenable to genetic engineering methods, as embodied in U.S. Patent 5,427,940, and as further disclosed herein, in order to alter the glucose dose response.
  • Primary human neuroendocrine secretory cells are immortalized as described in further detail elsewhere in the specification.
  • the present section is directed to describing the starting cells that may be further engineered for use in glycemic control, .and in particular for use in the treatment, prevention, amelioration of hypoglycemia.
  • Hum.an fetal pancreases at 18 to 24 gestational weeks can be obtained through nonprofit organ procurement centers, with patient consent for tissue donation being obtained. Dissection of specific organs from the fetuses is often done at the procurement centers.
  • Human organs can be obtained from autopsies through nonprofit organ procurement centers.
  • High quality human islets are available, for example, from Dr. Camillo Ricordi of the University of Miami Medical Center, an islet transplant surgeon who supplies human islets to scientists throughout the United States.
  • tumor cell lines and insulinomas arising from explants of resected neuroendocrine tumors are not necessarily, by definition, stable cells; some such cells maintain a differentiated phenotype for two, four or about six months at the maximum. However, such cells are intended for use as starting materials in the present invention.
  • pituitary cells may allow for higher efficiency of transformation as culture conditions have been reported for promoting the proliferation of rodent pituitary cells in vitro
  • Cells from the intermediate lobe may have an advantage for use in cell-based therapies of IDDM as there is a suggestion that this cell type can survive and sustain secretory function in autoimmune disease. These cells would therefore be useful in providing an indication of the effects ofthe modulators in vivo, as these cells would be less prone to attack from the host.
  • the POMC promoter was used to drive expression of insulin in the cells of the intermediate lobe of transgenic nonobese diabetic (NOD) mice. Such cells were resistant to autoimmune-dependent destruction even when implanted next to islets in which ⁇ cells were destroyed during the course ofthe disease (Lipes et al, 1996).
  • KEY NCI, National Cancer Institute; ATCC, American Type Culture Collection; NE, neuroendocrine; PAM, peptidylglycine alph amidating monooxygenase; SYN, synaptophysin; PC, proconvertase; VIM, vimentin; AB, antibiotic; S/R, sensitive/resistant; G418; H, hygromycin; O, ouabain; P, puromycin; B, blasticidin; Hd, histidinol; Mca, mycophenolic acid; Z, Zeocin; TG, transgen expression +/-; NP, neomycin phosphotransferase; I, insulin; G, glucagon/glycentin; GH, growth hormone; NT, not tested
  • Table 3 describes the properties of certain cell lines that are exemplary starting cells for use in the instant application.
  • ⁇ G H03 cells are derived from a human non-small cell lung carcinoma (ATCC Number: CRL-5816). These cells have a neuroendocrine phenotype, and can be grown in a monolayer. This line was derived by Gazdar and associates from a lung tissue obtained from a patient prior to therapy. H03 cells as obtained from the ATCC are not able to synthesize the peptide neuromedin B (NMB) or the gastrin releasing peptide (GRP).
  • NMB peptide neuromedin B
  • GFP gastrin releasing peptide
  • lung carcinoma cells include cells designated herein as ⁇ G H04, ⁇ G H05, ⁇ G H07, ⁇ G H09, ⁇ G HI 9, ⁇ G H20 and ⁇ G H21. These, as well as additional cells lines derived from other sources, are described in further detail herein below. These cell lines are only exemplary starting cells for use in the present application, given the teachings provided herein, one of ordinary skill in the art will be able to identify additional cells with characteristics that would make them appealing as cells to be engineered for use in the present invention.
  • HOI cells (ATCC Number: CCL-251) also may be used in the present invention. These cells are human colorectal carcinoma cells having an epithelial morphology. These cells grow in floating aggregates of round cells. A characteristic that makes these cells useful in the context of the present invention is that they contain cytoplasmic dense core granules characteristic of endocrine secretion.
  • ⁇ G H02 cells are obtained from the ATCC (CRL-1803) are derived from a thyroid medullary carcinoma. Their morphology is epithelial and are known to produce high levels of calcitonin and carcinoembryonic antigen (CEA). Chromosomal analysis of the cell line and tumors induced in nude mice reveal an aneuploid human karyotype with several marker chromosomes.
  • ⁇ G H04 cells .are obtained from the ATCC are lung carcinoma cells and have a neuroendocrine phenotype.
  • the cells have a homozygous partial deletion of the p53 protein, .ana lack expression ol p53 protein.
  • the cells are able to synthesize the peptide NMB at 0.1 pmol/mg protein, but not the gastrin releasing peptide (GRP).
  • ⁇ G H05 Another lung carcinoma cell that may prove a useful host cell in the context of the resent invention is designated ⁇ G H05 (ATCC Number: CRL-5808).
  • This is a classic small cell lung cancer cell line with an epithelial morphology. This line was derived from cells recovered from pleural effusion taken from a patient after chemotherapy.
  • NCI-H378 expresses elevated levels of the 4 biochemical markers of SCLC: neuron specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity.
  • the cells express the c-kit gene as well as the L-myc gene, and L-myc is amplified. The cells express easily detectable levels of p53 mRNA compared to levels found in normal lung
  • NMB neuromedin B
  • This line was derived from tissue taken prior to therapy. This is the best differentiated of the available bronchial carcinoid lines.
  • the cells express easily detectable levels of p53 mRNA compared to levels found in normal lung.
  • the cells are able to synthesize the peptide NMB (at 0.1 pmol/mg protein), but not the gastrin releasing peptide (GRP).
  • the cell line secretes a parathyroid hormone-like protein which is calcium stimulated through a protein kinase C pathway. Further, growth of NCI-H727 cells is inhibited by epidermal growth factor (EGF) receptor monoclonal antibodies.
  • EGF epidermal growth factor
  • ⁇ G H07 Another classic small cell lung cancer cell line is ⁇ G H07 (ATCC Number: CRL-5804). This line was derived from cells recovered from pleural effusion obtained from a patient prior to therapy, and expresses elevated levels of the 4 biochemical markers of SCLC: neuron-specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity. Only trace amounts of the retinoblastoma susceptibility gene (RB) mRNA, were detected. RB protein was not detected. The cells express the c-kit gene as well as the N- myc gene. N-myc is not amplified.
  • RB retinoblastoma susceptibility gene
  • the cells are not able to synthesize the peptide neuromedin a JNM ⁇ ) or tne gast ⁇ n-reieasing peptide (GRP). They express easily detectable levels of p53 mRNA compared to levels found in normal lung. These cells are useful for transfection studies.
  • ⁇ G H09 are derived from an atypical lung carcinoid and are available form the ATCC (CRL-5838).
  • ⁇ G H10 cell line is a commercially available cell line derive from lung carcinoma (ATCC Number CCL-185)
  • ATCC Number CCL-185.1 Another similar cell line is ATCC number CCL-185.1 derived from CCL-185 which was initiated through explant culture of lung carcinomatous tissue.
  • CCL-185.1 are adapted to growth in serum-free medium.
  • ⁇ G Hl l cells may be obtained form ATCC (number HTB-9) and are derived from a bladder carcinoma.
  • ⁇ G HI 3 (ATCC Number: CRL- 139) are from a primitive neuroectodermal brain tumor. The cells express CCK specific mRNA and synthesize considerable quantities of variably processed CCK prohormone.
  • CCL-249 are designated herein as ⁇ G HI 4 and are derived from a colon adenocarcinoma. This is one of 14 colorectal carcinoma cell lines derived from a well differentiated sigmoid tumor from a patient prior to therapy. The line was initially grown in medium with fetal bovine serum, but was later adapted to growth in the chemically defined medium ACL-4. Floating aggregates produce tubulogl.andul.ar structures lined by columnar epithelia.
  • ⁇ G HI 5 are from a colorectal carcinoma (ATCC Number: CCL-253) and have an epithelial phenotype. This line was derived from a metastasis to the abdominal wall obtained from a patient after treatment with 5-fluorouracil.
  • ⁇ G HI 6 are the same as the commercially available cell line of ATCC Number: CRL- 5974. These are gastric carcinoma cells that express the surface glycoproteins carcinoembryonic antigen (CbA) and 1AU ii and the muscarinic cholinergic and vasoactive intestinal peptide (VIP) receptors but lack gastrin receptors
  • HTB-10 are the cells referred to herein as ⁇ G HI 8, these cells are derived from a neuroblastoma cell line and is one of two cell lines (see also ATCC HTB-1 1) of neurogenic origin.
  • HTB-184 are small cell lung carcinoma cells of an extrapulmonary origin and are from an adrenal metastasis in an adult. The cells produce easily detectable p53 mRNA at levels comparable to those in normal lung tissue.
  • ⁇ G H20 (ATCC Number: HTB-177) are a large cell carcinoma cell line derived from the pleural fluid of a patient with large cell cancer of the lung.
  • the cells stain positively for keratin and vimentin but are negative for neurofilament triplet protein.
  • the line expresses some properties of neuroendocrine cells, is relatively chemosensitive and can be cloned in soft agar
  • ⁇ G H21 (ATCC Number: CRL-2195) is yet another small cell lung carcinoma cell that may be useful as a starting cell in the present invention. It can grow as suspension and loosely adherent culture and is a biochemically stable continuously cultured cell line which has retained important features of SCLC. The line was derived from a non-encapsulated primary lung tumor from the apical portion of the upper lobe of the left lung. This cell line is an unusual undifferentiated large cell variant of small cell lung carcinoma. It has the morphology of a variant, but the biochemical properties of a classic SCLC. Electron microscopy revealed the presence of gland formation and intracytoplasmic lamellar bodies. The cells have neuroendocrine markers L-dopa decarboxylase and dense core secretory granules.
  • ⁇ G H23 is a long-term tissue culture cell line derived from a metastatic human carcinoid tumor of the pancreas (Evers et al, 1991; Parekh et al, 1994). This cell line also is known as BON (Evers et al., 1991), tumors derived from this cell line are histologically identical to the original tumor.
  • the cells have significant amounts of neurotensin, pancreastatin, and serotonin (5-HT) are demonstrated in the cells by radioimmunoassay (RIA) and the presence of chromogranin A, bombesin, and 5-HT is confirmed by immunocytochemistry.
  • RIA radioimmunoassay
  • the cells possess neurosecretory granules and functional receptors for acetylcholine, 5-HT, isoproterenol, and somatostatin.
  • BON cells possess a specific transport system for uptake of 5-HT from the medium; this uptake system may be a route for regulation of autocrine effects of 5-HT on carcinoid cells (Parekh et al, 1994).
  • This unique hum.an carcinoid tumor cell line should provides .an exemplary starting material for the bioengineering described herein .and will be useful in that they possess intracellular mechanisms ideally adapted for secretagogue action in the release of amines and peptides.
  • ⁇ G H25 (ATCC Number: HB-8065) derived from a hepatoblastoma.
  • This cell line produces alpha- fetoprotein ( ⁇ fetoprotein); albumin; alpha2 macroglobulin ( ⁇ -2-macroglobulin); alphal antitrypsin ( ⁇ -1-antitrypsin); transferrin; alphal antichymotrypsin;( ⁇ -l-antichymotrypsin); haptoglobin; ceruloplasmin; plasminogen and demonstrates decreased expression of apoA-I mRNA and increased expression of catalase mRNA in response to gramoxone (oxidative stress) complement (C4); C3 activator; fibrinogen; alphal acid glycoprotein ( ⁇ -1 acid glycoprotein); alpha2 HS glycoprotein ( ⁇ -2-HS-glycoprotein); beta lipoprotein ( ⁇ -lipoprotein); retinol binding protein.
  • ⁇ fetoprotein alpha- fetoprotein
  • albumin
  • the transforming genetic construct may, therefore, be functionally and/or physically separated from the cell after transformation.
  • Advantages include generation of cell lines that do not constitutively express oncogenes which can act as tumor .antigens in vivo, control of growth ofthe resulting tumor lines for stable in vivo use and possibly the control ofthe differentiated state ofthe resultant cell line.
  • Temperature-Sensitive Regulation of Oncogene Expression allows for turning the growth promoting activity on and off.
  • oncogenes that are active at lower than physiological temperatures i.e., 32°C to 34°C
  • 37°C to 39°C physiological or higher temperatures
  • stable cell lines can be expanded, and further genetic modifications can be made and characterized in vitro at the low, permissive temperatures. When placed in vivo, these same cell lines will be exposed to the non-permissive temperature, and will not grow.
  • a temperature sensitive version of the SV40 virus was isolated and shown to have a mutation in the coding region ofthe large T antigen gene (Bourre and Sarasin, 1983).
  • Promoters capable of driving expression of heterologous genes in response to an exogenously added compound allow for conditional expression of oncogenes inserted under the control of the promoter.
  • the addition of the promoting agent then allows stable cell lines to be expanded and transformed. When placed in vivo, expression of the oncogene is turned off, unless the activating factor is provided.
  • lac repressor system Fieck et al, 1992; Wyborski and Short, 1991; each incorporated herein by reference
  • tetracycline regulatory system U.S. Patent 5,464,758; Gossen and Bujard, 1992; Gossen et al, 1995; each incorporated herein by reference.
  • the present invention contemplates the use of the CrelLox site-specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to rescue specific genes out of a genome. Briefly, the system involves the use of a bacterial nucleotide sequence knows as a Lox? site, which is recognized by the bacterial Cre protein. The Cre protein catalyzes a site-specific recombination event. This event is bi-directional, i.e., Cre will catalyze tne insertion ot sequences at a Lox? site or excise sequences that lie between two Lox? sites.
  • the present invention also contemplates the use of recombination activating genes (RAG) 1 and 2 to rescue specific genes from the genome of transformed cell lines.
  • RAG-1 GenBank accession number M29475
  • RAG-2 GenBank accession numbers M64796 and M338278
  • RGSs specific recombination signal sequences
  • V(D)J V(D)J recombination required for the assembly of immunoglobulin and T cell receptor genes
  • Transgenic expression of RAG-1 and RAG-2 proteins in non-lymphoid cells supports V(D)J recombination of reporter substrates (Oettinger et al, 1990).
  • the transforming construct of interest is engineered to contain flanking RSSs. Following transformation, the transforming construct that is internal to the RSSs can be deleted from the genome by the transient expression of RAG-1 and RAG-2 in the transformed cell.
  • pancreatic Cells The islets of Langerhans are scattered diffusely throughout the pancreas. Principally, four polypeptide hormones, (insulin, glucagon, somatostatin and pancreatic polypeptide) are synthesized and secreted by these cells. Each of the islet hormones is secreted by a distinct cell type, ⁇ -cells secrete glucagon, ⁇ -cells secret insulin, ⁇ -cells secrete somatostatin and pancreatic polypeptide is secreted by PP-cells. In islet organization, the glucagon and somatostatin producing cells tend to surround the more centrally located insulin secreting cells.
  • ⁇ -cells are engineered to express particular polypeptides.
  • primary ⁇ -cells may be used there are a number of ⁇ -cell lines that have oeen ⁇ e ⁇ ve ⁇ irom various insulinomas.
  • RIN 1046-38 cells are derived from a radiation-induced insulinoma but can be shown to be glucose responsive when studied at low passage numbers (Clark et al, 1990). This response is maximal at subphysiological glucose concentrations and is lost entirely when these cells are cultured for more than 40 passages (Clark et al, 1990). Although, RIN 1046-38 cells of low passage number exhibit GSIS, albeit with maximal secretion at glucose concentrations considerably lower than the threshold for response of normal ⁇ cells (Knaack et al, 1994). These cells also express GLUT-2 and glucokinase, the high Km glucose transporter and glucose phosphorylating enzymes that appear to control glucose flux and GSIS in ⁇ cells (Newgard, 1996).
  • RIN 1046-38 cells lose expression of GLUT-2 and glucokinase, become glucose unresponsive, and experience a decline in insulin content (Hughes et al, 1992; Knaack et al, 1994).
  • novel cell lines in which the genes for GLUT- 2, glucokinase .and hum.an insulin .are stably expressed in RIN 1046-38 cells by an "iterative engineering" strategy has been described (Clark et al, 1997). Important characteristics of these lines include insulin content that approaches that of normal human islet ⁇ cells, efficient processing of the overexpressed human proinsulin to mature insulin, and stability of expression ofthe transgenes in vitro .and in vivo.
  • an endogenous gene product it may be necessary to block expression of an endogenous gene product as an initial modification of host cells according to the present invention.
  • the targeted endogenous gene encodes a protein normally secreted by the host cell. Blocking expression of this endogenous gene product, while engineering high level expression of genes of interest, represents a unique way of usurping secretory function cells for exogenous protein production.
  • Cells generated by this two-step process express heterologous proteins, including a variety of natural or engineered proteins (fusions, chimeras, protein fragments, etc.).
  • Cell lines developed m t is way are uniquely suited for in vitro assays for the identification of modulators of protein secretion as well as in vivo cell-based delivery or in vitro large-scale production of defined peptide hormones with little or no contaminating or unwanted endogenous protein production.
  • constructs are designed to homologously recombine into particular endogenous gene loci, rendering the endogenous gene nonfunctional.
  • constructs are designed to randomly integrate throughout the genome, resulting in loss of expression of the endogenous gene.
  • constructs are designed to introduce nucleic acids complementary to a target endogenous gene. Expression of RNAs corresponding to these complementary nucleic acids will interfere with the transcription and or translation of the target sequences.
  • constructs are designed to introduce nucleic acids encoding ribozymes - RNA-cleaving enzymes - that will specifically cleave a target mRNA corresponding to the endogenous gene.
  • endogenous gene can be rendered dysfunctional by genomic site directed mutagenesis.
  • Each of these methods for blocking protein production are well known to those of skill in the .art.
  • WO publication numbers WO 97/26334 (published July 24, 1997) and WO 97/26321 (published July 24, 1997) describe these methodologies and are specifically incorporated herein by reference.
  • the present inventors contemplate the use of the tools of molecular biology to engineer cell lines with properties that approximate those of the normal ⁇ -cell (Hughes et al, 1992; Ferber et al, 1994).
  • RIN 1046-38 loses glucose responsiveness as well as GLUT-2 and glucokinase expression with time in culture (Clark et al, 1990; Ferber et al, 1994). Stable transfection of RIN 1046-38 cells of intermediate, but not high passage numbers witn ULU i-4. reconstitutes ⁇ siS .and induces a 4-fold increase in glucokinase activity relative to untransfected control cells (Ferber et al, 1994). While these studies represent an important start point, major issues must be dealt with before the cells can be perceived as having any therapeutic value.
  • RIN 1046-38 cells express rat rather than human insulin.
  • Another problem is that the up-regulation of glucokinase activity in response to GLUT-2 transfection is transient, and the cells lose glucose responsiveness over time (Ferber et al, 1994). And finally, the maximal increase in insulin secretion in response to glucose is only 3-fold, and occurs at subphysiological glucose concentrations (50-100 ⁇ M) (Ferber et al, 1994).
  • the inventors address these deficiencies by molecular engineering, which will require the introduction of several genes (GLUT-2, glucokinase, human insulin) into a single cell line, as well as a reduction in expression of other undesired genes that are normally expressed by these cells (hexokinase I, rat insulin).
  • GLUT-2 glucokinase
  • human insulin glucokinase
  • hexokinase I rat insulin
  • the events that may be conducted as separate construction events include blocking expression of endogenous gene products by molecular methods (including targeting of both copies of the endogenous gene), introducing a heterologous gene, and further modification of the host cell to achieve high level expression.
  • the particular difficulty in performing multiple steps like this is the need for distinct selectable markers. This is a limitation in that only a few selectable markers are available for use in mammalian cells and not all of these work sufficiently well for the purposes of this invention.
  • the present invention therefore contemplates the use of the CrelLox site-specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to rescue specific genes out of a genome, most notably drug selection markers. It is claimed as a way or increasing xne numoer of rounds of engineering.
  • tfte system involves the use of a bacterial nucleotide sequence knows as a Lox? site, which is recognized by the bacterial Cre protein.
  • the Cre protein catalyzes a site-specific recombination event. This event is bidirectional, i.e., Cre will catalyze the insertion of sequences at a Lox?
  • the present invention contemplates the supplemental expression or overexpression of proteins involved in maintaining the specialized phenotype of host cells, especially their secretory capacity.
  • proteins may be used to supplement the cell's natural enzymes.
  • IPF1 Insulin Promoter Factor 1
  • Insulin promoter factor 1 (IPF-1; also referred to as STF-1, IDX-1, PDX-1 and ⁇ TF-1) is a homeodomain-containing transcription factor proposed to play an important role in both pancreatic development and insulin gene expression in mature ⁇ -cells (Ohlsson et al, 1993, Leonard et al, 1993, Miller et al, 1994, Kruse et al, 1993). In embryos, IPF-1 is expressed prior to islet cell hormone gene expression and is restricted to positions within the primitive foregut where pancreas will later form. Indeed, mice in which the IPF-1 gene is disrupted by targeted knockout do not form a pancreas (Jonsson et al, 1994).
  • IPF-1 expression becomes restricted predominantly to ⁇ -cells.
  • IPF-1 binds to TAAT consensus motifs contained wiuun me ⁇ J ⁇ ⁇ I ⁇ . anu ⁇ elements of the insulin enhancer/promoter, wnereupon, it interacts with other transcription factors to activate insulin gene transcription (Peers et al, 1994).
  • IPF-1 will generally be present in the resultant stable human ⁇ -cells of the present invention
  • the overexpression of IPF-1 in human ⁇ -cell lines may be used to serve two purposes. First, it will increase transgene expression under the control of the insulin enhancer/promoter. Second, as IPF-1 appears to be critically involved in ⁇ -cell maturation, stable overexpression of IPF-1 in the ⁇ -cell lines should encourage these cells to maintain the differentiated function of a normal human ⁇ -cell.
  • Proteins can be grouped generally into two categories - secreted and non-secreted - discussions of each are detailed below. There are some general properties of proteins that are worthy of discussion at this juncture.
  • proteins will not have a single sequence but, rather, will exists in many forms. These forms may represent allelic variation or, rather, mutant forms of a given protein.
  • various proteins may be expressed advantageously as "fusion" proteins. Fusions .are generated by linking together the coding regions for two proteins, or parts of two proteins. This generates a new, single coding region that gives rise to the fusion protein. Fusions may be useful in producing secreted forms of proteins that .are not normally secreted or producing molecules that are immunologically tagged. Tagged proteins may be more easily purified or monitored using antibodies to the tag.
  • a third variation contemplated by the present invention involves the expression of protein fragments. It may not be necessary to express an entire protein and, in some cases, it may be desirable to express a particular functional domain, for example, where the protein fragment remains functional but is more stable, or less antigenic, or both. a. Secreted Proteins
  • Examples would include soluble CD-4, Factor VIII, Factor IX, von Willebrand Factor, TPA, urokinase, hirudin, interferons, TNF, interleukins, hematopoietic growth factors, antibodies, albumin, leptin, transferrin and nerve growth factors.
  • Peptide Hormones Peptide hormones claimed herein for engineering in neuroendocrine cells are grouped into three classes with specific examples given for each. These classes are defined by the complexity of their post-translational processing. Class I is represented by Growth Hormone, Prolactin and Parathyroid hormone. A more extensive list of human peptides that are included in Class I is given in Table 4. These require relatively limited proteolytic processing followed by storage and stimulated release from secretory granules. Class II is represented by Insulin and Glucagon. A more extensive list of human peptide hormones that are included in Class II are given in Table 5.
  • Class III is represented by Amylin, Glucagon-like Peptide I and Calcitonin. Again, a more extensive list of Class III human peptide hormones is given in Table 6. In addition to the proteolytic processing found in the Class II peptides, amidation ofthe C-terminus is required for proper biological function. Examples of engineering expression of all three of these closes of peptide hormones in a neuroendocrine cell are found in this patent.
  • GIP Gastric Inhibitory Peptide
  • VIP Vasoactive Intestinal Peptide
  • Alpha Melanocyte Stimulating Hormone alpha-MSH
  • GHRH Growth Hormone Releasing Factor
  • LHRH Luteinizing Hormone-Releasing Hormone
  • Substance K Neurokinin A
  • Non-secreted proteins can be engineered into neuroendocrine cells.
  • Two general classes of such proteins can be defined. The first are proteins that, once expressed in cells, stay associated with the cells in a variety of destinations. These destinations include the cytoplasm, nucleus, mitochondria, endoplasmic reticulum, golgi, membr.ane of secretory granules and plasma membrane.
  • Non-secreted proteins are both soluble and membrane associated.
  • the second class of proteins are ones that are normally associated with the cell, but have been modified such that they are now secreted by the cell. Modifications would include site-directed mutagenesis or expression of truncations of engineered proteins resulting in their secretion as well as creating novel fusion proteins that result in secretion of a normally non-secreted protein.
  • Cells engineered to produce such proteins could be used for either in vitro production of the protein or for in vivo, cell-b>ased therapies.
  • In vitro production would entail purification of the expressed protein from either the cell pellet for proteins remaining associated with the cell or from the conditioned media from cells secreting the engineered protein.
  • cell-based therapies would either he based on secretion ofthe engineered protein or beneficial effects ofthe cells expressing a non-secreted protein.
  • the cDNA's encoding a number of therapeutically useful human proteins are available. These include cell surface receptors, transporters and channels such as GLUT2, CFTR, leptin receptor, sulfonylurea receptor, ⁇ -cell inward rectifying channels, ⁇ 2-adrenergic receptor, pancreatic polypeptide receptor, somatostatin receptor, glucocorticoid receptor, potassium inward rectifying channel, GLP-1 receptor and muscarinic receptor etc.
  • Other proteins include protein processing enzymes such as PC2 and PC3, and PAM, transcription factors such as IPF1, and metabolic enzymes such as adenosine deaminase, phenylalanine hydroxylase, glucocerebrosidase .
  • the engineered cells may express and overexpress the obesity-associated protein known as leptin.
  • leptin is a peptide hormone that controls body composition and is believed to do so, at least in part, via interaction with hypothalamic receptors that regulate food intake and body weight.
  • the various isoforms of leptin receptor (Ob-R), including the long isoform (OB- Rb), are widely expressed in various tissues, suggesting that leptin may play an important role in actions on extraneural tissues as well.
  • leptin-induced triglyceride depletion involves a novel mechanisms by which triglyceride disappears through enhanced intracellular triglyceride metabolism, rather th,an through more traditional free fatty acid export pathways.
  • Insulin levels in adenovirus-leptin infected rats dropped even more dramatically than the fatty acids, being only about 1/3 of the .amount seen in controls. As stated above, the glucose levels of these animals was normal, however. These findings are consistent with enhanced insulin sensitivity in treated animals. Pancreata were isolated from hyperleptinemic rats and examined for ⁇ -cell function .and morphology. The most striking finding w.as the complete absence of insulin secretion in response to either glucose or arginine. The morphology appeared normal, and it was determined that insulin secretion could be reestablished following perfusion of pancreatic tissue in the presence of free fatty acids, thereby establishing an important role for these molecules in ⁇ -cell function.
  • the predisposition to diabetes in homozygous ZDF rats may reflect the fact that their tissue have been completely "unleptinized” throughout their life and therefore have accumulated high levels of TG. In normal rats, this accumulation is prevented by the action of leptin. It is expected that any therapy that reduces triglycerides in islets and in the target tissues of insulin will improve ⁇ -cell function and reduce insulin resistance.
  • the present application therefore encompasses various engineered cells which express leptin in amounts in excess of normal.
  • leptin genes may be manipulated and introduced are much the same as for other genes included herein, such as amylin.
  • a preferred embodiment would involve the use of a viral vector to deliver a leptin-encoding gene, for example, an adenoviral vector.
  • This approach may be exploited in at least two ways. First, in the engineering of cells to produce certain polypeptides in vitro, it may be desirable to express high levels of leptin in order to downregulate various cellular functions, including synthesis of certain proteins.
  • leptin overexpression may synergize with cellular functions, resulting in the increased expression of an endogenous or exogenous polypeptide of interest.
  • a leptin-overexpressing cell or a leptin expression construct, such as a leptin-expressing adenovirus, in an in vivo context.
  • leptin expressing cell lines may provide for prolonged expression of leptin in vivo .and for high level expression. Preliminary results indicate that injection of recombinantly produced leptin is less efficacious at achieving weight loss and reduction of lipids.
  • Induction of hyperleptinemia using cells lines or expression constructs also may find use in reducing fat content in livestock just prior to slaughter.
  • leptin-induced weight loss may act through different mechanisms than those currently employed, it may be possible to avoid related side effects such as diet-induced ketosis, heart attack and other diet- related symptoms.
  • These regimens may involve combinations of other engineered cells, cells engineered with leptin and at least one other gene or genetic construct (knock-out, antisense, ribozyme, etc.), combination gene therapy or combination with a drug.
  • the methods of delivering such pharmaceutical preparations are described elsewhere in this document
  • the engineered cells may express and/or overexpress certain enzymes of therapeutic value.
  • enzymes include by are not limited to adenosine deaminase (e.g. Genbank Accession Nos. P55265; U18121; U73107; Z97053; P00813; U75503; DUHUA), galactosidase (e.g. Genbank Accession Nos P54803; P51569; P23780; D00039), glucosidase (e.g.
  • P00740 human K02402 (human) P00741 (bovine) and A22493
  • sphingolipase lysosomal acid lipase (e.g., Genbank Accession Nos P38571; S41408), lipoprotein lipase (e.g., Genbank Accession No. P06858), hepatic lipase (e.g., Genbank Accession Nos. AF037404; PI 1150; P07098), pancreatic lipase related protein (e.g., Genbank Accession Nos. P54315; P54317) pancreatic lipase (P16233) and uronidase.
  • Genbank Accession Nos P38571; S41408 lipoprotein lipase
  • hepatic lipase e.g., Genbank Accession Nos. AF037404; PI 1150; P07098
  • pancreatic lipase related protein e.
  • the present invention also contemplates augmenting or increasing the capabilities of cells to produce biologically active polypeptides. This can be accomplished, in some instances, by overexpressing the proteins involved in protein processing, such as the endoproteases PC2 and PC3 (Steiner et al, 1992) or the peptide amidating enzyme, PAM (Eipper et al, 1992a) in the case of amidated peptide hormones.
  • proteins involved in protein processing such as the endoproteases PC2 and PC3 (Steiner et al, 1992) or the peptide amidating enzyme, PAM (Eipper et al, 1992a) in the case of amidated peptide hormones.
  • IPF1 Insulin Promoter Factor 1
  • Insulin promoter factor 1 (IPF-1; also referred to as STF-1, IDX-1, PDX-1 and ⁇ TF-1) is a homeodomain-containing transcription factor proposed to play an important role in both pancreatic development and insulin gene expression in mature ⁇ -cells (Ohlsson et al, 1993, Leonard et al, 1993, Miller et al, 1994, Kruse et al, 1993). In embryos, IPF-1 is expressed prior to islet cell hormone gene expression and is restricted to positions within the primitive foregut where pancreas will later form. Indeed, mice in which the IPF-1 gene is disrupted by targeted knockout do not form a pancreas (Jonsson et al, 1994).
  • IPF-1 expression becomes restricted predominantly to ⁇ -cells. IPF-1 binds to TAAT consensus motifs contained within the FLAT E and PI elements of the insulin enhancer/promoter, whereupon, it interacts with other transcription factors to activate insulin gene transcription (Peers et al, 1994).
  • IPF-1 in neuroendocrine ⁇ -cell lines will serve two purposes. First, it will increase transgene expression under the control of the insulin enhancer/promoter.
  • IPF-1 appears to be critically involved in ⁇ -cell maturation
  • stable overexpression of IPF-1 in ⁇ -cell lines should cause these mostly dedifferentiated ⁇ -cells to regain the more differentiated function of a normal animal ⁇ -cell. If so, then these redifferentiated ⁇ -cell lines could potentially function as a more effective neuroendocrine cell type for cell-based delivery of fully processed, bioactive peptide hormones.
  • cell surface proteins such as the ⁇ -cell-specific inwardly rectifying potassium channel (BIR; Inagaki et al, 1995), involved in release of the secretory granule contents upon glucose stimulation, the sulfonylurea receptor (SUR), and other ATP sensitive channels.
  • BIR ⁇ -cell-specific inwardly rectifying potassium channel
  • SUR sulfonylurea receptor
  • Other cell surface signaling receptors which help potentiate the glucose-stimulated degranulation of ⁇ -cells including the glucagon-like peptide I receptor (Thorens, 1992) and the glucose-dependent insulinotropic polypeptide receptor (also known as gastric inhibitory peptide receptor) (Usdin, 1993) can be engineered into neuroendocrine cells.
  • ⁇ -cell-specific signaling receptors are involved in secretory granule release in response to glucose.
  • glucose stimulated release of any heterologous peptide targeted to the secretory granule can be engineered.
  • other cell surface signaling proteins involved in non-glucose- stimulated release of secretory granule contents can be engineered into neuroendocrine cells. Examples would include releasing factor receptors such as Growth Hormone Releasing Factor Receptor (Lin et al, 1992) and Somatostatin or Growth Hormone Releasing Hormone Receptor (Mayo, 1992).
  • the present invention further includes embodiments where the resultant stable neuroendocrine cells .are further engineered to modify the secretion of the endogenous secretory polypeptide in response to one or more secretagogues.
  • the engineering of the resultant stable cells to generate a more physiologically-relevant regulated secretory response includes engineering the expression or overexpression of signaling proteins known to play a role in the regulated secretory response of neuroendocrine cells.
  • cell surface proteins such as the ⁇ -cell-specific inwardly rectifying potassium channel ( ⁇ cell inward rectifier, BIR; Inagaki et al, 1995), involved in release of the secretory granule contents upon glucose stimulation, the sulfonylurea receptor (SUR), late-rectifying voltage-gated channels, and ATP sensitive channel.
  • ⁇ cell inward rectifier BIR
  • SUR sulfonylurea receptor
  • ATP sensitive channel ATP sensitive channel.
  • heterologous releasing factor receptors may be used in these aspects ofthe invention, as may adrenergic receptors and the like.
  • ⁇ -cells which assist with potentiating the glucose- stimulated degranulation of ⁇ -cells include the glucagon-like peptide I receptor (Thorens, 1992) and the glucose-dependent insulinotropic polypeptide receptor (also known as gastric inhibitory peptide receptor) (Usdin et al, 1993), which can also be engineered into neuroendocrine cells according to the present invention.
  • glucagon-like peptide I receptor Thirens, 1992
  • glucose-dependent insulinotropic polypeptide receptor also known as gastric inhibitory peptide receptor
  • GLUT-2 and glucokinase see below
  • glucose stimulated release of a peptides targeted to the secretory granule can be reengineered or enhanced.
  • cell surface signaling proteins involved in non- glucose-stimulated release of secretory granule contents can be engineered into the stable neuroendocrine cells of the invention.
  • releasing factor receptors such as Growth Hormone Releasing Factor Receptor (Lin et al, 1992) and Somatostatin or Growth Hormone Releasing Hormone Receptor (Mayo, 1992).
  • the pancreatic ⁇ -cell is continually exposed to a complex mixture of molecules that modulate insulin synthesis, storage, and exocytosis.
  • the information in this mixture is translated to regulatory signals by three distinct mechanisms: (1) transport into the cell and metabolism of fuels, (2) ion fluxes, relative to extracellular and intracellular ion pools, and (3) hormonal signals that are mediated via receptors (reviewed in Komatsu et al. , 1997).
  • the transport and metabolism of glucose is the dominant signal that regulates insulin secretion.
  • a large portion of the glucose effect is mediated by K + -ATP channels, depends on membrane polarity, and regulates the influx of extracellular calcium through L-type Ca channels.
  • Amino acids are another fuel that participate in insulin secretion via the regulation ofthe K + -ATP channel.
  • Glucose metabolism also affects intracellular Ca stores by mechanisms that are independent of K + -ATP channels. This portion of glucose-regulated insulin secretion is augmented by many other molecules involved in glycemic control such as fatty acids and muscarinic receptor ligands. Binding to the muscarinic receptor by acetylcholine results in the activation of phospholipases, enzymes that catalyze the conversion of phophoinositides to inositol triphosphates (IP3) and diacylglycerol (DAG). Increased IP3 levels stimulate the release of Ca from intracellular stores and contribute to signals for exocytosis of insulin.
  • IP3 inositol triphosphates
  • DAG diacylglycerol
  • Increased IP3 levels stimulate the release of Ca from intracellular stores and contribute to signals for exocytosis of insulin.
  • a central theme in Ca -induced secretion is the activation of Ca /calmodulin-dependent kinases that
  • This form of regulation applies most often to the augmenting effects observed for hormones that bind receptors such as GLP-1, GIP, pituitary adenylate cyclase activating peptide (PACAP), and vasoactive intestinal peptide (VIP).
  • Receptors for these peptide hormones are typically coupled to GTP-binding proteins that regulate the membrane bound form of adenylate cyclase. Stimulation ofthe receptors results in increases in cyclic AMP levels and increases in the activity of protein kinase A, a potentiator of insulin secretion.
  • Protein kinase C is stimulated by DAG and functions to augment glucose- stimulated insulin secretion. ( Komatsu et al, 1997).
  • Prentki has proposed a model for glucose metabolism that takes into account many aspects of stimulated insulin secretion (Prentki, 1994). It categorizes stimulatory events as glycolytic and post-glycolytic and supports the view that the glucose-mediated regulation of insulin secretion cannot be fully explained by the effects of the K + -ATP channels and increases
  • pyruvate is a key intermediate metabolite and its fates provide two distinct mechanisms to stimulate secretion.
  • Pyruvate dehydrogenase which is stimulated by an increase in the ATP/ADP ratios resulting from glycolysis, moves the metabolism of glucose toward the citric acid cycle by the conversion of pyruvate to acetyl CoA.
  • Carbon fluxes through the citric acid cycle boost the ATP/ADP ratios even higher, and stimulate the closure of K + -ATP channels and the concomitant increases in intracellular Ca 2+ .
  • Pyruvate also is a key metabolite in anaplerosis, the replenishment of citric acid cycle intermediates.
  • This arm of pyruvate metabolism is initiated by the activity of pyruvate carboxylase, an enzyme that catalyzes the conversion of pyruvate to citrate.
  • citrate carboxylase an enzyme that catalyzes the conversion of pyruvate to citrate.
  • malonyl CoA a molecule that provides a link between glucose metabolism and fatty acid metabolism.
  • Increases in malonyl CoA promote the accumulation of fatty acid intermediates, potentiators of insulin secretion that appear to be independent of Ca 2+ (Prentki, 1994).
  • the related patent application entitled "Methods for preparing and using immortalized human neuroendocrine cells” attorney docket number BTGN:020PZ1 provides methods for using immortalized stable human neuroendocrine cells or secretory cells that have maintained their regulated secretory pathway.
  • the present section describes the engineering of such stable cell line.
  • the methods generally comprise providing to a starting neuroendocrine or regulated secretory cell an effective amount of a transforming genetic construct that comprises an operative transforming unit under the transcriptional control of a promoter specific for the target neuroendocrine cell.
  • the present section is directed to tranforming genetic constructs for the generation of immortalized cells, it will be understood that the discussions regarding the vectors, promoters, enhancers and IRESs are equally applicable in the context of iterative engineering the cells.
  • the target human neuroendocrine cells will be provided with the tr.ansforming genetic construct by infection with a recombinant virus, most preferably an adenovirus, that comprises the transforming construct.
  • a recombinant virus most preferably an adenovirus
  • the methods described herein may involve the use of two, three or more distinct transforming genetic constructs.
  • the use of defined media, or the use of defined media supplemented with one or more growth factors specific for the target neuroendocrine cells is contemplated.
  • promoters that have enhanced transcriptional activity, such as promoters comprising muitimerized promoter elements, the additional provision of a growth factor receptor gene to the target cell and/or the use of transforming genetic constructs that involve elements for effecting controlled or regulated expression or subsequent excision.
  • the present section relates to the transforming genes and genetic constructs.
  • Exemplary transforming genes and constructs are listed herein in Table 7. Any one or more of the genes listed therein may be used in the context of the present invention. Where two or more transforming genes are provided to a human neuroendocrine cell, it may be preferable to provide genes from different functional categories, such as those that perturb signal transduction, affect cell cycle, alter nuclear transcription, alter telomere structure or function, inhibit apoptosis, or that exert pleiotropic activities. It will be understood that the genes listed in Table 7 are only exemplary of the types of oncogenes, mutated tumor suppressors and other transforming genetic constructs and elements that may be used in this invention. Further transforming genes and constructs will be known to those of ordinary skill in the art. Table 7. Exemplary Oncogenes and Mutant Tumor Suppressors
  • the immortalizing genetic construct will comprise a gene or cDNA that is responsible for the perturbation of signal transduction.
  • Representative members of this class are genes or cDNAs encoding tyrosine kinases, serine/threonine kinases, growth factors and receptors, small GTPases, and receptor-type tyrosine phosphatase IA-2.
  • Exemplary of the members preferred for this use is neu (also known as her2 or erbB-2; GenB.ank accession numbers Ml 1730, X03363, U02326 and S57296).
  • neu was discovered as an oncogene in breast cancer, but it also is found in other forms of cancer, neu appears to be a member of the receptor tyrosine kinase family.
  • HGFr also known as scatter factor receptor
  • This is an example of a receptor, either endogenously present or expressed from a recombinant adenovirus, that is used to stimulate proliferation of a target cell population.
  • Other preferred members are insulin-like growth factor 1 receptor (GenBank accession number X04434 and M24599), and GTPase Gs ⁇ (GenBank accession numbers X56009, X04409).
  • Gs ⁇ is associated with pituitary tumors that secrete growth hormone, but not other neuroendocrine or endocrine tumors.
  • the immortalization genetic construct may be a factor that affects the cell cycle.
  • cyclin Dl also known as PRAD or bcl- 1; GenBank accession numbers M64349 and M73554
  • This is associated as an oncogene primarily with parathyroid tumors.
  • Other factors that may comprise the genetic immortalization construct include those gene that alter nuclear transcription c-myc (GenBank accession numbers J00120, K01980, M23541, V00501, X00364).
  • Inhibitors of apoptosis are also preferred for use is bcl-2 (distinct from bcl-1, cyclin Dl ; GenBank accession numbers M14745, X06487).
  • bcl-2 functions as an oncogene by binding and inactivating Bax, a protein in the apoptotic pathway.
  • the genetic constructs comprises molecules pleiotropic activities, preferred from this class is SV40 large T antigen (TAG; GenBank accession number J02400). Also preferred is temperature sensitive large T antigen.
  • genes that will be useful in immortalizing the neuroendocrine cells would be to use constructs that result in the failure to promote apoptosis.
  • Preferred in this category are p53 and the retinoblastoma gene.
  • Most forms of cancer have reports of p53 mutations. Inactivation of p53 results in a failure to promote apoptosis. With this failure, cancer cells progress in tumorogenesis rather than be destined for cell death.
  • a short list of cancers and mutations found in p53 is: ovarian (GenBank accession numbers S53545, S62213, S62216); liver (GenBank accession numbers S62711, S62713, S62714, S67715, S72716); gastric (GenBank accession numbers S63157); colon (GenBank accession numbers S63610); bladder (GenBank accession numbers S85568, S85570, S85691); lung (GenBank accession numbers S41969, S41977); and glioma (GenBank accession numbers S85807, S85712, S85713).
  • the invention contemplates the use of growth factor receptor genes and growth factor genes as the transforming elements.
  • human cells are infected with a recombinant adenovirus that provides overexpression of growth hormone receptor (GenBank Accession Nos. J0481 1 and X06562) controlled by the modRIP (or modHIP) promoter. Cells cultured in a defined medium would then be stimulated to proliferate by the addition of growth hormone to the medium. The replicating population of cells are then transformed by retroviral constructs that will result in stable expression of growth hormone receptor or an alternate transforming gene.
  • a recombinant adenovirus that provides overexpression of growth hormone receptor (GenBank Accession Nos. J0481 1 and X06562) controlled by the modRIP (or modHIP) promoter. Cells cultured in a defined medium would then be stimulated to proliferate by the addition of growth hormone to the medium. The replicating population of cells are then transformed by retroviral constructs that will result in stable expression of growth hormone receptor or an alternate
  • the invention contemplates the use of several transforming gene constructs in combination.
  • the transforming genetic construct may include more than one operative transforming unit, or more than one construct can be supplied.
  • glucagon Genebank Accession No: X03991
  • polypeptides involved in the regulation of glucagon expression such as ⁇ -1 adrenergic receptor (Genbank Accession No: U03866, L31774; U03864; U03865), ⁇ adrenergic receptor
  • ⁇ -cells or insulin secretory cells are engineered to be responsive to molecules that will have the effect of lowering insulin secretion and thereby allowing the surrounding glucose concentration to return to normal physiological levels, such molecules include but are not limited to ⁇ 2 adrenergic receptor, pancreatic polypeptide receptor, and glucocorticoid receptor.
  • Glucose sensing may be provided by iteratively engineering the cells to express GLUT-2 or glucokinase as described in U.S. Patent 5,427,940.
  • expression construct is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all ofthe nucleic acid encoding sequence is capable of being transcribed.
  • the transcript may be translated into a protein, but it need not be.
  • expression includes both transcription of a gene and translation of mRNA into a gene product.
  • expression only includes transcription ofthe nucleic acid encoding a gene of interest.
  • the nucleic acid encoding a gene product is under transcriptional control of a promoter.
  • a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
  • under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression ofthe gene.
  • promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II. Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) .and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins.
  • At least one module in each promoter functions to position the start site for RNA synthesis.
  • the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream ofthe start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline.
  • individual elements can function either co-operatively or independently to activate transcription.
  • the particular promoter that is employed to control the expression of a nucleic acid encoding a particular gene is not believed to be important, so long as it is capable of expressing the nucleic acid in the targeted cell.
  • a human cell it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell.
  • a promoter might include either a human or viral promoter.
  • the human cytomegalovirus (CMV) immediate early gene promoter can be used to obtain high-level expression of the gene of interest.
  • CMV cytomegalovirus
  • the use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a gene of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.
  • Tables 3 and 4 list several elements/promoters which may be employed, in the context ofthe present invention, to regulate the expression ofthe gene of interest. This list is not intended to be exhaustive of all the possible elements involved in the promotion of gene expression but, merely, to be exemplary thereof.
  • Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements.
  • a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
  • Eukaryotic promoters can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • NC AM Neural Cell Adhesion Molecule
  • SAA Human Serum Amyloid A
  • the expression ofthe genetic construct is under the control of a promoter.
  • the promoter is required to express the genetic construct to a degree sufficient to effect transformation of a target cell type .amongst a population of different cell types such that the transformed target cell results in the generation of a stable human regulated secretory cell.
  • the promoter drives the expression of the transgenic construct employed to engineer glucose counter-regulation into a cell.
  • Promoters can be classified into two groups, ubiquitous and tissue- or cell-specific. Ubiquitous promoters activate transcription in all or most tissues and cell types. Examples of ubiquitous promoters are cellular promoters like the histone promoters, promoters for many metabolic enzyme genes such as hexokinase I and glyceraldehyde-3 -phosphate dehydrogenase, and many viral promoters such as CMVp and the Rous sarcoma virus promoter (RSVp).
  • ubiquitous promoters are cellular promoters like the histone promoters, promoters for many metabolic enzyme genes such as hexokinase I and glyceraldehyde-3 -phosphate dehydrogenase, and many viral promoters such as CMVp and the Rous sarcoma virus promoter (RSVp).
  • Tissue- or cell-specific promoters activate transcription in a restricted set of tissues or cell types or, in some cases, only in a single cell type of a particular tissue.
  • stringent cell-specific promoters are the insulin gene promoters which .are expressed in only a single cell type (pancreatic ⁇ cells) while remaining silent in all other cell types, and the immunoglobulin gene promoters which are expressed only in cell types ofthe immune system.
  • promoters are shown above in Table 2 (Pearse and Takor, 1979; Nylen and Becker, 1995). Although not a complete list, these promoters .are exemplary of the types of promoters contemplated for use in the present invention. Additional promoters useful in the present invention will be readily known to those of skill in the art.
  • the promoter may be "context specific" in that it will be expressed only in the desired cell type and not in other cell types that are likely to be present in the population of target cells, e.g., it will be expressed in ⁇ cells, but not in ⁇ or ⁇ cells, when introduced into intact human islets.
  • an insulin promoter targets the expression of a linked transforming oncogene selectively to ⁇ cells of a human islet preparation even though many other contaminating cell types exist in the preparation.
  • the present invention is applicable to the generation of stably transformed neuroendocrine secretory cell lines other than ⁇ cells, other context specific promoters may be employed.
  • the cell-specific prolactin gene promoter can be used to express a linked transforming oncogene selectively to lactotrophs surrounded by all the other cell types present in a pituitary cell preparation.
  • HIP can direct cell-specific expression of linked genes in rodent ⁇ cell lines and rat primary islets, albeit, at a somewhat lower level than that observed for
  • RIPl and RIP2 should function effectively in human ⁇ cells.
  • FF RIPl FAR/FLAT minienhancer
  • glucagon promoter GenBank accession number X03991
  • growth hormone promoter GenBank accession numbers J03071 and K00470
  • POMC gene promoter GenBank accession numbers V01510 and K02406
  • calcitonin promoter GenBank accession number X15943
  • GIP gene promoter GenBank accession number M31674.
  • Promoters can be modified in a number of ways to increase their transcriptional activity. Multiple copies of a given promoter can be linked in tandem, mutations which increase activity may be introduced, single or multiple copies of individual promoter elements may be attached, parts of unrelated promoters may be fused together, or some combination of all of the above can be employed to generate highly active promoters. All such methods are contemplated for use in connection with the present invention.
  • German et al. (1992) mutated three nucleotides in the transcriptionally important FLAT E box of the rat insulin I gene promoter (RIP), resulting in a three- to four-fold increase in transcriptional activity of the mutated RIP compared to that of a nonmutated RIP as assayed in transiently transfected HIT cells. Also, the introduction of multiple copies of a promoter element from the E. coli tetracycline resistance operon promoter were introduced into the CMV promoter, significantly increasing the activity of this already very potent promoter (Liang et al, 1996).
  • CMV promoter which has high but short-lived transcriptional activity in dog myoblasts
  • MCKp muscle-specific creatine kinase promoter
  • modified rat insulin promoters containing multimerized enhancer elements have been engineered.
  • modRIP modified rat insulin promoters
  • the currently preferred modRIP contains six multimerized repeats of a 50 base pair region of the cis acting enhancer of RIP, placed upstream of an intact copy of RIP.
  • CMVp Cytomegalovirus promoter
  • a cDNA insert where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, .and any such sequence may be employed.
  • a terminator Also contemplated as an element of the expression cassette is a terminator. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • the delivery of a nucleic acid in a cell may be identified in vitro or in vivo by including a marker in the expression construct.
  • the marker would result in .an identifiable change to the transfected cell permitting easy identification of expression.
  • a drug selection marker aids in cloning and in the selection of transformants, for example, neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol.
  • enzymes such as herpes simplex virus thymidine kinase (tk) (euk-aryotic) or chloramphenicol acetyltransferase (CAT) (prokaryotic) may be employed.
  • Immunologic markers also can be employed.
  • the selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable markers are well known to one of skill in the art.
  • IRES elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picanovirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue ofthe IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.
  • Any heterologous open reading frame can be linked to IRES elements. This includes genes for secreted proteins, multi-subunit proteins, encoded by independent genes, intracellular or membrane-bound proteins and selectable markers. In this way, expression of several proteins can be simultaneously engineered into a cell with a single construct and a single selectable marker.
  • the neuroendocrine cell and the stable neuroendocrine cells for use in the present invention will be grown in cell culture.
  • the present section describes the methodology related to growth of cells in culture. 1. Culture Conditions
  • ⁇ cells are expanded by established culture conditions. For example, ⁇ cells can be cultured and even induced to divide as described (Clark and Chick, 1990; Beattie et al, 1991; Hayek et al, 1995; each incorporated herein by reference).
  • Human islets isolated by an automated method (Ricordi et al, 1988) are maintained in culture .and transformed by the inventive engineered expression of proteins that promote accelerated cell replication.
  • the transformation methods of the invention preferably involve the use of specific culture conditions designed to preferentially promote neuroendocrine cell growth, which are used in conjunction with the stable activation of cell specific gene promoter controlled protein expression.
  • the culture conditions are achieved by manipulating the following cell culture variables: media growth/survival factors (such as IGF-1, growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin), media differentiation factors (such as TGF- ⁇ ), media lipids, media metabolites (such as glucose, pyruvate, galactose, and amino acids), media serum (percentage serum, serum fraction, species of serum), gaseous exchange (ratio atmospheric 0 2 :C0 2 , and media volume), physical form of the islets prior to plating (whole, dispersed, or cell sorted islet cells), and extracellular substrate for cellular attachment (such as laminin, collagen, matrigel, and HTB-9 bladder carcinoma derived matrix).
  • media growth/survival factors such as IGF-1, growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin
  • media differentiation factors such as TGF- ⁇
  • media lipids such as glucose, pyruvate, galact
  • Fibroblast growth/survival in culture is eliminated by culturing the islets in defined media using factors (such as IGF-1, cysteine, and growth hormone) to selectively confer a growth/survival advantage to ⁇ cells in preference to fibroblasts.
  • factors such as IGF-1, cysteine, and growth hormone
  • Establishment of fibroblast free cultures will allow prolonged maintenance of human islet ⁇ cells in culture for subsequent infection with adenovirus expression vectors in cases where ⁇ cells are in a non-proliferative state, or retrovirus expression vectors for ⁇ cells which have been induced to proliferate by oncogene expression. Fibroblasts may even be killed by fibroblast-directed toxins.
  • Media comprising one or more growth factors that stimulate the growth of the target neuroendocrine cell and do not substantially stimulate growth of distinct cells in the cell population; i.e., act to induce preferential growth of the target cells rather than faster-growing, more hardy cells in the population, as may be used to deplete fibroblasts.
  • growth factors that stimulate the growth of the target neuroendocrine cell and do not substantially stimulate growth of distinct cells in the cell population; i.e., act to induce preferential growth of the target cells rather than faster-growing, more hardy cells in the population, as may be used to deplete fibroblasts.
  • Examples include defined serum free conditions used for ⁇ cells (Clark et al, 1990; incorporated herein by reference), or inclusion of growth or differentiation factors known to allow preferential growth of ⁇ cells (WO 95/29989; incorporated herein by reference).
  • the inventors have developed a media composition that will be particularly useful in the growth and propagation of the cells of the present invention.
  • the rational behind the development of "BetaGene" medium had its beginnings with the observation that in bioreactor high density cultures of ⁇ -cell line RIN-38, ethanolamine was a rapidly consumed component of the growth medium.
  • An equimolar mixture of ethanolamine- phosphoethanolamine was found to protect RIN-38 ⁇ -cells from linoleic acid toxicity (approximately 30 ⁇ g/ml linoleic acid in serum-free medium).
  • the method entails encapsulating ⁇ G18/3El cells- a rodent ⁇ -cell line engineered to secrete human insulin- in 1.5% alginate beads, ⁇ -cells encapsulated in beads are very .amenable to serumless culture, .and beads were cultured in different media ⁇ FBS for 3-6 days and insulin secretion was monitored to estimate growth and function.
  • the serumless cultures then were returned to the same base medium supplemented with FBS, with continued insulin monitoring.
  • the media screened were those most commonly used for culture of primary islets in the literature. Perform-ance of the different media were indicated by the rate and magnitude of functional loss, as well as the rate of recovery and completeness of recovery after return to FBS supplementation.
  • One medium CMRL 1066 was clearly inferior, while Ml 99, and a-MEM were fairly equivalent.
  • Media such as F12 and RPMI were not readily evaluated by this approach, due to the low calcium concentration of these media and resultant deterioration of the Ca-alginate hydrogel. The latter were then evaluated as equal mixtures with Ml 99 and MEM.
  • An M199-F12 mixture was determined to be the best performing formulation tested, while an MEM-F12 mixture could be used with at least short term equivalency.
  • Many components ofthe ⁇ G Medium are at concentrations that would be found in mixed formulations.
  • Bicarbonate was increased in the formulation to provide better pH control for scale-up cultures (such as the CellCubeTM).
  • Zinc was supplemented because primary beta cells have high concentrations of zinc and several islet enzymes bind Zn, and insulin crystal is coordinate with Zn.
  • glucose concentrations are known to be critical for ⁇ -cell culture.
  • One objective of the medium development was to derive a formulation that would optimally support primary pancreatic islets as well as ⁇ -cell lines. As a result, human islets were used to determine a glucose concentration that could support survival and function of human islets in culture.
  • Glucose in the range of 7 mM (6-8 mM) provided long term survival (months) of human islets, with maintenance of glucose sensing, as indicated by dose-response studies of glucose-induced insulin secretion, and by maintained insulin processing.
  • Cells may be induced to proliferate by initial infection with adenovirus or adeno- associated virus (AAV) comprising a gene that induces cellular proliferation, the gene being under the control of a promoter specific for the regulated secretory cell.
  • AAV adeno-associated virus
  • the cells may be induced to proliferate by growth on a stimulatory cell matrix (Hayek et al, 1995).
  • the transformed human cells may be placed in vivo, e.g., under kidney capsule of the nude rat, to allow outgrowth of transformed cells.
  • the lack of an immune response in the nude rat is known to allow long term survival and expression of recombinant adenovirus infected cells (Dai et ⁇ l., 1995; Yang et ⁇ l, 1994b).
  • the nucleic acid encoding the genes may be stably integrated into the genome of the cell.
  • the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA.
  • Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of, or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed. All expression constructs .and delivery methods .are contemplated for use in the context of the present invention, although certain methods are preferred, as outlined below.
  • the expression construct In order to effect expression of a gene construct, the expression construct must be delivered into a cell. As described below, the preferred mechanism for delivery is via viral infection, where the expression construct is encapsidated in an infectious viral particle. However, several non-viral methods for the transfer of expression constructs into cultured mammalian cells also are contemplated by the present invention. In one embodiment of the present invention, the expression construct may consist only of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned which physically or chemically permeabilize the cell membrane.
  • the expression construct may be entrapped in a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated is an expression construct complexed with Lipofectamine (Gibco BRL).
  • Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987). Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
  • the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
  • HVJ hemagglutinating virus
  • the liposome may be complexed or employed in conjunction with nuclear non- histone chromosomal proteins (HMG-1) (Kato et al, 1991).
  • HMG-1 nuclear non- histone chromosomal proteins
  • the liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
  • the expression construct is introduced into the cell via electroporation. Electroporation involves the exposure of a suspension of cells and DNA to a high- voltage electric discharge.
  • the expression construct is introduced to the cells using calcium phosphate precipitation.
  • Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique.
  • mouse L(A9), mouse C127, CHO, CV-1 , BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al, 1990).
  • the expression construct is delivered into the cell using DEAE- dextran followed by polyethylene glycol.
  • reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).
  • Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987).
  • Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990).
  • the microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads. Gainer et al. (1996) have transfected mouse islets with a luciferase gene/human immediate early promoter reporter construct, using ballistic particles accelerated by helium pressure.
  • Further embodiments of the present invention include the introduction of the expression construct by direct microinjection or sonication loading.
  • Direct microinjection has been used to introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub, 1985), and
  • Still further expression constructs that may be employed to deliver the tissue-specific promoter and transforming construct to the target cells are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in the target cells. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention. Specific delivery in the context of another mammalian cell type is described by Wu and Wu (1993; incorporated herein by reference).
  • Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a DNA-binding agent. Others comprise a cell receptor-specific ligand to which the DNA construct to be delivered has been operatively attached.
  • Several ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987, 1988; Wagner et al, 1990; Ferkol et al, 1993; Perales et al, 1994; Myers, EPO 0273085), which establishes the operability of the technique.
  • the ligand will be chosen to correspond to a receptor specifically expressed on the neuroendocrine target cell population.
  • the DNA delivery vehicle component of a cell-specific gene targeting vehicle may comprise a specific binding ligand in combination with a liposome.
  • the nucleic acids to be delivered are housed within the liposome and the specific binding ligand is functionally incorporated into the liposome membrane.
  • the liposome will thus specifically bind to the receptors of the target cell and deliver the contents to the cell.
  • Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.
  • EGF epidermal growth factor
  • the DNA delivery vehicle component of the targeted delivery vehicles may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
  • a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
  • Nicolau et al. (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, incorporated into liposomes and observed .an increase in the uptake ofthe insulin gene by hepatocytes.
  • the tissue-specific transforming constructs of the present invention can be specifically delivered into the target cells in a similar manner.
  • receptor mediated transfection is adenoviral assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et al, 1992; Curiel, 1994), and the inventors contemplate using the same technique to increase transfection efficiencies into human islets.
  • adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue-specific transforming construct that has been cloned therein.
  • the expression vector comprises a genetically engineered form of adenovirus.
  • retrovirus the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
  • adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification.
  • Adenovirus is particularly suitable for use as a gene transfer vector because of its mid- sized genome, ease of manipulation, high titer, wide target-cell range and high infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging.
  • ITRs inverted repeats
  • the early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication.
  • the El region (El A and E1B) encodes proteins responsible for the regulation of transcription ofthe viral genome and a few cellular genes.
  • the expression of the E2 region results in the synthesis of the proteins for viral DNA replication.
  • MLP major late promoter
  • TPL 5'-tripartite leader
  • recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process.
  • adenovirus generation and propagation of the current adenovirus vectors, which are replication deficient, depend on a helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham et al, 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the D3 or both regions (Graham and Prevec, 1991). In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury et al, 1987), providing capacity for about 2 extra kb of DNA.
  • the maximum capacity of the current adenovirus vector is under 7.5 kb, or about 15% of the total length ofthe vector. More than 80% ofthe adenovirus viral genome remains in the vector backbone.
  • Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
  • the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells.
  • the preferred helper cell line is 293.
  • Racher et al (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus.
  • natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100- 200 ml of medium. Following stirring at 40 rpm, the cell viability is estimated with trypan blue.
  • Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/1) is employed as follows.
  • the adenovirus may be of any of the 42 different known serotypes or subgroups A-F.
  • Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.
  • the typical vector according to the present invention is replication defective and will not have an adenovirus El region.
  • the position of insertion of the construct within the adenovirus sequences is not critical to the invention.
  • the polynucleotide encoding the gene of interest also may be inserted in lieu of the deleted E3 region in E3 replacement vectors as described by Karlsson et ⁇ l., (1986) or in the E4 region where a helper cell line or helper virus complements the E4 defect.
  • Adenovirus growth and manipulation is known to those of skill in the art, and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10 -10 plaque-forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et ⁇ l., 1963; Top et ⁇ l., 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
  • Adenovirus vectors have been used in eukaryotic gene expression (Levrero et ⁇ l., 1991;
  • Recombinant adenovirus and adeno-associated virus can both infect and transduce non-dividing human primary cells.
  • gene transfer efficiencies of approximately 70% for isolated rat islets have been demonstrated by the inventors (Becker et al, 1994a; Becker et al, 1994b; Becker et al, 1996) as well as by other investigators (Gainer et al, 1996).
  • Adeno-associated virus is an attractive vector system for use in the human cell transformation of the present invention as it has a high frequency of integration and it can infect nondividing cells, thus making it useful for delivery of genes into mammalian cells in tissue culture (Muzyczka, 1992).
  • AAV has a broad host range for infectivity (Tratschin et al, 1984; Laughlin, et al, 1986; Lebkowski, et al, 1988; McLaughlin, et al, 1988), which means it is applicable for use with human neuroendocrine cells, however, the tissue-specific promoter aspect of the present invention will ensure specific expression of the transforming construct. Details concerning the generation and use of rAAV vectors are described in U.S. Patent No. 5,139,941 and U.S. Patent No. 4,797,368, each incorporated herein by reference.
  • AAV is a dependent parvovirus in that it requires coinfection with another virus (either adenovirus or a member ofthe herpes virus family) to undergo a productive infection in cultured cells (Muzyczka, 1992).
  • another virus either adenovirus or a member ofthe herpes virus family
  • helper virus the wild type AAV genome integrates through its ends into human chromosome 19 where it resides in a latent state as a provirus (Kotin et al, 1990; Samulski et al, 1991).
  • rAAV is not restricted to chromosome 19 for integration unless the AAV Rep protein also is expressed (Shelling and Smith, 1994).
  • recombinant AAV (rAAV) virus is made by cotransfecting a plasmid containing the gene of interest flanked by the two AAV terminal repeats (McLaughlin et al, 1988; Samulski et al, 1989; each incorporated herein by reference) and an expression plasmid containing the wild type AAV coding sequences without the terminal repeats, for example pIM45 (McCarty et al, 1991; incorporated herein by reference).
  • the cells are also infected or transfected with adenc virus or plasmids carrying the adenovirus genes required for AAV helper function.
  • rAAV virus stocks made in such fashion are contaminated with adenovirus which must be physically separated from the rAAV particles (for example, by cesium chloride density centrifugation).
  • adenovirus vectors containing the AAV coding regions or cell lines containing the AAV coding regions and some or all ofthe adenovirus helper genes could be used (Yang et al, 1994a; Clark et al, 1995). Cell lines carrying the rAAV DNA as an integrated provirus can also be used (Flotte et al, 1995).
  • the present invention contemplates infection of the target cells with a recombinant adeno-associated virus (AAV) containing an oncogene driven by a tissue specific promoter.
  • AAV adeno-associated virus
  • Recombinant AAV plasmids with RIP driving T antigen have been constructed.
  • the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin, 1990).
  • the resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins.
  • the integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
  • the retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively.
  • a sequence found upstream from the gag gene contains a signal for packaging ofthe genome into virions.
  • Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).
  • a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
  • a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al, 1983).
  • Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).
  • viral vectors may be employed as expression constructs in the present invention.
  • Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et ⁇ l., 1988) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et ⁇ l., 1988; Horwich et ⁇ l., 1990). With the recent recognition of defective hepatitis B viruses, new insight was gained into the structure-function relationship of different viral sequences. In vitro studies showed that the virus could retain the ability for helper-dependent packaging and reverse transcription despite the deletion of up to 80% of its genome (Horwich et al, 1990).
  • Chang et al recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus genome in the place of the polymerase, surface, and pre-surface coding sequences. It was cotransfected with wild-type virus into an avian hepatoma cell line. Culture media containing high titers of the recombinant virus were used to infect primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after ttansfection (Chang et al, 1991).
  • CAT chloramphenicol acetyltransferase
  • the nucleic acids to be delivered are housed within an infective virus that has been engineered to express a specific binding ligand.
  • the virus particle will thus bind specifically to the cognate receptors ofthe target cell and deliver the contents to the cell.
  • a novel approach designed to allow specific targeting of retro virus vectors was recently developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors.
  • a further alternative for practicing the present invention is to use adenovirus or AAV infection of primary cells leading to in vitro expansion of a primary cell population that is then amenable to stable oncogene transfer by methods requiring cell growth such as retroviral transduction, plasmid transfection of expanding cells (Lipofectin or electroporation), or a second round of Adenovirus and/or AAV infection.
  • Another embodiment of the invention is to use alternating AAV and adenovirus infections. Propagation of AAV is dependent upon adenovirus, and using both viruses may lead to more productive infections. Such a method may increase the number of final cells that have oncogenes integrated and expressed.
  • adenoviral gene delivery affords a very low rate of integration of viral and recombinant DNAs into the host cell genome. Consequently, adenoviral gene expression is diluted when the cells divide and typically is used only for transient gene expression.
  • An advantage that adenoviral gene delivery has over many other viral vectors is that entry of the virus into the cell .and the expression of transgenic proteins is not dependent on cellular replication. This benefit of adenoviral gene delivery is in contrast to retroviruses where the integration and sustained expression of virally introduced DNA is dependent on cellular replication.
  • pancreatic ⁇ -cells typically do not divide in culture and are thereby resistant to transformation by immortalizing gene constructs delivered by retroviruses.
  • human ⁇ -cells can be infected with adenovirus for the purposes of transgenic protein expression.
  • human ⁇ -cells or pancreatic islets would first be infected with a recombinant adenovirus that provides for the expression of a growth-promoting protein to stimulate cellular division.
  • Cellular replication could be monitored by measuring thymidine incorporation or other techniques that have been developed to monitor DNA replication.
  • dividing cells could be enriched by FACS.
  • FACS Fluorescence Activated Cell Sorting
  • Glucose responsiveness is an important parameter in the neuroendocrine cell lines of the present invention. Immortal RIN cells have been shown to lose glucose responsiveness over time. The glucose-responsiveness can be re-engineered into a stable cell that secretes insulin but in which the glucose-response has been lost, diminished or shifted.
  • U.S. Patent 5,427,940 discloses islet and non-islet cell lines of neuroendocrine origin which are engineered for insulin expression and glucose regulation.
  • insulin gene can be supplied to such an engineered cell and, although this will not be required in all aspects of the present invention, it also is contemplated.
  • AtT-20 cells which are derived from ACTH secreting cells of the anterior pituitary. It has been demonstrated that stable transfection of AtT-20 cells with a construct in which a viral promoter is used to direct expression ofthe human proinsulin cDNA results in cell lines that secrete the correctly processed and mature insulin polypeptide (Moore et al, 1983). Insulin secretion from such lines (generally termed AtT-20ins) can be stimulated by agents such as forskolin or dibutyryl cAMP, with the major secreted product in the form of mature insulin.
  • agents such as forskolin or dibutyryl cAMP
  • AtT-20ins cells do not respond to glucose as a secretagogue (Hughes et al, 1991). Interestingly, AtT-20 cells express the glucokinase gene (Hughes et al, 1991, Liang et al, 1991) and at least in some lines, low levels of glucokinase activity (Hughes et al, 1991; 1992; Quaade et al, 1991), but are completely lacking in GLUT-2 expression (Hughes et al, 1991; 1992). Stable transfection of these cells with GLUT-2, but not the related transporter GLUT-1, confers glucose-stimulated insulin secretion (U.S. Patent 5,427,940; Hughes et al, 1992, 1993).
  • AtT-20ins cells The studies with AtT-20ins cells are important because they demonstrate that neuroendocrine cell lines that lack glucose-stimulated peptide release may be engineered for this function. Therefore, once a stable human neuroendocrine cell that has a regulated secretory pathway has been generated by the present invention, certain elements of the responsiveness can be re-engineered into the stable cell. In contrast, the "regulated secretory pathway", including the secretory granules, endopeptidases and post-translational modification enzymes, cannot be re- engineered into a cell lacking such a pathway.
  • U.S. Patent 5,427,940 describes methods for conferring glucose sensing in neuroendocrine cells and cell lines by transfection of such cells with one or more genes selected from the insulin gene, the glucokinase gene and the GLUT-2 glucose transporter gene, so as to provide an engineered cell having all three of these genes.
  • the glucokinase and GLUT-2 genes are thus preferred for use in re-engineering stable human cells.
  • Patent 5,427,940 discloses that three functional genes are required to give glucose- responsive insulin secreting capacity to a cell: an insulin gene, a GLUT-2 glucose transporter gene and a glucokinase gene. In the practice of the re-engineering aspects of the present invention, therefore, it may be that only one of these three genes needs to additionally supplied, expressed or overexpressed.
  • the stable neuroendocrine cell produces and expresses a reasonable level of insulin, but in a non-regulated manner, the provision of either or both of a functional glucokinase gene and a GLUT-2 gene will be desired.
  • One of ordinary skill in the art will be readily able to test the levels of glucokinase and GLUT-2 expression, either by molecular biological hybridization or biochemical activity assays, in order to determine which one or both of such enzymes is not sufficiently expressed or active and should therefore be supplied in recombinant form. If the stable cell does not express either of the aforementioned genes in a functional fashion, or at physiological levels, it will be preferred to introduce both genes.
  • the constructs of GenBank accession numbers J03145 and M25807, respectively may be used.
  • even the insulin gene could be re-engineered .and overexpressed in a stable cell ofthe invention.
  • GLUT-1 conferred glucose-stimulated insulin secretion, this was achieved with maximal responsiveness at subphysiological glucose levels.
  • the inventor reasoned that this was likely due to a non-optimal hexokinase: glucokinase ratio (U.S. Patent 5,427,940).
  • the stable cells of the invention may be modified to any degree such that they have a reduced a low K m hexokinase activity relative to the stable parent cell from which the re-engineered cell was prepared.
  • cells in which a moderate hexokinase inhibition is achieved will have utility.
  • Such inhibition levels are contemplated to be those in which the low K m hexokinase activity is reduced by at least about 5%, about 10%, about 15%, about 20%, or about 25% relative to control levels.
  • Re-engineered cells exhibiting more significant inhibition are also contemplated within the invention. Accordingly, cells in which the low K m hexokinase activity is reduced by about 30%, about 40%, about 50%, about 60% or even about 70% or higher, with respect to control levels, are contemplated as part of this invention and will be preferred in certain embodiments.
  • glucokinase to hexokinase GK:HK ratio
  • GK:HK ratio glucokinase to hexokinase
  • cells of this invention will have a low K m hexokinase activity that has been reduced to a level appropriate to confer more physiological insulin secretion capacity to the cell.
  • “Engineered cells that exhibit more physiological insulin secretion” are cells that exhibit glucose-stimulated insulin secretion (GSIS) closer to the normal range than the parent stable cell from which they were prepared.
  • GSIS glucose-stimulated insulin secretion
  • the maximal glucose response of previously described cell lines generally occurs at subphysiological glucose concentrations of between about
  • the GSIS of normal islet ⁇ cells generally occurs at glucose concentrations of between about 3 mM to 20 mM, with ranges of 5 to 20 mM and 4 to 9 mM being frequently reported. Insulin responses in these r.anges would therefore be described as "near-homeostatic insulin secretion.”
  • Cells that comprise an inhibitor in an amount effective to reduce the low K m hexokinase activity of the cell to a level sufficient to confer insulin secretion in response to an extracellular glucose concentration of between about 1 mM and about 20 mM will thus be most preferred.
  • Extracellular glucose concentrations of "between about 1 mM and about 20 mM " will be understood to include each and every numerical value within this range, such as being about 1, 2, 3, 4, 5, 7.5, 10, 12, 14, 16, 18, and about 20 mM or so.
  • any one of a variety of methods may be employed, including blocking of expression of the gene in the stable human cells and/or inhibiting or reducing the activity of .any protein produced.
  • the hexokinase gene construct of GenBank accession number J04526 may be utilized.
  • constructs can be designed to introduce nucleic acids complementary to a target endogenous gene, i.e., an antisense approach. Expression of RNAs corresponding to these complementary nucleic acids will interfere with the transcription and/or translation of the target sequences. Inhibitory constructs can still further be designed to homologously recombine into the hexokinase endogenous gene locus, rendering the endogenous gene nonfunctional, i.e., a knockout approach.
  • Genetic constructs also may be designed to introduce nucleic acids encoding ribozymes, RNA-cleaving enzymes, that will specifically cleave the target hexokinase mRNA.
  • the hexokinase activity may be abrogated by constructs designed to randomly integrate throughout the genome, resulting in loss of expression of the endogenous hexokinase gene.
  • the endogenous gene can be rendered dysfunctional by genomic site directed mutagenesis.
  • the immortalized secretory cell lines described by the present invention have been shown to have a stable neuroendocrine phenotype. They are capable of providing a measurable secretion of the secretory product. Therefore, within certain embodiments of the invention, methods .are provided for screening for modulators of glucose counter-regulation of a hypoglycemic state. Glucose counter-regulation will be mediated by a decrease in insulin secretion or an increase glucagon secretion or both. In either case the net effect will be an increase in glucose concentration from hypoglycemic to physiologically normal.
  • Screening methods may use the cells ofthe present invention either as adherent cells on a culture dish, as part of an alginate biomatrix, in suspension culture or in any other form that permits the secretion of the polypeptide to be monitored. These cells .are then used as reagents to screen small molecule and peptide libraries to identify modulators of secretory function.
  • Secretory function embodies all aspects of the cell's capacity to sense the extracellular milieu, respond to that milieu via the activation and inhibition of a variety of intracellular signaling mechanisms, and accordingly regulate the secretion of a peptide or hormone from the secretory pathway. Regulation from the secretory pathway can occur at any phase in the synthesis and release of a peptide or hormone including gene transcription; stability of the mRNA; translation; post-translational modifications such as proteolytic processing, formation of disulfide bonds, amidation, and glycosylation; trafficking through the secretory tubules and vesicles; storage within the secretory granule; membrane fusions, and exocytosis.
  • the secretory function may be manifest as the secretion of a particular polypeptide from a secretory cell.
  • the polypeptide (insulin or glucagon or any other polypeptide described herein) is generally secreted into the media of the cells, from where it can be quantified using any of a number of techniques.
  • the polypeptide may be purified according to known methods, such as precipitation (e.g., ammonium sulfate), HPLC, immunoprecipitation, ion exchange chromatography, affinity chromatography (including immunoaffinity chromatography) or various size separations (sedimentation, gel electrophoresis, gel filtration). Such techniques of polypeptide separation are well known to those of skill in the .art.
  • the purified polypeptide may then be qu.antified through immunodetection methods, biological activity, or radioisotope labeling.
  • the present invention provides methods of screening for substance that will have a glucose counter-regulatory effect in a hypoglycemic environment. Such compounds may act on the cells to decrease insulin secretion or on glucagon secretory-cells to increase glucagon secretion. Screening methods will monitoring the secretion of these polypeptides in the absence of the candidate substance and comparing such results to the assay performed in the presence of candidate substances.
  • this screening technique will prove useful in the general identification of a compound that will serve the purpose of promoting, augmenting or increasing the secretion of, for example, glucagon from a secretory cell or decrease, inhibit, or otherwise abrogate the secretion of insulin from a ⁇ -cell.
  • Such compounds will be useful in the treatment of hypoglycemia and diabetes.
  • the present invention is directed to a method for determining the ability of a candidate substance to stimulate glucose counter-regulation of immortalized cells that either naturally secrete molecules or have been engineered to possess secretory function as described herein.
  • the method including generally the steps of:
  • step (d) comparing the secretory function ofthe cell in step (c) with the secretory function ofthe cell of step (a).
  • a candidate substance capable of stimulating glucose counter- regulation by glucagon secretion in the assay above, one would measure or determine the glucagon secretory function of a glucagon-secretory cell in the absence of the added candidate substance by determining the secretion of the desired molecule.
  • a candidate substance which increases the secretory function or capacity relative to the secretory function in its absence, is indicative of a candidate substance glucose counter-regulatory properties.
  • a candidate substance capable of stimulating glucose counter- regulation by affecting insulin secretion in the assay above, one would measure or determine the insulin secretory function of a ⁇ -cell in the absence of the added candidate substance by determining the secretion ofthe desired molecule. One would then add the candidate substance to the cell and determine the secretory function in the presence of the candidate substance. A candidate substance which decreases the secretory function or capacity relative to the secretory function in its absence, is indicative of a candidate substance glucose counter-regulatory properties.
  • Secretory function may be determined by measuring the amount of secreted molecule, such molecules may be detected using any of a number of techniques well known to those of skill in the art.
  • the secreted molecule will be a polypeptide such as an amidated polypeptide, glycosylated polypeptide, a hormone or a growth factor. In such circumstances these molecules may be detected using any of a number of techniques well known to those of skill in the art as described herein below.
  • Secretory function also may be monitored by measuring, for example, calcium ions, cAMP, calmodulin, phosphorylation, dephosphorylation, membrane polarization glucose, ATP, ADP, fatty acids and NADPH or membrane potential.
  • Detection of these molecules can be performed using immunreactive detection, fluorescence luminescence, changes in action potential and the like.
  • the term “candidate substance” refers to any molecule that is capable of modulating glucose counter-regulation.
  • the candidate substance may be a protein or fragment thereof, a small molecule inhibitor, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds for identification through application of the screening assay will be compounds that are structurally related to other known modulators of secretion.
  • the active compounds may include fragments or parts of naturally-occurring compounds or may be only found as active combinations of known compounds which are otherwise inactive. However, prior to testing of such compounds in humans or animal models, it will possibly be necessary co test a variety of candidates to determine which have potential.
  • the active compounds may include fragments or parts of naturally-occurring compounds or may be only found as active combinations of known compounds which are otherwise inactive. Accordingly, the present invention provides screening assays to identify agents which stimulate or inhibit cellular secretion, it is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds.
  • the candidate substance identified by the present invention may be polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known glucose counter-regulatory molecules such as epinephrine and cortisol.
  • the candidate screening assays are simple to set up and perform. Thus, in assaying for a candidate glucose counter-regulatory compound, after obtaining an immortalized secretory cell of the present invention, one will admix a candidate substance with the cell, under conditions which would allow measurable secretion to occur. In this fashion, one can measure the ability of the candidate substance to modulate the secretory function of the cell in the absence of the candidate substance.
  • Effective amounts in certain circumstances are those amounts effective to reproducibly stimulate secretion from the cell in comparison to their normal levels. Compounds that achieve significant appropriate changes in activity will be used.
  • the cells ofthe present invention may be used therapeutically to provide glucose counter- regulatory capabilities to individuals with hypoglycemia, and particularly to diabetic individuals with insulin induced hypoglycemia. As such, cells with these capabilities may be supplied to a patient. Such cells may be propagated using a variety of techniques well known to those of skill in the .art. For example, cells of the present invention may be propagated as non-anchorage dependent cells growing freely in suspension throughout the bulk ofthe culture; or as anchorage- dependent cells requiring attachment to a solid substrate for their propagation (i.e., a monolayer type of cell growth).
  • WO publication numbers WO 97/26334 published July 24, 1997) and WO
  • the cells may be propagated in a microcarrier culture (v.an
  • This mode ofthe culture propagation on the microcarriers makes it possible to use this system for cellular manipulations, such as cell tr.ansfer without the use of proteolytic enzymes, cocultivation of cells, transplantation into animals, and perfusion of the culture using decanters, columns, fluidized beds, or hollow fibers for microcarrier retainment.
  • particular embodiments employ microencapsulation of cells because this system provides a useful mode of providing the cells to an animal model in vivo.
  • a porous membrane is formed around the cells permitting the exchange of nutrients, gases, and metabolic products with the bulk medium surrounding the capsule.
  • Microencapsulated cells are easily propagated in stirred tank reactors and, with beads sizes in the range of 150-1500 ⁇ m in diameter, are easily retained in a perfused reactor using a fine-meshed screen.
  • the ratio of capsule volume to total media volume can kept from as dense as
  • the effective cell density in the culture is 1-5 x 10 7 cells/ml.
  • the advantages of microencapsulation over other processes include the protection from the deleterious effects of shear stresses which occur from sparging and agitation, the ability to easily retain beads for the purpose of using perfused systems, scale up is relatively straightforward and the ability to use the beads for implantation.
  • the cells ofthe present invention may, irrespective ofthe culture method chosen, be used in protein production and as cells for in vitro cellular assays and screens as part of drug development protocols.
  • compositions of the stable cells in a form appropriate for the intended application, which will most usually be within a selectively permeable membrane. Nonetheless, the cells will generally be prepared as a composition that is essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
  • Aqueous compositions of the present invention comprise an effective .amount of stable neuroendocrine cells dispersed in a pharmaceutically acceptable carrier or aqueous medium, and preferably encapsulated.
  • phrases "pharmaceutically or pharmacologically acceptable” refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. As used herein, this term is particularly intended to include biocompatible implantable devices and encapsulated cell populations. The use of such media and agents for pharmaceutically active substances is well know in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells ofthe present invention, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
  • the cell preparations may further contain a preservative to prevent growth of microorganisms.
  • Intravenous vehicles include fluid and nutrient replenishers.
  • Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components in the pharmaceutical are adjusted according to well-known parameters.
  • the engineered cells of the present invention may be introduced into animals, including human subjects, so that glucose counter-regulatory control may be provided to hypoglycemic individual.
  • glucose counter-regulatory control may be provided to hypoglycemic individual.
  • the glucagon secretory cells that have been engineered for increased glucagon secretion and the ⁇ -cells that have been engineered to possess receptors that will decrease or diminish the secretion of insulin in a hypoglycemic state may be introduced to an individual manifesting such a state.
  • the cells may be engineered to sense the plasma glucose concentration.
  • other cells also will achieve advantages in accordance with the invention. It should be pointed out that the studies of Madsen and coworkers have shown that implantation of poorly differentiated rat insulinoma cells into animals results in a return to a more differentiated state, marked by enhanced insulin secretion in response to metabolic fuels (Madsen et al, 1988). These studies suggest that exposure of engineered cell lines to the in vivo milieu may have some effects on their response(s) to secretagogues.
  • a preferred method of providing the cells to an animal involves the encapsulation of the engineered cells in a biocompatible coating.
  • the cells are entrapped in a capsular coating that protects the contents from immunological responses.
  • One preferred encapsulation technique involves encapsulation with alginate-polylysine-alginate. Capsules made employing this technique generally have a diameter of approximately 1 mm and should contain several hundred cells.
  • Cells may thus be implanted using the alginate-polylysine encapsulation technique of O'Shea and Sun (1986), with modifications, as later described by Fritschy et al, (1991; both references incorporated herein by reference).
  • the engineered cells are suspended in 1.3% sodium alginate and encapsulated by extrusion of drops of the cell/alginate suspension through a syringe into CaCl 2 . After several washing steps, the droplets are suspended in polylysine and rewashed. The alginate within the capsules is then reliquified by suspension in 1 mM EGTA and then rewashed with Krebs balanced salt buffer.
  • An alternative approach is to seed Amicon fibers with stable cells of the present invention.
  • the cells become enmeshed in the fibers, which are semipermeable, and are thus protected in a manner similar to the micro encapsulates (Altman et al, 1986; incorporated herein by reference).
  • the cells may be implanted intraperitoneally, usually by injection into the peritoneal cavity through a large gauge needle (23 gauge).
  • U.S. Patent 5,626,561 specifically incorporated herein by reference, describes an implantable containment apparatus for a therapeutic device and method for loading and reloading the device.
  • the implantable containment apparatus is made of selectively permeable material and can be used to contain a therapeutic device, such as a drug delivery device, a cell encapsulation device, or a gene therapy device.
  • a therapeutic device can be easily placed and replaced in the apparatus without damaging tissues associated with the selectively permeable material ofthe apparatus.
  • U.S. Patent 4,402,694 also is incorporated herein by reference and describes a body cavity access device containing a hormone source.
  • the device supplies a hormone to a patient.
  • the device is made of an implantable housing which is placed in the body and has an impermeable extracorporeal segment and a semipermeable subcutaneous segment.
  • a hormone source such as live, hormone-producing cells, e.g., pancreatic islet cells or the engineered human cells of the present invention are then removably positioned in the housing to provide a hormone/ and or other peptide supply to the patient.
  • Such a device also can contain a sensor located within the subcutaneous segment and operably associated with a dispenser to release medication into the housing and to the patient.
  • Hydrophilic polymeric chambers for encapsulating biologically active tissue and methods for their preparation are described in U.S. Patent 4,298,002.
  • the tissue refers to those essential cellular components of a particular organ that is capable of receiving, modifying or secreting hormones.
  • a device comprising such chamber and such tissue is fabricated and implanted in a living body so that said tissue is permitted normal function without being rejected by the host's immunological system.
  • the viability of the tissue in the device is maintained by a correlation of factors including pore size and membrane thickness of the hydrophilic chamber.
  • the implanted device allows the inflow of essential nutrients and gases, and outflow of metabolites and products while simultaneously excluding the ingress of cellular components ofthe host's immunological system.
  • U.S. Patent 4,298,002 is incorporated by reference herein.
  • U.S. Patent 5,011,472 describes devices and methods to provide hybrid, modular systems for the constitutive delivery of appropriate dosages of active factor to a subject and, in some instances, to specific anatomical regions of the subject.
  • This patent is incorporated herein by reference in that it contains devices and methods that may be useful in conjunction with the present invention.
  • This system includes a cell reservoir containing living cells capable of secreting an active agent, which is preferably adapted for implantation within the body of the subject and further includes at least one semipermeable membrane, whereby the transplanted cells can be nourished by nutrients transported across the membrane while at the same time protected from immunological, bacterial, and viral assault.
  • the systems further include a pumping means, which can be implantable or extracorporeal, for drawing a body fluid from the subject into the cell reservoir and for actively transporting the secreted biological factors from the cell reservoir to a selected region ofthe subject.
  • a pumping means which can be implantable or extracorporeal, for drawing a body fluid from the subject into the cell reservoir and for actively transporting the secreted biological factors from the cell reservoir to a selected region ofthe subject.
  • U.S. Patent 4,892,538 describes methods and compositions for the in vivo delivery of neurotransmitters by implanted, encapsulated cells and the technology described therein may be useful in combination with the present invention.
  • U.S. Patent 5,002,661 describes an artificial pancreatic perfusion device in which a hollow fiber having an inner diameter of about 5 mm is surrounded by islets of Langerhans enclosed in a housing. The islets are suspended in a semi-solid matrix which ensures desired distribution of the cells about the hollow fiber. The hollow fiber and suspended islets are enclosed in a housing which further aids the desired distribution of islets about the hollow fiber.
  • the hollow fiber has a porosity which selectively allows passage of substances having a molecular weight of less than about 100,000 Daltons.
  • the semi-solid matrix in which the islets are embedded and suspended is formed of an appropriate supporting material such as alginate or agar. This device may be used with the present invention in that the engineered cells of the present invention may substitute for the islet cells.
  • U.S. Patent 5,549,675 describes additional methods for implanting tissue in a host.
  • the method comprises creating an implant assembly for holding cells including a wall for forming a porous boundary between the host tissue and the implanted cells in the device and implanting the device and then adding the cells.
  • the pore size of the boundary is such that it is sufficient to isolate the implanted cells from the immune response.
  • U.S. Patent 5,545,223 describes methods of making and using ported tissue implant systems and is therefore incorporated herein by reference.
  • U.S. Patent 5,569, 462 In certain instances it may be necessary to enhance vascularization of implant devices, methods for achieving such an aim are disclosed in U.S. Patent 5,569, 462.
  • the methods involve placing a population of therapeutic substance-producing cells into the cell receiving chamber of an immunoisolation apparatus, implanting the apparatus into a patient, and administering an immunomodulatory agent to the patient.
  • the immunomodulatory agent increases the number of close vascular structures in the vicinity of the implanted device, which increases the long term survival ofthe cell population housed therein.
  • Brauker, et. al. U.S. Patent 5,593,440, and U.S. Patent 5,314,471 each incorporated herein by reference
  • Implantation employing such encapsulation techniques are preferred for a variety of reasons. For example, transplantation of islets into animal models of diabetes by this method has been shown to significantly increase the period of normal glycemic control, by prolonging xenograft survival compared to uuencapsulated islets (O'Shea and Sun, 1986; Fritschy et al, 1991). Also, encapsulation will prevent uncontrolled proliferation of clonal cells. Capsules containing cells are implanted (approximately 1,000-10,000/animal) intraperitoneally and blood samples taken daily for monitoring of blood glucose and insulin.
  • An alternate approach to encapsulation is to simply inject glucose-sensing cells into the scapular region or peritoneal cavity of diabetic mice or rats, where these cells are reported to form tumors (Sato et al, 1962). Implantation by this approach may circumvent problems with viability or function, at least for the short term, that may be encountered with the encapsulation strategy. This approach will allow testing of the function of the cells in experimental animals, which is a viable use of the present invention, but certainly is not applicable as an ultimate strategy for treating human diabetes. Nonetheless, as a pre-clinical test, this will be understood to have significant utility.
  • biohybrid artificial organs encompass all devices which substitute for an organ or tissue function and incorporate both synthetic materials and living cells.
  • Implantable immunoisolation devices will preferably be used in forms in which the tissue is protected from immune rejection by enclosure within a semipermeable membrane.
  • Those of skill in the art will understand device design and performance, as it relates to maintenance of cell viability and function. Attention is to be focused on oxygen supply, tissue density and the development of materials that induce neovasclarization at the host tissue-membrane interface; and also on protection from immune rejection. Membrane properties may even be further adapted to prevent immune rejection, thus creating clinically useful impl-antable immunoisolation devices.
  • unit dose refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired response in association with its administration, i.e., the appropriate route and treatment regimen.
  • the quantity to be administered both according to number of treatments and unit dose, depends on the subject to be treated, the state of the subject, and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual.
  • EXAMPLE 1 Stable response to a variety of secretagogues.
  • ⁇ G 49/206 was chosen as representative of an engineered ⁇ -cell line that reproducibly responds to a variety of secretagogues. This line has been engineered to stably express functional glucose transporter (GLUT-2) and glucokinase proteins and biologically active human insulin (Clark et al, 1997).
  • cells Prior to testing, cells were plated on polystyrene plastic 48-well or 96-well tissue culture plates at a density of 0.1 x 10 6 cells/cm 2 (approx. 50% confluency) — approx. 90 x 10 3 cells/well or 30 x 10 3 cells/well, respectively. Cells were allowed to recover and propagated for 24-72 hours in regular growth media ( ⁇ Gene media with 3.5% FBS). After propagation and before stimulation, the cells are rinsed once and washed twice for 20 min.
  • regular growth media ⁇ Gene media with 3.5% FBS
  • HEPES Buffered Biological Salt Solution (HBBSS; in mmol/1: 114 NaCl, 4.7 KC1, 1.21 KH,P0 4 , 1.16 MgS0 4 , 25.5 NaHC0 3 , 2.5 CaCl2, 10 mM HEPES. 0.1% BSA) at 37 °C.
  • HBBSS HEPES Buffered Biological Salt Solution
  • 0.5 ml of HBBSS supplemented with secretagogue(s) was added to each well and allowed to incubate for 2 hours at 37°C.
  • HBBSS was harvested from each well and assayed for insulin. Results are expressed in terms of fold stimulation over a basal sample containing HBBSS only.
  • the cell lines of the present invention show stable insulin secretion with time in continuous culture.
  • the cell lines chosen represent established lines that have undergone more than 100 population doublings (2-3 years) during which two or three genes were iteratively introduced, including time for clonal selection for each gene introduced.
  • the cells therefore already have shown long term stability during the engineering process.
  • Cells thawed from cryogenic storage for experimentation are kept in maintenance culture in parallel. From these cultures, cells are harvested and plated for two more repeat experiments two to three weeks apart. This will prove stability over the course of a couple of months, demonstrating a window of time in which it is possible to validate reproducible results.
  • Secretagogues have been selected to represent agents that signal via discrete pathways, i.e., glucose and amino acids via metabolic signals, IBMX and GLP-1 via cAMP, carbachol via muscarinic receptors, sulfonylureas via the K +" -ATP channels, and phorbol esters via protein kinase C.
  • Cells are stimulated with the following: • 100 ⁇ M IBMX; with and without 10 mM glucose
  • Stimulatory Cocktail (10 mM each of glutamine, leucine, and arginine, 100 ⁇ M carbachol, 100 ⁇ M IBMX, and 10 mM glucose in BetaGene Medium with 0.1% BSA). The following controls are incorporated: No stimulant (basal); with and without 10 mM glucose; lOO ⁇ M Diazoxide.
  • the selected engineered cell lines have stable and reproducible responses to the various secretagogues over time in culture (FIG. 3 and FIG. 4).
  • the data shown are from the last of three experiments.
  • the cells had undergone 8 population doublings (PDs) after the engineering and clone selection was completed.
  • the parental cell line had been stable for over two years, undergone more than 100 PDs, and subjected to two more engineering steps. Through all these manipulations, the cells have maintained a remarkably stable phenotype.
  • the cells had undergone further 8 PDs (approx. 16 days) in continuous culture.
  • Glyburide in the absence or presence of glucose, elicit a 7-15 fold response, as the sulfonylurea inhibits the K + channel and causes depolarization of the cell membrane.
  • PMA acting directly on protein kinase C has an 8-10 fold effect on basal secretion in the absence of glucose and a strong 30-40 fold response in the presence of glucose.
  • a stimulatory cocktail that includes glucose, IBMX, amino acids, and carbachol, yields a 30-40 fold response.
  • engineered ⁇ -cell lines were bulk produced in a bioreactor, harvested and frozen to establish a homogeneous repository of cells. Cells undergoing this process should continue to secrete complex, fully biologically active polypeptides into the growth media with no significant differences in the response to glucose and other secretagogues pre-bulk, post-bulk and post-thaw.
  • ⁇ G 49/206 (described in example 1) was selected as a representative engineered ⁇ -cell line to undergo the complete process; bulk production, harvest, freeze .and thaw. Representative samples from each step were analyzed for response to various secretagogues. Each ofthe procedures and the secretion profile are described in detail below.
  • ⁇ G cell lines were bulk produced in the CellCubeTM system (Corning Costar) and frozen as described in example 30.
  • Frozen vials of ⁇ G 49/206 representing each stage of the bulk production process were thawed and allowed to recover prior to testing their insulin response to various secretagogues.
  • the cells were ready to plate for testing of cell response to various secretagogues 48- 72 hours after thawing.
  • This assay was done to demonstrate that each of the processes described; bulk production, harvest, freeze and thaw, has no appreciable effect on the secretory response of ⁇ G 49/206 cells.
  • the secretory response of pre-bulk, post bulk and harvest, and freeze/thaw samples was studied using the secretagogues listed in the table below. Each of the listed secretagogues and their signaling pathway has been previously described. The data are as follows:
  • alginate encapsulated cells Use of alginate encapsulated cells to enhance stability of the cells and their secretory response.
  • 49/206 cells were encapsulated in alginate using the following procedure. Trypsinized and PBS- washed cells are evenly suspended in a 1.5 - 2% final concentration of sodium alginate (50:50 mixture of LV low viscosity and HV high viscosity, Kelco, CA) in growth medium without serum. The suspension is loaded in a syringe and then dispensed through a 27 gauge needle at approx. 0.3 ml/min. The droplets leaving the tip of the needle are blown off by a continuous air stream. By adjusting the velocity of the air stream, beads averaging approx. 800 ⁇ m can be achieved reproducibly.
  • the droplets are blown into a container holding a 1.35% (w/v) CaCl 2 /20 mM HEPES solution.
  • the beads are allowed to fully congeal for approx. 10 min in the CaCl 2 solution. Beads are washed twice in growth medium without serum and placed a T-flask with regular growth medium and incubated for about 72 hours with one feeding at 48 hours.
  • FIG. 5 demonstrate that it is possible to encapsulate engineered RIN cells and maintain comparable responses to secretagogues relative to non-encapsulated cells.
  • the fold responses are essentially equivalent to the data in FIG. 3 and FIG. 4 with regard to fold stimulation. It should be noted that the data falls within a narrower range as indicated by the smaller standard deviation values derived. This observation is indicative of better control of total remaining cell number at time of stimulation and of more stable conditions for all cells in the individual wells.
  • EXAMPLE 4 Maintenance of secretion performance in a 96- well format.
  • the screens must be adaptable to a microtiter plate screening format.
  • the read-out or signal from an assay must be compatible with data management software so information can be tracked and integrated.
  • total screen time should be minimized.
  • assays should be sensitive and precise.
  • ⁇ G 49/206 cells (30,000 per well) were plated and cultured for 48 hrs. in 150 ⁇ l of BetaGene Medium/ 2.5% fetal bovine serum; washed twice (20 min each, in 200 ⁇ l in HBBSS), and stimulated with glucose or glucose plus IBMX.
  • the pattern of secretory responsiveness is maintained when ⁇ G 49/206 cells were plated, cultured, and assayed in a 96-well format: the inclusion of diazoxide in the medium provides a slight clamp to basal secretion, glucose alone is potently stimulatory, and the glucose response can be augmented by the inclusion of IBMX as a secretagogue.
  • Receptors of interest include the following: alpha-2 adrenergic receptor (ATTC number 59303, HPalpha2GEN Genbank accession numbers M18415, M23533, incorporated herein by reference), glucagon-like peptide I receptor (Genbank accession numbers: L23503, U10037, U01156, U01104: each incorporated herein by reference), somatostatin receptor V (mouse Genbank accession number AF004740; human Genbank accession numbers: L 14865, L14856, M81830, M96738, M81829, L07833 each incorporated herein by reference).
  • receptors to be used include the SUR channel (Genbank accession numbers L78207, U63455, L78243, incorporated herein by reference), KIR channel (Genbank accession number D50582, incorporated herein by reference), pancreatic polypeptide receptor (Genbank accession numbers: Z66526, U42387, U42389 each incorporated herein by reference), muscarinic receptors (Genbank accession numbers: X52068, X15264, X15265, X15266, AF026263 each incorporated herein by reference); glucocorticoid receptor (Genbank accession numbers: Ml 0901, Ml 1050 each incorporated herein by reference), human (glucose-dependent insulinotropic peptide) GIP receptor (Genbank accession number X81832, incorporated herein by reference) human PACAP/VIP receptor (Genbank accession numbers L36566, D 17516, U 18810, each incorporated herein by reference) human ⁇ -cell type Ca2+ channel (Genbank acces
  • DNAs encoding the receptors were ligated into plasmids suitable for the stable transfection of mammalian cells.
  • Such plasmids contain genes that confer resistance to antibiotics and cloning sites for transgene insertion and expression.
  • Resistance to hygromycin hygromycin phosphotransferase
  • pCB7 Resistance to zeomycin is encoded in CW102 (pZeocmv).
  • CW102 was created by replacing the SV40 promoter in pZeoSV with the CMV promoter.
  • pZeoSV was digested with Bam HI and the ends were blunted-ended by a fill-in reaction with Klenow.
  • the CMV promoter was excised from pAC/CMV by digestion with Not I and prepared for blunt-end ligations by treatment with Klenow. There are two copies of the CMV promoter in CW102: one driving the expresssion ofthe zeomycin resistance gene and the other for transcribing transgenes of interest.
  • RIN 1046-38 cells .and derived cell lines were grown BetaGene Medium containing 7.8 mM glucose and supplemented with 3.5% fetal bovine serum (JRH Biosciences, Lenexa, KS), 100 milliunits/ml penicillin and 100 ⁇ g/ml streptomycin. Cells were passaged weekly using 0.05% trypsin-EDTA solution .and cultured in an atmosphere of 95% air and 5% CO2 at 37°C.
  • RIN cell lines were grown to 50 to 75% confluence, harvested by trypsinization, washed once with phosphate-buffered saline (PBS), and resuspended in PBS for counting.
  • PBS phosphate-buffered saline
  • 1 x 10 7 cells were pelleted by centrifugation at 1000 rpm for 2 minutes .and resuspended in 0.4 ml electroporation buffer (137 mM NaCl, 6 mM glucose, 5 mM KC1, 0.7 mM Na HPO , 20 mM Hepes, pH 7.0 ; or in BetaGene medium without serum).
  • DNA was added to the cell suspension to achieve a final concentration of 30-50 ⁇ g/ml.
  • DNA was electroporated into the cells in a 2 mm cuvette at 170 volts, 510 ⁇ F and 129 ohms using an Electro Cell Manipulator 600 (BTX, Inc.). Stably transfected cells were selected by culturing in the appropriate drug for about 2 weeks.
  • the drug concentrations used were- 500 ⁇ g/ml active fraction G418 (Geneticin, Gibco Life Sciences); 300 ⁇ g/ml for hygromycin (Boehringer Mannheim); 400 ⁇ g/ml for zeomicin (InVitroGen).
  • the gene encoding the human alpha-2A receptor ( ⁇ 2AR) inserted into a plasmid backbone was purchased from the American Type Culture Collection. Following replication and preparation of this plasmid at BetaGene, the DNA was designated BX700. BX700 plasmid DNA was digested with restriction endonucleases Kpn I, Nhe I, and Hind III to release the ⁇ 2AR genomic fragment.
  • This fragment was ligated into pBluescript II SK plasmid that had been digested with Spe I, treated with the large fragment (Klenow) of DNA polymerase I to fill-in the overhangs created by Spe I digestion, and dephosphorylated with calf intestinal alkaline phosphatase (CIAP).
  • the plasmid resulting from this ligation, CE406, was digested with Kpn I and Xba I, and the ⁇ 2AR DNA was ligated in to pCB7 to create CE616 plasmid DNA.
  • RNAzol B RNA isolation reagent (Cinna/Biotex Laboratories International). RT-PCR was performed using the TitanTM One Tube RT-PCR System (Beohringer Mannheim).
  • RNA For the amplification of a portion of the rat GLP-1 receptor mRNA, 100 ng of B 17/1 total RNA was transcribed at 55° C using AMV reverse transcriptase and amplified with a blend of Taq DNA polymerase and Pwo DNA polymerase. 35 rounds of amplification were performed with denaturation at 94° C (30 sees), annealing at 59° C (45 sees) and extension at 68° C (2 min.) using oligonucleotides IDK4 (5'CAGCCTGCCCTGGAGGGAC3' SEQ ID NO:l) and IDK5 (5'CCGAGAAGGCCAGCAGTGTGTAC3' SEQ ID NO:2).
  • the full-length human GLP-1 mRNA was amplified from RNA isolated from a human small cell lung line (ATCC: HTB-184, NCI: H510A) using oligonucleotides IDK3 (5 GGTGGAATTCCTGAACTCCCCC3' SEQ ID NO:3) and IDK6
  • the rat GLP-1 cDNA was subcloned into pNOTA/T7 (5' to 3', Inc) to create plasmid CU201.
  • the human PCR product was subcloned into pBluescript KS that had been digested with EcoR V and the resulting plasmid was designated CX800.
  • the GLP-1 receptor fragment was isolated from CX800 following digestion with EcoR I and Hind III, and ligated with CW102 that had been digested with EcoR I .and Hind III.
  • the human pancreatic polypeptide receptor (PPR) mRNA was amplified from RNAs isolated from human lung cell lines (ATCC number: CRL-5816; NCI-H810) using the TitanTM One Tube RT-PCR System. lOOng of total RNA was transcribed at 55° C; 35 rounds of amplification were performed with 94°C denaturation (30 sees), 57°C annealing (30 sees), and 68° C extension (2 min). PCR products were subcloned into pBluescript SK that had been digested with Hind III and filled in with Klenow to create plasmid DG105. The PPR fragment form DG105 was ligated into CW102 as a EcoR 1/ Kpn I fragment.
  • the mouse somatostatin receptor, type V gene ligated into pBluescript was received from the Dr. F. Charles Brunicardi, Baylor Medical Center, Houston, Texas. Following replication of the plasmid at BGene the DNA was designated CW000. CW000 was digested with PpuM I and treated with Klenow. The SSTRV DNA was ligated in CW102 that had been digested with Bam
  • EXAMPLE 6 Transgenic overexpression of the ⁇ 2 AR improves the response of RIN cells to Clonidine, an analogue of epinephrine.
  • Epinephrine participates in regulating circulating glucose levels by stimulating glucose production from the liver and inhibiting insulin secretion from the pancreatic ⁇ -cell.
  • ⁇ G18/3El cells are relatively refractory to epinephrine and Clonidine, an analogue of epinephrine.
  • Clonidine an analogue of epinephrine.
  • human pancreatic islets are about 10-fold more sensitive to this compound than ⁇ G18/3El cells. It was reasoned that the sensitivity of ⁇ G18/3El cells to Clonidine could be increased by the transgenic overexpression of the ⁇ 2AR.
  • ⁇ G18/3El cells were electroporated (EP265) with plasmid CE616. Following selection with hygromycin and growth, single colonies were assayed by immunocytochemisty for the expression of the transgenic oc2AR.
  • ⁇ G18/3El cells .and single clones derived from EP265 were plated on Falcon 8-chamber culture slides and maintained for 2 days in BetaGene Medium. Following fixation, cells were incubated with ⁇ 2AR antibody (diluted 1 :200; Dr. John Regan, University of Arizona, Arlington). Following incubation with a secondary antibody (antichicken IgG ,alkaline phosphatase) immune complexes were detected colormetrically. The specificity of the ⁇ 2AR antibody was confirmed by competition assays with a ⁇ 2AR-glutathione-S transferase fusion protein. Eight individual clones were analyzed for sensitivity to Clonidine in insulin-secretion assays.
  • the capacity of the cell lines to secrete mature insulin during stimulation of the regulated secretory pathway was determined by incubating for 1 hour in a mixture of secretagogues.
  • the mixture consisted of RPMI medium (JRH BioSciences) with 5 mM glucose, supplemented with 0.1% BSA, 100 ⁇ M carbachol, and 100 ⁇ M of isobutylmethylx-anthine (IBMX).
  • IBMX isobutylmethylx-anthine
  • ⁇ G265/2 cell lines were encapsulated in alginate and injected into the intraperitoneal cavity of Zucker diabetic rats to test if an enhanced sensitivity to Clonidine would extend to in vivo conditions. Beads were maintained in vivo for 3 - 5 days, or until blood glucose normalized. Animals were injected with Clonidine, an agonist of the ⁇ 2AR (50 ⁇ g/kg) or Yohimbine, an antagonist of the ⁇ 2AR (75 ⁇ g/kg). Blood glucose, rat C-peptide II, and human insulin levels were monitored at 20 minute intervals post-injection. As shown in FIG. 9, Clonidine injection resulted in a 50% reduction of human insulin in plasma; whereas, Yohimbine had no effect on human insulin in plasma.
  • FIG. 10A graphically represents insulin secretion from engineered cell lines that have been maintained in culture for one week with ⁇ Gene medium, supplemented or non- supplemented with 3% fetal bovine serum (FBS).
  • FBS fetal bovine serum
  • the loss of stimulated insulin secretion from engineered ⁇ -cell lines that occurs in the absence of FBS in the culture medium provides an in vitro system for modeling the loss of insulin secretion that occurs in NIDDM. All the aspects of engineered ⁇ - cells that make them suitable for the identification of insulin-modulating compounds also create an ideal reagent for modeling ⁇ -cell dysfunction.
  • the effects of FBS-deprivation shown in FIG. 10 are relatively rapid, reproducible, and amenable to high-throughput screening.
  • Experiments could be designed to identify serum factors that are involved in the maintenance of stimulated secretion, identify candidate genes and proteins whose expression patterns are modulated by FBS-deprivation, or screen for compounds that maintain stimulated insulin secretion despite the absence of FBS in the culture medium. Information from any of these screens could be informative as to biology of ⁇ -cell dysfunction in NIDDM and provide new insights into the design of therapeutic compounds.
  • BetaGene, Inc. has introduced transgenes to achieve physiologically relevant glucose-sensing in beta-cell lines. More recently as described in the present invention, the introduction of transgenic receptors also has been contemplated so that implanted cell lines can sense and respond to a variety of post-prandial and/or hypoglycemic signals.
  • cDNAs encoding the following cell-surface proteins: subunits of the K ATP channel, SUR and Kir, alpha-2 adrenergic receptor, pancreatic polypeptide receptor, glucagon like peptide receptor, glucocorticoid receptor, and somatostatin receptor.
  • the mouse somatostatin receptor, type V gene (SSTRV, Genbank accession number AF004740) ligated into pBluescript and a rabbit polyclonal antibody that recognizes the receptor (Ab9462) were received from the Dr. F. Charles Brunicardi, Baylor Medical Center, Houston, Texas. Following replication of the plasmid at BetaGene the DNA was designated CW000. CW000 was digested with PpmM I and treated with Klenow. The SSTRV DNA was ligated in CW102 that had been digested with Bam HI, filled in with Klenow, and treated with CIAP, and the resulting plasmid was designated CX503.
  • ⁇ G 40/110 cells (clonal derivatives of RIN 1046- 38 overexpressing human insulin and glucokinase) were transfected (EP 603) with plasmid CX503. Following selection in Zeomycin, 13 colonies were selected for further analysis and growth. Portions of the clones were plated onto cover slides and assayed by immunocytochemistry for the expression of SSTRV. The primary antibody Ab9462 was diluted 1/1000 and immune complexes were colorimetrically detected following incubation with a secondary antibody, goat anti-rabbit linked alkaline phosphatase. Of the 13 clones, one was a high expressor of SSTRV ( ⁇ G 603/11), and two expressed low levels of the receptor ( ⁇ G 603/8 and 10). In the other clones (including ⁇ G 603/7) levels of SSTRV were below detection limits ofthe assay and indistinguishable from the unengineered clones.
  • Two clones (a high expressor, ⁇ G603/l 1 and a non-expressor, ⁇ G 603/7) were tested at basal and stimulatory conditions with various concentrations of SS-28 added to media under 2 hr. stimulation conditions.
  • glucose-stimulated (10 mM glucose) insulin secretion from ⁇ G 603/11 cells were potently inhibited by 50 pM SS-28; whereas, ⁇ G 603/7 cells were resistant to all concentrations of SS-28.
  • the effects of SS-28 were such that stimulated secretion from ⁇ G 630/11 could be reduced to levels below those observed for basal.
  • SS-28 was tested as an inhibitor of various secretagogues of insulin secretion. As shown in FIG. 1 IB, at 5 nM SS-28 effectively inhibits stimulated insulin secretion in the presence of BetaGene Medium with no glucose and under conditions of maximum stimulation, Stimulatory Cocktail (BetaGene Media supplemented with 10 mM glucose, 10 mM each of glutamine, leucine, and arginine, 100 ⁇ M carbachol, and 100 ⁇ M IBMX,).
  • BetaGene plasmid AA603 simian virus promoter 40 (SV40) driving expression of neomycin phosphotransferase and cytomegalovirus (CMV) promoter driving expression of human insulin
  • SV40 simian virus promoter 40
  • CMV cytomegalovirus
  • Three clones expressing relatively high levels of insulin were selected for further study: ⁇ G 498/20, ⁇ G 498/44, and ⁇ G 498/45; secreting about 100, 20, and 50 ng/ million cells/ 24 hrs, respectively.
  • the cellular contents and culture medium of ⁇ G 498/20 were extracted with acetic acid and fractionated by high-performance liquid chromatography. Immunoreactive insulin species were quantified by radioimmunoassay using human insulin standards. Proinsulin was effectively processed to mature insulin, with mature insulin representing the majority ofthe total insulin both in whole cell and media extracts (FIG. 12A and FIG. 12B).
  • the chromatography in FIG. 12A was derived the cellular contents of ⁇ G 498/20, and FIG. 12B is derived from insulin secreted into the media.
  • HEPES/bicarbonate-buffered salt solution HEPES/bicarbonate-buffered salt solution
  • Insulin secretion was stimulated by incubating the cells for 2 hrs in HBBSS containing 0.1% BSA and supplemented with 10 mM IBMX, 100 ⁇ M carbachol, or 10 nM ofthe phorbol ester, PMA; all in the presence of absence of 10 mM glucose.
  • ⁇ G 498/20 respond robustly to carbachol and PMA (about 10 - 15 fold over basal), however, the cells were unresponsive to glucose and IBMX.
  • ⁇ G 498/44 and ⁇ G 498/45 were nearly identical in their secretion profiles as compared to ⁇ G 498/20.
  • ⁇ G 498/45 was further engineered for increased levels of insulin expression by the introduction of number of plasmids, all of which encoded human insulin but varied in the genes encoding antibiotic resistance.
  • the 793, 794, and 796 cell lines are resistant to mycophenolic acid, puromycin, and hygromycin, respectively.
  • the data in FIG. 13B show the presence of a regulated secretory pathway in the progenitor cell line (498/45) and the maintenance of this capacity through a second round of engineering (793, 794, and 796 cell lines). Insulin content and secretion were increased by about 3- to 4-fold in second generation clonal cell lines.
  • the insulin secreted from two of these high-producing clones (793/28 and 793/15) was fractionated by high-performance liquid chromatography, and immunoreactive insulin species were quantified by radioimmunoassay using human insulin standards.
  • Proinsulin was effectively processed to mature insulin, with mature insulin representing the majority of the total insulin in media extracts.
  • NIH nude rats (Strain F344/Ncr-rnu form the National Cancer Institute, Frederick, MC) were housed in a sterile isolation facility with free access to sterile standard laboratory diets and water. Immune-competent Wistar and Zucker rats were housed in standard facilities and had free access to standard laboratory diets and water.
  • IDM insulin-dependent diabetes mellitus
  • pancreatic beta cells were selectively destroyed in nude and Wistar rats by intracardiac administration of streptozotocin (STZ (70 mg/kg body weight). Blood glucose was monitored to confirm inducement of diabetes; all animals that received cellular transplants had blood glucose levels of greater than 375 mg/dl within 2 days of STZ treatment. Alginate- encapsulated cells were surgically implanted into the intraperitoneal cavity of anesthetized animals.
  • mice were divided into two groups: a control group that received the parental cells, ⁇ G H03 or low doses of ⁇ G 498/20, and an experimental group that received high doses of ⁇ G 498/20.
  • Data in FIG. 14A, FIG. 14B, and FIG. 14C demonstrate that ⁇ G 498/20 cells can reverse hyperglycemia in nude and immunocompetent hosts, and insulin delivery in vivo by this cell line is .an effective treatment for both IDDM and NIDDM.
  • FIG. 14A cells were implanted into STZ-treated, diabetic nude NIH rats (25 million/ 100 grams body weight).
  • the blood glucose values of the control group show that the unengineered parental line ( ⁇ G H03) does not impact blood glucose.
  • ⁇ G 498/20 cells were implanted into STZ-treated, diabetic male Wistar rats (FIG. 14B).
  • both doses of ⁇ G 498/20 affected a correction in hyperglycemia with the following differences: (1) The higher dose of cells reduced blood glucose more rapidly; 2 days versus 4 -6 days for the lower dose. (2) The higher dose of ⁇ G 498/20 stabilized blood glucose in the normo-glycemic range for a longer period of time; 27 days post implant, versus 17 days for the lower dose.
  • Serum analysis of human insulin and C-peptide and rat C-peptide are consistent with the effects on hyperglycemia resulting from secretions from ⁇ G 498/20.
  • rat C-peptide was reduced to about 4% of normal pre-implant, and on day 7, post-implant, was less titan 10% of normal C-peptide levels.
  • secretion by ⁇ G 498/20 of human insulin and detection of human C-peptide in the serum correlated well with cell number (FIG. 15) and the effects observed on blood glucose (FIG. 14B).
  • the study of in vivo performance of ⁇ G 498/20 cells was extended to a model of NIDDM, Zucker diabetic fatty (ZDF) rats.
  • EXAMPLE 13 Improved Glucose Tolerance by Treatment with Cells Derived from ⁇ G H03
  • Glucose tolerance testing was performed on the STZ-treated Wistar rats on day 19 post- transplantation. As shown in FIG. 16A, only the higher dose of cells is functioning to correct hyperglycemia at this time point. Likewise, with 25 million ⁇ G 498/20 cells per 100 gm body weight, there is a clamping of hyperglycemic excursion following a glucose bolus. The rats that received a low dose of ⁇ G 498/20 and ⁇ G H03 were glucose intolerant. As shown in FIG. 16B, treatment of ZDF rats with ⁇ G 498/20 cells results in a similar pattern: low cell doses that fail to correct hyperglycemia do not correct glucose intolerance; however cell doses sufficient to reduce blood glucose also improve glucose tolerance. The glucose tolerance test in ZDF rats was performed on day 13 post-transplantation.
  • glycated hemoglobin A marker that predicts susceptibility to the long-term complications associated with diabetes is glycated hemoglobin (GHb). Sustained, poor glycemic control correlates with an excessive glycation of hemoglobin and the subsequent development of retinopathy, neuropathy, and nephropathy. Consequently, an important criterion for the effectiveness of any given therapy for diabetes is a reduction in percent of hemoglobin that is glycated. Blood samples were taken from rats and glycated hemoglobin in the blood was determined with Helena Glyco-Tek affinity columns (cat number 5351, Helena Laboratories) as recommended by the manufacturer. As shown, in FIG.
  • ⁇ G 498/20 cells were as effective and durable in immune-competent rats as they were in nude rats (FIG. 14A versus FIG. 14B and FIG. 14C).
  • alginate provides time-limited and partial protection from the immunotoxicity of the host, it was expected that graft survival in the Wistar and Zucker rat strains would be much reduced from that observed in the nude rat.
  • the prolonged survival of encapsulated ⁇ G 498/20 in two immune-competent hosts suggests that this cell line may be intrinsically resistant to the effects of immune-mediated killing and cytotoxicity, .and/or somewhat invisible to immune surveillance.
  • ⁇ G 498/20 and ⁇ G H03 cells were exposed to a number of human cytokines that are known to participate in immune-mediated cytotoxicity (FIG. 18 A). Cells were plated into 96- well plates (50,000 /well), grown in BetaGene Medium for 24 hours and switched into medium supplemented with cytokines for 48 hours. Viability of the cultures was determined by an MTT staining assay.
  • both ⁇ G H03 and its clonal derivative ⁇ G 498/20 were resistant to various concentrations of Interleukin -lbeta (IL-l ⁇ ), interferon gamma (IFN ⁇ ), tumor necrosis factor-alpha (TNF ⁇ ), and the combined actions of all three of these cytokines.
  • IL-l ⁇ Interleukin -lbeta
  • IFN ⁇ interferon gamma
  • TNF ⁇ tumor necrosis factor-alpha
  • cytokines The effect of cytokines on insulin secretion from ⁇ G 498/20 was also tested, and as shown in FIG. 18B, the cells' secretory function was uneffected by the effects of cytokines.
  • Cells were plated in 48-well plates (-90,000 cells/well) and cultured for 2 days. For secretion studies, cells were washed twice, 20 min each, in HEPES/bicarbonate-buffered salt solution (HBBSS; in n ⁇ mol/1: 114 NaCl, 4.7 KC1, 1.21 KH2P04, 1.16 MgS ⁇ 4, 25.5 NaHC ⁇ 3, 2.5 CaCl2, 10 HEPES) supplemented with 0.1% BSA but lacking glucose.
  • HEPES/bicarbonate-buffered salt solution HEPES/bicarbonate-buffered salt solution
  • Insulin secretion was stimulated by incubating the cells in HBBSS containing 0.1% BSA and supplemented with 10 mM glucose, or 10 mM glucose plus either 100 ⁇ M carbachol or 10 nM PMA. After a 2 hr incubation, medium was collected and assayed for insulin by radioimmunoassay. Two sets of cultures were exposed to cytokines for 24 hours, prior to secretion studies (24h cytokines, .and 24h cytokines + HBBSS + cytokines); and two sets of cultures were supplemented with cytokines for the 2 hr secretion period (HBBSS + cytokines, and 24h cytokines + HBBSS + cytokines).
  • HBSS The control culture
  • cytokines were exposed to the following mixture of human cytokines that have been shown to impair cellular function and cause cell-killing in multiple cell types: IL-l ⁇ (5 ng/ml) IFN ⁇ (200 units/ml), TNF ⁇ and TNF ⁇ (10 ng/ml).
  • IL-l ⁇ 5 ng/ml
  • IFN ⁇ 200 units/ml
  • TNF ⁇ 10 ng/ml
  • INS-1 .and RIN beta-cell lines are susceptible to cell-killing by IFN ⁇ and that IL-1 ⁇ is cytotoxic to INS-1 cells (Hohmeier et al, 1998). Although protection from IL-l ⁇ in these studies was induced by the overexpression of manganese superoxide dismutase in the INS-1 cells, a cell line that is inherently cytokine-resistant may be a preferred starting material for cell-based delivery of therapeutic products in immune-competent hosts.
  • ⁇ G H03 cells have been engineered to express glucagon like peptide 1 (GLP-1) and human growth hormone (hGH).
  • GLP-1 glucagon like peptide 1
  • hGH human growth hormone
  • the human neuroendocrine cell line ⁇ G H04 was stably transfected with BetaGene plasmid AA603 (SV40 driving the expression of neomycin phosphotransferase and CMV driving expression of human insulin) resulting in monoclonal cell lines ⁇ G 707/55, 707/63, 707/76, 707/94 and 707/96.
  • the clonal cell lines were studied for their ability to secrete insulin in response to various modulators of secretion, as previously described. In each of the 5 clonal cell lines insulin secretion did not change with respect to basal in response to stimulation by 10 mM IBMX, 100 mM carbachol, or 10 nM PMA; and 10 mM glucose.
  • FIG. 19 illustrates the secretion response of ⁇ G 707/55, 63, 76, 94, 96 clones and the a clonal derivative of ⁇ G H03 ( ⁇ G 498/45) to the secretagogue cocktail described above.
  • ⁇ G 498/45 cells secrete in excess of 500 ng/flask/hour of insulin.
  • ⁇ G 707 clonal lines secrete a negligible amount of insulin under these conditions.
  • Cell content of ⁇ G 707/55 was analyzed by HPLC for insulin. A small proinsulin peak was detected, however no mature insulin was detected within these cells.
  • BetaGene plasmid CD303 (CMV driving expression of human growth hormone, SV40 driving neomycin resistance) was used to establish cell lines resistant to G418.
  • the monoclonal cell line ⁇ G 785/5 was analyzed for cell content versus secreted human growth hormone on a Western blot. The results indicated a small fraction of human growth hormone stored within the cells and a large fraction of this peptide in the medium.
  • ⁇ G H04 cell line despite the presence of multiple proteins associated with a neuroendocrine phenotype is not a preferred candidate for secretion of transgenic peptides from the regulated secretory pathway.
  • These cells use a constitutive mode of secretion, rather than a regulated secretory pathway, perhaps due to an inability to depolarize the cell membrane or an absence of dense core granules for peptide storage.
  • Several factors controlling peptide trafficking also may be missing in these cells, further complicating regulated peptide release.
  • the ⁇ G H04 cells do not process insulin to its mature form.
  • GLUT-2 transporter in 498/20 cells results in increased sensitivity to STZ.
  • a preferred embodiment in the in vivo delivery of peptides via transplantation of engineered cell lines is the installation of a mechanism that allows for the transplanted cells to be "turned-off ' in both secretory function .and growth potential. Scenarios where this "off switch" may need to be employed include a malfunction in the graft, an alteration in the physiology of the host creating an incapability with the graft, or a breach in the encapsulation device rendering it permeable to cells.
  • an "off switch" for the transplanted cells will be non-invasive to the host; easy to administer; have short-term, immediate effects; and be selective for the grafted cells and non- toxic to the host.
  • One "off switch” that can fulfill these criteria is the installation of a negative selection system into the transplanted cells.
  • the cells would be engineered to express a protein that converts a non-toxic substance to a cytotoxic one, through catalysis, transport, or binding.
  • negative selection systems include herpes simples virus thymidine kinase in combination with gancyclovir; cytosine deaminase in combination with 5- fluorocytosine; glucose transporter, type 2 (GLUT-2) in combination with streptozotocin (STZ) and the use of nitroreductase.
  • U.S. Patent application serial number 08/546,934 and PCT publication WO 97/15668 are specifically incorporated herein by reference in that the referenced documents provide methods and compositions comprising GLUT-2 and GLUT-2 chimeras, as such the techniques described therein emphasize the utility of negative selection aspects with the present invention.
  • ⁇ G 498/20 cells a human neuroendocrine cell line engineered to express insulin, was tested for sensitivity to STZ and found to be resistant to cell killing at concentrations up to 10 mM.
  • ⁇ G 498/20 cells were electroporated (EP642) with plasmid AD402 (CMVp-
  • GLUT2/SV40p-Hygro selected for resistance to hygromycin, and tested by Western blotting for the expression of the GLUT-2 trinsporter.
  • ⁇ G 642 clones expressed variable levels of the tr.ansgenic GLUT-2, and those cells transfected with a plasmid conferring hygromycin resistance alone ( ⁇ G 640-v) did not express detectable levels of the transporter.
  • the levels of GLUT-2 in the ⁇ G 642 clones as detected by Western blot analysis correlate with functional transport capacity. High GLUT-2 expressors were most sensitive to STZ, with some cell lines effectively killed at less than 3 mM. These data prove the feasibility of converting a human cell line such as ⁇ G 498/20 from one that is STZ-resistant to a STZ-sensitive phenotype by the overexpression of the GLUT-2 transporter.
  • ATP ATP
  • Ca ATP
  • the metabolism of glucose is converted to a secretory signal in large part by altering ATP/ADP ratios. Increases in this ratio, resulting from increased glycolytic flux, cause closing of the K ATP channel, depolarization of the plasma membrane, and increases in cytosolic Ca .
  • Increasing cytosolic Ca is a common mechanism by which secretagogues stimulate insulin exocytosis.
  • Intracellular Ca and ATP can both be detected with assays that are compatible with
  • Calcium-binding dyes that increase in intensity of fluorescence in a dose-dependent fashion such as Fluo-3 and Calcium green, are widely used in cell-based assays in the pharmaceutical industry.
  • ⁇ G 49/206 and ⁇ G 40/110 cells are washed to achieve a basal state in secretion, loaded with Calcium green, and stimulated with various secretagogues. Insulin secretion should correlate with increases in calcium-dependent fluorescence.
  • the Ca -sensitive photoprotein aequorin in either ⁇ G 49/206 or ⁇ G 490/110 cells. It has recently been shown that this protein could be targeted to either the cytoplasm and/or mitochondria of the rodent ⁇ -cell line INS-1, and stably transfected clonal derivatives provided a model for studying the effects of nutrient-stimulated insulin secretion on subcellular Ca (Maechler et al., 1997; Kennedy et al, 1996). Studies from this same group have shown that INS-1 cells transfected with cytosolic luciferase served as a model to monitor ATP changes in living cells. Luciferase-expressing clones were monitored by photon detection, and shown to be a model for tracking ATP changes simultaneously with stimulated insulin secretion (Maechler et al., 1998).
  • BetaGene has begun studies with fluorescent Ca dyes in ⁇ G 49/206 cells, and is poised to express aequorin and/or luciferase as needed to enable or enhance HTS of secretory function.
  • EXAMPLE 19 Methods for Creating a Human ⁇ -Cell Line
  • Preferred starting materials will consist of either a surgically removed human neuroendocrine tumor such as an insulinoma, or isolated primary tissue such as human islets.
  • the ⁇ -cells in these tissues proliferate at a very slow rate, therefore, the first step is to get them to grow.
  • adenovirus expressing an oncogene under the control of the rat insulin 1 gene promoter (RIP).
  • Adenovirus is the preferred viral vector because it will infect and express its transgene in nondividing cells.
  • RIP will selectively express the oncogene, in this case, temperature sensitive SV40 T-antigen (tsTAG), in only ⁇ cells.
  • tsTAG temperature sensitive SV40 T-antigen
  • tsTAG temperature sensitive SV40 T-antigen
  • the ⁇ cells should proliferate while other cell types remain quiescent.
  • the second step is to immortalize the proliferating ⁇ -cells by infection with a recombinant retrovirus also expressing an oncogene like tsTAG under the control of RIP.
  • Retroviruses require cellular division in order to integrate into the genome. Once integrated the transgene should be stably expressed resulting in an immortalized cell.
  • the present invention contemplates the use of cell lines derived from human insulinomas as starting cells for the instant methods to produce immortalized human neuroendocrine cells. This example describes the culturing of human insulinomas.
  • tissue culture media BetaGene medium supplemented with 3.5% fetal bovine serum (FBS), 200 U and ⁇ g/ml penicillin/streptomycin, and 50 ⁇ g/ml gentamycin).
  • FBS fetal bovine serum
  • the tissue is kept on ice and sierile, keeping the transit time to less than 30 minutes.
  • the tissue is minced with iris scissors until it is reduced to pieces 1 mm or smaller.
  • the tumor is then transferred to 40 mesh tissue sieve through which the large pieces are forced using rubber pestle.
  • the cells are then washed twice for a period of 15 minutes each with fresh culture media containing antibiotics.
  • the tissue is then split onto standard Falcon tissue culture dishes and dishes coated with matrigel extracellular matrix.
  • the tissue is maintained under standard tissue culture atmospheric conditions of 37°C; 5% C0 2 /95% air; and humidified.
  • the tissue is then cultured with media composed of 30% conditioned tissue culture media (BetaGene medium containing 3.5% fetal bovine serum (FBS) conditioned by culture with ⁇ G 261/13, a rat ⁇ -cell line stably transfected with pCB6 expressing the full length human growth hormone coding region), 70% BetaGene Medium product # 62469-79P, 1% FBS, 50 ⁇ g/ml gentamycin.
  • BetaGene medium containing 3.5% fetal bovine serum (FBS) conditioned by culture with ⁇ G 261/13, a rat ⁇ -cell line stably transfected with pCB6 expressing the full length human growth hormone coding region
  • BetaGene Medium product # 62469-79P 1% FBS,
  • Rat islets from adult animals weighing 150-200 g were isolated using the following protocol. Rats were anesthetized with i.p. injection of Nembutal, placed on their back ventral side up, and the abdominal area was wetted with 70% alcohol. Using large forceps and large scissors a midsagittal cut through the skin and musculature from hip level to xiphoid process was made to expose the abdominal cavity. Lateral cuts through skin and musculature were made at the level of the ribs to fold abdominal walls down. The duodenum was located under and adjacent to the liver on the animals right side. The bile duct was clamped where it enters the duodenum with a hemostat, which was positioned so the bile duct was straightened out but not stretched.
  • the bile duct was blunt dissected from liver adhesions and connective tissue at the level of the liver hilus, while being careful not to rupture the descending aorta directly beneath bile duct.
  • the bile duct was held with fine forceps as close to the hilus bifurcation as possible. While the bile duct was lifted slightly, microscissors were used to nick the bile duct just downstream of the forceps hold.
  • the beveled end of cannula was inserted into the bile duct lumen through the nick, and the end ofthe cannula was worked down the bile duct to a level past the bile duct branches to the liver lobes.
  • pancreatic attachments to the large intestine, the mesenteric attachment of the duodenum, and the spleen attachment to greater curvature of stomach were dissected. Then the pancreatic fat from the spleen to the stomach was cut, and while holding the duodenum at the pylorus, the gut was bisected on the duodenal side of the pylorus. The duodenum and attached pancreas was removed from abdominal cavity by cutting the connections to the dorsal cavity wall, the spleen and the gut. The pancreas was then placed in weight dish and any remaining fat and lymph nodes were trimmed off.
  • the pancreas was transferred to a 50 cc tube on ice, .and digested in a 37°C water bath for 17 minutes. The digestion was stopped by adding ice cold Ml 99/5% NBS to the 40 ml mark. The tube was then shaken sharply for 5 strokes, and then centrifuged at 1000 rpm for 2 minutes. The supernatant was decanted, and the 40 ml wash was repeated with ice cold M199/%5 NBS a total of 3 times. Any remaining undigested connective tissue was removed.
  • the pellet was resuspended in 20 ml of media, and the digest was poured through a tissue sieve and collected in a fresh 50 ml tube.
  • the original tube was rinsed with 20 ml of media, and the rinse was poured through the tissue sieve.
  • the sample was centrifuged at 1000 rpm for 2 min, the media was poured off, and the tube was drained upside down on a paper towel to remove as much media as possible.
  • 10 ml of Histopaque- 1077 Sigma 1077-1
  • was added was resuspend by vortexing maximally for an instant (2 sec). At this point, 10 ml of media was slowly added to form the top layer of the gradient.
  • the sample was centrifuged in a swinging bucket rotor centrifuge at 2400 rpm for 20 min.
  • the islet tissue settled at the interface between the histopaque and the media.
  • the islets were removed with a pipette, placed in a fresh 50 cc tube, and washed twice with media.
  • the islets can be stored for several hours at 4°C.
  • the islets were transferred to a petri dish and visualized with a stereoscopic dissecting microscope and a lateral fiber optic light source.
  • the islets were separated from non-islet tissue debris prior to use with an eppendorf microtip.
  • 6000 islet equivalents were placed in a 50 ml tube, brought up in PBS (calcium and magnesium free), and then centrifuged to pellet the islets.
  • the islets were resuspended in 5 ml of trypsin/DNAse solution (1 mg/ml trypsin, 30 ⁇ g/ml DNAse find in PBS), .and incubated for 15 min at 37°C, shaking vigorously every 5 minutes.
  • the sample was refluxed through a 10 ml pipet if large pieces were visible.
  • To stop the digestion 5 ml. of ice cold media was added, and the sample was placed on ice.
  • the cells were pelleted at 600 rpm for 5 min, and resuspend in 6 ml fresh media.
  • the islets were cultured on two types of matrices.
  • Matrigel collaborative Biomedical, #40234
  • Matrigel was thawed overnight at 4 °C and then diluted 1 :4 with Medium 199 without FBS. 2 ml was added to each well of a 6 well plate, and the excess was removed. The matrix was polymerized for 1 hour at room temperature, followed by a rinse with PBS. Coated plates were then placed at 50°C for 2 hours to further dry the matrix. Coated plates are stored at -20°C, and then thawed and rinsed once with PBS prior to plating cells.
  • HTB-9 American Type Culture Collection, ATCC HTB-9 (5637)
  • HTB-9 matrix was prepared by culturing the cells to confluency in RPMI 1640 with 10% FBS as indicated by the supplier. Media was aspirated and cells washed and lysed in water. This was repeated two times to ensure complete cell lysis. The remaining matrix was incubated for 10 to 15 minutes in PBS, rinsed two more times with PBS, and then stored indefinitely under PBS at 4°C. Prior to plating of dispersed cells, the PBS is aspirated. Cells are plated onto both Matrigel or the HTB-9 matrix in Medium 199 containing 4% FBS.
  • the islet cells spread from the periphery to form a monolayer ring comprising approximately 50% of the islet cells with the remaining islet cells in the central multilayer islet remnant after 2 days culture on HTB-9 matrix. Attachment and spreading of both dispersed and whole islets on matrigel extracellular matrix was slower and less complete than that observed for HTB-9 matrix. After 6 days culture, about 70% of dispersed islet cells were in monolayer plaques, and peripheral monolayer zones were just forming on whole islet plaques. In general islet cells on matrigel matrix tended to be taller and rounded in contrast to HTB-9 cultures in which the cells were flattened and spread over a larger area. Fibroblasts from the islets were observed in both the matrigel and HTB-9 matrix cultures but were a minor population (1 to 5%) compared to the epithelial like presumed endocrine cells.
  • EXAMPLE 22 Human Islet Function in BetaGene Medium Human islet preparations were obtained from the distribution center of The Diabetes Research Institute, Miami FL. The volume of islets received are expressed in islet equivalents (IEQ). An islet equivalent is the number of cells/volume that is found in an islet with a diameter of a 150 ⁇ m. Insulin content and secretory response of the islets was assayed first upon receipt and second after culture in BetaGene medium. Proper insulin processing was also analyzed before and after culture in BetaGene medium.
  • IEQ islet equivalents
  • Islet preparation suspensions were spun down in a bench top centrifuge at 1000 rpm for 2 minutes at room temperature to pellet the cells.
  • the shipping medium was aspirated leaving approximately 5 ml behind to avoid disrupting the pellet.
  • the pellets were resuspended in the remaining 5 ml medium and transferred to a new 50 ml conical tube.
  • Islet cells do not divide in culture and may be overrun by various replicating cells which are present in islet preps as shipped. Encapsulating the cells immediately upon receipt minimizes the growth of fibroblasts and other cell types.
  • the islets were resuspended in a 2% sodium alginate solution (50% high viscosity and 50% low viscosity sodium alginate made up in complete BetaGene medium) at a concentration of 1000 IEQ per 1 milliliter of alginate.
  • the suspension is transferred to a syringe and allowed to sit at room temperature for 5 minutes to allow all air bubbles to rise to the surface.
  • a 25 gauge needle is attached to the syringe and the islet/alginate slurry is dispensed through the syringe into a 50 ml conical tube containing approximately 35 mis of 1.35% CaCl2 /20 mM HEPES.
  • Beads are formed as the slurry hits the surface of the CaCl2 solution, and are completely polymerized after about 10 minutes.
  • the CaC ⁇ solution is removed carefully and the beads are washed with two volumes of BetaGene medium / 20 mM HEPES.
  • the encapsulated islets were then cultured with the medium under conditions described for each study.
  • HPLC system used for resolving insulin from its precursor, proinsulin:
  • Encapsulated islets were cultured in BetaGene medium and fed 3 times weekly. The islets were removed from the alginate to extract the insulin content. To recover the islets, the beads were incubated in 6 mM EDTA/10 ml BetaGene medium and the alginate was dispersed by pipetting until the mixture became homogeneous. The mixture was centrifuged at 1/2 speed in a benchtop centrifuge for 5 minutes, the supernatant with alginate was removed and the islets washed with 10 ml PBS/2mM EDTA. The solution was spun again and the pellet was resuspended in 5 ml PBS to remove EDTA, spun again and resuspended in content buffer for analysis by HPLC as described above.
  • Alginate encapsulated islets were cultured in 24 well plates for at least 4 days, with «50 IEQ/ well (or 5 beads) in 2 ml of medium. The day before the study the culture medium was replaced with fresh medium. The day of the study the islets are equilibrated for 90 minutes with BetaGene Medium with low glucose. The medium was then removed and replaced with 1 ml of RPMI without glucose, or Modified BetaGene Medium, (manufactured without glucose), that was supplemented with glucose to provide concentrations between 2.2 and 22 mM glucose, .and 22 mM + IBMX. The islets were then incubated at 37°C for 90 minutes and samples collected at the end of 90 minutes for assay of insulin. Each experimental value usually represents results from 6 replicate wells. The glucose concentration providing 50% of maximal stimulation (Stim- 50) was calculated from the fitted line ofthe glucose dose-response curve. Results
  • the serum requirements of human islets were tested in long term (> 2month) cultures supplemented with various amounts of serum, 1%, 3.5%, or 10% FBS and 5% horse serum (ES). In four independent isolations the average daily insulin output for 60-90 days was minimally affected by amount of serum supplementation. However, the overall tendency was for higher FBS to yield lower output. Similarly, in an acute secretion experiment, insulin secretion from islets cultured in 10% FBS exhibited lower response to glucose or to a stronger mixed secretagogue stimulus (FIG. 25). The sustained insulin output from human islets with 1% FBS supplementation (in BetaGene Medium) suggested that human islets also may secrete insulin and survive under serum-free conditions.
  • BetaGene Medium The capacity of BetaGene Medium to sustain the dose-responsive nature of the insulin secretory response was evaluated with continuous cultures. Human islets were stimulated with varied glucose concentrations at intervals to monitor secretory changes that may occur with time. It has been previously noted that the capacity of human islets to respond to glucose is impacted by isolation methods and conditions, in particular, cold ischemia time. Cold ischemia of the preparations studies varied between 10 and 22 h. Variables related to donors and isolations produce considerable variation among islet isolations. As a result, the magnitude of response shown in FIG. 27 is not found with all preparations. However, a common finding was an initially poor response, with increased function with time of culture in BetaGene Medium, and a maintained capability to secrete insulin in response to glucose for times >4 months (FIG. 27).
  • the sustained secretory function for months in culture was also accompanied by maintained insulin content and insulin processing. This is illustrated with both islets that have initially low or initially high insulin contents, and with islets that initially exhibit minimal insulin processing capacity.
  • the insulin content of islets from HI28 was low upon arrival, 0.3 ⁇ g/1000 IEQ with >90% mature, processed insulin.
  • the insulin content of mature, processed insulin with HI28 islets cultured 1.5 months in BetaGene Medium was increased 4 fold to 1.3 ⁇ g/1000 IEQ.
  • FIG. 28 shows the fractionation of insulin extracted from islets of HI21. Initially (FIG. 28 A), 99% of the insulin was unprocessed insulin, with only 29 ng mature insulin/1000 IEQ. The mature insulin content was increased 18-fold to 512 ng/lOOOIEQ after 4 weeks of culture in BetaGene Medium; this represents >90% of the insulin content (FIG. 28B).
  • HI27 islets were cultured 8 weeks and then insulin content was fractionated by HPLC, with this isolation as well, islets had regained the capacity to process insulin. In both of these preparations, while insulin processing improved the total insulin content (mature + unprocessed insulin) was decreased.
  • BetaGene medium exhibit improved secretory function, maintained glucose-responsiveness, while maintaining or even increasing proteolytic processing of insulin and insulin content.
  • tsTAG tsA58 coding region
  • Drug resistance to G418 results from translation of the downstream Neo gene due to the internal ribosome entry site (IRES, Macejak and Sarnow, 1991).
  • a second tsTAG expression plasmid was constructed in which the CMV promoter was replaced with the rat Insulin 1 promoter (RIP).
  • pCMV/tsTAG/IRES/Neo was digested with Spel and EcoRI, removing the CMV promoter, and replaced with RIP on a 440 bp Spel/Eco ⁇ fragment derived from pRIP7/INS (Clark et al., 1996), generating pRIP/tsTAG/IRES/Neo.
  • tsTAG Recombinant adenoviruses expressing tsTAG under the control of either the RIP promoter or the CMV promoter were constructed.
  • the tsTAG encoding fragment was isolated from pCMV/tsTAG/IRES/Neo by digestion with Sail, treatment with Klenow fragment, followed by EcoRI digestion. The fragment was ligated into pAC/RIP that had been digested with BamHI, Klenow treated and digested with EcoRI, generating pAC/RIPtsTAG.
  • p AC/CM VtsTAG was constructed by removing tsTAG from pBS/tsA58 and ligating into pAC/CMV to produce pAC/RIPtsTAG.
  • Retroviral expression plasmids were constructed in order to produce recombinant retroviruses capable of expressing tsTAG under the control of the tissue-specific rat insulin promoter.
  • a fragment containing RIP/tsTAG was isolated from pRIP/tsTAG/IR ⁇ S/Neo by digestion with Sail, Klenow treatment followed by Spel digestion. This fragment was ligated into pBS/hGH PolyA that had been treated with Xbal, Klenow treated and digested with Spel, generating pBS/RIP/tsTAG/hGH PolyA.
  • the hGH PolyA sequence in pBS/hGH PolyA is a 625 base sequence which directs efficient transcriptional termination and polyadenylation of mRNAs.
  • pBS/RIP/tsTAG/hGH PolyA was digested with S ⁇ cl, Klenow treated, followed by digestion with Sail allowing isolation of a RIP/tsTAG/hGH PolyA containing fragment.
  • This fragment was ligated into two retroviral plasmids, pBabeNeo and pBabePuro (Morgenstem and Land 1990), following digestion with SnaBl .and Sail, generating pBabeNeo/RIPtsTAG and pBabePuro/RIPtsTAG, respectively.
  • E6/E7 genes were obtained from Dr. Jerry Shay and Dr. Woody Wright at the University of Texas Southwestern Medical Center. These genes were cloned into the viral vector backbone
  • E6/E7/LXSN was then introduced into the PA317 packaging cell line to produce replication - defective recombinant retrovirus.
  • the full length IGF-1 receptor mRNA (Genbank accession number: X04434) was reverse transcribed and amplified by the polymerase chain reaction (RT-PCR). Total RNA was isolated from A549 cells using RNAzol B RNA isolation reagent (Cinna/Biotex Laboratories
  • RT-PCR was performed using SuperscriptTM Preamplification System (Life Technologies).
  • the IGF1 receptor cDNA was gel purified and cloned as an EcoRI/BamHI fragment into EcoRI/BamHI digested CW102 resulting in plasmid DM202.
  • EXAMPLE 24 Cell-Specific Expression of tsTAG and beta-galactosidase
  • tsTAG Cell-specific transcription of tsTAG was determined for both pBABE/Neo/RIPtsTAG and pXTl/RIPtsTAG (construction of these plasmids is detailed in Example 6) in RIN cells and in 293 human fibroblast cells.
  • the retroviral plasmids were stably transfected into both cell types and levels of tsTAG mRNA and protein were determined by Northern and Western blotting, respectively. Significant levels of tsTAG mRNA and protein were detected in RIN cell extracts containing either retroviral plasmid, whereas, no expression of tsTAG mRNA or protein was observed in 293 cell extracts containing either retroviral construct.
  • RIN 1046-38 cells were infected with adeno/RIP-tsTAG at varying multiplicities of infection (MOI). The virus was left on the cells for 2 hours then washed off and the cells received fresh medium. The infected cultures were incubated at 37°C for 48 hours then were shifted to 33.5°C for an additional 48 - 72 hours. The cells were washed with PBS and then fixed in Carnoy's fixative for immunocytochemistry. The anti-TAG antibody used to detect TAG expression in RIN cells was from Santa Cruz Biotechnology. Roughly, 10 to 20 % of the RIN cells were intensely stained for TAG expression at MOIs of approximately 30 to 300 viral particles per cell.
  • MOI multiplicities of infection
  • recombinant plasmids utilizing the insulin promoter engineered for enhanced activity are constructed (see Example 8). These constructs provide ⁇ -cell specific expression of the oncogene, and in the case of the insulin promoter with enhanced function, also provide a level of gene expression nearly equivalent to that achievable with the CMV promoter.
  • the media was aspirated off 6 well cluster dishes containing primary cultures of islets with the cells well attached to dishes. Then 2 ml of Ml 99 media 10% FBS containing 1000 pfu/cell was added (estimating 500,000 cells from 500 islets and 5 x 10 pfu/2 ml media). The sample was incubated at 37°C for 1 hour, the media was aspirated, and then 6 ml of Ml 99/4% FBS was added. The sample was cultured for 24 hours, and then expression was checked.
  • the cells were washed once with PBS, and then fixed for 20 min at room temperature in 0.5% formaldehyde. The cells were washed again with PBS, 1 ml of stain was added, and the sample was incubated for 30 min at 37°C. The cells were then washed once with PBS. In all culture preparations, dispersed and whole islet on matrigel or HTB-9 matrix, staining appeared faster, more intensely, and with higher frequency (greater than 80% of cells) in cultures infected with pAC-CMV- ⁇ -gal than in cultures infected with pAC-RIP- ⁇ -gal (about 50% of cells).
  • CMV is a more efficient gene promoter in cultured rat islet cells than the rat insulin promoter although at this time it cannot be ruled out that the difference in ⁇ -gal expression under these promoters was due to differences in the titer of viable adenovirus used to infect the islet cultures. It was also observed that fibroblasts stained for the presence of ⁇ -galactosidase in cultures infected with pAC-CMV- ⁇ -gal but did not stain in cultures infected with pAC-RIP- ⁇ -gal indicating a specificity for RIP promoter expression in islet ⁇ -cells. I'hese studies demonstrate the feasibility of maintaining primary cultures of islet tissue and using adenovirus expression systems to modify protein production of these cultures.
  • the pituitary gland secretes a number of different hormones including leutenizing hormone (LH), thyroid stimulating hormone (TSH) and follicle stimulating hormone (FSH) using a regulated secretory pathway.
  • LH leutenizing hormone
  • TSH thyroid stimulating hormone
  • FSH follicle stimulating hormone
  • Each of these hormones contain an alpha and beta subunit.
  • the beta subunits are expressed only in the appropriate pituitary cell types, giving specificity to each hormone.
  • the alpha subunit, called ⁇ -glycoprotein is common to all pituitary hormones and is expressed in all pituitary cell types. Although expression of this protein is fairly ubiquitous in the pituitary, it is postulated to be specific to neuroendocrine cell types only.
  • the ⁇ -glycoprotein promoter may aid in expression of transforming proteins within neuroendocrine cells only and not within non- neuroendocrine cell types which may be also be present in the culture or tumor.
  • the ⁇ -glycoprotein promoter (Genbank accession number L05632) was amplified by PCR from human liver DNA (Clontech) using Taq Plus Long (StrataGene). Oligonucleotides AT255 (GGGGAACTAGTAAACTCTTTGTTGAAG SEQ ID NO: 14) and AT256 (CTCAGTAACTCGAGTTAATGAAGTCCT SEQ ID NO: 15) were used in 40 rounds of PCR with denaturation at 94°C (30 sec), annealing at 55°C (30 sec) and extension at 72°C (2 min) to amplify the promoter.
  • BetaGene plasmid BL436 CMV-neo
  • BetaGene plasmid DM102 ⁇ - glycoprotein-neo
  • AtT20, RIN38, and H03 cells were transfected with BetaGene plasmids BL436 (CMVneo), BY428 (RIPneo) and DM102 ( ⁇ -glycoprotein-neo) by electroporation as previously described. Clones resistant to G418 were counted after 13 days of selection. Pituitary cells (AtT20) transfected with BY428 did not survive selection with G418. DM102 created about 75% fewer clones than BL436 in the same cell line. In RIN38 (rat insulinoma) and H03 (human neuroendocrine) cells, DM102 colony formation was equivalent to BY428 with BL436 creating 75% more clones. These data indicate that the ⁇ -glycoprotein promoter may provide neuroendocrine-specific gene expression.
  • EXAMPLE 25 Modified Insulin Promoters
  • the rat insulin 1 gene promoter fragment (RIP) was modified in an attempt to strengthen its transcriptional activity.
  • the principal modification involved the attachment of varying numbers of Far-FLAT minienhancers (FF minienhancer) (German et al. 1992) to different positions within an intact RIP or to a RIP truncated at -205 (-205RIP).
  • FF minienhancer Far-FLAT minienhancer
  • FF minienhancers were constructed by generating oligonucleotides corresponding to the region of RIP between -247 and -196: 5*-GATCCCTTCATCAGGCCATCTGGCCCCTTGTTAATAATCGACTGACCCTAG GTCTAA-3' (top strand; SEQ ID NO:5); and 5'-GATCTTAGACCTAGGGTCAGTCGATT ATTAACAAGGGGCCAGATGGCCTGATGAAGG-3' (bottom strand; SEQ ID NO:6).
  • the underlined sequences at the ends of the oligonucleotides are BamHI and Bglll recognition sites.
  • the oligonucleotides were annealed and ligated in the presence of restriction enzymes BamHI and Bglll. Since BamHI and BgUl produce compatible DNA ends but can no longer be digested by BamHI or Bglll, the only multimers that escaped BamHI and Bglll digestion were ligated head-to-tail.
  • FFE minienhancers in which the three italicized bases in SEQ ID NO:5 and SEQ ID NO:6 above were mutated are called FFE minienhancers.
  • FFE minienhancers are constructed essentially as described above by generating oligonucleotides corresponding to the region of RIP between -247 and -196: 5'-GATCCCTTCATCAGGCCATCTGGCCCCTTGTTAA TAATC7A T7ACCCTAGGTCTAA-3' (top strand; SEQ ID NO:7); and 5'-GATCTTAGACCTAGGGT A7T4GATTATTAACAAGGGGCCAGATGGCCTGATGAA GG-3' (bottom strand; SEQ ID NO:8).
  • the italicized bases represent the mutated bases.
  • FFE minienhancers were shown to be more active than FF minienhancers when both are attached to a minimal promoter (German et al. 1992).
  • FF and FFE minienhancer dimers, trimers, etc. were separated by polyacrylamide gel electrophoresis and blunt-end cloned into the transient transfection vector, pBS/RIP/hGH, at either a Xh ⁇ site immediately upstream of -415 of the intact RIP, into an Avrll site at -206 of an intact RIP, or into an Apal site immediately upstream of -205RIP.
  • the number and orientation of minienhancer repeats were verified by DNA sequencing.
  • FF and FFE minienhancer/RIP-hGH constructs were transiently cotransfected along with Rous sarcoma virus-chloramphenicol acetyltransferase (RSV-CAT), an internal control plasmid used to monitor differences in transfection efficiencies, into 1 x 10 RIN cells by electroporation (Chu and Berg 1987) as modified by Bassel-Duby et al. (1992).
  • RSV-CAT Rous sarcoma virus-chloramphenicol acetyltransferase
  • the cells were incubated overnight in 199 medium containing 5 mM butyrate. The next day 199 medium containing butyrate was removed and new medium without butyrate was placed on the cells.
  • CAT activity in the cell extracts was determined by the method of Nielsen et al. (1989). Promoter activity as measured by hGH production was then normalized for transfection efficiency differences between samples by the quantitated CAT activity in each sample.
  • the strength of the modified RIP promoters was also determined in stably transfected RIN cells.
  • the stable transfection vector, pFFE3/RIP8/INS/IRES/NEO containing three copies of FFE minienhancers (FFE3) was generated by inserting a blunt-ended KpnllHin ⁇ lll FFE3/RIP into pCMV8/INS/IRES/NEO in which the CMV promoter was removed with Spel and Sad.
  • pFFE6/RIP8/INS/IRES/NEO was constructed by inserting an ⁇ /j ⁇ l/blunt-endedHmdIII FFE6/RIP fragment into pRIP8/hGH polyA in which RIP was removed by Apal/EcoRY.
  • a Bgl ⁇ llStul INS/IRES/NEO fragment was then inserted into pFFE6/RIP8/hGH polyA to complete pFFE6/RIP8/INS/IRES/NEO.
  • RJPi rat insulin 1 gene intron
  • RJPi was obtained by polymerase chain reaction from rat genomic DNA using oligonucleotides 5'-CTCCCAAGCTTAAGTGACCAGCTACAA-3' (SEQ ID NO:9) and 5'-GGGCAA CCTAGGTACTGGACCTTCTATC-3' (SEQ ID NO: 10). These oligos produced a 185 bp product containing the 119 bp RlPi (Cordell et al 1979) and a Hmdlll site on the 5' end and a BamHI site on the 3' end.
  • PCR product was digested with Hmdlll and BamHI and ligated into pNoTA T7, whereupon it was removed with Xbal blunt-ended with Klenow/HmdIII .and inserted into EcoRV/Hwdlll digested pRIP8/INS/IR ⁇ S/N ⁇ O to generate pRIP8/RIPi/INS/IRES/NEO.
  • pFFE6/RIP8/RIPi/INS/IRES/NEO was constructed by replacing the 5' adenovirus-immunoglobulin hybrid intron/INS/IRES of pFFE6/RIP8/INS/IRES/NEO with RIPi/INS/IRES from pRIP8/RIPi/INS/IRES/NEO.
  • FFE6 promoters also proved to be cell-specific. FFE6 promoters were fused with the neomycin gene to generate FFE6/RIP8/NEO. This plasmid was stably transfected into RIN cells, 293 cells, and pituitary AtT-20 cells. When challenged with G418, drug-resistant colonies were only present in RIN cells. As a control, CMV/NEO was also stably transfected into RIN cells, 293 cells, .and pituitary AtT-20 cells. After selection in G418, a large number of drug-resistant colonies were present in all three lines.
  • RIP derivatives like FFE6/RIP8/RIPi possess two important characteristics necessary for optimal expression of linked transforming genes in human ⁇ -cells: 1) they will direct expression of the transforming gene to ⁇ -cells and remain silent in other cell types associated with the islet preparation; and 2) they will deliver high levels of the transforming gene similar to those obtained from the very strong, non-cell-specific CMVp.
  • EXAMPLE 26 Induction of ⁇ -Cell Growth
  • Pancreatic islet ⁇ -cell growth can occur from two separate pathways (Swenne, 1992). New islets can differentiate from budding of pancreatic ductule epithelium (neogenesis), or from the replication of existing islet ⁇ -cells. Neogenesis of islets is thought to primarily occur during fetal and perinatal stages of development, but has also been observed in the regenerating adult pancreas (Bonner-Weir, 1992). Replication of existing pancreatic ⁇ -cells has been seen in the late fetal stages, but is thought to be the principal means of increasing ⁇ -cell mass in the adult (Swenne, 1992). In a population of normal islet ⁇ -cells the number that are under going cell- division has been measured to be between 0.5-2%.
  • GH mediates its growth effect on ⁇ -cells by stimulating the production of IGF-I in islets which in turn mediates a paracrine or autocrine effect to stimulate ⁇ -cell replication (Nielsen, 1982). While this may in part be so, (indeed IGF-I alone has been shown to stimulate fetal ⁇ -cell replication 2-fold (Brelje and Sorenson, 1991)), it also is clear that GH can exert a stimulation of adult ⁇ -cell replication independently of IGF-I (Swenne et al, 1987). Gastrin and cholecystokinin can instigate a small increase in ⁇ -cell replication (Bonner- Weir, 1992).
  • EGF does not appear to affect ⁇ -cell replication even though significant EGF binding to ⁇ -cells has been observed (Nielsen, 1989), suggesting that the EGF signal tiansduction pathway is not functional in pancreatic ⁇ -cells.
  • PDGF does not appear to affect ⁇ -cell replication, but this is due to there being very few PDGF-receptors on ⁇ -cells.
  • the PDGF ⁇ receptor is transfected into ⁇ -cells only a 50% increase in DNA synthesis was observed upon stimulation with PDGF ⁇ -chain (Welsh et al, 1990), suggesting that a post-receptor signal transduction mechanism for ⁇ -cell replication is only partly present.
  • pancreatic ⁇ -cells a mitogenic signal transduction pathway mediated via Ras activation can be induced.
  • proto-oncogene expression is undetectable or extremely low, but in islets transfected with v-src, or a combination of c-myc and c-Ha-ras, only a modest 50% increased cell replication rate was observed (Welsh et al, 1987).
  • these studies imply that it is important to appropriately activate a mitogenic signal transduction pathway in ⁇ -cells as well as to overexpress certain key elements within that pathway.
  • the present Example concerns the identification of mitogenic signal transduction pathways in pancreatic ⁇ -cells, which in turn indicates an appropriate growth factor and signaling pathway to exploit for inducing ⁇ -cell growth in vitro and/or establishing novel ⁇ -cell lines.
  • the inventors have found that IGF-1 and activation of a signal transduction pathway via IRS-2 and p70 S6K (FIG. 28) can induce up to a 30-fold increase in ⁇ -cell growth in insulinoma cells.
  • Recombinant adenoviruses were generated to overexpress the IGF-1 receptor and/or IRS-2 in primary isolated islets (preferably human islets) to determine the effects of IGF-1 induced ⁇ -cell growth.
  • IRS-1 and IRS-2 cDNAs were obtained from Morris White (Joslin Diabetes Center/Harvard Medical School, Boston, MA). A series of constitutively on/off IRS-1 and -2 variants are also available.
  • Recombinant adenoviruses where IRS-1, IRS-2, IGF-1 receptor, or insulin receptor expression is driven by the ubiquitous CMV-promoter using pAC-CMV were generated, and confirmed by restriction enzyme and sequence analysis.
  • recombinant adenoviruses for specific ⁇ -cell expression driven by the insulin promoter using pAC-RIP
  • Recombinant adenoviruses expressing ⁇ -galactosidase and luciferase driven by the CMV-promoter are used as controls.
  • a pAC-RIP driven luciferase expressing recombinant adenovirus is used as a control.
  • Recombinant adenovirus infection of isolated islets is followed as previously described (Becker et al, 1994). Confirmation of IRS-1, IRS-2 IGF-1 receptor and insulin receptor overexpression in islets by Northern- and immunoblotting is performed.
  • Recombination of the pAC and pJM17 vectors to generate El A deficient recombinant adenovirus can only accommodate an -3.8 kb insert into pAC shuttle vector.
  • the IRS- 1, IRS-2, IGF-1 receptor, and insulin receptor cDNA inserts are all >3.8 kb. Therefore, the pBHGl l (E3 deficient vector) instead of pJM17 is used to generate El A and E3 deficient recombinant adenovirus.
  • the pBHGl 1 vector enables inserts of up to 9 kb into pAC to be used which is suitable for IRS-1, IRS-2, IGF-1 receptor, and insulin receptor cDNAs.
  • the pBHGl l vector was obtained from Larry Moss (New England Medical Center, Boston, MA).
  • RITz-cells are isolated from the well granulated line of NEDH-rat transplantable insulinoma tissue by cellular sieving and PercollTM centrifugation gradient purification. They are maintained in culture under identical conditions for INS-1 cells (Alarc ⁇ n et al, 1993). In terms of insulin secretion, RITz-cells are not responsive to glucose in the physiological range, but are when elevating intracellular cAMP, phorbol esters, and/or depolarization.
  • the (de)differentiation state is assessed using three parameters: I) Glucose-regulated proinsulin biosynthesis translation- To date all the available transformed ⁇ -cell lines (except the relatively well differentiated low passage MIN6 cells) do not possess a phenotype of specific regulated proinsulin biosynthesis by a physiologically relevant range of glucose concentrations. Maintenance of correct glucose stimulated proinsulin biosynthesis in IRS-2/IGF-1 receptor overexpressing islet ⁇ -cells (Alarc ⁇ n et al, 1993) is an indication of maintaining a differentiation state.
  • Regulated (pro)insulin release- Dedifferentiated transformed ⁇ -cell lines have a tendency to constitutively secrete an increased proportion of proinsulin, and also lose their response to relevant secretagogues, especially glucose in the 2-20 mM range.
  • Pulse-chase radiolabeling protocols Alarc ⁇ n et al, 1995.are used to assess the proinsulin:insulin ratio released from IRS-2/IGF-1 receptor overexpressing islet ⁇ -cells in response to glucose and a stimulatory cocktail containing multiple secretogogues and potentiators of glucose-stimulated insulin secretion and thus assess the differentiation state.
  • p7 ⁇ phosphorylation state The extent of p70 phosphorylation in ⁇ -cell lines tends to correlate with dedifferentiation state and growth rate of the cells.
  • the phosphosphorylation of p70 S6K occurs on multiple sites on the molecule, with 5 phosphorylated forms observed by immunoblotting (due to electrophoretic retardation ofthe p70 phospho-forms on SDS-PAGE); the upper 3-5 multiple phosphorylated p70 forms are activated.
  • ⁇ -cell Mitogenic Signal Transduction Pathways Induction of ⁇ -cell growth/transformation requires not only overexpression of a particular element in a mitogenic signal transduction pathway (i.e., IRS-2), but also activation of that pathway by an appropriate growth factor (i.e., IGF-1). Therefore, in IRS-2/IGF-1 receptor overexpressing islet cells it is important to assess activation of the IGF-1 signal transduction pathway(s). This is performed using established methods (Myers and White, 1996).
  • Changes in protein-protein interactions is measured (e.g., IGF-1 instigated IRS-2-PI3 kinase association by immunoprecipitation with p85 PI3 kinase antibody followed by immunoblotting with either .anti-phosphotyrosine .and/or IRS-2 .antibodies); the phosphorylation state of a particular protein is determined (e.g., using specific antibodies that recognize only phosphorylated MAP kinase, or immunoblotting for gel retardation analysis of p70 or immunoprecipitation followed by anti-phosphotyrosine immunoblotting); and induction of enzyme activity is measured (e.g., MAP kinase or PI3 kinase assays).
  • Necessary reagents or assay kits are purchased form UBI.
  • IRS-2 mRNA levels for IRS-2 were increased >50-fold in insulinoma cells compared to isolated islets.
  • IRS-2 mRNA levels for IRS-2 were also found in RIN 1046-38, RIN- m5F, INS-1, ⁇ TC3, HIT and MIN6 cell lines, but not in ⁇ TC-1, AtT20, PC-12, GH-3, 293, Cos, CHO or 3T3-L1 cell-lines where IRS-2 mRNA levels were comparable to those in isolated rat islets.
  • the elevated IRS-2 levels appear to be peculiar to insulinoma cell lines.
  • the only other gene product found so far to be overexpressed to such an extent in insulinoma cells is a Ha-Ras containing VL30 transposon element (i.e. an endogenous retroviral like transposon that contains the Ha-Ras sequence within it).
  • the overexpressed VL30 element mRNA is not reflected in Ha-Ras expression at the protein level which is unchanged compared to normal rat islets.
  • this particular VL30 is acting like a typical transposon that is quite common to tumor cells.
  • the elevated levels of IRS-2 mRNA in insulinoma cells were also reflected at the protein level by immunoblot analysis.
  • the levels of other potential mitogenic signal transduction proteins in the ⁇ -cell namely IRS-1, c-Ha-Ras, PI3-kinase, p70 , She, Grb-2, MAP-kinase (erk-1 .and -2 isoforms) and CREB were not changed between islets and insulinoma cells.
  • RITz- cells A polyclonal cell line from the NEDH-rat transplantable insulinoma tissue termed RITz- cells.
  • RITz-cells When starved of serum for 48h RITz-cells continue to grow, albeit at a slower rate, so that the rate of H-thymidine incorporation drops 4-fold compared to fed cells.
  • RITz-cells With 10% (v/v) serum the H-thymidine incorporation rate increases by 20-fold after a further 48h incubation, in line with a parallel increase in RITz-cell proliferation.
  • the expression levels of the aforementioned signaling molecules did not significantly change in these ⁇ serum studies.
  • the differentiation state (as judged by secreted proinsulin:insulin ratio and regulated insulin secretory response to a stimulatory cocktail (20 mM glucose, 10 ⁇ M forskolin, 1 mM IBMX, 30 mM KC1, 50 ⁇ M PMA) did not alter in the same ⁇ serum studies.
  • IGF-1 at a concentration of 10 "9 M was found to give a maximum stimulation (>30-fold; ED 50 ⁇ 10 "10 M IGF-1) of RITz-cell growth (as analyzed by H-thymidine incorporation) after a period of 48h serum deprivation.
  • IGF-1 at 10 M There is no additive or synergism of serum (10% v/v) + IGF-1 (at 10 M), suggesting that it is IGF-1 in serum that is responsible of stimulating RITz-cell growth.
  • the RITz-cells do remarkably well in the absence of serum for periods up to 5 days, although they do grow at a slower rate. It is possible that insulin secreted by such insulinoma cells is 'feeding back' via the IGF-1 receptor to maintain the cell line.
  • IRS-2 is activated by tyrosine phosphorylation within the 10-30 min window, resulting in increased association of PI3'K to IRS-2 in INS-1 cells, as shown by immunoprecipitation with a PI3'-kinase 85 kD subunit antibody, and subsequent antiphospho- tyrosine .and/or IRS2 immunoblotting analyses in 48 h serum-starved INS-1 cells that have been re-fed with serum for 10 min or 30 min. Similar results are observed with IGF-1 stimulation.
  • IGF-1 signal transduction pathway in ⁇ -cells occurs preferably via a IRS-2/p70 route, rather than a route involving activation of Ras. Because ofthe massive overexpression of IRS-2 in insulinoma cells, it appears that IGF-1 signaling is mediated via IRS- 2 rather than IRS-1. As previously stated, IRS-2 expression levels did not change in response to adding back serum and/or IGF-1. This latter observation suggests that it is not only IRS-2 overexpression, but also activation of IRS-2/p70 signal transduction pathway that is important for IGF-1 mediated stimulation of ⁇ -cell growth.
  • IRS-2 (and possibly IGF-1 receptor) overexpression in primary (human) islets initiates an IGF-1 mediated potent stimulation of ⁇ -cell mitogenesis .and/or leads to a novel (human) ⁇ -cell line (FIG. 31).
  • a background level of glucose is required for IGF-1 to stimulate mitogenesis of INS-1 cells (as judged by [ H]-thymidine incorporation).
  • glucose must be present > 3 mM glucose (FIG. 32).
  • IGF-1 only has a slight effect in stimulating INS1 cell growth.
  • Glucose alone can instigate INS1 cell growth in a dose dependent manner -3 -fold at 6 mM glucose, -4- fold at 9 mM glucose and -10-fold at 18 mM glucose.
  • This effect of glucose on INS1 cell growth is potentiated by IGF1 in a dose dependent manner >10 pM IGF-1 reaching a maximum between 10-100 nM IGF-1.
  • the role that glucose plays in IGF-1 mitogenic signaling pathways in pancreatic ⁇ -cells is investigated by studying phosphorylation activation of the 'signal transduction proteins' .and protein-protein interactions by IGF-1 ⁇ glucose. It is known that glucose is capable of activating MAPK (via a Ca + -dependent process), therefore its role in activation of other elements in that pathway is investigated.
  • GH growth hormone
  • rGH rat growth hormone
  • INS1 cell growth like that of IGF-1, requires a 'background' of glucose (FIG. 30).
  • the rGH has no effect on INS-1 cell growth until a threshold of 6 mM glucose that reaches a maximum (-50-fold increase compared to "0" glucose) at 15 mM glucose.
  • a background level of glucose was required to stimulate mitogenesis in the adenovirus infected cells.
  • IRS-2 is a multiple tyrosine phosphorylated molecule that appears to be located at a crossroads for many mitogenic signal transduction pathways in a ceil (Myers and White, 1996).
  • One particular growth factor induces phosphorylation of only certain IRS-2 tyrosine residues, and thus limits the number of downstream elements that associate with IRS-2 and can then be activated.
  • IRS-2 activation requires exogenous growth factor stimulation (even in IRS-2 overexpressing cells), thus activation of mitogenic signal transduction pathways via IRS-2 can be turned on .and off (unlike overexpression of 'constitutively on' downstream elements).
  • IRS-2 activation requires exogenous growth factor stimulation (even in IRS-2 overexpressing cells), thus activation of mitogenic signal transduction pathways via IRS-2 can be turned on .and off (unlike overexpression of 'constitutively on' downstream elements).
  • mitogenic signal transduction pathways in ⁇ -cells is being investigated to identify other candidates that induce ⁇ -cell growth.
  • BetaGene Medium Maintains Growth and Function of Neuroendocrine Cells
  • the biologic activity of peptides considered for biopharmaceutical applications are influenced by a number of complex modifications. These post-translational modifications include correct proteolytic processing of precursor molecules, amidation, glycosylation, disulfide formation, folding, and oligerimization. Production in mammalian cell systems is necessary for many therapeutically relevant peptides to ensure bioactivity and minimize immunogenicity. The latter issue of immunogenicity may even require the use of human cell systems.
  • Neuroendocrine cells are cells that are specialized in the biosynthesis and export (secretion) of biologically relevant peptides. A distinguishing characteristic of neuroendocrine cells is the dominance of a regulated secretory pathway.
  • This pathway involves sorting to and storage of peptides in dense- core or secretory vesicles, in addition to both relatively high level biosynthesis and post- translational modifications of peptides.
  • Neuroendocrine cells are being developed as a cellular therapy for in vivo delivery of bioactive peptides. Such an application requires large-scale production ofthe implantable cells.
  • a number of enzymes that are essential for the post-translational modifications have been characterized, with many abundantly expressed in neuroendocrine cells. Whether manufacturing processes utilizing neuroendocrine cells involve production of purified peptides or cells for implantation, the process must sustain the activity of these enzymes so that bioactive peptides will be produced.
  • the present invention is directed to optimized culture media for neuroendocrine cells, for the purpose of not only growth, but also function. Specifically, secretory function, and the functional activity of enzymes requisite for post-translational processing. This has involved the use of primary human neuroendocrine cells, and neuroendocrine cell lines, (some specifically engineered to express therapeutically relevant peptides), to empirically determine components critical to secretion and processing.
  • a neutral red uptake assay was used for quantification of viable cell mass to allow rapid determinations of cell growth, and for calculation of cell doubling times.
  • Neutral red diffuses across cell membranes, while protonated neutral red does not.
  • Accumulation of neutral red is dependent on an acidic compartment (maintained by H+/ATPase) in metabolically active cells. Accumulation is time and concentration dependent, and with conditions appropriate to cells of interest, uptake is linearly related to viable cell number.
  • the assay is initiated by adding neutral red (from 1 mg/ml stock in acetic acid) to cells to provide a final concentration of 25-50 ⁇ g/ml (a mimmum of 2 ml medium/cm culture surface in each well is required).
  • the cells are then incubated with neutral red for 0.5-1 h at 37°C.
  • the medium with neutral red is then aspirated, the cells washed once with medium and the neutral red is extracted from the cells.
  • Neutral red is extracted with a solution containing 50% ethanol and 0.1 M NaH 2 P0 4 (pH 5.1-5.5).
  • the soluble neutral red is quantified by determining absorbance at 540 nm in a plate reading spectrophotometer, with a standard curve of neutral red (1-40 ⁇ g/ml) dissolved in the same extraction solution.
  • Human growth hormone was determined with a human growth hormone ELISA
  • GH growth hormone
  • BG785/5 is an engineered version of a neuroendocrine line derived from a lung tumor (BGH04; ATCC CRL-5803); these cells have been engineered to express human growth hormone.
  • BGH16 is a neuroendocrine gastric carcinoma (ATCC CRL-5974).
  • the other 2 lines are rodent cells, derived from a rat insulinoma, one, BG18/3E1, was engineered to express human insulin (Diabetes 46:958-967, 1997), the other, BG191/26, was engineered to express preproglucagon (transfected with BetaGene plasmid BU503; W097/26334 and W097/26321).
  • BGH16 cells were passaged with a 1 :3 split ratio into 12 well plates and fed 2-3 times/week with 4 ml per well of BetaGene Medium supplemented with 2% or 5% serum or serum-free.
  • BG785/5 cells were plated (1 :30 ) into 24 well plates, «1 x 10 4 /well, and fed 2-3 times/week with 2-3 ml per well of either RPMI or BetaGene Medium supplemented with FBS or serum-free.
  • Media samples were collected for human GH assay, and cell growth determined at 2-3 day intervals for « 2 weeks.
  • RPMI is the medium recommended for this cell type.
  • BG18/3E1 cells were plated (1 :8 to 1:16) into 24 well plates, *1 x 10 5 /well, and fed 2-3 times/week with 2-3 ml per well of BetaGene Medium supplemented with 0.5-5% FBS or serum- free. Media samples were collected for hum-an insulin assay, and cell growth determined at 2-3 day intervals for approx. 2 weeks.
  • Serum-supplemented media contained fetal bovine serum (JRH Biosciences, Lenexa KS), supplemented to 2%, unless otherwise indicated.
  • the lot of serum used was selected by screening >5 lots of serum by assaying attachment, clonal growth, and maintenance of secretory function (of primary pancreatic beta cells and beta cell lines) at serum supplements of 0.5% to 5%.
  • Serum-free supplement provided 0.1% BSA, 10 ⁇ g/ml of transferrin, and 50 ⁇ M each of ethanolamine and phosphoethanolamine.
  • BetaGene medium The performance of cells in BetaGene medium (JRH Biosciences) was compared to RPMI, a medium recommended for culture of human cells (Methods in Enzymology 58, pages 213 and 91; 1979). RPMI is also the medium recommended for the BGH04 cell line (the parental cell line engineered to yield the BG785/5 cell line).
  • BGH16 cells were derived and cultured in DMEM:F12 (50:50) mixture supplemented with a complex mixture of hormones, growth factors, selenium, BSA, transferrin, ethanolamine and phosphoethanolamine (10 ⁇ M each). For the present studies the BGH16 cells were switched to BetaGene Medium with either FBS or serum-free supplements and growth was evaluated in this medium. Results: Growth & Function
  • the BGH16 cell line is a slow-growing suspension culture with a 5-6 day doubling time.
  • the BG785/5 cell line is a rapidly growing monolayer culture that readily reaches confluence with a 2 day doubling time.
  • the BG18/3E1 cell line is a slower-growing monolayer culture that does not readily achieve confluence. Growth in BetaGene Medium for all these cell lines was maintained when serum-free supplements (SF) were used in the place of FBS (Table 12).
  • the BG785/5 cell line was derived from BGH04, cells which were derived and routinely cultured in RPMI w/FBS.
  • the growth rate of BG785/5 cells in BetaGene and RPMI media, with FBS or SF, is shown in FIG. 36.
  • cells grown in RPMI w/FBS exhibited a longer lag phase, the growth of cells in BetaGene medium and RPMI w/FBS was similar, all with doubling times of 2 days.
  • cells in RPMI w/SF essentially failed to grow, with an apparent doubling time of 26 ⁇ 1 days.
  • Three wells of RPMI w/SF were switched to BetaGene Medium w/SF for the last 4 days of the experiment, resulting in a restart of growth and a doubling time of 3.2 ⁇ 0.2 days.
  • BetaGene Medium In contrast with growth, the secretory function of cells in RPMI medium did not keep pace with cells grown in BetaGene Medium (FIG. 37).
  • the human growth hormone (hGH) output of cells grown in BetaGene Medium with FBS was approx. 5 times greater than growth hormone output from cells in RPMI w/FBS.
  • the hGH output of BetaGene Medium w/SF was more than 5 times that of RPMI w/SF. While BetaGene Medium supplemented with SF sustained hGH output equal to that of RPMI w/FBS, it was not sufficient to support the same secretory function as BetaGene Medium with FBS.
  • BG18/3E1 cells The growth of BG18/3E1 cells was slowed only with low serum — at 0.5%, but not by SF-supplementation (Table 12). The insulin secretory function of these cells was maintained with all supplements until the cells reached the plateau phase of growth. Cells at plateau phase, whether supplemented with 0.5% FBS or SF, do not maintain normal secretory output (FIG. 38). This was confirmed in separate studies with SF .and 0.5% FBS cultures. The secretory impairment at plateau phase may be due to decreased biosynthesis or processing of insulin rather than an impairment of secretion. The ability to respond to a secretagogue cocktail is shown in FIG. 39 for SF- and 2% FBS- supplemented cultures in BetaGene Medium (see example 30 for composition of trace mineral and amino acid supplements).
  • RPMI medium is one of the most commonly used media for culture of rat (and hamster) beta-cell lines.
  • the present results with BetaGene medium stand in contrast with the literature where insulinoma cells cultured in RPMI medium extinguish insulin production at plateau phase of cell growth (Karlsen, et al. 1991). Insulin output with BetaGene medium supplemented with serum-free supplements is reduced at plateau phase of growth, although it is not extinguished.
  • BetaGene medium The capability of BetaGene medium to sustain processing and secretion of a peptide that yields proteolytically cleaved and amidated products was evaluated by measuring GLP-1 (amidated and non-amidated) production.
  • Amidation of a carboxy-terminal glycine is one of the later events in post-translational processing. This modification is essential for the activity of some peptides, including about half of peptide hormones, and appears to be rate-limiting for production of some peptides (Eipper, et al, 1992; Cuttitta 1993).
  • the bifunctional enzyme responsible for amidation is peptidylglycine a-amidating monooxygenase (PAM).
  • PAM monooxygenase
  • the enzyme itself is proteolytically processed and is both N- and O- link glycosylated and is targeted to secretory granules in neuroendocrine cells (Yun et al, 1994). This enzyme requires copper and ascorbate to accomplish amidation; copper is a part ofthe functional enzyme.
  • Ascorbic acid has been shown to be diabetogenic in vivo, toxic to mouse islets in vitro, and to cultured fibroblasts, hepatocytes and lung carcinoma cells (discussed in Anderson & Grankvist, 1995). It is not clear what concentrations of ascorbate would be required by islets, whether ascorbate would be toxic with chronic culture, or whether there may be species differences in the effect of ascorbate in beta-cells.
  • Ascorbic acid or a substitute reducing agent is utilized on an essentially equimolar basis for each mole of amidated product.
  • the provision of ascorbate would then be expected to be important for maintaining peptide amidation with neuroendocrine cells cultured, particularly, in the absence of serum, or grown at high-density, production scale.
  • One study of neuroendocrine cells engineered to express an amidated peptide was unable to increase amidation activity by supplementing with 50 mM ascorbic acid (Takeuchi et al, 1991); maximal production achieved was approx. 6 pmol/million cells-day.
  • the present studies have used cultured primary human islets, rat beta-cell lines, and human neuroendocrine cells to determine 1) the chronic cytotoxic effects of ascorbate, and A-2-P; 2) whether A-2-P will support PAM- amidation activity; 3) whether A-2-P has any effect on the secretion of non-amidated peptides, such as insulin.
  • the first consideration was to determine whether A-2-P was a more stable form of vitamin C in the cell culture environment.
  • a simple assay was devised that takes advantage of the dye reducing properties of ascorbic acid.
  • the assay can be coupled with alkaline phosphatase to dephosphorylate A-2-P so that it can be measured with the same assay system used to measure ascorbate.
  • the assay uses alkaline Tris-Mg buffer (pH 7.8-8.0; 2 mM MgCl 2 ) and nitroblue tetrazolium for ascorbate alone, or for A-2-P the solution contains in addition 10 U/ml of calf intestinal phophatase (C-AlkP).
  • Ascorbate reduces the pale yellow NBT resulting in an intense purple color development. The color is developed whether the source is sodium ascorbate or ascorbic acid produced by the dephosphorylation of A-2-P by C-A1P.
  • Na ascorbate stock solution, and A-2-P stock solution was made at 100 mM in RO/DI water or culture medium; ascorbic acid stock are stored frozen less than -120° C. These stock solutions are used to construct a standard curve with a range of 1 to 18 mM in culture medium.
  • the assay reaction mixture consists of 0.1 M Tris buffer, 1 mM magnesium, 0.4 ⁇ M nitroblue tetrazolium, with or without 10 U/ml of C-AlkP.
  • the standards and samples, 10 ⁇ l are pipetted into individual wells of a 96 well plate.
  • the reaction is started by adding 100 ⁇ l of reaction mixture to each well.
  • the reaction is quantified as a rate assay, with kinetic reading of OD at 595 nM at 20s intervals for 15 minutes.
  • the stability of ascorbate was determined by spiking medium samples with ascorbic acid or A-2-P, then incubating the samples in the dark at 4°C, room temperature, and 37°C.
  • the change in concentration with ascorbate and A-2-P, after 1 .and 2 days at the various temperatures is presented in Table 13.
  • the results indicate that ascorbate in media is degraded quickly, with marked breakdown occurring at 4°C.
  • A-2-P was very stable with little loss of activity (98% recovery) after 4 days at 37°C. Refrigerated media exhibited the same A-2-P concentrations as freshly manufactured medium for times of >6 months.
  • BGH03 a lung neuroendocrine cell line was engineered to express human insulin by transfection with BetaGene plasmid AA603.
  • the resultant cell line BG498/45 biosynthesizes, processes, and secretes human insulin.
  • a suspension culture of BG498/45 cells (PD33) were plated in varying concentrations of ascorbate or A-2-P. Samples were collected for insulin assay and medium changed after 2 and 5 days of culture. The insulin RIA is described herein (see example 33).
  • ascorbate altered insulin output by reducing insulin «20% only at the highest concentration.
  • cells were dying and insulin output was reduced to «20% of controls by the highest concentrations of ascorbate, while «400 ⁇ M concentrations of both ascorbate and A-2-P enhanced insulin secretion (FIG. 41).
  • the highest concentration of A-2-P did not inhibit insulin output.
  • This present assay used the BG191/26 cells line engineered to overexpress the preproglucagon gene.
  • Production of amidated and nonamidated GLP1 was determined by immunoassay of secreted cell products from cells cultured 1 day in RPMI medium (with 2% FBS) supplemented with varying concentrations of A-2-P.
  • the dose-response shows half-max. and maximal amidation activity with ⁇ l and 10-100 ⁇ M of A-2-P (FIG. 42).
  • the amount of amidated GLP-1 plateaued from 25-1000 ⁇ M. Concentrations of 10 mM consistently (4 separate experiments) resulted in slight decreases in amidated GLP-1, with a similar tendency to reduce non-amidated GLP-1 output.
  • Supplementation with A-2-P results in a decrease in non-amidated GLP-1, such that amidated/ non-amidated exceeds 100%.
  • Maximal output of .amidated GLP-1 with this cell line is «12 pmol/million cells-day, representing 5 fold increase over 0 ⁇ M A-2-P.
  • This result demonstrates that supplementation with A-2-P can effect increased amidation activity with cultured cells, and that maximal amidation activity is reached at lower concentrations (with a related beta-cell line), than the concentrations that increased insulin output ( «400 ⁇ M; FIG. 41).
  • BG191/26 cell monolayers in T25 flasks were changed to RPMI medium ⁇ copper, or BG Medium ⁇ additional copper (the latter medium contains 5 nM copper).
  • Medium samples were collected after 24 h and the GLP-1 species were separated and quantified by HPLC.
  • the results in FIG. 43 show that supplementing RPMI (which has no copper in its formulation) increases the output of amidated GLP-1. Further supplementation of BG medium with copper to 250 and 500 nM does not increase amidated GLP-1, whereas 1 ⁇ M copper tends to decrease amidated GLP-1.
  • BetaGene Medium have higher output of non-amidated GLP-1, and thus a lower ratio of .amidated product than cells with RPMI. Both forms of GLP-1 are active, so this final processing step is less critical for GLP-1 production.
  • a human cell line BGH01 was found to naturally express GLP-1. This cell line was used to test the effect of 5 nM copper on amidation. In medium without copper these cells contained 3 ng of GLP-1, with amidated GLP-1 constituting slightly more than half. In the presence of copper the GLP-1 content was increased 4 fold, with amidated GLP-1 constituting more th.an 80 % ofthe total. This indicates that with conventional culture conditions the same concentration of copper can be used for both rodent and human cells that make an amidated product.
  • Human islets encapsulated in alginate beads were set up in 24 well plates with «50 islet equivalents/well and cultured in BetaGene Medium with or without added A-2-P and copper.
  • Secretory function .and glucose-sensing was determined by incubating the islets with different concentrations of glucose for 90 minutes (from 2.2 to 22 mM). This glucose dose-response test was performed immediately before adding ascorbate to the cultures and at 2 week intervals. In the first 2 weeks 500 ⁇ M A-2-P, and 1 ⁇ M copper was supplemented. In the second 2 weeks ascorbate was increased to 2 mM, copper was kept at 1 ⁇ M.
  • FIG. 44 shows that A-2-P did not impair function as indicated by sensing of glucose, (EC50 for control and A-2-P islets was the same). Additionally, the maintenance of maximal insulin secretion indicates that there is minimal toxicity of A-2-P for these culture times.
  • the above findings demonstrate the stability of A-2-P in media, the effectiveness of A-2- P in supporting amidation-activity in cell culture, the beneficial effect on secretory function, .and the concomitant lack of cytotoxicity with cultures of neuroendocrine cell lines and primary human islets.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Genetics & Genomics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention porte sur des compositions et procédés relatifs à des lignées de cellules neuroendocrines humaines obtenues par génie génétique, à mécanisme sécrétoire régulé, et plus particulièrement sur des procédés et compositions assurant par génie génétique la régulation de la sécrétion de cellules. Certains aspects de l'invention ont trait à des mécanismes de détection glycémique induits par génie génétique dans une population de cellules. Dans des exécutions particulières, l'invention porte sur des compositions et procédés conférant à une population de cellules obtenues par génie génétique des mécanismes indirects de détection glycémique. L'invention porte spécifiquement sur des procédés et compositions d'induction par génie génétique dans des cellules de la capacité de détection indirecte du glucose et d'une capacité de contre régulation du glucose, et sur des procédés d'utilisation desdites cellules pour réduire l'hypoglycémie dans le traitement du diabète.
EP99904073A 1998-01-12 1999-01-11 Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines Withdrawn EP1045898A2 (fr)

Applications Claiming Priority (11)

Application Number Priority Date Filing Date Title
US7255698P 1998-01-12 1998-01-12
US7120998P 1998-01-12 1998-01-12
US7119398P 1998-01-12 1998-01-12
US71209P 1998-01-12
US71193P 1998-01-12
US72556P 1998-01-12
US8784898P 1998-06-03 1998-06-03
US8782198P 1998-06-03 1998-06-03
US87821P 1998-06-03
US87848P 1998-06-03
PCT/US1999/000631 WO1999035255A2 (fr) 1998-01-12 1999-01-11 Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines

Publications (1)

Publication Number Publication Date
EP1045898A2 true EP1045898A2 (fr) 2000-10-25

Family

ID=27535873

Family Applications (2)

Application Number Title Priority Date Filing Date
EP99901421A Withdrawn EP1047938A2 (fr) 1998-01-12 1999-01-11 Lignees cellulaires recombinees pour le criblage de medicaments
EP99904073A Withdrawn EP1045898A2 (fr) 1998-01-12 1999-01-11 Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP99901421A Withdrawn EP1047938A2 (fr) 1998-01-12 1999-01-11 Lignees cellulaires recombinees pour le criblage de medicaments

Country Status (4)

Country Link
EP (2) EP1047938A2 (fr)
AU (3) AU2455199A (fr)
CA (2) CA2318376A1 (fr)
WO (3) WO1999035495A2 (fr)

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SK14922002A3 (sk) * 2000-03-17 2003-04-01 Ajinomoto Co., Inc. Farmaceutický prostriedok na prevenciu, zlepšenie a/alebo liečenie diabetickej komplikácie a použitie postprandiálnej látky na zníženie hladiny krvného cukru
EP1370134B1 (fr) * 2001-03-23 2016-03-23 University Of Ottawa Procedes et compositions pour la cryoconservation de cellules animales primaires dissociees
US7166463B2 (en) 2001-11-16 2007-01-23 The Regents Of The University Of Colorado Nucleic acids encoding modified olfactory cyclic nucleotide gated ion channels
EP1893159B1 (fr) 2005-06-17 2015-09-30 Vital Health Sciences Pty Ltd. Support comprenant un ou plusieurs dérivés de di- et/ou monophosphate d'agents de transfert d'électrons
ES2336575T3 (es) 2005-09-22 2010-04-14 Biocompatibles Uk Limited Polipeptidos de fusion glp-1 (peptido-1 similar al glucagon) con resistencia aumentada a la peptidasa.
PT1974014T (pt) * 2006-01-04 2017-05-26 Baxalta Inc Meios de cultura celulares livres de oligopeptídeos
DE602006009631D1 (de) 2006-05-10 2009-11-19 Biocompatibles Uk Ltd GLP-1 Peptide enthaltende kugelförmige Mikrokapseln, deren Produktion und deren Verwendung
CA2657248C (fr) 2006-07-13 2018-10-30 Wyeth Production de glycoproteines
PL2167644T3 (pl) 2007-05-01 2017-06-30 Vitrolife Sweden Ab Pożywki hodowlane dla komórek rozwojowych zawierające podwyższone stężenia kwasu liponowego
AU2008297930A1 (en) * 2007-09-11 2009-03-19 Mondobiotech Laboratories Ag Use of octreotide as a therapeutic agent
EP2163243A1 (fr) * 2008-09-12 2010-03-17 Biocompatibles UK Limited Traitement de l'infarctus du myocarde (AMI) utilisant des cellules encapsulées codant et sécrétant des peptides GLP-1 ou analogues associés
PT2464725T (pt) 2009-08-11 2020-05-21 Hoffmann La Roche Produção de proteínas em meios de cultura celular isentos de glutamina
EP2531047A4 (fr) 2010-02-05 2014-03-19 Phosphagenics Ltd Vecteur comprenant du phosphate de tocophéryle non neutralisé
KR20120115991A (ko) * 2010-02-05 2012-10-19 포스파제닉스 리미티드 담체 조성물
ES2829386T3 (es) 2010-03-30 2021-05-31 Phosphagenics Ltd Parche de administración transdérmica
ES2736224T3 (es) * 2011-02-22 2019-12-27 Promethera Biosciences Sa Sistema de llenado para proporcionar concentraciones y volúmenes uniformes y sus métodos
WO2012122586A1 (fr) 2011-03-15 2012-09-20 Phosphagenics Limited Nouvelle composition
US8945876B2 (en) 2011-11-23 2015-02-03 University Of Hawaii Auto-processing domains for polypeptide expression
WO2013082458A1 (fr) 2011-12-02 2013-06-06 The Regents Of The University Of California Solution de protection de reperfusion et ses utilisations
AR095196A1 (es) 2013-03-15 2015-09-30 Regeneron Pharma Medio de cultivo celular libre de suero
WO2015066631A2 (fr) * 2013-11-01 2015-05-07 University Of Notre Dame Du Lac Milieu de culture cellulaire et optimisation des bioprocessus
ES2716674T3 (es) 2013-11-22 2019-06-14 Centre Nat Rech Scient Célula congelada lista para ensayo y método para minimizar variabilidad en el rendimiento de la misma
US10918110B2 (en) 2015-07-08 2021-02-16 Corning Incorporated Antimicrobial phase-separating glass and glass ceramic articles and laminates
TW202330904A (zh) 2015-08-04 2023-08-01 美商再生元醫藥公司 補充牛磺酸之細胞培養基及用法
CN108601732A (zh) 2015-12-09 2018-09-28 磷肌酸有限公司 药物制剂
MX2019006845A (es) 2016-12-21 2019-10-15 Avecho Biotechnology Ltd Proceso.
KR102569522B1 (ko) * 2017-11-24 2023-08-24 주식회사 차바이오랩 세포 동결 보존용 조성물 및 이를 이용한 세포 동결 보존 방법
WO2020206187A1 (fr) * 2019-04-02 2020-10-08 Centagen, Inc Système de haute technologie de rajeunissement de cellules souches pour traiter le vieillissement et la maladie
CN114868736B (zh) * 2022-03-08 2022-12-09 四川中科奥格生物科技有限公司 一种胰岛细胞稳定液及其制备方法和用途
CN114561337B (zh) * 2022-03-09 2023-10-03 广州源井生物科技有限公司 一种提高HepG2细胞克隆形成率的单克隆增强培养基和方法

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5180662A (en) * 1988-01-05 1993-01-19 The United States Of America As Represented By The Department Of Health And Human Services Cytotoxic T lymphocyte activation assay
US5427940A (en) * 1991-06-03 1995-06-27 Board Of Regents, The University Of Texas System Engineered cells producing insulin in response to glucose
AU650045B2 (en) * 1990-09-12 1994-06-09 Lifecell Corporation Method and apparatus for cryopreparation dry stabilization and rehydration of biological suspensions
DE550760T1 (de) * 1991-07-18 1994-02-03 Fuji Yakuhin Kogyo Kk Serum-freie gewebekulturmedien die einen gewebeinhibitor der metallproteinase enthalten und methoden des zellwachstum.
GB9125052D0 (en) * 1991-11-26 1992-01-22 Isis Innovation Culture of bone cells
FR2726005B1 (fr) * 1994-10-10 1997-01-03 Adim Lignees immortalisees de cellules endotheliales cerebrales et leurs applications au traitement de differents troubles ou maladies primaires et secondaires neurologiques ou psychiatriques
AU718254B2 (en) * 1996-01-19 2000-04-13 Betagene, Inc. Recombinant expression of proteins from secretory cell lines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9935255A2 *

Also Published As

Publication number Publication date
WO1999035242A1 (fr) 1999-07-15
WO1999035255A9 (fr) 2001-05-31
CA2318379A1 (fr) 1999-07-15
WO1999035495A2 (fr) 1999-07-15
EP1047938A2 (fr) 2000-11-02
WO1999035255A8 (fr) 1999-09-10
AU2112199A (en) 1999-07-26
WO1999035255A2 (fr) 1999-07-15
AU2455199A (en) 1999-07-26
WO1999035242A9 (fr) 1999-09-30
WO1999035255A3 (fr) 1999-10-28
WO1999035495A3 (fr) 1999-11-25
AU2113199A (en) 1999-07-26
CA2318376A1 (fr) 1999-07-15

Similar Documents

Publication Publication Date Title
EP1045898A2 (fr) Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines
US8415153B2 (en) Differentiation and enrichment of islet-like cells from human pluripotent stem cells
CA2692325C (fr) Cellules d'ilots pancreatiques provenant de cellules souches embryonnaires humaines
EP1354942B1 (fr) Induction de cellules produisant de l'insuline
CA2246268A1 (fr) Expression par recombinaison de proteines issues de lignees cellulaires secretoires
Calderari et al. Defective IGF2 and IGF1R protein production in embryonic pancreas precedes beta cell mass anomaly in the Goto–Kakizaki rat model of type 2 diabetes
Kelly et al. Comparison of insulin release from MIN6 pseudoislets and pancreatic islets of Langerhans reveals importance of homotypic cell interactions
US20060210963A1 (en) Induction of a Beta Cell Differentiation in Human Cells
WO1997026357A1 (fr) Compositions et procedes d'inhibition de l'hexokinase
US7527971B2 (en) Adult stem cell lines
WO1999035245A9 (fr) Procedes pour preparer et utiliser des cellules neuroendocriniennes humaines immortalisees
US6448045B1 (en) Inducing insulin gene expression in pancreas cells expressing recombinant PDX-1
EP2185696B1 (fr) Cellules génétiquement modifiées pour comprendre la glucokinase d'un îlot pancréatique et leurs utilisations
US20050064587A1 (en) Pancreatic small cells and uses thereof
US6171856B1 (en) Methods and compositions relating to no-mediated cytotoxicity
US20150056173A1 (en) Beta cell growth and differentiation
WO1999006059A2 (fr) Procedes et compositions relatifs a la cytotoxicite induite par l'oxyde nitrique
Sekine et al. Glucose-Induced Insulin Secretion in INS-1 Cells Depends on Factors Present in Fetal Calf Serum and Rat Islet–Conditioned Medium
Bouckenooghe et al. Modulation of specific beta cell gene (re) expression during in vitro expansion of human pancreatic islet cells
WO2007075956A2 (fr) Procede de production et d’utilisation de cellules endocrines pancreatiques
Tatake et al. Glucose-regulated insulin production from genetically engineered human non-beta cells
WO2001005943A2 (fr) Compositions a base de lignees cellulaires de recombinaison secretant lcat, et methodes associees
US20140193910A1 (en) Methods for producing pancreatic precursor cells and uses thereof
El-Nashar et al. Histological study of the role of stem cells on experimentally induced diabetes mellitus
EP1572949A2 (fr) Entretien des ilots de langerhans

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000727

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20000727;LT PAYMENT 20000727;LV PAYMENT 20000727;MK PAYMENT 20000727;RO PAYMENT 20000727;SI PAYMENT 20000727

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20020801