WO1999035495A2 - Lignees cellulaires recombinees pour le criblage de medicaments - Google Patents

Lignees cellulaires recombinees pour le criblage de medicaments Download PDF

Info

Publication number
WO1999035495A2
WO1999035495A2 PCT/US1999/000551 US9900551W WO9935495A2 WO 1999035495 A2 WO1999035495 A2 WO 1999035495A2 US 9900551 W US9900551 W US 9900551W WO 9935495 A2 WO9935495 A2 WO 9935495A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
cells
secretion
insulin
secretory
Prior art date
Application number
PCT/US1999/000551
Other languages
English (en)
Other versions
WO1999035495A3 (fr
Inventor
Anice E. Thigpen
Christian Quaade
Samuel A. Clark
Original Assignee
Betagene, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Betagene, Inc. filed Critical Betagene, Inc.
Priority to AU21121/99A priority Critical patent/AU2112199A/en
Priority to CA 2318379 priority patent/CA2318379A1/fr
Priority to EP99901421A priority patent/EP1047938A2/fr
Publication of WO1999035495A2 publication Critical patent/WO1999035495A2/fr
Publication of WO1999035495A3 publication Critical patent/WO1999035495A3/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0018—Culture media for cell or tissue culture
    • C12N5/0037—Serum-free medium, which may still contain naturally-sourced components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/507—Pancreatic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C12N2500/22—Zinc; Zn chelators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C12N2500/10—Metals; Metal chelators
    • C12N2500/20—Transition metals
    • C12N2500/24—Iron; Fe chelators; Transferrin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/32—Amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/38—Vitamins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/40—Nucleotides, nucleosides, bases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/46—Amines, e.g. putrescine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/90—Serum-free medium, which may still contain naturally-sourced components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C12N2510/02—Cells for production
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/70—Polysaccharides
    • C12N2533/74—Alginate

Definitions

  • the present invention relates generally to the fields of biochemistry and bioengineering of eukaryotic cells. More particularly, it provides compositions and methods for screening for modulators of secretory function.
  • Cells of neuroendocrine origin generally have the capacity to synthesize and secrete one or more polypeptide products in a regulated manner.
  • cells of the anterior or intermediate lobes of the pituitary produce growth hormone or proopiomelanocortin (POMC)- derived peptides, such as ACTH and MSH; thyroid C cells secrete calcitonin; and distinct types of pancreatic cells produce and secrete hormones such as glucagon and insulin.
  • POMC proopiomelanocortin
  • Neuroendocrine cells also exhibit sorting mechanisms whereby a given polypeptide or protein, destined for secretion, is targeted to the regulated secretory pathway or the default constitutive secretory pathway. These cells also have processes for achieving secretory protein maturation, which generally involves protein folding, disulfide bond formation, glycosylation, endoproteolytic processing as well as other types of post-translational modifications. Neuroendocrine cells exhibit controlled release of the secretory protein or polypeptide, most often in response to one or more external signaling molecules, or "secretagogues,” and thus have regulatory pathways allowing the cells to secrete a desired product from the secretory storage granules in response to physiological or pharmacological stimuli.
  • neuroendocrine cells are the ⁇ cells of the islets of Langerhans in the pancreas. These cells secrete insulin in response to modulators such as amino acids, glyceraldehyde, free fatty acids, and, most prominently, glucose.
  • modulators such as amino acids, glyceraldehyde, free fatty acids, and, most prominently, glucose.
  • the capacity of normal islet ⁇ cells to sense a rise in blood glucose concentration and to respond to elevated levels of glucose by secreting insulin is critical to the control of blood glucose levels.
  • Increased insulin secretion in response to a glucose load prevents chronic hyperglycemia in normal individuals by stimulating glucose uptake into peripheral tissues, particularly muscle and adipose tissue. Aberrations in insulin secretion have serious consequences, i.e., diabetes.
  • IDDM insulin-dependent diabetes mellitus
  • NIDDM noninsul in-dependent diabetes mellitus
  • NIDDM often presents later in life, and progression of the disease is associated with ⁇ -cell exhaustion and eventual ⁇ -cell failure such that about 60% of people with the disease eventually convert from insulin-independence to an insulin-dependent status.
  • NIDDM patients are usually treated with diet and oral agents, particularly in the early phases of the disease. Greater than 90% of
  • ⁇ NIDDM patients require pharmacological treatment in order to achieve long-term glycemic control (Krall and Beaser, 1989; ADA, 1996).
  • Insulin was the first therapeutic drug prescribed for the treatment of diabetes. It was introduced in 1922 for the treatment of IDDM and dramatically reduced the mortality rate in this patient population (Joslin Diabetes Manual). Treatment for IDDM largely remains centered around self-injection of insulin once or twice daily. The possibility of islet or pancreas fragment transplantation has been investigated as a means for permanent insulin replacement (Lacy, 1995). However, this approach has been severely hampered by the difficulties associated with obtaining tissue, as well as the finding that transplanted islets are recognized and destroyed by the same autoimmune mechanism responsible for destruction of the patients' original islet ⁇ cells. Thus, the development of new therapeutic strategies is highly desirable.
  • sulfonylurea drugs became available for the treatment of NIDDM. This class of drugs is widely prescribed in the United States and acts directly on the pancreatic ⁇ - cell to stimulate insulin secretion. Long-term use of the sulfonylurea drugs often results in a loss of drug efficacy. Usage among patients goes from about 64% in the first five years after diagnosis, to 37% after 20 years of diabetes (Diabetes 1996: vital Statistics).
  • PrandinTM Repaglinide
  • Prandin acts on the same ⁇ -cell receptor as the sufonylureas and stimulates insulin secretion via closure of ATP-dependent potassium channels.
  • this drug may pose less risk for hypoglycemic episodes (Balfour JA, Faulds D. Repaglinide. Drug Aging, 13(2): 173 180, 1998 and Physicians Desk Reference, Ed 53, 1999).
  • Metformin N,N-dimethylimidocarbonimidic diamide hydrochloride, also known as GLUCOPHAGER
  • troglitazone a thiazolidinedione, also known as Rezulin
  • Acarbose an oligosaccharide also known as PrecoseR, exerts its activity in the gastrointestinal tract where it functions as an inhibitor of alpha-glucosidase.
  • This invention describes the genetic tailoring of cell lines and their use in high throughput, biological assays for the identification of novel therapeutic compounds or drug targets.
  • the use of humanized rodent pancreatic ⁇ -cell lines as screening tools for therapeutics in the prevention and/or treatment of diabetes will be described.
  • the present invention provides a method of identifying a modulator of secretory function comprising the steps of: (i) providing an immortalized cell having a stable secretory function; (ii) contacting the cell with a candidate substance; (iii) measuring the secretory function of the cell; and (iv) comparing the secretory function of the cell in step (iii) with the secretory function of the cell of step (i), wherein an alteration in the secretory function indicates that the candidate substance is a modulator of the secretory function.
  • the secretory function of the cell comprises the secretion of a polypeptide.
  • the polypeptide may be an amidated polypeptide, a glycosylated polypeptide. a hormone, an enzyme or a growth factor.
  • the secretory function is dependent on a regulator wherein the regulator is selected from the group consisting of calcium ions, cAMP, calmodulin, phosphorylation. dephosphorylation, membrane polarization glucose, ATP, ADP, fatty acids, triglycerides, nitrous oxide (and other free radicals) and NADPH.
  • the modulator inhibits the secretion; in yet other embodiments, the modulator stimulates the secretion.
  • the cell is encapsulated in a biocompatible matrix.
  • the cell is in an animal.
  • the cell may be a fetal cell.
  • the cell is part of a primary cell obtained from human tissue.
  • the cell may, independently be part of an adherent culture or as part of a suspension culture.
  • the cell is an immortalized cell.
  • the cell may be independently, an endocrine cell, and more particularly it may be a neuroendocrine cell.
  • the neuroendocrine cell may be obtained from a human neuroendocrine tumor.
  • the cell may be an insulinoma cell, a human cell, a non-human cell, a secretory cell, a pancreatic beta cell, a pancreatic alpha cell, a pituitary cell, an adipocyte, a hepatocyte, a muscle cell, a lung cell or a gastrointestinal cell.
  • the cell is responsive to modulators of secretion.
  • the cell is non-responsive to modulators of secretion.
  • the glycosylated polypeptide may be selected from the group consisting of amylin. luteinizing hormone, follicle stimulating hormone and chorionic gonadotrophin.
  • the hormone may be selected from the group consisting of growth hormone, prolactin, placental lactogen, luteinizing hormone, follicle-stimulating hormone, chorionic gonadotropin, thyroid-stimulating hormone, leptin.
  • adrenocorticotropin ACTH
  • angiotensin I angiotensin II
  • ⁇ -endorphin ⁇ -melanocyte stimulating hormone
  • ⁇ -MSH ⁇ -melanocyte stimulating hormone
  • cholecystokinin endothelin I
  • galanin galanin
  • gastric inhibitory peptide GIP
  • glucagon insulin
  • lipotropins neurophysins and somatostatin.
  • the amidated polypeptide may be selected from the group consisting of calcitonin, calcitonin gene related peptide (CGRP), ⁇ -calcitonin gene related peptide, hypercalcemia of malignancy factor (1 -40) (PTH-rP), parathyroid hormone-related protein (107-139) (PTH-rP), parathyroid hormone-related protein (107-1 11) (PTH-rP), cholecystokinin (27-33) (CCK), galanin message associated peptide, preprogalanin (65-105), gastrin I, gastrin releasing peptide, glucagon-like peptide (GLP-1), pancreastatin, pancreatic peptide, peptide YY, PHM, secretin, vasoactive intestinal peptide (VIP), oxytocin, vasopressin (AVP), vasotocin, enkephalins, enkephalinamide.
  • VIP vasoactive intestinal peptide
  • metorphinamide (adrenorphin), alpha melanocyte stimulating hormone (alpha-MSH), atrial natriuretic factor (5-28) (ANF), amylin, amyloid P component (SAP-1), corticotropin releasing hormone (CRH), growth hormone releasing factor (GHRH), luteinizing hormone-releasing hormone (LHRH), neuropeptide Y, substance K (neurokinin A), substance P and thyrotropin releasing hormone (TRH).
  • the cell secretes insulin in response to a modulator.
  • the growth factor may be selected from the group consisting of epidermal growth factor, platelet- derived growth factor, fibroblast growth factor, hepatocyte growth factor and insulin-like growth factor 1.
  • the polypeptide may be an enzyme that is a secreted enzyme.
  • the secreted enzyme may be selected from the group consisting of adenosine deaminase, galactosidase, glucosidase, lecithin:cholesterol acyltransferase (LCAT), factor IX, sphingolipase, lysosomal acid lipase, lipoprotein lipase, hepatic lipase, pancreatic lipase related protein, pancreatic lipase and uronidase.
  • LCAT adenosine deaminase
  • galactosidase glucosidase
  • factor IX factor IX
  • sphingolipase lysosomal acid lipase
  • lipoprotein lipase hepatic lipase
  • pancreatic lipase related protein pancre
  • the cell may be engineered to modify the secretion of the polypeptide in response to the secretagogue.
  • the cell may be engineered to secrete an amidated polypeptide. a glycosylated polypeptide, a hormone or a growth factor in response to the secretagogue.
  • the cell is an engineered cell that expresses a recombinant
  • the cell is an engineered cell that expresses a recombinant glucokinase (hexokinase IV) gene.
  • the cell is an engineered cell that has a reduced hexokinase I activity relative to the cell from which it was prepared.
  • the cell is derived from a ⁇ TC, RIN, HIT, BHC, CM, TRM, TRM6, AtT20, PC12, BG 49/206, BG40/1 10, BG-H03, BG 498/45, BG 498/20, NCI-H810 (CRL-5816), BON, NES2Y, NCI-H508 (CLL-253).
  • HEPG2 or HAP5 cell More particularly, the cell may be selected from the group consisting of ⁇ G HOI, ⁇ G H02, ⁇ G H03, ⁇ G H04, ⁇ G H05, ⁇ G H06, ⁇ G H07. ⁇ G H08.
  • the cell secretes an endogenous secretory polypeptide.
  • the cell is engineered to increase secretion of an endogenous secretory polypeptide.
  • the cell is engineered to modify the secretion of an endogenous secretory polypeptide in response to the modulator. More particularly, the cell comprises an endogenous gene encoding the poK peptide and in certain aspects, the expression of the gene is inhibited. In still further preferred embodiments, the cell further comprises an exogenous gene that encodes an exogenous secretory polypeptide, the cell secreting the exogenous secretory polypeptide.
  • the cell is grown in defined media further supplemented with a growth factor specific for the cell.
  • the cell may be a human pancreatic ⁇ -cell and the growth factor is HGF, IGF-1. PDGF, NGF or growth hormone.
  • the cell expresses an endogenous receptor.
  • the cell comprises an endogenous gene encoding the receptor and the expression of the gene is inhibited.
  • the cell may be engineered to modify the expression of an endogenous receptor in response to the modulator.
  • the modulator may be a stimulator of the expression or an inhibitor of the expression.
  • the cell may further comprise an exogenous gene that encodes an exogenous receptor, the cell expressing the exogenous receptor.
  • the receptor is selected from the group consisting of ⁇ -adrenergic receptor, ⁇ -adrenergic receptor, potassium inward rectifying
  • 2+ channel 2+ channel, sulphonylurea receptor, GLP-1 receptor, L-Ca receptor, voltage-dependant late rectifying channel, growth hormone receptor, luteinizing hormone receptor, corticotrophin receptor, urocortin receptor, glucocorticoid receptor, pancreatic polypeptide receptor, somatostatin receptor, muscarinic receptor, BK channel and leptin receptor.
  • the cell secretory function is responsive to a cell signaling molecule and the cell signaling molecule is a modulator of the secretion.
  • the modulator may be a stimulator or an inhibitor of the secretion.
  • the cell signal may be Ca ⁇ dependent or Ca + independent.
  • a modulator of secretory function identified according a method comprising the steps of: (i) providing an immortalized cell having a stable secretory function; (ii) contacting the cell with a candidate substance; (iii) measuring the secretory function of the cell; and (iv) comparing the secretory function of the cell in step (iii) with the secretory function of the cell of step (i), wherein an alteration in the secretory function indicates that the candidate substance is a modulator the secretory function.
  • Alternative aspects of the present invention provide a modulator of polypeptide secretion identified according a method comprising the steps of: (i) providing a stable, immortalized cell that secretes a polypeptide; (ii) contacting the cell with a candidate substance; (iii) incubating the cell; (iv) measuring the secretion of the polypeptide; and (v) comparing the secretion of the polypeptide in the cell of step (iii) with the secretion of the polypeptide in the cell of step (i), wherein an alteration in the secretion of the polypeptide indicates that the candidate substance is a modulator the secretion.
  • the present invention provides a method of identifying a modulator of insulin secretion comprising the steps of: (i) providing an engineered pancreatic ⁇ cell; (ii) contacting the cell with a candidate substance; (iii) measuring the insulin secretion of the cell; and (iv) comparing the insulin secretion of the cell in step (iii) with the insulin secretion of the cell of step (i), wherein an alteration in the insulin secretion indicates that the candidate substance is a modulator the secretion.
  • Another embodiment of the present invention provides a method of identifying a modulator of insulin secretion comprising the steps of (i) providing an engineered pancreatic ⁇ cell; (ii) contacting the cell with a candidate substance; (iii) measuring the intracellular signal of the cell; and (iv) comparing the intracellular signal of the cell in step (iii) with the intracellular signal of the cell of step (i); wherein an alteration in the intracellular signal indicates that the candidate substance is a modulator the insulin secretion.
  • the intracellular signal can include but is not limited to pH, calcium. ATP, ADP, action potentials, membrane polarity, fatty acid pools such as free fatty acids and triglycerides, glycolytic flux, NADPH, NADP. NADH, NAD, nitrous oxide and other free radicals, DNA fragmentation and other events associated with apoptosis, patterns of gene expression, cAMP, calmodulin. and enzyme activities.
  • a more specific embodiment of the present invention provides a method of identifying a modulator of insulin secretion comprising the steps of (i) providing an engineered pancreatic ⁇ cell; (ii) contacting the cell with a candidate substance; (iii) measuring the intracellular Ca + of the cell; and (iv) comparing the intracellular Ca " of the cell in step (iii) with the intracellular Ca + of the cell of step (i); wherein an alteration in the intracellular Ca indicates that the candidate substance is a modulator the insulin secretion.
  • Another aspect of the present invention provides an engineered human cell line that has a regulated secretory pathway, the cell comprising a transgene encoding a therapeutic polypeptide.
  • the transgene is introduced to the cell by contacting the cell with an expression construct comprising the gene operably linked to a promoter functional in eukaryotic cells.
  • the cell is selected from the group consisting of ⁇ TC, RIN, HIT, BHC, CM. TRM.
  • TRM6 AtT20, PC12, BG 49/206, BG40/110, BG-H03, BG 498/45, BG 498/20, NCI-H810 (CRL-5816), BON, NES2Y, NCI-H508 (CLL- 253), HEPG2 or HAP5 cell.
  • the cell may be selected from the group consisting of ⁇ G HOI, ⁇ G H02, ⁇ G H03, ⁇ G H04, ⁇ G H05, ⁇ G H06, ⁇ G H07, ⁇ G H08, ⁇ G H09, ⁇ G HIO, ⁇ G Hl l, ⁇ G H12, ⁇ G H13, ⁇ G H 14, ⁇ G H15, ⁇ G H16, ⁇ G H17, ⁇ G H18, ⁇ G H19, ⁇ G H20, ⁇ G H21, ⁇ G H22, ⁇ G H23 and ⁇ G H25.
  • FIG. 1 Multiple signaling pathways are involved in the regulation of insulin secretion. Insulin secretion is regulated by fuels and hormones, and is subject to regulation as well by synthetic compounds. The various modulators exert effects via specific cell surface receptors, metabolic pathways, and ion fluxes. Most changes in secretion are mediated through changes in intracellular calcium.
  • FIG. 2 Schematic summary of how engineered cell lines can facilitate in vitro and in vivo testing of candidate compounds that modulate insulin secretion.
  • Compounds can be screened for their effects on secretory function using primary islets, enriched populations of beta cells, and engineered cell lines. Information from these screens can be used to elucidate potentially novel drug targets and to enrich for compounds that impact secretory function.
  • Encapsulated cells can be transplanted into rodents or other mammals for pre-clinical in vivo testing of candidate compounds.
  • FIG. 3 Engineered beta-cell lines respond to a variety of secretagogues.
  • ⁇ G 49/206 cell lines were plated, cultured for 48 hrs., rinsed and washed two times (20 min. each) in HEPES Buffered Biological Salt Solution (HBBSS).
  • HBBSS HBBSS supplemented with secretagogue(s) was added to each well and allowed to incubate for 2 hours.
  • Medium was harvested from each well, assayed for insulin, and the amount of insulin secreted per hour, normalized to cell number, was determined. Normalization for cell number was achieved by staining with the neutral red, a viability dye.
  • FIG. 4 The response of engineered ⁇ -cell lines to secretagogues is stable over time and population doublings.
  • ⁇ G 49/206 cells were tested for stability of secretogogue responsiveness by monitoring insulin secretion over several population doublings (PD) ranging from PD12 to PD105.
  • PD population doublings
  • Cells were plated, cultured for 48 hrs, and washed two time (30 min. each) in a HBBSS. Insulin secretion was stimulated with glucose alone (Basal +) or in the absence or presence of glucose (presence indicated by "+") with IBMX.
  • the stimulatory cocktail contains a mixture of secretagogues (BetaGene media supplemented with 10 mM glucose, 10 mM glutamine, leucine. and arginine, lOO ⁇ M carbachol, and l OO ⁇ M IBMX).
  • FIG. 5 Secretagogue-stimulated insulin secretion of engineered RIN cell lines is maintained in microbeads.
  • ⁇ G 49/206 cells were encapsulated in 50 ⁇ l alginate beads, cultured in BetaGene medium for 72 hrs, and tested for secretagogue-responsive insulin secretion. Following washes in HBBSS, cells were stimulated with glucose, glucose plus IBMX, or a Stimulatory Cocktail (BetaGene supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, lOO ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES). As shown, glucose plus IBMX resulted in an 8-fold stimulation in insulin secretion, which is comparable to the fold stimulation observed with adherent cultures.
  • FIG. 6 Engineered RIN cells retain secretory responsiveness in a 96-well format. ⁇ G 49/206 cells were plated and assayed in 48-well dishes (100,000/well) as described in the legend to FIG. 3. For 96-well assays, 30,000 ⁇ G 49/206 cells were plated and cultured for 48 hrs. in 150 ⁇ l of BetaGene Medium/ 2.5%> FCS; washed twice, 20 min each, in 200 ⁇ l in HBBSS, and cells stimulated with glucose or glucose plus IBMX.
  • FIG. 7 Overexpression of the alpha2-adrenergic receptor in RIN cell lines confers an increased sensitivity to Clonidine in vitro.
  • ⁇ G 265/2 and ⁇ G 265/4 cell lines that overexpress transgenic alpha2-adrenergic receptor, were compared to the parental cell line ( ⁇ G 18/3E1) for the capacity of Clonidine to inhibit stimulated insulin secretion.
  • Cell lines were plated, cultured for 48 hrs, and washed two times (30 min. each) in a basal medium (RPMI medium/ without glucose/0.5%> BSA/ 20 mM HEPES/ 100 ⁇ m diazoxide).
  • Clonidine was potently inhibitory of stimulated insulin secretion in both the ⁇ G 265/2 and ⁇ G 265/4 cell lines resulting in a 60% and 30% reduction, respectively.
  • the parental ⁇ G 18/3E1 cell lines was resistant to the inhibitory effects at all concentrations of Clonidine tested.
  • FIG. 8 Engineered RIN cell lines that express transgenic alpha2-adrenergic receptor are more sensitive than human islets to Clonidine.
  • ⁇ G 265/2 cells and human islets were encapsulated in alginate microbeads and stimulated to secrete insulin in 0, 1 , 10. 100. or 1000 nM Clonidine. Washes and stimulations were performed as described in the legend to FIG.7. At 10 nM Clonidine. human islets were refractory to Clonidine; whereas, insulin secretion from ⁇ G 265/4 cells was inhibited by about 35%.
  • FIG. 9 Overexpression of the alpha2-adrenergic receptor in RIN cell lines confers an increased sensitivity to Clonidine in vivo.
  • ⁇ G 265/2 cell lines were encapsulated in alginate beads and injected intraperitoneally (IP) into Zucker diabetic, fatty rats. Following 4-5 days of in vivo growth and normalization of blood glucose, rats were injected IP with Clonidine (50 ⁇ g/kg), or Yohimbine (75 ⁇ g/kg). 20 minutes post-injection blood samples were taken to determine the levels of human insulin and rat C-peptide in the plasma. Yohimbine had no effect on human insulin or rat C-peptide levels. Clonidine injection resulted in a 50% reduction of human insulin and rat C-peptide in plasma.
  • FIG. 10A and FIG. 10B Engineered beta-cell lines lose stimulated insulin secretion, but maintain basal insulin secretion in the absence of fetal bovine serum.
  • FIG. 10A ⁇ G 18/3E1 cells were encapsulated in alginate and maintained for one week in culture in BetaGene medium with or without FBS supplement. Beads were washed with basal medium and treated with a cocktail (BetaGene supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, 100 ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES) to stimulate insulin secretion.
  • a cocktail BetaGene supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, 100 ⁇ M carbachol, lOO ⁇ M IBMX, 0.1% BSA, 20 mM HEPES
  • FIG. 10B compares the effects of different lots of BetaGene Medium and FBS on cellular growth. As shown, lots 7E183 is equivalent to lot 7H3299 with respect to support of cellular growth, and 9 days of FBS-depletion diminishes growth of the cells by 10 - 20%.
  • FIG. IIA and FIG. 11B Over-expression of somatostatin receptor (SSTRV) in ⁇ G 40/110 confers increased sensitivity to somatostatin (SS-28).
  • SSTRV somatostatin receptor
  • a cell line expressing high levels of the transgenic SSTRV receptor ( ⁇ G 603/1 1) was compared to a non-expressing cell line, ⁇ G 603/7 (FIG. 11 A).
  • 50 pM SS-28 was potently inhibitory of glucose- stimulated insulin secretion from ⁇ G 603/1 1. but had no effect on ⁇ G 603/7 insulin secretion.
  • Secretion studies were performed with HBBSS supplemented with varying concentrations of SS-28 in the absence or presence of 10 mM glucose. As shown in FIG.
  • nM SS-28 inhibits insulin secretion from ⁇ G 603/1 1 when cells were stimulated with BetaGene Medium in the absence of glucose and in a stimulatory cocktail (BetaGene Media supplemented with 10 mM glucose, 10 mM glutamine, leucine, and arginine, l OO ⁇ M carbachol, lOO ⁇ M IBMX, 0.1 % BSA, 20 mM HEPES).
  • FIG. 12A and FIG. 12B Efficient processing of overexpressed human proinsulin in engineered human neuroendocrine cells. Immunoreactive insulin was measured from HPLC-fractionated samples prepared from ⁇ G 498/20. Peaks were identified by migration position of standards.
  • FIG. 12A is the analysis of insulin content extracted from the cells
  • FIG. 12B is the analysis of insulin secreted into the media.
  • FIG. 13A and FIG. 13B Regulated secretion from engineered human cell lines.
  • Insulin secretion from ⁇ G 498/20 was measured in a two hour static incubation assay at basal conditions (0 mM) or stimulated conditions: 10 mM glucose (10 mM); 10 mM glucose + 100 ⁇ M IBMX (IBMX + lOmM); 100 ⁇ M carbachol (carb); 100 ⁇ M carbachol + 10 mM glucose (carb + 10 mM); 10 nM PMA (PMA); 10 nM PMA + 10 mM glucose (PMA + glucose); RPMI Medium + 100 ⁇ M diazoxide + BSA (RPMI + Diaz); or a stimulatory cocktail (RPMI medium supplemented with 10 mM glucose; BSA; 10 mM each arginine, leucine, glutamine; 100 ⁇ M carbachol, and 100 ⁇ M IBMX).
  • 10 mM glucose 10 mM
  • 10 mM glucose + 100 ⁇ M IBMX IBMX + lOmM
  • cell line ⁇ G 498/45 created by transfection of BG H03 with a plasmid conferring resistance to neomycin and encoding human insulin
  • 793, 794, and 796 cell lines are resistant to mycophenolic acid, puromycin, and hygromycin, respectively.
  • the data show the presence of a regulated secretory pathway in the progenitor cell line (498/45) and the maintenance of this capacity through a second round of engineering (793, 794, and 796 cell lines).
  • the increase in stimulated secretion over basal secretion ranges from about 6- to 15-fold among the various clones.
  • FIG. 14A, FIG. 14B, and FIG. 14C Correction of Diabetes in Rodents.
  • Encapsulated ⁇ G 498/20 and ⁇ G H03 cells were implanted into STZ-diabetic, NIH nude rats (FIG. 14A), immune-competent STZ-diabetic Wistar rats (FIG. 14B) or Zucker Diabetic Fatty Rats (ZDF, FIG. 14C).
  • Unengineered, parental cells ( ⁇ G H03) or low doses of ⁇ G 498/20 cells failed to affect hyperglycemia.
  • doses of ⁇ G 498/20 ranging from 15 to 25 million cells per 100 gm body weight completely corrected hyperglycemia in nude and immune-competent hosts; and in IDDM and NIDDM.
  • FIG. 15 Human C-peptide levels in the serum of rats implanted with ⁇ G 498/20 or the parental ⁇ G H03 correlate with cell number. As shown, implantation of ⁇ G 498/20 cells into STZ-diabetic Wistar rats elevates human C-peptide levels in the serum with the highest dose of cells (25 million 100 gm body weight) producing the highest level of serum human C- peptide levels for the longest period of time. The drop in C-peptide to levels below about 3 ng/ml with both cell doses of ⁇ G 498/20 correlate with increases in blood glucose shown in FIG. 14B. ⁇ G H03 cells do not produce detectable levels of human C-peptide.
  • FIG. 16A and 16B Implantation into diabetic rodents with ⁇ G 498/20 cells improves glucose tolerance. Following an overnight fast, animals were given a glucose bolus, and blood glucose levels were monitored. As shown both STZ-treated Wistar rats (FIG. 16A) and ZDF rats (FIG. 16B) show a dose dependent improvement in glucose tolerance when implanted with ⁇ G 498/20 versus implants with the unengineered parental cell line, ⁇ G H03.
  • FIG. 17A and 17B Cell-based delivery of insulin via encapsulated ⁇ G 498/20 cells reduces glycated hemoglobin (GHb) in diabetic rodents.
  • STZ-treated Fisher nudes (FIG. 17A) or STZ-treated Wistar rats (FIG. 17B) that were implanted with ⁇ G 498/20 cells experienced about 58% and 33% reduction, respectively, in % glycated hemoglobin as compared to control diabetic animals implanted with the unengineered parental cell line ⁇ G H03.
  • FIG. 18A and FIG. 18B ⁇ G H03 and ⁇ G 498/20 cells are resistant to the effects of cytokines.
  • ⁇ G H03 and ⁇ G 498/20 cells were incubated in BetaGene medium supplemented with various human cytokines as indicated for 48 hours. Tested cytokines had no impact on viability as assessed by comparing cytokine-treated cultures to untreated controls.
  • ⁇ G 498/20 cells were tested for the maintenance of secretory function in presence of cytokines (IL-lb 15 ng/ml; IFN 200 units/ml; TNF ⁇ and TNF ⁇ each at 10 ng/ml).
  • Insulin secretion was stimulated by incubating the cells in HBBSS containing 0.1% BSA and supplemented with 10 mM glucose, or 10 mM glucose plus either 100 ⁇ M carbachol or 10 nM PMA.
  • Two sets of cultures were exposed to cytokines for 24 hours, prior to secretion studies (24h cytokines, and 24h cytokines + HBBSS + cytokines); and two sets of cultures were supplemented with cytokines for the 2 hr secretion period (HBBSS + cytokines, and 24h cytokines + HBBSS + cytokines).
  • the control culture (HBBSS) was not exposed to cytokines.
  • the secretory function of ⁇ G 498/20 cells was unaffected by short or long-term exposure to cytokines.
  • FIG. 19 Engineered ⁇ G H04 fail to secrete insulin from the regulated secretory pathway.
  • Transgenic CMV-insulin/ SV40-Neo
  • clonal derivatives of ⁇ G H04 known to secrete human insulin were tested for the capacity to secrete human insulin from the regulated secretory pathway.
  • basal conditions HBSS with no glucose
  • stimulated conditions HBSS + 25 mM KCI + 2.5 mM Forskolin + 50 ⁇ M IBMX
  • ⁇ G HO4 clones 707/55, 707/63, 707/76, 707/94, and 707/96.
  • the clonal line derived from ⁇ G H03. there was a robust response to the aforementioned secretagogue cocktail, with about a 5-fold difference between basal and stimulated secretion.
  • FIG. 20 Major components of the counter-regulatory and sympathetic responses to hypoglycemia.
  • Sympathetic activation involves both stimulation of adrenaline secretion from the adrenal medulla, and increased release of noradrenaline (and adrenaline) from sympathetic nerve endings, which act directly in sympathetically innervated tissues (e.g. the liver and arterioles) and also spill over into the circulation.
  • Vasopressin has weak counter- regulatory effects on its own, but acts synergistically with the other hormones (figure adapted from "Textbook of Diabetes", 2nd. Edn. John C. Pickup and Gareth Wiiliam Eds.. Blackwell Sciences, Publ., 1997).
  • FIG. 21 General mechanisms for modulating secretion from the regulated secretory pathway.
  • secretion from the regulated secretory pathway can be modulated by the transgenic expression of cellular proteins that act as positive regulators of secretion (oval with a "+") or negative regulators (oval with "-").
  • cellular proteins that act as positive regulators of secretion (oval with a "+") or negative regulators (oval with "-").
  • Typically such proteins function as receptors at the cell surface.
  • Each class of receptor is subject to activation (ACT.) or inhibition (INH.) of activity by the binding of receptor-specific ligands, and such ligands can be physiological or pharmacological agents.
  • the modulation in receptor activity by ligand binding is translated through intracellular signaling to stimulate or inhibit the secretion of peptide hormones from the regulated secretory pathway.
  • FIG. 22 A Two-Step method for creating human neuroendocrince cell lines.
  • Primary tissues such as human islets, or neuroendocrine tumors, such as insulinomas. can be induced to proliferate through transgenic expression of growth-promoting proteins.
  • a preferred protocol for such engineering is to selectively direct gene expression with the use of tissue- specific promoters and to provide transgenes via infection with recombinant adenovirus. Following an induction of proliferation, the cell population of interest is subject to enhanced rates of immortalization via infection with recombinant retroviruses.
  • FIG. 23 Total insulin release from a human insulinoma.
  • a freshly excised human insulinoma, about 1 cm was processed and initially plated into two tissue culture wells. 9.6 cm each. The cells that survived were subsequently aliquoted into a variety of culture conditions. At the times indicated, tissue culture media samples were obtained from each of the cell samples, and insulin was measured by RIA. The insulin output from the different samples was summed to give total output.
  • FIG. 24 Maintenance of human islets in BetaGene Medium supplemented with various concentrations of glucose. Islets were cultured in BetaGene Medium with 3.9. 7.8 and 22 mM glucose for 2 weeks. The secretory responses to glucose concentrations of 3.9 mM. 22 mM and 22 mM +50 ⁇ M IBMX were then compared. Although lower glucose was less deleterious than the higher concentration, both resulted in impaired secretory response.
  • FIG. 25 Maintenance of human islets in BetaGene Medium supplemented with various concentrations of fetal bovine serum.
  • the serum requirements of human islets were tested in long term (2 month) cultures supplemented with various amounts of serum, 1%, 3.5%. or 10% FBS and 5% horse serum (ES).
  • ES horse serum
  • insulin secretion from islets cultured in 10% FBS exhibited lower response to glucose or to a stronger mixed secretagogue stimulus.
  • the sustained insulin output from human islets with 1% FBS supplementation suggested that human islets may also secrete insulin and survive under serum-free conditions
  • FIG. 26 Comparison of commonly used medias to BetaGene Medium in the maintenance of human islets. Islets were cultured for 2-3 months with BetaGene Medium, Medium 199, alpha MEM, or CMRL. all with equivalent glucose, and 0.1% BSA. In four independent islet isolations the insulin output was the highest with islets cultured in BetaGene Medium. In contrast, CMRL performed the poorest, essentially with no islet survival past 2 months with all 4 isolations studied.
  • FIG. 27 Long-term culture of human islets in BetaGene Medium restores and maintains glucose-stimulated insulin secretion.
  • the capacity of BetaGene Medium to sustain the dose-responsive nature of the insulin secretory response was evaluated with continuous cultures. Human islets were stimulated with varied glucose concentrations at intervals to monitor secretory changes that may occur with time. A common finding was an initially poor response (shown at 1 week), with increased function with time of culture in BetaGene Medium (6 weeks and 13 weeks), and a maintained capability to secrete insulin in response to glucose for times >4 months.
  • FIG. 28A and 28B Processing of proinsulin to mature insulin is enhanced by culturing human islets in BetaGene Medium. Insulin content was extracted from HI21 and fractionated by HPLC.
  • FIG. 29A and FIG. 29B Modified RIP activity in transiently transfected RIN cells.
  • FIG. 29A A schematic representation of the types of modified RIP promoters.
  • FIG. 29B Modified RIP promoter - human growth hormone (hGH) constructs were transiently transfected into RIN cells. After 48 to 96 h, hGH protein levels in the medium were determined by a radioimmunoassay. As shown in the figure, the modified RIP promoters, FFE3/-415RIP and FFE6/-415RIP, were approximately 5-fold stronger than the RIP (-415RIP) promoter by itself.
  • hGH human growth hormone
  • FIG. 30A, FIG. 30B and FIG. 30C Modified RIP activity in stably transfected RIN cells.
  • the CMV promoter, RIP promoter, and several modified RIP promoters were fused to insulin and were stably transfected into RIN cells.
  • FIG. 30A Insulin mRNA levels for each promoter construct were determined by Northern blot and quantitated with a phosphoimager. Cyclophilin mRNA levels were also determined by a phosphoimager as a control for Northern blot loading differences.
  • FIG. 30B Insulin protein levels secreted into the culture medium were determined by a radioimmunoassay.
  • FIG. 30C Modified RIP activity in stably transfected RIN cells.
  • the CMV promoter, RIP promoter, and several modified RIP promoters were fused to insulin and were stably transfected into RIN cells.
  • FIG. 30A Insulin mRNA levels for each promoter construct were determined by Northern blot and quantitate
  • Insulin protein levels within the cell were determined by a radioimmunoassay after breaking open the cells by sonication. In all three cases, be it insulin mRNA levels, secreted insulin protein, or insulin protein content inside the cell, the modified RIP promoters were significantly stronger than the RIP promoter by itself. The FFE6 modified RIP promoters approach the activity of the very strong CMV promoter.
  • FIG. 31 Mitogenic signal pathways in ⁇ -cells. Mitogenic pathways are shown for insulin-like growth factor- 1 (IGF-1) and for growth hormone (GH). The IGF- 1 /IGF- 1 receptor complex can signal cell mitogenesis via two pathways but in ⁇ cells it does so primarily through the IRS pathway. Mitogenic stimulation of ⁇ cells by GH is through the JAK/STAT pathway.
  • IGF-1 insulin-like growth factor- 1
  • GH growth hormone
  • FIG. 32 IGF-1 stimulation of ⁇ cell growth in the presence of increasing glucose concentrations IGF-1 (10 nM) was added to INSl cells incubated at different glucose concentrations. As judged by [ ⁇ ]-thymidine incorporation glucose alone can initiate INSl cell growth in a dose-dependent manner reaching a maximum of approximately 10-fold at 18 mM glucose. The effect of glucose on INSl cell growth is potentiated by IGF-1 reaching a maximum of INSl cell growth at 15mM glucose.
  • FIG. 33 Growth hormone stimulation of ⁇ cell growth in the presence of increasing glucose concentrations.
  • rGH (lOnM) was added to INSl cells incubated at different glucose concentrations.
  • the action of rGH like that of IGF-1 , requires a background of glucose to exert its effects.
  • the rGH has little effect on cell growth until a threshold of 6mM glucose and reaches a maximum at 15 mM glucose where there is an approximately 50- fold increase in [ H]-thymidine incorporation over that at 0 mM glucose.
  • FIG. 34 Additive effects of IGF-1 and rGH on ⁇ cell growth.
  • INSl cells were incubated with either 10 nM IGF-1 alone, lOnM rGH alone, or both lOnM IGF-1 and lOnM rGH at increasing glucose concentrations.
  • both IGF-1 and rGH potentiate the effect of glucose on INSl cell growth to approximately the same degree.
  • An additive effect on cell growth is observed when both growth factors are added to INSl cells at the same time.
  • FIG. 35 Adenoviral overexpression of IRS-1, IRS-2, and SV40 large T-antigen in INSl cells.
  • INSl cells were infected with either AdV- ⁇ Gal.
  • IGF-1 (10 nM) was added to the INSl cells in the presence of either 3 mM or 15 mM glucose.
  • Adenoviral-mediated overexpression of IRS-2 in INSl cells in the presence of 10 nM IGF-1 and 15 mM glucose resulted in an approximately 200-fold increase in [ H]-thymidine incorporation compared to uninfected cells plus no glucose.
  • AdV-IRS-1 infected cells in the presence of 10 nM IGF-1 and 15 mM glucose showed no increase of [ * ⁇ ]-thymidine incorporation over and above that for uninfected cells or cells infected with AdV- ⁇ Gal in the presence of 10 nM IGF-1 and 15 mM glucose.
  • FIG. 36 BetaGene Medium enhances growth of an engineered, human neuroendocrine cell line.
  • the BG785/5 cell line was derived from BGH04 cells which were derived and routinely cultured in RPMI w/FBS.
  • the growth rate of BG785/5 cells in BetaGene and RPMI media, with FBS or SF, is shown.
  • cells grown in RPMI w/FBS exhibited a longer lag phase
  • the growth of cells in BetaGene medium and RPMI w/FBS was similar, all with doubling times of 2 days.
  • cells in RPMI w/SF essentially failed to grow, with an apparent doubling time of 26 ⁇ 1 days.
  • FIG. 37 BetaGene Medium enhances secretory function of an engineered, rodent neuroendocrine cell lines (BG170-hGH).
  • the human growth hormone (hGH) output of cells grown in BetaGene Medium with FBS was approx. 5 times greater than growth hormone output from cells in RPMI w/FBS.
  • the hGH output of BetaGene Medium w/SF was more than 5 times that of RPMI w/SF.
  • FIG. 38 BetaGene Medium maintains secretory function of BG 18/E1 cell line.
  • the insulin secretory function of BG18/3E1 cells was maintained when cells were cultured in BetaGene Medium supplemented with 5%>, 2%, or 1% FBS. There was an impairment of secretory function with cells supplemented with 0.5% FBS or SF during the plateau phase of growth (about day 8 - 9 of culture). The secretory impairment at plateau phase under these conditions may be due to decreased biosynthesis or processing of insulin rather than an impairment of secretion.
  • FIG. 39 Growth in BetaGene Medium maintains regulated secretion from the BG
  • BG18/3E1 cells were grown and maintained at plateau phase for 4 days in BetaGene supplemented with minerals, minerals and amino acids, amino acids, or 2% FBS.
  • the ability to respond to a secretagogue cocktail is shown for various SF- and 2% FBS- supplemented cultures in BetaGene Medium. This demonstrates that the capability of the regulated secretory pathway has been maintained, only the absolute output has been affected in both unstimulated and stimulated states, while the fold response is maintained.
  • FIG. 40 BetaGene Medium enhances production of GLP-1 from an engineered, rodent neuroendocrine cell line.
  • the capability of BetaGene medium to sustain processing and secretion of a peptide that yields proteolytically cleaved and amidated products was evaluated by measuring GLP-1 (amidated and non-amidated) production.
  • FIG. 41 Ascorbate-2-phosphate supplemented media enhances insulin production of an engineered human neuroendocrine cell line.
  • a suspension culture of BG498/45 cells (PD33) were plated in varying concentrations of ascorbate or A-2-P. Samples were collected for insulin assay and medium changed after 2 and 5 days of culture. In the initial 2 days of culture ascorbate altered insulin output by reducing insulin about 20%, only at the highest concentration. In the final 3 days cells, high concentrations of ascorbate were cytotoxic. while A400 ⁇ M concentrations of both ascorbate and A-2-P enhanced insulin secretion. The highest concentration of A-2-P did not inhibit insulin output.
  • FIG. 42 Media supplementation with ascorbate-2-phosphate can effect increased amidation activity with cultured cells.
  • Production of amidated and nonamidated GLP1 was determined by immunoassay of secreted cell products from cells cultured 1 day in RPMI medium (with 2% FBS) supplemented with varying concentrations of A-2-P.
  • the dose- response shows half-max. and maximal amidation activity with Al and 10-100 ⁇ M of A-2-P.
  • the amount of amidated GLP-1 plateaued from 25-1000 ⁇ M. Concentrations of 10 mM consistently (4 separate experiments) resulted in slight decreases in amidated GLP-1 , with a similar tendency to reduce non-amidated GLP-1 output.
  • FIG. 43 Optimal Copper Concentration for PAM Activity.
  • BG191/26 cell monolayers in T25 flasks were changed to RPMI medium ⁇ copper, or BG Medium ⁇ additional copper (the latter medium contains 5 nM copper).
  • Medium samples were collected after 24 h and the GLP-1 species were separated and quantified by HPLC.
  • the results show that supplementing RPMI (which has no copper in its formulation) increases the output of amidated GLP-1.
  • Further supplementation of BG medium with copper to 250 and 500 nM does not increase amidated GLP-1, whereas 1 ⁇ M copper tends to decrease amidated GLP-1.
  • FIG. 44 Lack of Cytotoxic Effect of ascorbate-2-phosphate on Primary Human Islets.
  • Human islets encapsulated in alginate beads were set up in 24 well plates with A50 islet equivalents/well and cultured in BetaGene Medium with or without added A-2-P and copper.
  • Secretory function and glucose-sensing was determined by incubating the islets with different concentrations of glucose for 90 minutes (from 2.2 to 22 mM). This glucose dose-response test was performed immediately before adding ascorbate to the cultures and at 2 week intervals. In the first 2 weeks 500 ⁇ M A-2-P, and 1 ⁇ M copper was supplemented. In the second 2 weeks ascorbate was increased to 2 mM, copper was kept at 1 ⁇ M.
  • A-2-P did not impair function as indicated by sensing of glucose, and the maintenance of maximal insulin secretion indicates that there is minimal toxicity of A-2-P for these culture times.
  • FIG. 45 Two sequential rounds of bulk culture growth, bulk cryopreservation, and thaws do not alter secretory function.
  • ⁇ G18/3El cells which had been grown in bulk cultures were tested for maintained secretory performance. This was determined by assaying insulin secretory response (y-axis) to a secretagogue cocktail ("Swiss") after (x-axis): one bulk culture production and one freeze/thaw (CI F/T); at harvest after one bulk culture production (CI PostBulk); at seeding of second bulk culture after one bulk and one freeze/thaw (CI Seed C2); harvest from second bulk culture (Post C2); and after second bulk culture and second bulk freeze and thaw (C2 F/T). Insulin secretory response from these cells was unaltered by bulk culture and freezing; neither unstimulated (Basal) nor secretagogue-induced (“Stim”) secretion was altered.
  • Basal unstimulated
  • Sttim secretagogue-induced
  • FIG. 46 Insulin output of cells in defined Betagene Medium. Comparison of insulin output from encapsulated ⁇ G18/3El cells in defined BetaGene Medium ( ⁇ GM) with output of cells in BetaGene Medium supplemented with FBS ( ⁇ BM+) or select media with and without FBS. Aginate-encapsulated ⁇ G18/3El cells were cultured in 24 well plates in BetaGene Medium without ( ⁇ GM) or with FBS ( ⁇ GM+); in MEM without (MEM) or with FBS (MEM+); in a mixture of F12 and MEM without (F12/MEM) or with (F12/MEM+) FBS. Media samples were collected at intervals and assayed for insulin, and growth was determined by assay of viable cell mass terminally.
  • MEM+ was 50 ⁇ 5% of ⁇ GM+ and F12/MEM+, which were equivalent; MEM was ⁇ 10%, F12/MEM was 50 ⁇ 5%, and ⁇ GM was 80 ⁇ 8%. Insulin output of ⁇ GM+ was the best, with F12/MEM+ and ⁇ GM essentially equivalent.
  • FIG. 47 Switching cells to Defined BetaGene Medium increases insulin output. A portion of unsupplemented cultures of ⁇ G18/3El cells of figure 46 were continued an additional 3 days. Half of the cells cultured in F12/MEM (no FBS) were switched to defined ⁇ GM for the final 3 days. Switching to defined BetaGene Medium more than doubled insulin output, indicating that BetaGene Medium can compensate for insufficiencies of other defined media.
  • Neuroendocrine cells by definition, have sorting mechanisms, whereby a given polypeptide, protein or hormone destined for secretion, is targeted to the regulated secretory pathway or the default constitutive secretory pathway. Loss or impaired function of neuroendocrine cells is associated with a variety of human diseases and disorders. For example, the failure of substantia nigra cells to properly produce dopamine results in Parkinson's Disease. The failure of thyroid cells to properly produce thyroid hormones results in athyrotic cretinism, and the loss of adrenal gland cells, with the consequent failure to produce adrenal hormones results in Adison's Disease.
  • Secretory cells generally, and in particular neuroendocrine cells, have several endogenous functions that make them uniquely suited for production of a wide range of proteins, including secreted peptide hormones. These specialized functions include the regulated secretory pathway.
  • the regulated secretory pathway embodies the secretory granules of neuroendocrine cells which serve as the site of maturation and storage of a large class of peptide hormones with profound biological functions.
  • Proper biological function of the peptides is due both to their secretion in a regulated and titratable manner and a complex set of post-translational modifications resulting in the final, biologically active product. As a result, these cells can be used as in vitro models of in vivo secretory cell function. Stable cell lines that reflect the in vivo production and secretion of proteins, could be employed in the identification of modulators of said protein secretion.
  • the present invention is designed to take advantage of the secretory machinery of certain cells for the purpose of screening for modulators of secretory function. A variety of different modifications may be made to these cells to make them more suitable candidates for drug screening.
  • One material that could be potentially used in biological screens to identify candidate agents as therapies for NIDDM are rodent ⁇ -cell lines.
  • Several such cell lines have been established, maintained for extended periods in vitro, and characterized with regard to the synthesis and regulated secretion of insulin.
  • the cell lines include those established from the pancreatic islets of rat (Chick et al., 1977; Gazdar et al., 1980; McClenaghan et al. 1996) hamster (Ashcroft et al., 1986), and mouse (Miyazaki et al., 1990; Knaack et al., 1994).
  • These cell lines and their clonal derivatives potentially provide an unlimited supply of material; however, they are deficient in other properties important for their use as screening tools for therapeutic agents for diabetes.
  • ⁇ -cell lines are deficient in key functional aspects when compared to islet ⁇ -cells. Insulin content is decreased and proinsulin processing is often impaired (Poitout et al, 1996). In ⁇ -cell lines the threshold or magnitude of glucose-stimulated insulin secretion (GSIS) and response to agents that can potentiate GSIS are often not representative of primary ⁇ -cells (Newgard, Diabetes Rev. 1996). In addition, many ⁇ -cell lines express peptides that are not expressed by the primary ⁇ -cell such as somatostatin, pancreatic polypeptide. and glucagon (Madsen et ⁇ /., 1986).
  • GSIS glucose-stimulated insulin secretion
  • HIT cells One of the most ubiquitous properties of established ⁇ -cell lines is phenotypic instability such that, with extended cultivation, the cells loose those traits that are singularly ⁇ - cell in nature.
  • HIT cells, many ⁇ TC cell lines, and unengineered RIN cell lines have less insulin content than a normal ⁇ -cell (Radvanyi et al.. 1993), and this level has been reported to drop if the cells are maintained in culture for multiple population doublings (Clark et al, 1990; Poitout et al, 1996).
  • HIT cells lose responsiveness to glucose, arginine, and various secretagogues with serial passages (Zhang et al, 1989).
  • ⁇ TC cell lines display relatively normal GSIS at early passages, but with continuous propagation, these cells acquire aberrant insulin secretion that is characterized by a hypersensitivity to glucose (Efrat et al, 1988; Efrat et al, 1993; Poitout et al, 1996).
  • the present invention provides stable cells lines with a phenotypic integrity that allows them to be used as screening tools for the identification of novel substances that can be employed in the modulation of secretory function that is manifest in a number of diseased states including diabetes.
  • These cell lines may be derived from a previously characterized, immortal RIN cell line that has been further engineered with secretory properties.
  • the present invention provides methods and compositions that will allow one of skill in the art to engineer secretory cells so that they are immortalized. Further, these cells are engineered to ensure that glucose sensing and responsiveness is maintained over a period of time, i.e., indefinitely.
  • the components for such a system, and methods of making and using such cell lines are set forth in detail below.
  • NIDDM neurodegenerative disease .
  • the onset and progression of NIDDM are marked by discreet stages of ⁇ -cell dysfunction and failure with defects in insulin secretion presenting throughout the disease (Porte 1991 ; Granner and O'Brien 1992; Polonsky 1995; Polonsky, Sturis et al, 1996).
  • the early phases of NIDDM often are characterized by insulin resistance and a compensatory increase in the secretion of insulin.
  • hyperinsulinemia fails to completely overcome insulin resistance, mild fasting hyperglycemia and impaired glucose tolerance become detectable.
  • hypoinsulinemia presents.
  • the first-phase of insulin secretion is short in duration and facilitates immediate glucose disposal. Its loss, typically early in NIDDM. results in postpandrial hyperglycemia.
  • the second phase of glucose- stimulated insulin secretion becomes impaired and results in overt NIDDM with fasting hyperglycemia.
  • Other defects in insulin secretion that often are present in NIDDM are abnormal, pulsatile insulin secretion, an increase in the plasma of ratio of proinsulin to insulin, and impairments of various secretagogues to potentiate GSIS (Porte 1991 ; Granner and O'Brien 1992; Polonsky 1995; Polonsky, Sturis et al, 1996).
  • Glucolipotoxicity refers to the detrimental effects that sustained elevations of plasma glucose and free fatty acids have on ⁇ - cell metabolism.
  • the resulting disruption of ⁇ -cell fuel metabolism leads to faulty insulin secretion and contributes to ongoing ⁇ -cell failure.
  • Optimal glucose-sensing and subsequent insulin secretion have been linked to two key ⁇ -cell proteins: the glucose transporter, type 2 (GLUT-2) and hexokinase, type IV, (glucokinase).
  • Cytosolic long chain fatty acyl-CoA esters and free fatty acids are potentiators of GSIS (DeFronzo,1997). Partitioning of fatty acyl-CoA molecules between the cytoplasm and mitochondria is regulated by glucose. Basal glucose levels stimulate transport into the mitochondria and ⁇ -oxidation, and elevations of intracellular glucose promote increases in cytoplasmic concentrations of long-chain fatty acyl CoA esters and potentiation of GSIS.
  • CPT-1 carnitine palmitoyl transferase 1
  • the protein that transports fatty acyl-CoA molecules into the mitochondria from the cytoplasm is inhibited by malonyl CoA, a metabolite that increases with increases in glucose metabolism (DeFronzo, 1997).
  • malonyl CoA a metabolite that increases with increases in glucose metabolism
  • Leptin is a peptide hormone synthesized in and secreted from adipocytes. It has dramatic effects on body composition by regulating food intake and thermogenesis. Rodent strains with defects either in leptin production or leptin receptors are obese and a have high incidence of NIDDM. Increases in plasma leptin levels have been shown to reduce body fat in several obese and non-obese rodent models. Leptin receptors are expressed in tissues throughout the body and have been shown to be present in pancreatic islets.
  • Leptin has been shown to induce enzymes of fatty acid oxidation and deplete triglyceride pools in pancreatic islets (Shimabukuro, Koyama et al., 1997; Zhou. Shimabukuro et al, 1997). It is postulated that leptin functions in normal physiology to protect the ⁇ -cell from lipotoxicy and helps to prevent adipogenic diabetes (Shimabukuro, Koyama et al., 1997; Shimabukuro, Koyama et al., 1997; Zhou, Shimabukuro et al., 1997). It is currently unknown if defects in leptin-regulated fatty acid metabolism are causally linked to progressive ⁇ -cell failure that is characteristic of NIDDM in humans.
  • NIDDM ⁇ -cell failure characteristic of NIDDM is a complex and multifaceted process.
  • the only pharmaceutical agents that target the ⁇ -cell in NIDDM are compounds that bind the SUR KIR channels.
  • Such compounds include the widely used sulfonylurea agents and an unrelated compound, PrandinTM. These drugs treat the symptom of hyperglycemia by interacting with K -ATP channels to stimulate insulin secretion.
  • PrandinTM an unrelated compound
  • These drugs treat the symptom of hyperglycemia by interacting with K -ATP channels to stimulate insulin secretion.
  • long-term use of the sulfonylurea drugs often results in a loss of drug efficacy.
  • FIG. 2 illustrates the use of human primary islets or ⁇ -cells and engineered cell lines in drug screening and drug discovery programs that target ⁇ -cell dysfunction in NIDDM.
  • human islets can provide a starting point for the discovery of novel targets and validation of candidate targets and candidate compounds.
  • the use of human islets throughout a NIDDM drug discovery path could provide a "check" in the identification of hits, optimization of leads, and selection of candidate compounds.
  • human islets can be used as a starting point for the synthesis of cDNA libraries so that discreet mRNAs encoding target proteins may be cloned.
  • the ⁇ - cells of the human islet may be enriched to serve as a screening tool or starting material for cDNA synthesis. Enrichment could be achieved through cell sorting or through selective survival of the ⁇ -cells of the islet. In the latter case, human islets could be infected with recombinant adenovirus or transfected with DNA plasmids in which expression of neomycin phosphotransferease (NPT) or another enzyme encoding antibiotic resistance is driven by an insulin promoter. Such tissue-specific expression of NPT would provide for the selective survival of the ⁇ -cells following exposure of the mixed cell population to G418.
  • NPT neomycin phosphotransferease
  • engineered cell lines with stable and predictable ⁇ -cell phenotypes can be created and used in the screening and enrichment of compounds that alter ⁇ -cell secretory function.
  • a target in the ⁇ -cell such a target could be cloned from a human islet or an enriched ⁇ -cell population.
  • engineered cell line could extend beyond in vitro screens to use in the creation of a "humanized" animal model. Because engineered RIN cells grow well in rodent models, these cell lines offer the capacity of in vivo testing of candidate compounds for safety and efficacy. In a preferred embodiment, the endogenous ⁇ - cells of a rodent would be selectively ablated through the administration of streptozotocin. Encapsulated, engineered cell lines that express the appropriate human target could then be implanted and the in vivo biological effects of candidate compounds on the secretory function of transplant could be assessed. B. Desired Properties of an Islet ⁇ -cell
  • the present invention provides a secretory cell that may be employed in the identification of modulators of secretory function.
  • a secretory cell that may be employed in the identification of modulators of secretory function.
  • Such compounds will be especially useful in a variety of diseased states in which secretory function has been impaired.
  • Such compounds also will be used against impaired ⁇ -cell function and metabolism.
  • An example of such a state would be the loss of ⁇ -cell integrity that is manifest in diabetes.
  • immortalized secretory cells that have a stable neuroendocrine phenotype will be used to identify compounds that will be useful in the regulating this secretory function.
  • properties that are desired of a cell line that will be representative of a human islet ⁇ -cell.
  • the regulated pathway of the ⁇ -cell encompasses both acute regulation of insulin secretion (i.e. a large increment between the unstimulated and stimulated states) and the complete processing of proinsulin to the mature insulin polypeptide.
  • secretory granules allow the storage of insulin as a depot at the plasma membrane that can be released within seconds of arrival of a fuel-derived or hormonal signal, and also serve as the site of conversion of proinsulin to insulin by virtue of their high concen * trations of the relevant convertases PCI (also known as PC3) and PC2.
  • the presence of secretory granules and retention of proinsulin processing capacity represent a major advantage of insulinoma and other neuroendocrine cell lines relative to cells less specialized for secretion of peptide hormones such as hepatoma cells or fibroblasts.
  • a second, and certainly central parameter, is for the cell to be equipped with a capacity for modulator-sensing and responsiveness.
  • modulator encompasses stimulators and inhibitors of secretory function.
  • glucose responsiveness has several components that must be considered, including the appropriate threshold for the response (islet ⁇ -cells typically respond to glucose at concentrations in excess of the fasting level of 4-5 mM). rapid response dynamics ( ⁇ -cells secrete insulin in response to glucose within minutes of its application and turn off insulin secretion nearly as rapidly when glucose is removed) and an appropriate magnitude of response.
  • engineered cell lines retain phenotypic and genotypic stability. This includes maintenance of both genes that are inserted or deleted during the course of engineering and key endogenous genes. As discussed below this is a significant limitation on current technology.
  • RIN 1046-38 cells are derived from a radiation-induced insulinoma but can be shown to be glucose responsive when studied at low passage numbers (Clark et al, 1990). This response is maximal at subphysiological glucose concentrations and is lost entirely when these cells are cultured for more than 40 passages (Clark et al, 1990). Although, RIN 1046-38 cells of low passage number exhibit GSIS, the maximal secretion is at glucose concentrations considerably lower than the threshold for response of normal ⁇ -cells (Knaack et al, 1994). These cells also express GLUT-2 and glucokinase, the high Km glucose transporter and glucose phosphorylating enzymes that appear to control glucose flux and GSIS in ⁇ -cells (Newgard, 1996).
  • RIN 1046-38 cells lose expression of GLUT-2 and glucokinase, become glucose unresponsive, and experience a decline in insulin content (Hughes et al, 1992; Knaack et al, 1994; Ferber et al, 1994).
  • novel cell lines in which the genes for GLUT-2, glucokinase and human insulin are stably expressed in RIN 1046-38 cells by an "iterative engineering" strategy has been described (Clark et al., 1997). Important characteristics of engineered lines include insulin content that approaches that of normal human islet ⁇ -cells, efficient processing of the overexpressed human proinsulin to mature insulin, and stability of expression of the transgenes in vitro and in vivo.
  • a variety of host cells are contemplated for use in assays for identifying modulators of secretory function. For such screening purposes it will be desirable, as stated above, that the polypeptide be released from cells in response to the modulators of the present invention.
  • These cells may be established cell lines that are engineered to express secretory proteins.
  • a human ⁇ -cell line that is immortalized and retains the characteristics of the primary ⁇ -cell would be a preferred material to use in assays.
  • the attempts at immortalization of human pancreatic ⁇ -cells have resulted in cell lines that do not retain the defining properties of the primary ⁇ -cell, such as the capacity to synthesize insulin and secrete it from the regulated secretory pathway.
  • Regulated secretory cells present a natural bioreactor containing specialized enzymes involved in the processing and maturation of secreted proteins. These processing enzymes include endoproteases (Steiner et al., 1992) and carboxypeptidases (Fricker. 1988) for the cleavage of prohormones to hormones and PAM, an enzyme catalyzing the amidation of a number of peptide hormones (Eipper et al, 1992a). Similarly, maturation and folding of peptide hormones is performed in a controlled, stepwise manner with defined parameters including pH, calcium and redox states.
  • This external stimulus defined as a secretagogue
  • a secretagogue can vary depending on cell type, optimal concentration of secretagogue, and dynamics of secretion. Proteins can be stored in secretory granules in their final processed form. In this way a large intracellular pool of mature secretory product exists which can be released quickly upon secretagogue stimulation.
  • a cell specialized for secreting proteins via a regulated pathway also can secrete proteins via the constitutive secretory pathway. Many cell types secrete proteins by the constitutive pathway with little or no secretion through a regulated pathway.
  • secretory cell defines cells specialized for regulated secretion, and excludes cells that are not specialized for regulated secretion.
  • the regulated secretory pathway is found in secretory cell types such as endocrine, exocrine, neuronal, some gastrointestinal tract cells and other cells of the diffuse endocrine system.
  • the origin of the starting cells for use in the present invention thus includes human tissues and tumors of neuroendocrine lineages that have a well defined regulated secretory pathway. Cells with defined conditions for culturing ex vivo with some replicative capacity also are preferred. Pancreatic ⁇ -cells, pancreatic ⁇ -cells and pituitary cells are preferred for use in the present invention, with ⁇ -cells being more preferred. Examples of such cells are shown in Table 1 (Pearse and Takor. 1979; Nylen and Becker, 1995).
  • the neuroendocrine cells of the invention preferably will secrete one or more of the endogenous secretory polypeptides listed herein in Table 1.
  • Stable ⁇ -cells that secrete insulin will be preferred in certain aspects of the invention, with cells that secrete correctly processed human insulin being more preferred.
  • the stable ⁇ -cells of the invention also may be advantageously used to secrete endogenous human amylin.
  • the other preferred cell types of the invention, pituitary cells may be used advantageously to secrete endogenous human growth hormone, ACTH or MSH.
  • pancreatic ⁇ cells In addition to pancreatic ⁇ cells, pancreatic ⁇ -cells, and pituitary cells, further cells within Table 1 that are more preferred for use in the present invention include thyroid C cells, which secrete endogenous human calcitonin; intestinal endocrine cells, which secrete endogenous human GLP-1 and GIP: and pancreatic ⁇ cells, which secrete endogenous human glucagon. Particularly preferred cells are shown in Table 2.
  • regulated secretory pathway means that the rate of secretion of an endogenous polypeptide can be stimulated by external stimuli, commonly referred to as secretagogues.
  • a secretagogue is a substance that stimulates the secretion of a polypeptide.
  • Secretagogues can be physiological in nature, e.g., glucose, amino acids, or hormones, or pharmacological, e.g.. IBMX, forskolin, or sulfonylureas.
  • Polypeptides destined for the regulated secretory pathway are stored in intracellular storage vesicles known as secretory granules.
  • Glucose is the most important stimulator of insulin secretion, not only because of its potent direct effects, but also because it is permissive for the stimulatory action of a wide array of other secretagogues. While there is good evidence to suggest that glucose exerts its effect through its own metabolism, resulting in the creation of signals that appear to work through modulation of ion channel activities and influx of extracellular Ca 2+ , the exact nature of the metabolic coupling factors remains unknown. The magnitude of the insulin secretory response appears to be related to the rate of ⁇ -cell glucose metabolism, and both parameters are sharply increased in response to modest increments in extracellular glucose concentrations within the physiological range of 4 to 8 mM.
  • ⁇ -cells are equipped with the glucose transporter GLUT-2 and the glucose phosphorylating enzyme glucokinase which have kinetic properties, particularly a relatively low affinity for glucose, that are ideal for modulation of glucose responsiveness at the relatively high concentrations of the sugar encountered in the circulation (Newgard and McGarry 1995).
  • Nutritional signals also are derived from amino acids and lipids that each serve as potentiators of glucose-stimulated insulin secretion. Many secretagogues effect a response in the ⁇ -cell via interaction with specific receptors. Glucagon-like peptide 1 (GLP-1 ) is an example of such a secretagogue. This peptide hormone binds its receptor and potentiates insulin secretion in the presence of glucose.
  • Activin A has been reported to stimulate insulin secretion in rat pancreatic islets and HIT cell lines. This stimulation is receptor-mediated and Ca 2+ -dependent (Shibata et al, 1996). Leptin receptors have been reported to be expressed in ⁇ -cells (Kieffer et al, 1996); however, reports of the effects of leptin on insulin secretion are varied (Emilsson et al, 1997; Tanizawa et al. 1997).
  • Epinephrine and its analogues act to inhibit insulin secretion via signaling through the alpha 2 adrenergic receptor.
  • somatostatin and pancreatic polypeptide VIP, PACAP, GIP, acetylcholine, cholecytokinin also act via specific receptors to inhibit insulin secretion (Lambert and Atkins 1989).
  • ⁇ cells also respond to a number of non-physiological compounds that act via endogenous receptors or signaling machinery (Clark et al, 1990).
  • Carbachol stimulates insulin secretion via activation of muscarinic receptors.
  • Inhibition of phosphodiesterase via administration of IBMX allows for the accumulation of cyclic AMP, a potentiator of insulin secretion.
  • Stimulation of kinase activity such as the phorbol ester activation of protein kinase C, will stimulate insulin secretion if cells are exposed the kinase-activator for short periods of times.
  • Diazoxide inhibits insulin secretion by interacting with and opening the potassium-ATP channel.
  • K + channels such as large-conductance Ca + -dependent K + (BK) channels and late rectifying voltage dependant channels, have been reported to be expressed in pancreatic ⁇ -cells and participate in regulating membrane polarity and secretion (Dukes and Philipson, 1996; Kalman et al., 1998). Compounds that open or block these channels are currently under development and may be useful pharmacological agents (Olesen et al, 1994: Strobaek et al, 1996).
  • PRANDINTM is an oral blood glucose-lowering drug of the meglitinide class used in the management of type 2 diabetes mellitus (also known as non-insulin dependent diabetes mellitus or NIDDM).
  • Repaglinide S(+) 2-ethoxy-4(2((3-methyl-l-(2-(l-piperidinyl) phenyl)-butyl) amino)-2-oxoethyl) benzoic acid, is chemically unrelated to the oral sulfonylurea insulin secretagogues.
  • Repaglinide lowers blood glucose levels by stimulating the release of insulin from the pancreas. This action is dependent upon functioning ⁇ -cells in the pancreatic islets. Insulin release is glucose-dependent and diminishes at low glucose concentrations.
  • Repaglinide acts by closing ATP-dependent potassium channels in the ⁇ -cell membrane by binding at characterizable sites. This potassium channel blockade depolarizes the ⁇ -cell, which leads to an opening of calcium channels. The resulting increased calcium influx induces insulin secretion.
  • the ion channel mechanism is highly tissue selective with low affinity for heart and skeletal muscle.
  • administration of PrandinTM improves glycemic control, as reflected by HbA lc and fasting glucose levels. This is associated with a reduction in the diabetic complications retinopathy. neuropathy, and nephropathy.
  • a preferred vehicle may be one of the several cell lines derived from islet ⁇ -cells that have emerged over the past two decades. While early lines were derived from radiation- or virus-induced tumors (Gazdar et al.
  • transgenic technology Efrat et al. 1988, Miyazaki et al.. 1990.
  • a general approach taken with the latter technique is to express an oncogene, most often SV40 T-antigen, under control of the insulin promoter in transgenic animals, thereby generating ⁇ -cell tumors that can be used for propagating insulinoma cell lines (Efrat et al. 1988, Miyazaki et al, 1990). While insulinoma lines provide an advantage in that they can be grown in essentially unlimited quantity at relatively low cost, most exhibit differences in their glucose-stimulated insulin secretory response relative to normal islets.
  • RINm5F cells which were derived from a radiation-induced insulinoma and which in their current form are completely lacking in any acute glucose-stimulated insulin secretion response (Halban et al, 1983).
  • RIN 1046-38 cells are also derived from a radiation-induced insulinoma but can be shown to be glucose responsive when studied at low passage numbers (Clark et al. 1990). This response is maximal at subphysiological glucose concentrations and is lost entirely when these cells are cultured for more than 40 passages (Clark et al, 1990).
  • GLUT-2 and glucokinase are expressed in low passage RIN 1046-38 cells but are gradually diminished with time in culture in synchrony with the loss of glucose-stimulated insulin release (Ferber et al. 1994).
  • Restoration of GLUT-2 and glucokinase expression in RIN 1046-38 cells by stable transfection restores glucose-stimulated insulin secretion (Ferber et al, 1994), and the use of these genes as a general tool for engineering of glucose sensing has been described in a previously issued patent (Newgard, U.S. Patent 5,427,940).
  • RIN 1046-38 cells transfected with the GLUT-2 gene alone are maximally glucose responsive at low concentrations of the sugar (approximately 50 ⁇ M), but the threshold for response can be shifted by preincubating the cells with 2-deoxyglucose. which when converted to 2-deoxyglucose-6-phosphate inside the cell serves as an inhibitor of low K m hexokinase, but not glucokinase activity (Ferber et al, 1994).
  • INS-1 that retains many of the characteristics of the differentiated ⁇ -cell, most notably a relatively high insulin content and a glucose-stimulated insulin secretion response that occurs over the physiological range (Asafari et al, 1992). This line was isolated by propagating cells freshly dispersed from an X-ray induced insulinoma tumor in media containing 2- mercaptoethanol. Consistent with the finding of physiological glucose responsiveness, a recent report indicates that INS-1 cells express GLUT-2 and glucokinase as their predominant glucose transporter and glucose phosphorylating enzyme, respectively (Marie et al. 1993). INS-1 cells grow very slowly and require 2-mercaptoethanol. It remains to be determined whether glucose responsiveness and expression of GLUT-2 and glucokinase are retained with prolonged culturing of these cells, or in vivo.
  • ⁇ TC cells Cell lines derived by transgenic expression of T-antigen in ⁇ -cells (generally termed ⁇ TC cells) also exhibit variable phenotypes (Efrat et al, 1988, Miyazaki et al, 1990. Whitesell et al, 1991 and Efrat et al. 1993). Some lines have little glucose-stimulated insulin release or exhibit maximal responses at subphysiological glucose concentrations (Efrat et al, 1988, Miyazaki et al, 1990, Whitesell et al, 1991), while others respond to glucose concentrations over the physiological range (Miyazaki et al., 1990 and Efrat et al, 1993).
  • Glucose-unresponsive lines such as MIN-7 were found to express GLUT-1 rather than GLUT-2 as their major glucose transporter isoform, while MIN-6 cells were found to express GLUT-2 and to exhibit normal glucose-stimulated insulin secretion (Miyazaki et al, 1990). More recently, Efrat and coworkers demonstrated that their cell line ⁇ TC-6, which exhibits a glucose-stimulated insulin secretion response that resembles that of the islet in magnitude and concentration dependence, expressed GLUT-2 and contained a glucokinase:hexokinase activity ratio similar to that of the normal islet (Efrat et al. 1993).
  • AtT-20 cell An alternative host to insulinoma cell lines are non-islet cell lines of neuroendocrine origin that are engineered for insulin expression.
  • AtT-20 cell which is derived from ACTH secreting cells of the anterior pituitary.
  • Insulin secretion from such lines can be stimulated by agents such as forskolin or dibutyryl cAMP, with the major secreted product in the form of mature insulin.
  • AtT-20 cells express the glucokinase gene (Hughes et al, 1991, Liang et al, 1991) and at least in some lines, low levels of glucokinase activity (Hughes et al, 1991 and 1992, Quaade et al, 1991), but are completely lacking in GLUT-2 expression (Hughes et al, 1991 and 1992).
  • AtT-20ins cells The studies with AtT-20ins cells are important because they demonstrate that neuroendocrine cell lines that normally lack glucose-stimulated peptide release may be engineered for this function.
  • Other cell lines that are characterized as neuroendocrine, but lacking in endogenous glucose response include PC 12, a neuronal cell line (ATCC CRL 1721 ) and GH3, an anterior pituitary cell line that secretes growth hormone (ATCC CCL82.1). It is not possible to determine whether such cell lines will gain glucose responsiveness by engineering similar to that described for the AtT-20ins cell system without performing the experiments.
  • neuroendocrine lines do exhibit other properties important for this invention such as a regulated secretory pathway, expression of endopeptidases required for processing of prohormones to their mature hormone products, and post-translational modification enzymes.
  • Some or all neuroendocrine lines also will be useful for glucose-regulated product delivery, using the methods described in U.S. Patent 5,427,940 to generate such responsiveness.
  • the present invention uses stable human secretory cells by transforming a non-stable secretory cell such that it is immortalized and retains its phenotype through numerous cell culture passages.
  • the final attributes of such cell lines of the present invention are functionally defined as having maintained a regulated secretory pathway, being stable to in vitro culture and, preferably, as being amenable to further engineering.
  • the present section describes the production of these cells for use in the screening assays of the present invention.
  • the human secretory or neuroendocrine cell will be "culturable,” i.e., it will be capable of growing in vitro and producing the desired endogenous secretory polypeptide with a demonstrated regulated secretory pathway.
  • a "stable, transformed" human regulated secretory cell in the context of the present invention will be a cell that exhibits in vitro growth for at least twenty population doublings.
  • the resultant human regulated secretory cell also will maintain the required differentiated phenotype after transformation, i.e., it will exhibit the phenotypic properties of a demonstrable regulated secretory pathway, secretory storage granules, the capacity for peptide processing, and will produce the selected endogenous secretory polypeptide.
  • the stable human secretory cell is a ⁇ -cell.
  • the human ⁇ - cells of the present invention will exhibit the capacit ⁇ to grow in vitro, with a minimum of at least about 20 population doublings, or preferably, of about 30, about 40, about 50, about 60, about 70. or about 80 population doublings. Even more preferably, the resultant human ⁇ -cells of the invention will have even further increments of population doublings up to and including a completely transformed state wherein the cells grow in perpetuity.
  • the human ⁇ -cells of the present invention also will exhibit the capacity to produce biologically active human insulin.
  • the insulin produced may be comprised entirely of mature insulin; or entirely of the biological precursor of mature insulin, termed proinsulin; or of all possible mixtures of proinsulin, insulin, and processing intermediates that are produced in the course of conversion of proinsulin to insulin.
  • proinsulin biological precursor of mature insulin
  • processing intermediates that are produced in the course of conversion of proinsulin to insulin.
  • the preferred embodiment of the present invention are cells that produce primarily or exclusively mature insulin, cells that produce proinsulin will also be useful in various embodiments. Such cells are useful per se, particularly as any form of insulin can be obtained in vitro, purified and converted to mature insulin.
  • insulin is an exemplary secretory protein
  • the stable human neuroendocrine cell line may be engineered to express a variety of secretory proteins for the purposes of identifying specific modulators of secretory function.
  • PC2 and PC3 proteases known as PC2 and PC3 that are responsible for the conversion of proinsulin to insulin can be introduced into the stable human ⁇ cells by genetic engineering methods, thereby enhancing the efficiency of conversion of proinsulin to insulin.
  • the stable human ⁇ cells of the present invention generall> will exhibit a minimal insulin content of about 5 ng/million cells, but may contain as much as. or even more insulin than, normal isolated human islets, which have approximately 1 -10 ⁇ g/million cells. It will be understood that the cells of the present invention may contain any amount of insulin within the above-specified ranges, such as about 10 ng insulin/million cells, about 50 ng, about 100 ng, about 200 ng. about 500 ng, about 1000 ng (1 ⁇ g), about 2 ⁇ g. about 5 ⁇ g, about 10 ⁇ g, about 20 ⁇ g, about 50 ⁇ g, about 75 ⁇ g, up to and including about 100 ⁇ g insulin/million cells.
  • the human ⁇ cells of the present invention may be defined as cells having an insulin content of between about 10%, about 20%, about 30%. about 40%, about 50%, about 60%. about 70%, about 80%, about 90%, up to and including about 100% of normal human islet content, which is about 1-10 ⁇ g/million cells.
  • the human ⁇ cells of the present invention will preferably exhibit enhanced insulin secretion when exposed to one or more secretagogues selected from IBMX, carbachol. amino acids, and glucose, or when exposed to a secretory "cocktail" of such compounds.
  • the human ⁇ cells will more preferably exhibit enhanced insulin secretion when exposed to glucose, and will most preferably exhibit enhanced insulin secretion when exposed to 10 mM glucose.
  • the increase in insulin secretion in response to a non-glucose secretagogue or cocktail thereof should be at least about 1.1 times or about 1.5 times that observed in cells incubated in the absence of the secretagogue or secretory cocktail. However, in preferred embodiments, the increase in insulin secretion in response to a non-glucose secretagogue or cocktail thereof should be at least about double that observed in cells incubated in the absence of the secretagogue or secretory cocktail. In more preferred embodiments, a higher increase will be observed, up to and including a 3-fold, 5-fold, 10-fold, 20-fold, 50-fold. 100-fold. 200-fold, 300-fold, 500-fold, 750-fold or even about a 1000-fold enhancement.
  • the human ⁇ -cells of the present invention preferably will exhibit a glucose-stimulated insulin secretion (GSIS) response.
  • GSIS glucose-stimulated insulin secretion
  • This increase in secretion should be at least about 1.1 times or about 1.5 times that observed in cells incubated in the absence of glucose. More preferred are increases in secretion of at least about double that observed in cells incubated in the absence of glucose, with even more preferred increases being higher, up to and including a 3-fold, 5-fold, 10-fold, 20-fold. 50-fold, 100-fold, 200-fold, 300-fold, 500-fold, 750-fold or even about a 1000-fold enhancement, including all increments therebetween.
  • glucose responsive insulin secretion will be observed in the range of 1.0 to 20 mM glucose. GSIS response will occur more preferably with a threshold for response of 3-5 mM glucose, with maximal secretion stimulated by 10-20 mM glucose, as occurs in normal human islets. Cell lines with glucose dose responses occurring over a higher or lower range also will have significant utility, given that any regulated insulin production will be useful.
  • Primary human neuroendocrine secretory cells are immortalized as described in further detail elsewhere in the specification.
  • the present section is directed to describing the starting cells that may be further engineered for the drug screening purposes of the present invention.
  • Fetal Cells Human fetal pancreases at 18 to 24 gestational weeks can be obtained through nonprofit organ procurement centers, with patient consent for tissue donation being obtained. Dissection of specific organs from the fetuses is often done at the procurement centers. Isolation of fetal pancreases and islets is performed by established techniques (Otonkoski et al, 1993; incorporated herein by reference).
  • Cells from Primary Human Tissues Human organs can be obtained from autopsies through nonprofit organ procurement centers. High quality human islets are available, for example, from Dr. Camillo Ricordi of the University of Miami Medical Center, an islet transplant surgeon who supplies human islets to scientists throughout the United States. Automated methods for isolation of human pancreatic islets have been established (Ricordi et al, 1988; incorporated herein by reference).
  • Cells from Resected Neuroendocrine Tumors Explanted tumor samples from surgically resected tumors are another preferred starting material. More preferred are insulinomas and pituitary tumors. Two exemplary insulinomas have been reported (Gueli et al, 1987; Cavallo et al, 1992).
  • tumor cell lines and insulinomas arising from explants of resected neuroendocrine tumors are not necessarily, by definition, stable cells; some such cells maintain a differentiated phenotype for two, four or about six months at the maximum. However, such cells are intended for use as starting materials in the present invention.
  • Nylen and Becker, 1995 while not a complete list, is exemplary of the types of cells contemplated for use in the present invention, ⁇ cells, ⁇ -cells and pituitary cells are preferred for use in the present invention, with ⁇ cells being more preferred. Additional cell types useful in the present invention will be readily known to those of skill in the art.
  • pituitary cells are preferred for use with this invention.
  • pituitary cells may allow for higher efficiency of transformation as culture conditions have been reported for promoting the proliferation of rodent pituitary cells in vitro (Nicol et al, 1990).
  • the inventors contemplate establishing similar conditions for human pituitary cells which will allow for retroviral infection and provide a means for efficiently introducing transforming genes.
  • Cells from the intermediate lobe may have an advantage for use in cell-based therapies of IDDM as there is a suggestion that this cell type can survive and sustain secretory function in autoimmune disease. These cells would therefore be useful in providing an indication of the effects of the modulators in vivo, as these cells would be less prone to attack from the host.
  • the POMC promoter was used to drive expression of insulin in the cells of the intermediate lobe of transgenic nonobese diabetic (NOD) mice. Such cells were resistant to autoimmune-dependent destruction even when implanted next to islets in which ⁇ cells were destroyed during the course of the disease (Lipes et al, 1996).
  • H05 H378/CRL-5808 Lung PAM+, SYN+, G R , H R , O R NT NT PC1/PC3(+), PC2+, VIM-.
  • H06 H727/CRL-581 5 Lung PAM+, SYN+, G R .
  • H R 0 s NT NT PC 1 /PC3+, PC2-.
  • KEY NCI, National Cancer Institute; ATCC, American Type Culture Collection; NE, neuroendocrine; PAM, peptidylglycine alpha-amida monooxygenase; SYN, synaptophysin; PC, proconvertase; VIM, vimentin; AB, antibiotic; S/R, sensitive/resistant; G, G418; H, hygromycin ouabain; P, puromycin; B, blasticidin; Hd, histidinol; Mca, mycophenolic acid; Z, Zeocin; TG, transgene expression +/-; NP, neom phosphotransferase; I, insulin; G, glucagon/glycentin; GH, growth hormone; NT, not tested
  • Table 2 describes the properties of certain cell lines that are exemplary starting cells for use in the instant application.
  • ⁇ G H03 cells are derived from a human non-small cell lung carcinoma (ATCC Number: CRL-5816). These cells have a neuroendocrine phenotype. and can be grown in a monolayer. This line was derived by Gazdar and associates from a lung tissue obtained from a patient prior to therapy. H03 cells as obtained from the ATCC are not able to synthesize the peptide neuromedin B (NMB) or the gastrin releasing peptide (GRP).
  • NMB peptide neuromedin B
  • GFP gastrin releasing peptide
  • lung carcinoma cells include cells designated herein as ⁇ G H04, ⁇ G H05, ⁇ G H07, ⁇ G H09, ⁇ G HI 9, ⁇ G H20 and ⁇ G H21. These, as well as additional cells lines derived from other sources, are described in further detail herein below. These cell lines are only exemplary starting cells for use in the present application, given the teachings provided herein, one of ordinary skill in the art will be able to identify additional cells with characteristics that would make them appealing as cells to be engineered for use in the present invention.
  • HOI cells (ATCC Number: CCL-251) also may be used in the present invention. These cells are human colorectal carcinoma cells having an epithelial morphology. These cells grow in floating aggregates of round cells. A characteristic that makes these cells useful in the context of the present invention is that they contain cytoplasmic dense core granules characteristic of endocrine secretion.
  • ⁇ G H02 cells are obtained from the ATCC (CRL- 1803) are derived from a thyroid medullary carcinoma. Their morphology is epithelial and are known to produce high levels of calcitonin and carcinoembryonic antigen (CEA). Chromosomal analysis of the cell line and tumors induced in nude mice reveal an aneuploid human karyotype with several marker chromosomes.
  • ⁇ G H04 cells are obtained from the ATCC (CRL-5803) are lung carcinoma cells and have a neuroendocrine phenotype. The cells have a homozygous partial deletion of the p53 protein, and lack expression of p53 protein. The cells are able to synthesize the peptide NMB at 0.1 pmol/mg protein, but not the gastrin releasing peptide (GRP).
  • Another lung carcinoma cell that may prove a useful host cell in the context of the resent invention is designated ⁇ G H05 (ATCC Number: CRL-5808). This is a classic small cell lung cancer cell line with an epithelial morphology. This line was derived from cells recovered from pleural effusion taken from a patient after chemotherapy.
  • NCI-H378 expresses elevated levels of the 4 biochemical markers of SCLC: neuron specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity.
  • the cells express the c-kit gene as well as the L-myc gene, and L-myc is amplified.
  • the cells express easily detectable levels of p53 mRNA compared to levels found in normal lung
  • NMB neuromedin B
  • the cells express easily detectable levels of p53 mRNA compared to levels found in normal lung.
  • the cells are able to synthesize the peptide NMB (at 0.1 pmol/mg protein), but not the gastrin releasing peptide (GRP).
  • GFP gastrin releasing peptide
  • the cell line secretes a parathyroid hormone-like protein which is calcium stimulated through a protein kinase C pathway. Further, growth of NCI-H727 cells is inhibited by epidermal growth factor (EGF) receptor monoclonal antibodies.
  • EGF epidermal growth factor
  • ⁇ G H07 Another classic small cell lung cancer cell line is ⁇ G H07 (ATCC Number: CRL-5804). This line was derived from cells recovered from pleural effusion obtained from a patient prior to therapy, and expresses elevated levels of the 4 biochemical markers of SCLC: neuron- specific enolase, the brain isoenzyme of creatine kinase, L-dopa carboxylase and bombesin-like immunoreactivity. Only trace amounts of the retinoblastoma susceptibility gene (RB) mRNA, were detected. RB protein was not detected. The cells express the c-kit gene as well as the N- myc gene. N-myc is not amplified. The cells are not able to synthesize the peptide neuromedin
  • NMB gastrin-releasing peptide
  • GFP gastrin-releasing peptide
  • ⁇ G H08 are carcinoma cells isolated from a stage 3 A squamous cell lymph node carcinoma (ATCC Number: CRL-5867).
  • ⁇ G H09 are derived from an atypical lung carcinoid and are available form the ATCC (CRL-5838).
  • ⁇ G H10 cell line is a commercially available cell line derive from lung carcinoma (ATCC Number CCL-185)
  • Another similar cell line is ATCC number CCL- 185.1 derived from CCL-185 which was initiated through explant culture of lung carcinomatous tissue.
  • CCL-185.1 are adapted to growth in serum-free medium.
  • ⁇ G HI 1 cells may be obtained form ATCC (number HTB-9) and are derived from a bladder carcinoma.
  • ⁇ G HI 3 (ATCC Number: CRL-2139) are from a primitive neuroectodermal brain tumor. The cells express CCK specific mRNA and synthesize considerable quantities of variably processed CCK prohormone.
  • CCL-249 are designated herein as ⁇ G HI 4 and are derived from a colon adenocarcinoma. This is one of 14 colorectal carcinoma cell lines derived from a well differentiated sigmoid tumor from a patient prior to therapy. The line was initially grown in medium with fetal bovine serum, but was later adapted to growth in the chemically defined medium ACL-4. Floating aggregates produce tubuloglandular structures lined by columnar epithelia.
  • ⁇ G H 15 are from a colorectal carcinoma (ATCC Number: CCL-253) and have an epithelial phenotype. This line was derived from a metastasis to the abdominal wall obtained from a patient after treatment with 5-fluorouracil.
  • ⁇ G H 16 are the same as the commercially available cell line of ATCC Number: CRL- 5974. These are gastric carcinoma cells that express the surface glycoproteins carcinoembryonic antigen (CEA) and TAG 72 and the muscarinic cholinergic and vasoactive intestinal peptide (VIP) receptors but lack gastrin receptors
  • HTB-10 are the cells referred to herein as ⁇ G H I 8, these cells are derived from a neuroblastoma cell line and is one of two cell lines (see also ATCC HTB-11) of neurogenic origin.
  • ⁇ G HI 9 or ATCC Number: HTB-184 are small cell lung carcinoma cells of an extrapulmonary origin and are from an adrenal metastasis in an adult. The cells produce easily detectable p53 mRNA at levels comparable to those in normal lung tissue.
  • ⁇ G H20 (ATCC Number: HTB-177) are a large cell carcinoma cell line derived from the pleural fluid of a patient with large cell cancer of the lung.
  • the cells stain positively for keratin and vimentin but are negative for neurofilament triplet protein.
  • the line expresses some properties of neuroendocrine cells, is relatively chemosensitive and can be cloned in soft agar (with or without serum).
  • ⁇ G H21 (ATCC Number: CRL-2195) is yet another small cell lung carcinoma cell that may be useful as a starting cell in the present invention. It can grow as suspension and loosely adherent culture and is a biochemically stable continuously cultured cell line which has retained important features of SCLC. The line was derived from a non-encapsulated primary lung tumor from the apical portion of the upper lobe of the left lung. This cell line is an unusual undifferentiated large cell variant of small cell lung carcinoma. It has the morphology of a variant, but the biochemical properties of a classic SCLC. Electron microscopy revealed the presence of gland formation and intracytoplasmic lamellar bodies. The cells have neuroendocrine markers L-dopa decarboxylase and dense core secretory granules.
  • ⁇ G H23 is a long-term tissue culture cell line derived from a metastatic human carcinoid tumor of the pancreas (Evers et al., 1991 ; Parekh et al., 1994). This cell line is also known as BON (Evers et al., 1991), tumors derived from this cell line are histologically identical to the original tumor. The cells have significant amounts of neurotensin, pancreastatin. and serotonin (5-HT) are demonstrated in the cells by radioimmunoassay (RIA) and the presence of chromogranin A, bombesin. and 5-HT is confirmed by immunocytochemistry.
  • RIA radioimmunoassay
  • the cells possess neurosecretory granules and functional receptors for acetylcholinc. 5-HT, isoproterenol, and somatostatin.
  • BON cells possess a specific transport system for uptake of 5- HT from the medium; this uptake system may be a route for regulation of autocrine effects of 5- HT on carcinoid cells (Parekh et al., 1994).
  • This unique human carcinoid tumor cell line should provides an exemplary starting material for the bioengineering described herein and will be useful in that they possess intracellular mechanisms ideally adapted for secretagogue action in the release of amines and peptides.
  • ⁇ G H25 (ATCC Number: HB-8065) derived from a hepatoblastoma.
  • This cell line produces alpha-fetoprotein ( ⁇ fetoprotein); albumin; alpha2 macroglobulin ( ⁇ -2-macroglobulin); alphal antitrypsin ( ⁇ -1-antitrypsin); transferrin; alphal antichymotrypsin;( ⁇ -l-antichymotrypsin); haptoglobin; ceruloplasmin; plasminogen and demonstrates decreased expression of apoA-I mRNA and increased expression of catalase mRNA in response to gramoxone (oxidative stress) complement (C4); C3 activator; fibrinogen; alphal acid glycoprotein ( ⁇ -1 acid glycoprotein); alpha2 HS glycoprotein ( ⁇ -2-HS-glycoprotein); beta lipoprotein ( ⁇ -lipoprotein); retinol binding protein.
  • ⁇ fetoprotein alpha-fetoprotein
  • albumin alpha
  • the transforming genetic construct may, therefore, be functionally and/or physically separated from the cell after transformation.
  • Advantages include generation of cell lines that do not constitutively express oncogenes which can act as tumor antigens in vivo, control of growth of the resulting tumor lines for stable in vivo use and possibly the control of the differentiated state of the resultant cell line.
  • Temperature-Sensitive Regulation of Oncogene Expression allows for turning the growth promoting activity on and off.
  • oncogenes that are active at lower than physiological temperatures (i.e., 32°C to 34°C) and off at physiological or higher temperatures (37°C to 39°C) are preferred.
  • stable cell lines can be expanded, and further genetic modifications can be made and characterized in vitro at the low, permissive temperatures. When placed in vivo, these same cell lines will be exposed to the non-permissive temperature, and will not grow.
  • a temperature sensitive version of the SV40 virus was isolated and shown to have a mutation in the coding region of the large T antigen gene (Bourre and Sarasin. 1983).
  • Promoters capable of driving expression of heterologous genes in response to an exogenously added compound allow for conditional expression of oncogenes inserted under the control of the promoter.
  • the addition of the promoting agent then allows stable cell lines to be expanded and transformed. When placed in vivo, expression of the oncogene is turned off, unless the activating factor is provided.
  • lac repressor system See FIG. 1;
  • the present invention contemplates the use of the ( 're/Lox site-specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to rescue specific genes out of a genome.
  • the system involves the use of a bacterial nucleotide sequence knows as a Lox? site, which is recognized by the bacterial Cre protein.
  • the Cre protein catalyzes a site-specific recombination event. This event is bidirectional, i.e., Cre will catalyze the insertion of sequences at a Lox? site or excise sequences that lie between two Lox? sites.
  • Cre will catalyze the insertion of sequences at a Lox? site or excise sequences that lie between two Lox? sites.
  • the present invention also contemplates the use of recombination activating genes
  • RAG-1 RAG 1 and 2 to rescue specific genes from the genome of transformed cell lines.
  • the transforming construct of interest is engineered to contain flanking RSSs. Following transformation, the transforming construct that is internal to the RSSs can be deleted from the genome by the transient expression of RAG-1 and RAG-2 in the transformed cell.
  • an endogenous gene product it may be necessary to block expression of an endogenous gene product as an initial modification of host cells according to the present invention.
  • the targeted endogenous gene encodes a protein normally secreted by the host cell. Blocking expression of this endogenous gene product, while engineering high level expression of genes of interest, represents a unique way of usurping secretory function cells for exogenous protein production.
  • Cells generated by this two-step process express heterologous proteins, including a variety of natural or engineered proteins (fusions, chimeras, protein fragments, etc.).
  • Cell lines developed in this way are uniquely suited for in vitro assays for the identification of modulators of protein secretion as well as in vivo cell-based delivery or in vitro large-scale production of defined peptide hormones with little or no contaminating or unwanted endogenous protein production.
  • constructs are designed to homologously recombine into particular endogenous gene loci, rendering the endogenous gene nonfunctional.
  • constructs are designed to randomly integrate throughout the genome, resulting in loss of expression of the endogenous gene.
  • constructs are designed to introduce nucleic acids complementary to a target endogenous gene. Expression of RNAs corresponding to these complementary nucleic acids will interfere with the transcription and/or translation of the target sequences.
  • constructs are designed to introduce nucleic acids encoding ribozymes - RNA-cleaving enzymes - that will specifically cleave a target mRNA corresponding to the endogenous gene.
  • endogenous gene can be rendered dysfunctional by genomic site directed mutagenesis.
  • Each of these methods for blocking protein production are well known to those of skill in the art.
  • WO publication numbers WO 97/26334 (published July 24, 1997) and WO 97/26321 (published July 24, 1997) describe these methodologies and are specifically incorporated herein by reference.
  • the present inventors contemplate the use of the tools of molecular biology to engineer cell lines with properties that approximate those of the normal ⁇ -cell (Hughes et al, 1992; Ferber et al. , 1994).
  • RIN 1046-38 loses glucose responsiveness as well as GLUT-2 and glucokinase expression with time in culture (Clark et al, 1990; Ferber et al, 1994). Stable transfection of RIN 1046-38 cells of intermediate, but not high passage numbers with GLUT-2 reconstitutes GSIS and induces a 4-fold increase in glucokinase activity relative to untransfected control cells (Ferber et al, 1994). While these studies represent an important start point, major issues must be dealt with before the cells can be perceived as having any therapeutic value.
  • RIN 1046-38 cells express rat rather than human insulin.
  • Another problem is that the up-regulation of glucokinase activity in response to GLUT-2 transfection is transient, and the cells lose glucose responsiveness over time (Ferber et al, 1994). And finally, the maximal increase in insulin secretion in response to glucose is only 3-fold, and occurs at subphysiological glucose concentrations (50-100 ⁇ M) (Ferber et al, 1994).
  • the inventors address these deficiencies by molecular engineering, which will require the introduction of several genes (GLUT-2, glucokinase, human insulin) into a single cell line, as well as a reduction in expression of other undesired genes that are normally expressed by these cells (hexokinase I. rat insulin).
  • GLUT-2 glucokinase
  • human insulin glucokinase
  • hexokinase I. rat insulin hexokinase I. rat insulin
  • the events that may be conducted as separate construction events include blocking expression of endogenous gene products by molecular methods (including targeting of both copies of the endogenous gene), introducing a heterologous gene, and further modification of the host cell to achieve high level expression.
  • molecular methods including targeting of both copies of the endogenous gene
  • introducing a heterologous gene and further modification of the host cell to achieve high level expression.
  • the particular difficulty in performing multiple steps like this is the need for distinct selectable markers. This is a limitation in that only a few selectable markers are available for use in mammalian cells and not all of these work sufficiently well for the purposes of this invention.
  • the present invention therefore contemplates the use of the CrelLox site-specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to rescue specific genes out of a genome, most notably drug selection markers. It is claimed as a way of increasing the number of rounds of engineering. Briefly, the system involves the use of a bacterial nucleotide sequence knows as a Lox? site, which is recognized by the bacterial Cre protein. The Cre protein catalyzes a site-specific recombination event. This event is bidirectional, i.e., Cre will catalyze the insertion of sequences at a Lox? site or excise sequences that lie between two Lox? sites.
  • the present invention contemplates the supplemental expression or overexpression of proteins involved in maintaining the specialized phenotype of host cells, especially their secretory capacity.
  • proteins may be used to supplement the cell's natural enzymes.
  • IPF1 Insulin Promoter Factor 1
  • Insulin promoter factor 1 (IPF-1 ; also referred to as STF-1. IDX-1 , PDX-1 and ⁇ TF-1) is a homeodomain-containing transcription factor proposed to play an important role in both pancreatic development and insulin gene expression in mature ⁇ -cells (Ohlsson et al, 1993, Leonard et al. 1993, Miller et al, 1994, Kruse et al, 1993). In embryos, IPF-1 is expressed prior to islet cell hormone gene expression and is restricted to positions within the primitive foregut where pancreas will later form. Indeed, mice in which the IPF-1 gene is disrupted by targeted knockout do not form a pancreas (Jonsson et al, 1994).
  • IPF-1 expression becomes restricted predominantly to ⁇ -cells. IPF-1 binds to TAAT consensus motifs contained within the FLAT E and PI elements of the insulin enhancer/promoter, whereupon, it interacts with other transcription factors to activate insulin gene transcription (Peers et al, 1994).
  • IPF-1 will generally be present in the resultant stable human ⁇ -cells of the present invention
  • the overexpression of IPF-1 in human ⁇ -cell lines may be used to serve two purposes. First, it will increase transgene expression under the control of the insulin enhancer/promoter. Second, as IPF-1 appears to be critically involved in ⁇ -cell maturation, stable overexpression of IPF-1 in the ⁇ -cell lines should encourage these cells to maintain the differentiated function of a normal human ⁇ -cell.
  • Proteins can be grouped generally into two categories - secreted and non-secreted. Discussions of each are detailed below. There are some general properties of proteins that are worthy of discussion at this juncture.
  • proteins will not have a single sequence but, rather, will exists in many forms. These forms may represent allelic variation or, rather, mutant forms of a given protein.
  • various proteins may be expressed advantageously as "fusion" proteins. Fusions are generated by linking together the coding regions for two proteins, or parts of two proteins. This generates a new, single coding region that gives rise to the fusion protein. Fusions may be useful in producing secreted forms of proteins that are not normally secreted or producing molecules that are immunologically tagged. Tagged proteins may be more easily purified or monitored using antibodies to the tag.
  • a third variation contemplated by the present invention involves the expression of protein fragments. It may not be necessary to express an entire protein and, in some cases, it may be desirable to express a particular functional domain, for example, where the protein fragment remains functional but is more stable, or less antigenic, or both.
  • a. Secreted Proteins Expression of several proteins that are normally secreted can be engineered into neuroendocrine cells. The cDNA's encoding a number of useful human proteins are available. Examples would include soluble CD-4, Factor VIII, Factor IX, von Willebrand Factor, TPA, urokinase, hirudin. interferons, TNF, interleukins, hematopoietic growth factors, antibodies, albumin, leptin, transferrin and nerve growth factors.
  • Peptide Hormones Peptide hormones claimed herein for engineering in neuroendocrine cells are grouped into three classes with specific examples given for each. These classes are defined by the complexity of their post-translational processing. Class I is represented by Growth Hormone, Prolactin and Parathyroid hormone. A more extensive list of human peptides that are included in Class I is given in Table 3. These require relatively limited proteolytic processing followed by storage and stimulated release from secretory granules. Class II is represented by Insulin and Glucagon. A more extensive list of human peptide hormones that are included in Class II are given in Table 4.
  • Class III is represented b> Amylin, Glucagon- like Peptide I and Calcitonin. Again, a more extensive list of Class III human peptide hormones is given in Table 5. In addition to the proteolytic processing found in the Class II peptides, amidation of the C-terminus is required for proper biological function. Examples of engineering expression of all three of these classes of peptide hormones in a neuroendocrine cell are found in this specification. TABLE 3 CLASS I HUMAN PEPTIDE HORMONES
  • GIP Gastric Inhibitory Peptide
  • PTH-rP Parathyroid Hormone-related protein
  • PTH-rP Parathyroid Hormone-related protein
  • VIP Vasoactive Intestinal Peptide
  • AVP Vasopressin
  • Metorphinamide (Adrenorphin) Alpha Melanocyte Stimulating Hormone (alpha-MSH) Atrial Natriuretic Factor (5-28) (ANF) Amylin Table 5 - Continued
  • GHRH Growth Hormone Releasing Factor
  • LHRH Luteinizing Hormone-Releasing Hormone
  • Substance K Neurokinin A
  • Non-secreted proteins can be engineered into neuroendocrine cells.
  • Two general classes of such proteins can be defined. The first are proteins that, once expressed in cells, stay associated with the cells in a variety of destinations. These destinations include the cytoplasm, nucleus, mitochondria, endoplasmic reticulum, golgi, membrane of secretory granules and plasma membrane.
  • Non-secreted proteins are both soluble and membrane associated.
  • the second class of proteins are ones that are normally associated with the cell, but have been modified such that they are now secreted by the cell. Modifications would include site-directed mutagenesis or expression of truncations of engineered proteins resulting in their secretion as well as creating novel fusion proteins that result in secretion of a normally non- secreted protein.
  • Cells engineered to produce such proteins will be used for in vitro and in vivo screening for modulators of protein production and secretion. This will entail purification of the secreted protein from the conditioned media from cells secreting the engineered protein. In vivo, cell- based screening methods would either be based on secretion of the engineered protein or beneficial effects of the cells expressing a non-secreted protein.
  • the cDNA's encoding a number of therapeutical ly useful human proteins are available. These include cell surface receptors, transporters and channels such as GLUT2, CFTR, leptin receptor, sulfonylurea receptor, ⁇ -cell inward rectifying channels, ⁇ 2-adrenergic receptor, pancreatic polypeptide receptor, somatostatin receptor, glucocorticoid receptor, potassium inward rectifying channel, GLP-1 receptor and muscarinic receptor etc.
  • Other proteins include protein processing enzymes such as PC2 and PC3, and PAM, transcription factors such as IPF1, and metabolic enzymes such as adenosine deaminase, phenylalanine hydroxylase, glucocerebrosidase.
  • the engineered cells may express and overexpress the obesity-associated protein known as leptin.
  • leptin is a peptide hormone that controls body composition and is believed to do so, at least in part, via interaction with hypothalamic receptors that regulate food intake and body weight.
  • leptin-induced triglyceride depletion involves a novel mechanisms by which triglyceride disappears through enhanced intracellular triglyceride metabolism, rather than through more traditional free fatty acid export pathways.
  • Insulin levels in adenovirus-leptin infected rats dropped even more dramatically than the fatty acids, being only about 1 /3 of the amount seen in controls. As stated above, the glucose levels of these animals was normal, however. These findings are consistent with enhanced insulin sensitivity in treated animals. Pancreata were isolated from hyperleptinemic rats and examined for ⁇ -cell function and morphology. The most striking finding was the complete absence of insulin secretion in response to either glucose or arginine. The morphology appeared normal, and it was determined that insulin secretion could be reestablished following perfusion of pancreatic tissue in the presence of free fatty acids, thereby establishing an important role for these molecules in ⁇ -cell function. These studies also indicate that leptin- mediated reduction of elevated tissue lipid levels will improve ⁇ -cell function, reduce insulin resistance and help restore abnormal glucose homeostasis in obese individuals.
  • a further connection between diabetes and leptin comes from studies with genetically obese ZDF rats, which contain mutant OB-R genes.
  • the islets of these animals become overloaded with fat at the time that hyperglycemia begins.
  • maneuvers that reduce islet fat content prevent diabetes in ZDF rats, it has been proposed that the accumulation of triglycerides in islets plays a causal role in ⁇ -cell dysfunction.
  • the predisposition to diabetes in homozygous ZDF rats may reflect the fact that their tissue have been completely "unleptinized" throughout their life and therefore have accumulated high levels of TG. In normal rats, this accumulation is prevented by the action of leptin. It is expected that any therapy that reduces triglycerides in islets and in the target tissues of insulin will improve ⁇ -cell function and reduce insulin resistance.
  • the present application therefore encompasses various engineered cells which express leptin in amounts in excess of normal.
  • leptin genes may be manipulated and introduced are much the same as for other genes included herein, such as amylin.
  • a preferred embodiment would involve the use of a viral vector to deliver a leptin-encoding gene, for example, an adenoviral vector.
  • This approach may be exploited in at least two ways. First, in the engineering of cells to produce certain polypeptides in vitro, it may be desirable to express high levels of leptin in order to down-regulate various cellular functions, including synthesis of certain proteins. Similarly, leptin overexpression may synergize with cellular functions, resulting in the increased expression of an endogenous or exogenous polypeptide of interest.
  • leptin-overexpressing cell or a leptin expression construct, such as a leptin-expressing adenovirus
  • leptin expressing cell lines may provide for prolonged expression of leptin in vivo and for high level expression.
  • Preliminary results indicate that injection of recombinantly produced leptin is less efficacious at achieving weight loss and reduction of lipids.
  • Induction of hyperleptinemia using cells lines or expression constructs also may find use in reducing fat content in livestock just prior to slaughter.
  • leptin-induced weight loss may act through different mechanisms than those currently employed, it may be possible to avoid related side effects such as diet-induced ketosis, heart attack and other diet-related symptoms.
  • These regimens may involve combinations of other engineered cells, cells engineered with leptin and at least one other gene or genetic construct (knock-out. antisense, ribozyme, etc.), combination gene therapy or combination with a drug.
  • the methods of delivering such pharmaceutical preparations are described elsewhere in this document
  • the engineered cells may express and/or overexpress certain enzymes of therapeutic value.
  • enzymes include by are not limited to adenosine deaminase (e.g. Genbank Accession Nos. P55265; U18121 ; U73107; Z97053; P00813; U75503; DUHUA), galactosidase (e.g. Genbank Accession Nos.
  • glucosidase e.g. Genbank Accession Nos P29064 ( ⁇ - glucosidase), P26208 ( ⁇ -glucosidase), lecithi cholesterol acyltransferase (LCAT, e.g. Genbank Accession Nos. 729921 (baboon), P04180 (human).
  • XXHUN human LCAT precursor
  • X04981 factor IX
  • factor IX e.g., Genbank Accession Nos. P00740 (human) K02402 (human) P00741 (bovine) and A22493
  • sphingolipase lysosomal acid lipase (e.g., Genbank Accession Nos
  • lipoprotein lipase e.g., Genbank Accession No. P06858
  • hepatic lipase e.g., Genbank Accession Nos. AF037404; PI 1150; P07098
  • pancreatic lipase related protein e.g., Genbank Accession Nos. P54315; P54317) pancreatic lipase (P16233) and uronidase.
  • the present invention also contemplates augmenting or increasing the capabilities of cells to produce biologically active polypeptides. This can be accomplished, in some instances, by overexpressing the proteins involved in protein processing, such as the endoproteases PC2 and PC3 (Steiner et al, 1992) or the peptide amidating enzyme, PAM (Eipper et al, 1992a) in the case of amidated peptide hormones.
  • proteins involved in protein processing such as the endoproteases PC2 and PC3 (Steiner et al, 1992) or the peptide amidating enzyme, PAM (Eipper et al, 1992a) in the case of amidated peptide hormones.
  • Insulin Promoter Factor 1 (IPF1) found in pancreatic ⁇ - cells (Ohlsson et al. 1993) could increase or stabilize the capabilities of engineered neuroendocrine cells.
  • Insulin promoter factor 1 (IPF-1 : also referred to as STF-1, IDX-1, PDX- 1 and ⁇ TF-1 ) is a homeodomain-containing transcription factor proposed to play an important role in both pancreatic development and insulin gene expression in mature ⁇ -cells (Ohlsson et al, 1993.
  • IPF-1 is expressed prior to islet cell hormone gene expression and is restricted to positions within the primitive foregut where pancreas will later form. Indeed, mice in which the IPF-1 gene is disrupted by targeted knockout do not form a pancreas (Jonsson et al, 1994). Later in pancreatic development, as the different cell types of the pancreas start to emerge, IPF-1 expression becomes restricted predominantly to ⁇ -cells. IPF-1 binds to TAAT consensus motifs contained within the FLAT E and PI elements of the insulin enhancer/promoter, whereupon, it interacts with other transcription factors to activate insulin gene transcription
  • Stable overexpression of IPF-1 in neuroendocrine ⁇ -cell lines will serve two purposes. First, it will increase transgene expression under the control of the insulin enhancer/promoter. Second, because IPF-1 appears to be critically involved in ⁇ -cell maturation, stable overexpression of IPF-1 in ⁇ -cell lines should cause these mostly dedifferentiated ⁇ -cells to regain the more differentiated function of a normal animal ⁇ -cell. If so, then these redifferentiated ⁇ -cell lines could potentially function as a more effective neuroendocrine cell type for cell-based delivery of fully processed, bioactive peptide hormones.
  • cell surface proteins such as the ⁇ -cell-specific inwardly rectifying potassium channel (BIR; Inagaki et al, 1995), involved in release of the secretory granule contents upon glucose stimulation, the sulfonylurea receptor (SUR), and other ATP sensitive channels.
  • BIR ⁇ -cell-specific inwardly rectifying potassium channel
  • SUR sulfonylurea receptor
  • Other cell surface signaling receptors which help potentiate the glucose-stimulated degranulation of ⁇ - cells including the glucagon-like peptide I receptor (Thorens. 1992) and the glucose-dependent insulinotropic polypeptide receptor (also known as gastric inhibitory peptide receptor) (Usdin. 1993) can be engineered into neuroendocrine cells.
  • ⁇ -cell-specific signaling receptors are involved in secretory granule release in response to glucose.
  • glucose stimulated release of any heterologous peptide targeted to the secretory granule can be engineered.
  • other cell surface signaling proteins involved in non-glucose-stimulated release of secretory granule contents can be engineered into neuroendocrine cells. Examples would include releasing factor receptors such as Growth Hormone Releasing Factor Receptor (Lin et al, 1992) and Somatostatin or Growth Hormone Releasing Hormone Receptor (Mayo, 1992).
  • the present invention further includes embodiments where the resultant stable neuroendocrine cells are further engineered to modify the secretion of the endogenous secretory polypeptide in response to one or more secretagogues.
  • the engineering of the resultant stable cells to generate a more physiologically-relevant regulated secretory response includes engineering the expression or overexpression of signaling proteins known to play a role in the regulated secretory response of neuroendocrine cells.
  • signaling proteins known to play a role in the regulated secretory response of neuroendocrine cells.
  • These include cell surface proteins such as the ⁇ -cell-specific inwardly rectifying potassium channel ( ⁇ cell inward rectifier, BIR; Inagaki et al, 1995), involved in release of the secretory granule contents upon glucose stimulation, the sulfonylurea receptor (SUR), and ATP sensitive channel.
  • Other heterologous releasing factor receptors may be used in these aspects of the invention, as may adrenergic receptors and the like.
  • ⁇ -cells which assist with potentiating the glucose- stimulated degranulation of ⁇ -cells include the glucagon-like peptide I receptor (Thorens, 1992) and the glucose-dependent insulinotropic polypeptide receptor (also known as gastric inhibitory peptide receptor) (Usdin et al, 1993), which can also be engineered into neuroendocrine cells according to the present invention.
  • These ⁇ -cell-specific signaling receptors, as well as GLUT-2 and glucokinase are involved in secreto . granule release in response to glucose. In this way. glucose stimulated release of a peptides targeted to the secretory granule can be reengineered or enhanced.
  • cell surface signaling proteins involved in non- glucose-stimulated release of secretory granule contents can be engineered into the stable neuroendocrine cells of the invention.
  • releasing factor receptors such as
  • the pancreatic ⁇ -cell is continually exposed to a complex mixture of molecules that modulate insulin synthesis, storage, and exocytosis.
  • the information in this mixture is translated to regulatory signals by three distinct mechanisms: (1) transport into the cell and metabolism of fuels, (2) ion fluxes, relative to extracellular and intracellular ion pools, and (3) hormonal signals that are mediated via receptors (reviewed in Komatsu et al., 1997).
  • the transport and metabolism of glucose is the dominant signal that regulates insulin secretion.
  • a large portion of the glucose effect is mediated by K + -ATP channels, depends on membrane polarity, and regulates the influx of extracellular calcium through L-type Ca channels.
  • Amino acids are another fuel that participate in insulin secretion via the regulation of the K + -ATP channel.
  • Glucose metabolism also affects intracellular Ca stores by mechanisms that are independent of K + -ATP channels. This portion of glucose-regulated insulin secretion is augmented by many other molecules involved in glycemic control such as fatty acids and muscarinic receptor ligands. Binding to the muscarinic receptor by acetylcholine results in the activation of phospholipases, enzymes that catalyze the conversion of phophoinositides to inositol triphosphates (IP3) and diacylglycerol (DAG). Increased IP3 levels stimulate the release of Ca from intracellular stores and contribute to signals for exocytosis of insulin.
  • IP3 inositol triphosphates
  • DAG diacylglycerol
  • a central theme in Ca -induced secretion is the activation of Ca /calmodulin-dependent kinases that link Ca 2+ levels to exocytosis (Ashcroft, 1994).
  • glucose regulates insulin secretion by events that are both K -ATP channel-independent and Ca "+ -independent.
  • This form of regulation applies most often to the augmenting effects observed for hormones that bind receptors such as GLP-1, GIP, pituitary adenylate cyclase activating peptide (PACAP), and vasoactive intestinal peptide (VIP).
  • Receptors for these peptide hormones are typically coupled to GTP-binding proteins that regulate the membrane bound form of adenylate cyclase.
  • Stimulation of the receptors results in increases in cyclic AMP levels and increases in the activity of protein kinase A, a potentiator of insulin secretion.
  • Other secretory kinase effects may also be independent of the K + -ATP channels and intracellular Ca + .
  • Protein kinase C is stimulated by DAG and functions to augment glucose-stimulated insulin secretion. ( Komatsu et al., 1997).
  • Prentki has proposed a model for glucose metabolism that takes into account many aspects of stimulated insulin secretion (Prentki. 1994). It categorizes stimulatory events as glycolytic and post-glycolytic and supports the view that the glucose-mediated regulation of insulin secretion cannot be fully explained by the effects of the K + -ATP channels and increases
  • pyruvate is a key intermediate metabolite and its fates provide two distinct mechanisms to stimulate secretion.
  • Pyruvate dehydrogenase which is stimulated by an increase in the ATP/ADP ratios resulting from glycolysis, moves the metabolism of glucose toward the citric acid cycle by the conversion of pyruvate to acetyl CoA.
  • Carbon fluxes through the citric acid cycle boost the ATP/ADP ratios even higher, and stimulate the closure of K -ATP channels and the concomitant increases in intracellular Ca .
  • Pyruvate also is a key metabolite in anaplerosis, the replenishment of citric acid cycle intermediates.
  • This arm of pyruvate metabolism is initiated by the activity of pyruvate carboxylase, an enzyme that catalyzes the conversion of pyruvate to citrate.
  • citrate carboxylase an enzyme that catalyzes the conversion of pyruvate to citrate.
  • malonyl CoA a molecule that provides a link between glucose metabolism and fatty acid metabolism.
  • Increases in malonyl CoA promote the accumulation of fatty acid intermediates, potentiators of insulin secretion that appear to be independent of Ca " ⁇ (Prentki, 1994).
  • the present invention further provides methods for preparing immortalized stable human neuroendocrine cells or secretory cells that have maintained their regulated secretory pathway.
  • the methods generally comprise providing to a human neuroendocrine or regulated secretory cell an effective amount of a transforming genetic construct that comprises an operative transforming unit under the transcriptional control of a promoter specific for the target neuroendocrine cell.
  • the target human neuroendocrine cells will be provided with the transforming genetic construct by infection with a recombinant virus, most preferably an adenovirus, that comprises the transforming construct.
  • a recombinant virus most preferably an adenovirus
  • the methods described herein may involve the use of two, three or more distinct transforming genetic constructs.
  • the use of defined media, or the use of defined media supplemented with one or more growth factors specific for the target neuroendocrine cells is contemplated.
  • one or more promoters that have enhanced transcriptional activity such as promoters comprising multimerized promoter elements, the additional provision of a growth factor receptor gene to the target cell and/or the use of transforming genetic constructs that involve elements for effecting controlled or regulated expression or subsequent excision.
  • the present section relates to the transforming genes and genetic constructs.
  • Exemplary transforming genes and constructs are listed herein in Table 6. Any one or more of the genes listed therein may be used in the context of the present invention. Where two or more transforming genes are provided to a human neuroendocrine cell, it may be preferable to provide genes from different functional categories, such as those that perturb signal transduction. affect cell cycle, alter nuclear transcription, alter telomere structure or function, inhibit apoptosis, or that exert pleiotropic activities. It will be understood that the genes listed in Table 6 are only exemplary of the types of oncogenes. mutated tumor suppressors and other transforming genetic constructs and elements that may be used in this invention. Further transforming genes and constructs will be known to those of ordinary skill in the art. TABLE 6 EXEMPLARY ONCOGENES AND MUTANT TUMOR SUPPRESSORS
  • tyrosine kinases both membrane-associated and cytoplasmic perturb signal transduction forms, such as Src family, Jak/Stats, Ros, Neu, Fms, Ret, abl.
  • Met serine/threonine kinases Mos, Raf, protein kinase C, PIM-1 growth factor and receptors: platelet derived growth factor
  • PDGF insulin-like growth factor
  • IGF-1 insulin-like growth factor
  • IRS-1 insulin receptor substrate
  • EGF-2 insulin receptor substrate
  • EGF epidermal growth factor
  • HGF basic fibroblast growth factor
  • G GTPases
  • cyclin-dependent protein kinases (cdk), classes A - E; affect cell cycle members of the cyclin family such as cyclin D
  • Myc family members including c-myc, N-myc, and L-myc; alter nuclear transcription Rel family members including NF-kappaB; c-Myb, Ap-1 , fos, jun, insulinoma associated cDNA (IA-1), ErbB-1, PAX gene family
  • bcl-2 and family members including Bcl-xl, Mcl-1, Bak, Al . inhibit apoptosis
  • viral proteins such as SV40 and polyoma large T antigens, pleiotropic activities SV40 temperature sensitive large T antigen, adenovirus El A and E1B, papilomavirus E6 and E7
  • MUTANT TUMOR SUPPRESSORS p53 retinoblastoma gene (Rb), Wilm's tumor (WT1), bax failure to promote alpha, interleukin- l b-converting enzyme and family, MEN-1 apoptosis gene (chromosome 1 l ql 3).
  • neurofibromatosis type 1 (NF1), cdk inhibitor pi 6, colorectal cancer gene (DCC), familial adenomatosis polyposis gene (FAP), multiple tumor suppressor gene (MTS-1 ), BRCA1, BRCA2
  • the immortalizing genetic construct will comprise a gene or cDNA that is responsible for the perturbation of signal transduction.
  • Representative members of this class are genes or cDNAs encoding tyrosine kinases, serine/threonine kinases, growth factors and receptors, small GTPases, and receptor-type tyrosine phosphatase IA-2.
  • Exemplary of the members preferred for use in the present invention is neu (also known as he 2 or erbB-2; GenBank accession numbers Ml 1730, X03363, U02326 and S57296).
  • neu was discovered as an oncogene in breast cancer, but it is also found in other forms of cancer, neu appears to be a member of the receptor tyrosine kinase family.
  • HGFr also known as scatter factor receptor
  • Other preferred members are insulin-like growth factor 1 receptor (GenBank accession number X04434 and M24599), and GTPase Gs feather (GenBank accession numbers X56009, X04409).
  • Gs ⁇ is associated with pituitary tumors that secrete growth hormone, but not other neuroendocrine or endocrine tumors.
  • the immortalization genetic construct may be a factor that affects the cell cycle. Exemplary of this type of factor is cyclin DI (also known as PRAD or bcl-1; GenBank accession numbers M64349 and M73554). This is associated as an oncogene primarily with parathyroid tumors.
  • Other factors that may comprise the genetic immortalization construct include those gene that alter nuclear transcription c-myc (GenBank accession numbers J00120, K01980. M23541, V00501, X00364).
  • Inhibitors of apoptosis are also preferred for use is bcl-2 (distinct from bcl-1, cyclin DI ; GenBank accession numbers M14745, X06487). Overexpression of this oncogene was first discovered in T cell lymphomas. bcl-2 functions as an oncogene by binding and inactivating Bax, a protein in the apoptotic pathway.
  • the genetic constructs comprise molecules with pleiotropic activities, preferred from this class is SV40 large T antigen (TAG; GenBank accession number J02400). Also preferred is temperature sensitive large T antigen.
  • genes that will be useful in immortalizing the neuroendocrine cells are constructs that result in the failure to promote apoptosis. Preferred in this category are p53 and the retinoblastoma gene. Most forms of cancer have reports of p53 mutations. Inactivation of p53 results in a failure to promote apoptosis. With this failure, cancer cells progress in tumorogenesis rather than be destined for cell death.
  • a short list of cancers and mutations found in p53 is: ovarian (GenBank accession numbers S53545, S62213, S62216); liver (GenBank accession numbers S6271 1 , S62713, S62714, S67715, S72716); gastric (GenBank accession numbers S63157); colon (GenBank accession numbers S63610); bladder (GenBank accession numbers S85568, S85570, S85691); lung (GenBank accession numbers S41969, S41977); and glioma (GenBank accession numbers S85807, S85712, S85713).
  • the invention contemplates the use of growth factor receptor genes and growth factor genes as the transforming elements.
  • human ⁇ cells are infected with a recombinant adenovirus that provides overexpression of growth hormone receptor (GenBank Accession Nos. J0481 1 and X06562) controlled by the modRIP (or modHIP) promoter, ⁇ cells cultured in a defined medium would then be stimulated to proliferate by the addition of growth hormone to the medium.
  • the replicating population of ⁇ cells are then transformed by retroviral constructs that will result in stable expression of growth hormone receptor or an alternate transforming gene.
  • the use of other growth promoting genes such as IGF-1 receptor (and its ligand in the medium) and or the signaling substrate of growth factor receptors (such as IRS-2 in the case of IGF-1 receptor) could similarly be used to achieve growth and transformation.
  • the invention contemplates the use of several transforming gene constructs in combination.
  • the transforming genetic construct may include more than one operative transforming unit, or more than one construct can be supplied.
  • expression construct is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in which part or all of the nucleic acid encoding sequence is capable of being transcribed.
  • the transcript may be translated into a protein, but it need not be.
  • expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest.
  • the nucleic acid encoding a gene product is under transcriptional control of a promoter.
  • a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene.
  • under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.
  • promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for RNA polymerase II.
  • Much of the thinking about how promoters are organized derives from analyses of several viral promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, augmented by more recent work, have shown that promoters are composed of discrete functional modules, each consisting of approximately 7-20 bp of DNA, and containing one or more recognition sites for transcriptional activator or repressor proteins. At least one module in each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box. but in some promoters lacking a
  • TATA box such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either co-operatively or independently to activate transcription.
  • the particular promoter that is employed to control the expression of a nucleic acid encoding a particular gene is not believed to be important, so long as it is capable of expressing the nucleic acid in the targeted cell.
  • a human cell it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell.
  • a promoter might include either a human or viral promoter.
  • the human cytomegalovirus (CMV) immediate early gene promoter can be used to obtain high-level expression of the gene of interest.
  • CMV cytomegalovirus
  • the use of other viral or mammalian cellular or bacterial phage promoters which are well-known in the art to achieve expression of a gene of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.
  • a promoter with well-known properties, the level and pattern of expression of the gene product following transfection can be optimized.
  • Tables 6 and 7 list several elements/promoters which may be employed, in the context of the present invention, to regulate the expression of the gene of interest. This list is not intended to be exhaustive of all the possible elements involved in the promotion of gene expression but, merely, to be exemplary thereof.
  • Enhancers were originally detected as genetic elements that increased transcription from a promoter located at a distant position on the same molecule of DNA. This ability to act over a large distance had little precedent in classic studies of prokaryotic transcriptional regulation. Subsequent work showed that regions of DNA with enhancer activity are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins.
  • enhancers The basic distinction between enhancers and promoters is operational. An enhancer region as a whole must be able to stimulate transcription at a distance; this need not be true of a promoter region or its component elements. On the other hand, a promoter must have one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous, often seeming to have a very similar modular organization.
  • Eukaryotic promoters can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • NCAM Neural Cell Adhesion Molecule
  • SAA Human Serum Amyloid A
  • TPA Collagenase Phorbol Ester
  • TPA Stromelysin Phorbol Ester
  • the expression of the transforming genetic construct is under the control of a promoter.
  • the promoter is required to express the transforming genetic construct to a degree sufficient to effect transformation of a target cell type amongst a population of different cell types such that the transformed target cell results in the generation of a stable human regulated secretory cell. Promoters can be classified into two groups, ubiquitous and tissue- or cell-specific.
  • Ubiquitous promoters activate transcription in all or most tissues and cell types.
  • ubiquitous promoters are cellular promoters like the histone promoters, promoters for many metabolic enzyme genes such as hexokinase I and glyceraldehyde-3 -phosphate dehydrogenase, and many viral promoters such as CMVp and the Rous sarcoma virus promoter (RSVp).
  • Tissue- or cell-specific promoters activate transcription in a restricted set of tissues or cell types or, in some cases, only in a single cell type of a particular tissue.
  • stringent cell-specific promoters are the insulin gene promoters which are expressed in only a single cell type (pancreatic ⁇ cells) while remaining silent in all other cell types, and the immunoglobulin gene promoters which are expressed only in cell types of the immune system.
  • promoters are shown above in Table 1 (Pearse and Takor, 1979; Nylen and Becker, 1995). Although not a complete list, these promoters are exemplary of the types of promoters contemplated for use in the present invention. Additional promoters useful in the present invention will be readily known to those of skill in the art.
  • the promoter may be "context specific" in that it will be expressed only in the desired cell type and not in other cell types that are likely to be present in the population of target cells, e.g., it will be expressed in ⁇ cells, but not in ⁇ or ⁇ cells, when introduced into intact human islets.
  • an insulin promoter targets the expression of a linked transforming oncogene selectively to ⁇ cells of a human islet preparation even though many other contaminating cell types exist in the preparation.
  • the present invention is applicable to the generation of stably transformed neuroendocrine secretory cell lines other than ⁇ cells, other context specific promoters may be employed.
  • the cell-specific prolactin gene promoter can be used to express a linked transforming oncogene selectively to lactotrophs surrounded by all the other cell types present in a pituitary cell preparation. a. ⁇ Cell-Specific Promoters.
  • HIP can direct cell-specific expression of linked genes in rodent ⁇ cell lines and rat primary islets, albeit, at a somewhat lower level than that observed for RIPl (Melloul et al, 1993).
  • RIPl and RIP2 should function effectively in human ⁇ cells.
  • FF RIPl FAR/FLAT minienhancer
  • glucagon promoter GenBank accession number X03991 : growth hormone promoter, GenBank accession numbers J03071 and K00470; POMC gene promoter, GenBank accession numbers V01510 and K02406; calcitonin promoter, GenBank accession number XI 5943; and the GIP gene promoter, GenBank accession number M31674.
  • Modified Promoters are the glucagon promoter, GenBank accession number X03991 : growth hormone promoter, GenBank accession numbers J03071 and K00470; POMC gene promoter, GenBank accession numbers V01510 and K02406; calcitonin promoter, GenBank accession number XI 5943; and the GIP gene promoter, GenBank accession number M31674.
  • Promoters can be modified in a number of ways to increase their transcriptional activity. Multiple copies of a given promoter can be linked in tandem, mutations which increase activity may be introduced, single or multiple copies of individual promoter elements may be attached. parts of unrelated promoters may be fused together, or some combination of all of the above can be employed to generate highly active promoters. All such methods are contemplated for use in connection with the present invention.
  • German et al, (1992) mutated three nucleotides in the transcriptionally important FLAT
  • CMV promoter which has high but short-lived transcriptional activity in dog myoblasts
  • MCKp muscle-specific creatine kinase promoter
  • modified rat insulin promoters containing multimerized enhancer elements have been engineered.
  • modRIP modified rat insulin promoters
  • the currently preferred modRIP contains six multimerized repeats of a 50 base pair region of the cis acting enhancer of RIP, placed upstream of an intact copy of RIP.
  • CMVp Cytomegalovirus promoter
  • a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
  • a terminator is also contemplated as an element of the expression cassette. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • the delivery of a nucleic acid in a cell may be identified in vitro or in vivo by including a marker in the expression construct.
  • the marker would result in an identifiable change to the transfected cell permitting easy identification of expression.
  • a drug selection marker aids in cloning and in the selection of transformants, for example, neomycin, puromycin. hygromycin, DHFR, GPT, zeocin and histidinol.
  • enzymes such as herpes simplex virus thymidine kinase (tk) (eukaryotic) or chloramphenicol acetyltransferase (CAT) (prokaryotic) may be employed.
  • Immunologic markers also can be employed.
  • the selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable markers are well known to one of skill in the art.
  • IRES internal ribosome binding sites
  • IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg. 1988). IRES elements from two members of the picanovirus family (polio and encephalomyocarditis) have been described
  • IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message.
  • Any heterologous open reading frame can be linked to IRES elements. This includes genes for secreted proteins, multi-subunit proteins, encoded by independent genes, intracellular or membrane-bound proteins and selectable markers. In this way, expression of several proteins can be simultaneously engineered into a cell with a single construct and a single selectable marker.
  • the neuroendocrine cell and the stable neuroendocrine cells of the present invention will be grown in cell culture.
  • the present section describes the methodology related to growth of cells in culture.
  • ⁇ cells are expanded by established culture conditions. For example, ⁇ cells can be cultured and even induced to divide as described (Clark and Chick, 1990; Beattie et al,
  • Human islets isolated by an automated method (Ricordi et al, 1988) are maintained in culture and transformed by the inventive engineered expression of proteins that promote accelerated cell replication.
  • the transformation methods of the invention preferably involve the use of specific culture conditions designed to preferentially promote neuroendocrine cell growth, which are used in conjunction with the stable activation of cell specific gene promoter controlled protein expression.
  • the culture conditions are achieved by manipulating the following cell culture variables: media growth survival factors (such as IGF-1 , growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin), media differentiation factors (such as TGF- ⁇ ).
  • media growth survival factors such as IGF-1 , growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin
  • media differentiation factors such as TGF- ⁇ .
  • media lipids such as IGF-1 , growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin
  • media differentiation factors such as TGF- ⁇
  • media lipids such as IGF-1 , growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin
  • media differentiation factors such as TGF- ⁇
  • media lipids such as IGF-1 , growth hormone, prolactin, PDGF, hepatocyte growth factor, and transferrin
  • media differentiation factors such as TGF- ⁇
  • Fibroblast growth/survival in culture is eliminated by culturing the islets in defined media using factors (such as IGF-1, cysteine, and growth hormone) to selectively confer a growth/survival advantage to ⁇ cells in preference to fibroblasts.
  • factors such as IGF-1, cysteine, and growth hormone
  • Establishment of fibroblast free cultures will allow prolonged maintenance of human islet ⁇ cells in culture for subsequent infection with adenovirus expression vectors in cases where ⁇ cells are in a non-proliferative state, or retrovirus expression vectors for ⁇ cells which have been induced to proliferate by oncogene expression. Fibroblasts may even be killed by fibroblast-directed toxins.
  • Media comprising one or more growth factors that stimulate the growth of the target neuroendocrine cell and do not substantially stimulate growth of distinct cells in the cell population; i.e., act to induce preferential growth of the target cells rather than faster-growing, more hardy cells in the population, as may be used to deplete fibroblasts.
  • growth factors that stimulate the growth of the target neuroendocrine cell and do not substantially stimulate growth of distinct cells in the cell population; i.e., act to induce preferential growth of the target cells rather than faster-growing, more hardy cells in the population, as may be used to deplete fibroblasts.
  • Examples include defined serum free conditions used for ⁇ cells (Clark et al, 1990; incorporated herein by reference), or inclusion of growth or differentiation factors known to allow preferential growth of ⁇ cells (WO 95/29989; incorporated herein by reference).
  • the inventors have developed a media composition that will be particularly useful in the growth and propagation of the cells of the present invention.
  • the rational behind the development of "BetaGene” medium had its beginnings with the observation that in bioreactor high density cultures of ⁇ -cell line RIN-38. ethanolamine was a rapidly consumed component of the growth medium. An equimolar mixture of ethanolamine- phosphoethanolamine was found to protect RIN-38 ⁇ -cells from linoleic acid toxicity
  • the serumless cultures then were returned to the same base medium supplemented with FBS, with continued insulin monitoring.
  • the media screened were those most commonly used for culture of primary islets in the literature. Performance of the different media were indicated by the rate and magnitude of functional loss, as well as the rate of recovery and completeness of recovery after return to FBS supplementation.
  • One medium CMRL 1066 was clearly inferior. while Ml 99, and a-MEM were fairly equivalent.
  • Media such as F12 and RPMI were not readily evaluated by this approach, due to the low calcium concentration of these media and resultant deterioration of the Ca-alginate hydrogel. The latter were then evaluated as equal mixtures with M199 and MEM.
  • An M199-F12 mixture was determined to be the best performing formulation tested, while an MEM-F12 mixture could be used with at least short term equivalency. Many components of the BG Medium are at concentrations that would be found in mixed formulations (others reflect our optimization).
  • Bicarbonate was increased in the formulation to provide better pH control for scale-up cultures (such as the CellCubeTM).
  • Zinc was supplemented because primary beta cells have high concentrations of zinc and several islet enzymes bind Zn, and insulin crystal is coordinate with Zn.
  • glucose concentrations are known to be critical for ⁇ -cell culture.
  • One objective of the medium development was to derive a formulation that would optimally support primary pancreatic islets as well as ⁇ -cell lines. As a result, human islets were used to determine a glucose concentration that could support survival and function of human islets in culture.
  • Glucose in the range of 7 mM (6-8 mM) provided long term survival (months) of human islets, with maintenance of glucose sensing, as indicated by dose-response studies of glucose-induced insulin secretion, and by maintained (and in islets of two donors restored insulin processing).
  • Cells may be induced to proliferate by initial infection with adenovirus or adeno- associated virus (AAV) comprising a gene that induces cellular proliferation, the gene being under the control of a promoter specific for the regulated secretory cell.
  • AAV adeno-associated virus
  • the cells may be induced to proliferate by growth on a stimulatory cell matrix (Hayek et al, 1995).
  • the transformed human cells may be placed in vivo, e.g., under kidney capsule of the nude rat, to allow outgrowth of transformed cells.
  • the lack of an immune response in the nude rat is known to allow long term survival and expression of recombinant adenovirus infected cells (Dai et al, 1995;
  • the nucleic acid encoding the genes may be stably integrated into the genome of the cell.
  • the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA.
  • Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of, or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed. All expression constructs and delivery methods are contemplated for use in the context of the present invention, although certain methods are preferred, as outlined below.
  • the expression construct In order to effect expression of a gene construct, the expression construct must be delivered into a cell. As described below, the preferred mechanism for delivery is via viral infection, where the expression construct is encapsidated in an infectious viral particle. However, several non-viral methods for the transfer of expression constructs into cultured mammalian cells also are contemplated by the present invention. In one embodiment of the present invention, the expression construct may consist only of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned which physically or chemically permeabilize the cell membrane.
  • the expression construct may be entrapped in a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers
  • Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al.. 1987). Wong et al, (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.
  • the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
  • HVJ hemagglutinating virus
  • the liposome may be complexed or employed in conjunction with nuclear non- histone chromosomal proteins (HMG-1 ) (Kato et al, 1991).
  • HMG-1 nuclear non- histone chromosomal proteins
  • the liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
  • the expression construct is introduced into the cell via electroporation. Electroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge.
  • the expression construct is introduced to the cells using calcium phosphate precipitation.
  • Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique. Also in this manner. mouse L(A9), mouse C127, CHO, CV-1 , BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama. 1987). and rat hepatocytes were transfected with a variety of marker genes (Rippe et al, 1990).
  • the expression construct is delivered into the cell using DEAE- dextran followed by polyethylene glycol.
  • reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).
  • Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987).
  • Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990).
  • the microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads. Gainer et al, (1996) have transfected mouse islets with a luciferase gene/human immediate early promoter reporter construct, using ballistic particles accelerated by helium pressure.
  • Further embodiments of the present invention include the introduction of the expression construct by direct microinjection or sonication loading.
  • Direct microinjection has been used to introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub, 1985), and
  • the expression construct is introduced into the cell using adenovirus assisted transfection.
  • Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et al. 1992; Curiel, 1994), and the inventors contemplate using the same technique to increase transfection efficiencies into human islets.
  • tissue-specific promoter and transforming construct are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in the target cells. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention. Specific delivery in the context of another mammalian cell type is described by Wu and Wu (1993; incorporated herein by reference).
  • Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a DNA-binding agent. Others comprise a cell receptor-specific ligand to which the DNA construct to be delivered has been operatively attached.
  • Several ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987, 1988: Wagner et al, 1990; Ferkol et al, 1993; Perales et al, 1994; Myers, EPO 0273085), which establishes the operability of the technique.
  • the ligand will be chosen to correspond to a receptor specifically expressed on the neuroendocrine target cell population.
  • the DNA delivery vehicle component of a cell-specific gene targeting vehicle may comprise a specific binding ligand in combination with a liposome.
  • the nucleic acids to be delivered are housed within the liposome and the specific binding ligand is functionally incorporated into the liposome membrane.
  • the liposome will thus specifically bind to the receptors of the target cell and deliver the contents to the cell.
  • Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.
  • EGF epidermal growth factor
  • the DNA delivery vehicle component of the targeted delivery vehicles may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
  • a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
  • Nicolau et al, (1987) employed lactosyl-ceramide. a galactose-terminal asialganglioside. incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes.
  • the tissue-specific transforming constructs of the present invention can be specifically delivered into the target cells in a similar manner.
  • adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue-specific transforming construct that has been cloned therein.
  • the expression vector comprises a genetically engineered form of adenovirus.
  • retrovirus the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity.
  • adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification.
  • Adenovirus is particularly suitable for use as a gene transfer vector because of its midsized genome, ease of manipulation, high titer, wide target-cell range and high infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs). which are cis elements necessary for viral DNA replication and packaging.
  • ITRs inverted repeats
  • the early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication.
  • the El region (El A and EIB) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes.
  • the expression of the E2 region results in the synthesis of the proteins for viral DNA replication.
  • MLP major late promoter
  • TPL 5'-tripartite leader
  • recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two proviral vectors, wild-type adenovirus may be generated from this process.
  • adenovirus generation and propagation of the current adenovirus vectors, which are replication deficient, depend on a helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (Graham et al., 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the D3 or both regions (Graham and Prevec, 1991). In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury et al, 1987), providing capacity for about 2 extra kb of DNA.
  • the maximum capacity of the current adenovirus vector is under 7.5 kb. or about 15%) of the total length of the vector. More than 80%) of the adenovirus viral genome remains in the vector backbone.
  • Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells.
  • the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells.
  • the preferred helper cell line is 293.
  • Racher et al (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus.
  • natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100- 200 ml of medium. Following stirring at 40 rpm, the cell viability is estimated with trypan blue.
  • Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/1) is employed as follows.
  • the adenovirus may be of any of the 42 different known serotypes or subgroups A-F.
  • Adenovirus type 5 of subgroup C is the preferred starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.
  • the typical vector according to the present invention is replication defective and will not have an adenovirus E l region.
  • it will be most convenient to introduce the transforming construct at the position from which the El -coding sequences have been removed.
  • the position of insertion of the construct within the adenovirus sequences is not critical to the invention.
  • the polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors as described by Karlsson et al, (1986) or in the E4 region where a helper cell line or helper virus complements the E4 defect.
  • Adenovirus growth and manipulation is known to those of skill in the art, and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g.,
  • adenovirus 10 -10 plaque-forming units per ml, and they are highly infective.
  • the life cycle of adenovirus does not require integration into the host cell genome.
  • the foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et al, 1963; Top et al, 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.
  • Adenovirus vectors have been used in eukaryotic gene expression (Levrero et al, 1991 ; Gomez-Foix et al, 1992) and vaccine development (Grunhaus and Horwitz, 1992; Graham and Prevec, 1992). Recently, animal studies suggested that recombinant adenovirus could be used for gene therapy (Stratford-Perricaudet and Perricaudet, 1991 : Stratford-Perricaudet et al, 1990; Rich et al, 1993). Studies in administering recombinant adenovirus to different tissues include trachea instillation (Rosenfeld et al, 1991 ; Rosenfeld et al. 1992), muscle injection (Ragot el al. 1993), peripheral intravenous injections (Herz and Gerard. 1993) and stereotactic inoculation into the brain (Le Gal La Salle et al, 1993).
  • Recombinant adenovirus and adeno-associated virus can both infect and transduce non-dividing human primary cells.
  • gene transfer efficiencies of approximately 70% for isolated rat islets have been demonstrated by the inventors (Becker et al, 1994a; Becker et al, 1994b; Becker et al, 1996) as well as by other investigators (Gainer et al. 1996).
  • Adeno-associated virus is an attractive vector system for use in the human cell transformation of the present invention as it has a high frequency of integration and it can infect nondividing cells, thus making it useful for delivery of genes into mammalian cells in tissue culture (Muzyczka. 1992).
  • AAV has a broad host range for infectivity (Tratschin et al. 1984; Laughlin, et al, 1986: Lebkowski, et al, 1988; McLaughlin, et al, 1988), which means it is applicable for use with human neuroendocrine cells, however, the tissue-specific promoter aspect of the present invention will ensure specific expression of the transforming construct. Details concerning the generation and use of rAAV vectors are described in U.S. Patent No.
  • AAV vectors have been used successfully for in vitro and in vivo transduction of marker genes (Kaplitt et al,
  • AAV is a dependent parvovirus in that it requires coinfection with another virus (either adenovirus or a member of the herpes virus family) to undergo a productive infection in cultured cells (Muzyczka, 1992).
  • another virus either adenovirus or a member of the herpes virus family
  • helper virus the wild type AAV genome integrates through its ends into human chromosome 19 where it resides in a latent state as a provirus (Kotin et al, 1990; Samulski et al, 1991).
  • rAAV is not restricted to chromosome 19 for integration unless the AAV Rep protein is also expressed (Shelling and Smith, 1994).
  • recombinant AAV (rAAV) virus is made by cotransfecting a plasmid containing the gene of interest flanked by the two AAV terminal repeats (McLaughlin et al, 1988; Samulski et al, 1989; each incorporated herein by reference) and an expression plasmid containing the wild type AAV coding sequences without the terminal repeats, for example pIM45 (McCarty et al, 1991 ; incorporated herein by reference).
  • the cells are also infected or transfected with adenovirus or plasmids carrying the adenovirus genes required for AAV helper function.
  • rAAV virus stocks made in such fashion are contaminated with adenovirus which must be physically separated from the rAAV particles (for example, by cesium chloride density centrifugation).
  • adenovirus vectors containing the AAV coding regions or cell lines containing the AAV coding regions and some or all of the adenovirus helper genes could be used (Yang et al, 1994a; Clark et al. 1995). Cell lines carrying the rAAV DNA as an integrated provirus can also be used (Flotte et al, 1995).
  • the present invention contemplates infection of the target cells with a recombinant adeno-associated virus (AAV) containing an oncogene driven by a tissue specific promoter.
  • AAV adeno-associated virus
  • Recombinant AAV plasmids with RIP driving T antigen have been constructed.
  • Retroviral Infection The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse- transcription (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
  • the retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively. A sequence found upstream from the gag gene contains a signal for packaging of the genome into virions. Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome. These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).
  • LTR long terminal repeat
  • a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
  • a packaging cell line containing the gag, pol. and env genes but without the LTR and packaging components is constructed (Mann et al,
  • Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).
  • viral vectors may be employed as expression constructs in the present invention.
  • Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden,
  • Chang et al recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus genome in the place of the polymerase, surface, and pre-surface coding sequences. It was cotransfected with wild-type virus into an avian hepatoma cell line. Culture media containing high titers of the recombinant virus were used to infect primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after transfection (Chang et al. 1991).
  • CAT chloramphenicol acetyltransferase
  • the nucleic acids to be delivered are housed within an infective virus that has been engineered to express a specific binding ligand.
  • the virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell.
  • a novel approach designed to allow specific targeting of retrovirus vectors was recently developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors.
  • a further alternative for practicing the present invention is to use adenovirus or AAV infection of primary cells leading to in vitro expansion of a primary cell population that is then amenable to stable oncogene transfer by methods requiring cell growth such as retroviral transduction, plasmid transfection of expanding cells (Lipofectin or electroporation), or a second round of Adenovirus and/or AAV infection.
  • Another embodiment of the invention is to use alternating AAV and adenovirus infections. Propagation of AAV is dependent upon adenovirus. and using both viruses may lead to more productive infections. Such a method may increase the number of final cells that have oncogenes integrated and expressed. Multiple, sequential viral infections may allow one of skill in the art to exploit the benefits of various viral delivery systems and avoid their limitations. For example, a limitation of adenoviral gene delivery is that this system affords a very low rate of integration of viral and recombinant DNAs into the host cell genome. Consequently, adenoviral gene expression is diluted when the cells divide and typically is used only for transient gene expression.
  • adenoviral gene delivery has over many other viral vectors is that entry of the virus into the cell and the expression of transgenic proteins is not dependent on cellular replication. This benefit of adenoviral gene delivery is in contrast to retroviruses where the integration and sustained expression of virally introduced DNA is dependent on cellular replication.
  • pancreatic ⁇ -cells typically do not divide in culture and are thereby resistant to transformation by immortalizing gene constructs delivered by retroviruses.
  • human ⁇ -cells can be infected with adenovirus for the purposes of transgenic protein expression.
  • human ⁇ -cells or pancreatic islets would first be infected with a recombinant adenovirus that provides for the expression of a growth-promoting protein to stimulate cellular division.
  • Cellular replication could be monitored by measuring thymidine incorporation or other techniques that have been developed to monitor DNA replication.
  • dividing cells could be enriched by FACS.
  • FACS Fluorescence Activated Cell Sorting
  • Glucose responsiveness is an important parameter in the neuroendocrine cell lines of the present invention. Immortal RIN cells have been shown to lose glucose responsiveness over time. The glucose-responsiveness can be re-engineered into a stable cell that secretes insulin but in which the glucose-response has been lost, diminished or shifted.
  • U.S. Patent 5,427,940 discloses islet and non-islet cell lines of neuroendocrine origin which are engineered for insulin expression and glucose regulation.
  • insulin gene can be supplied to such an engineered cell and, although this will not be required in many aspects of the present invention, it is also contemplated.
  • AtT-20 cells which are derived from ACTH secreting cells of the anterior pituitary. It has been demonstrated that stable transfection of AtT-20 cells with a construct in which a viral promoter is used to direct expression of the human proinsulin cDNA results in cell lines that secrete the correctly processed and mature insulin polypeptide (Moore et al, 1983). Insulin secretion from such lines (generally termed AtT-20ins) can be stimulated by agents such as forskolin or dibutyryl cAMP, with the major secreted product in the form of mature insulin. These results suggest that these cells contain a regulated secretory pathway that is similar to that operative in the islet ⁇ -cell (Moore et al, 1983.
  • PC2 and PC3 the endopeptidases that process proinsulin to insulin in the islet ⁇ -cell, termed PC2 and PC3, are also expressed in AtT-20ins cells (Smeekens and Steiner, 1990, Hakes et al, 1991).
  • AtT-20ins cells do not respond to glucose as a secretagogue (Hughes et al. 1991 ).
  • AtT-20 cells express the glucokinase gene (Hughes et al, 1991. Liang et al, 1991) and at least in some lines, low levels of glucokinase activity (Hughes et al. 1991 : 1992; Quaade et al, 1991), but are completely lacking in GLUT-2 expression (Hughes et al. 1991 ; 1992).
  • Stable transfection of these cells with GLUT-2. but not the related transporter GLUT-1 confers glucose-stimulated insulin secretion (U.S. Patent 5,427.940; Hughes et al, 1992, 1993).
  • AtT-20ins cells The studies with AtT-20ins cells are important because they demonstrate that neuroendocrine cell lines that lack glucose-stimulated peptide release may be engineered for this function. Therefore, once a stable human neuroendocrine cell that has a regulated secretory pathway has been generated by the present invention, certain elements of the responsiveness can be reengineered into the stable cell. In contrast, the "regulated secretory pathway", including the secretory granules, endopeptidases and post-translational modification enzymes, cannot be reengineered into a cell lacking such a pathway.
  • U.S. Patent 5,427,940 incorporated herein by reference, describes methods for conferring glucose sensing in neuroendocrine cells and cell lines by transfection of such cells with one or more genes selected from the insulin gene, the glucokinase gene and the GLUT-2 glucose transporter gene, so as to provide an engineered cell having all three of these genes.
  • the glucokinase and GLUT-2 genes are thus preferred for use in re-engineering stable human cells.
  • U.S. Patent 5,427,940 discloses that three functional genes are required to give glucose- responsive insulin secreting capacity to a cell: an insulin gene, a GLUT-2 glucose transporter gene and a glucokinase gene. In the practice of the re-engineering aspects of the present invention, therefore, it may be that only one of these three genes needs to additionally supplied, expressed or overexpressed.
  • the stable human cell produces and expresses a reasonable level of insulin, but in a non-regulated manner, the provision of either or both of a functional glucokinase gene and a GLUT-2 gene will be desired.
  • One of ordinary skill in the art will be readily able to test the levels of glucokinase and GLUT-2 expression, either by molecular biological hybridization or biochemical activity assays, in order to determine which one or both of such enzymes is not sufficiently expressed or active and should therefore be supplied in recombinant form. If the stable cell does not express either of the aforementioned genes in a functional fashion, or at physiological levels, it will be preferred to introduce both genes.
  • the constructs of GenBank accession numbers J03145 and M25807, respectively may be used.
  • even the insulin gene could be re-engineered and overexpressed in a stable cell of the invention.
  • the stable cells of the invention may be modified to any degree such that they have a reduced a low K m hexokinase activity relative to the stable parent cell from which the re-engineered cell was prepared.
  • cells in which a moderate hexokinase inhibition is achieved will have utility.
  • Such inhibition levels are contemplated to be those in which the low K m hexokinase activity is reduced by at least about 5%, about 10%. about 15%, about 20%, or about 25% relative to control levels.
  • Re-engineered cells exhibiting more significant inhibition are also contemplated within the invention. Accordingly, cells in which the low K m hexokinase activity is reduced by about 30%, about 40%), about 50%>, about 60% or even about 70% or higher, with respect to control levels, are contemplated as part of this invention and will be preferred in certain embodiments.
  • GK:HK ratio glucokinase to hexokinase
  • cells of this invention will have a low K m hexokinase activity that has been reduced to a level appropriate to confer more physiological insulin secretion capacity to the cell.
  • GSIS glucose-stimulated insulin secretion
  • the GSIS of normal islet ⁇ -cells generally occurs at glucose concentrations of between about 3 mM to 20 mM, with ranges of 5 to 20 mM and 4 to 9 mM being frequently reported. Insulin responses in these ranges would therefore be described as "near-homeostatic insulin secretion.”
  • Cells that comprise an inhibitor in an amount effective to reduce the low K m hexokinase activity of the cell to a level sufficient to confer insulin secretion in response to an extracellular glucose concentration of between about 1 mM and about 20 mM will thus be most preferred.
  • Extracellular glucose concentrations of "between about 1 mM and about 20 mM " will be understood to include each and every numerical value within this range, such as being about 1, 2, 3, 4, 5, 7.5, 10, 12, 14, 16, 18, and about 20 mM or so.
  • any one of a variety of methods may be employed, including blocking of expression of the gene in the stable human cells and/or inhibiting or reducing the activity of any protein produced.
  • the hexokinase gene construct of GenBank accession number J04526 may be utilized.
  • constructs can be designed to introduce nucleic acids complementary to a target endogenous gene, i.e.. an antisense approach.
  • RNAs corresponding to these complementary nucleic acids will interfere with the transcription and/or translation of the target sequences.
  • Inhibitory constructs can still further be designed to homologously recombine into the hexokinase endogenous gene locus, rendering the endogenous gene nonfunctional, i.e., a knock-out approach.
  • Genetic constructs may also be designed to introduce nucleic acids encoding ribozymes, RNA-cleaving enzymes, that will specifically cleave the target hexokinase mRNA.
  • the hexokinase activity may be abrogated by constructs designed to randomly integrate throughout the genome, resulting in loss of expression of the endogenous hexokinase gene.
  • endogenous gene can be rendered dysfunctional by genomic site directed mutagenesis.
  • genomic site directed mutagenesis methods for blocking hexokinase production are well known to those of skill in the art.
  • the immortalized secretory cell lines described by the present invention have been shown to have a stable neuroendocrine phenotype. They are capable of providing a measurable secretion of the secretory product. Furthermore, they have been shown to be secretagogue responsive, thereby showing that these cell lines respond to modulators of secretory function. Therefore, within certain embodiments of the invention, methods are provided for screening for modulators of secretory function. Such methods may use the cells of the present invention either as adherent cells on a culture dish, as part of an alginate biomatrix, in suspension culture or in any other form that permits the secretion of the polypeptide to be monitored. These cells are then used as reagents to screen small molecule and peptide libraries to identify modulators of secretory function.
  • Secretory function embodies all aspects of the cell's capacity to sense the extracellular milieu, respond to that milieu via the activation and inhibition of a variety of intracellular signaling mechanisms, and accordingly regulate the secretion of a peptide or hormone from the secretory pathway.
  • intracellular signals may include, but are not limited to, calcium ions. cAMP, calmodulin. phosphorylation. dephosphorylation, membrane polarization, glucose. pH. ATP, ADP, fatty acid pools such as free fatty acids and triglycerides, nitrous oxide and other free radicals, action potentials, glycolytic flux, DNA fragmentation and other events associated with apoptosis, patterns of gene expression, NADPH, NADP, NADH, NAD and enzyme activities.
  • Regulation from the secretory pathway can occur at any phase in the synthesis and release of a peptide or hormone including gene transcription; stability of the mRNA; translation; post-translational modifications such as proteolytic processing, formation of disulfide bonds, amidation, and glycosylation; trafficking through the secretory tubules and vesicles; storage within the secretory granule; membrane fusions, and exocytosis.
  • the secretory function may be manifest as the secretion of a particular polypeptide from a secretory cell.
  • the polypeptide is generally secreted into the media of the cells, from where it can be quantified using any of a number of techniques.
  • the polypeptide may be detected directly from the media using for example, ELISA, RIA and the like.
  • the polypeptide may be purified prior to detection according to known methods, such as precipitation (e.g., ammonium sulfate), HPLC, immunoprecipitation. ion exchange chromatography, affinity chromatography
  • polypeptide separation including immunoaffinity chromatography or various size separations (sedimentation, gel electrophoresis, gel filtration).
  • size separations including immunoaffinity chromatography or various size separations (sedimentation, gel electrophoresis, gel filtration).
  • size separations including immunoaffinity chromatography or various size separations (sedimentation, gel electrophoresis, gel filtration).
  • the purified polypeptide may then quantified through immunodetection methods, biological activity, or radioisotope labeling. These techniques are described herein below.
  • the present invention provides methods of screening for stimulators of secretory function, by monitoring secretory function in the absence of the candidate substance and comparing such results to the assay performed in the presence of candidate secretory function stimulators.
  • the present invention concerns a method for identifying such stimulators. It is contemplated that this screening technique will prove useful in the general identification of a compound that will serve the purpose of promoting, augmenting or increasing the secretion of, for example, a polypeptide from a secretory cell as exemplified by the immortalized secretory cells of the present invention. Such compounds will be useful in the treatment of various secretory disorders resulting from impaired secretory function, such as for example, diabetes, Parkinson's disease, athyrotic cretinism and Adison's disease.
  • the present invention is directed to a method for determining the ability of a candidate substance to stimulate the secretory function of immortalized cells that either naturally secrete molecules or have been engineered to possess secretory function as described herein.
  • the method including generally the steps of:
  • step (c) measuring the secretory function of said cell; and (d) comparing the secretory function of the cell in step (c) with the secretory function of the cell of step (a).
  • secretory function may be determined by measuring the amount of secreted molecule.
  • the secreted molecule will be a polypeptide such as an amidated polypeptide, glycosylated polypeptide, a hormone or a growth factor.
  • these molecules may be detected using any of a number of techniques well known to those of skill in the art as described herein below.
  • Secretory function may also be monitored by measuring, for example, calcium ions, cAMP, calmodulin, phosphorylation, dephosphorylation, membrane polarization glucose, ATP, ADP, fatty acids and NADPH or membrane potential. Detection of these molecules can be performed using immunreactive detection, fluorescence luminescence, changes in action potential and the like.
  • the present invention is directed to a method for determining the ability of a candidate substance to have an inhibitory or even antagonistic effect on secretion from the immortalized cells described herein.
  • the method including generally the steps of:
  • step (d) comparing the secretory function of the cell in step (c) with the secretory function of the cell of step (a).
  • Candidate Substances To identify a candidate substance as being capable of inhibiting secretory function one would measure or determine such a secretory activity in the absence of the added candidate substance and monitoring the secretory function. One would then add the candidate inhibitory substance to the cell and determine the secretory function in the presence of the candidate inhibitory substance. A candidate substance which is inhibitory would decrease the secretion from said cell, relative to the amount of secretion in its absence.
  • candidate substance refers to any molecule that is capable of modulating secretory function.
  • the candidate substance may be a protein or fragment thereof, a small molecule inhibitor, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds for identification through application of the screening assay will be compounds that are structurally related to other known modulators of secretion.
  • the active compounds may include fragments or parts of naturally-occurring compounds or may be only found as active combinations of known compounds which are otherwise inactive. However, prior to testing of such compounds in humans or animal models, it will be necessary to test a variety of candidates to determine which have potential.
  • the active compounds may include fragments or parts of naturally- occurring compounds or may be found as active combinations of known compounds which are otherwise inactive. Accordingly, the present invention provides screening assays to identify agents which stimulate or inhibit cellular secretion, it is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known secretagogues or inhibitors of secretory function.
  • the candidate screening assays are simple to set up and perform. Thus, in assaying for a candidate substance, after obtaining an immortalized secretory cell of the present invention, one will admix a candidate substance with the cell, under conditions which would allow measurable secretion to occur. In this fashion, one can measure the ability of the candidate substance to stimulate the secretory function of the cell in the absence of the candidate substance. Likewise, in assays for inhibitors after obtaining an immortalized secretory cell, the candidate substance is admixed with the cell. In this fashion the ability of the candidate inhibitory substance to reduce, abolish, or otherwise diminish secretion from said cell may be detected.
  • Effective amounts in certain circumstances are those amounts effective to reproducibly stimulate secretion from the cell in comparison to their normal levels.
  • Purification techniques are well known to those of skill in the art, and will be used to purify the molecules secreted from the immortalized secretory cells of the present invention. These techniques tend to involve the separation the secreted protein or other secretory molecule from other components of the mixture. Having separated the secreted product from the other components, the sample may be purified using chromatographic and electrophoretic techniques to achieve complete purification. Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isolectric focusing. A particularly efficient method of purifying peptides is fast protein liquid chromatography or even HPLC.
  • the secreted molecule is a polypeptide and may be isolated from the conditioned media and analyzing the extracts by HPLC as described (Halban et al, 1986, Sizonenko and Halban, 1991). Solvent systems, gradients and flow rates used were as described by Halban et al, (1986) however it is well within the skill of the ordinary person ion the art to adapt the chromatography conditions to suit individual need. Standards may be used to obtain optimization of chromatography conditions and methods.
  • Certain aspects of the present invention concern the purification, and in particular embodiments, the substantial purification, of a secreted product.
  • the term "purified” as used herein is intended to refer to a composition, isolatable from other components, wherein the product is purified to any degree relative to its naturally-obtainable state, i.e., in this case, relative to its purity within a hepatocyte or ⁇ -cell extract.
  • a purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.
  • purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term “substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50% or more of the proteins in the composition.
  • Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the number of polypeptides within a fraction by SDS/PAGE analysis.
  • a preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number".
  • the actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity.
  • Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater -fold purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.
  • High Performance Liquid Chromatography is characterized by a very rapid separation with extraordinary resolution of peaks. This is achieved by the use of very fine particles and high pressure to maintain and adequate flow rate. Separation can be accomplished in a matter of minutes, or a most an hour. Moreover, only a very small volume of the sample is needed because the particles are so small and close-packed that the void volume is a very small fraction of the bed volume. Also, the concentration of the sample need not be very great because the bands are so narrow that there is very little dilution of the sample.
  • Gel chromatography or molecular sieve chromatography. is a special type of partition chromatography that is based on molecular size.
  • the theory behind gel chromatography is that the column, which is prepared with tiny particles of an inert substance that contain small pores, separates larger molecules from smaller molecules as they pass through or around the pores, depending on their size.
  • the sole factor determining rate of flow is the size.
  • molecules are eluted from the column in decreasing size, so long as the shape is relatively constant.
  • Gel chromatography is unsurpassed for separating molecules of different size because separation is independent of all other factors such as pH, ionic strength, temperature, etc. There also is virtually no adso ⁇ tion, less zone spreading and the elution volume is related in a simple matter to molecular weight.
  • Affinity Chromatography is a chromatographic procedure that relies on the specific affinity between a substance to be isolated and a molecule that it can specifically bind to. This is a receptor-ligand type interaction.
  • the column material is synthesized by covalently coupling one of the binding partners to an insoluble matrix. The column material is then able to specifically adsorb the substance from the solution. Elution occurs by changing the conditions to those in which binding will not occur (alter pH, ionic strength, temperature, etc.).
  • Lectins are a class of substances that bind to a variety of polysaccharides and glycoproteins. Lectins are usually coupled to agarose by cyanogen bromide. Conconavalin A coupled to Sepharose was the first material of this sort to be used and has been widely used in the isolation of polysaccharides and glycoproteins other lectins that have been include lentil lectin, wheat germ agglutinin which has been useful in the purification of N-acetyl glucosaminyl residues and He/z ' x pomatia lectin.
  • Lectins themselves are purified using affinity chromatography with carbohydrate ligands. Lactose has been used to purify lectins from castor bean and peanuts; maltose has been useful in extracting lectins from lentils and jack bean; N-acetyl-D galactosamine is used for purifying lectins from soybean; N- acetyl glucosaminyl binds to lectins from wheat germ; D-galactosamine has been used in obtaining lectins from clams and L-fucose will bind to lectins from lotus.
  • the matrix should be a substance that itself does not adsorb molecules to any significant extent and that has a broad range of chemical, physical and thermal stability.
  • the ligand should be coupled in such a way as to not affect its binding properties.
  • the ligand should also provide relatively tight binding. And it should be possible to elute the substance without destroying the sample or the ligand.
  • affinity chromatography One of the most common forms of affinity chromatography is immunoaffinity chromatography. The generation of antibodies that would be suitable for use in accord with the present invention is discussed below.
  • the present invention encompasses methods for determining the effects of active compounds on the secretory function of the immortalized secretory cells of the present invention. Generally, this will be achieved by determining the secretion of, for example a secretory polypeptide, of the immortalized secretory cell in the presence of the active compounds and comparing the level of secretion with those levels observed in normal cells of the same type. In this manner the secretory function of the immortalized secretory cells may be quantitated.
  • the immunodetection methods of the present invention have evident utility in the detecting polypeptide secretion.
  • a sample containing the secreted moiety is contacted with a corresponding antibody.
  • a modulator screening assay is performed in which cells secreting a polypeptide are exposed to a test or candidate substance under suitable conditions and for a time sufficient to permit the agent to effect secretion of the polypeptide.
  • the secretion of the polypeptide is then detected by incubating the reaction mixture with for example a specific antibody, which antibody may be labeled directly or may be detected secondarily, (e.g...
  • the test reaction is compared to a control reaction which lacks the test sample.
  • the presence and/or amount of complexes formed between the polypeptide and the antibody is detected in the test sample (e.g. by determining the presence or amount of label bound directly to the antibody or to a secondary antibody directed against the primary antibody).
  • agents that inhibit polypeptide secretion will demonstrate a reduced binding with polypeptide-specific antibodies relative to the control sample and agents that induce or stimulate polypeptide secretion will demonstrate an increased binding with specific antibodies relative to the control sample.
  • the present invention concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biological the secreted components.
  • the steps of various useful immunodetection methods have been described in the scientific literature and are well known to those of skill in the art.
  • the immunobinding methods include obtaining a sample suspected of containing a compound of interest (i.e. the secreted molecule), and contacting the sample with an antibody under conditions effective to allow the formation of immunocomplexes.
  • a compound of interest i.e. the secreted molecule
  • the immunobinding methods include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process.
  • a sample to be measured as containing a secreted molecule and contact the sample with an antibodx or encoded protein or peptide, as the case may be, and then detect or quantify the amount of immune complexes formed under the specific conditions.
  • the biological sample analyzed may be any sample that is suspected of containing a secreted molecule from the immortalized, secretory cells of the present invention.
  • a cell may be an immortalized neuroendocrine cell, an immortalized pancreatic ⁇ -cell, or even any biological fluid that comes into contact with the secretory cells in vivo.
  • the sample-antibody composition such as a tissue section, ELISA plate, dot blot or western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.
  • the secreted protein, peptide or corresponding antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined.
  • the first added component that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the encoded protein, peptide or corresponding antibody.
  • the second binding ligand may be linked to a detectable label.
  • the second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody.
  • the primary immune complexes are contacted with the labeled, secondary binding ligand. or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes.
  • the secondary immune complexes are then generally washed to remove any non- specifically bound labeled secondary antibodies or ligands. and the remaining label in the secondary immune complexes is then detected.
  • Further methods include the detection of primary immune complexes by a two step approach.
  • a second binding ligand such as an antibody, that has binding affinity for the encoded protein, peptide or corresponding antibody is used to form secondary immune complexes, as described above.
  • the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes).
  • the third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed.
  • This system may provide for signal amplification if desired.
  • secreted proteins or peptides of the invention will be detected in a preferred embodiment in ELISA assays.
  • Antibodies against such secreted proteins are readily available to those of skill in the art.
  • Immunoassays in their most simple and direct sense, are binding assays. Certain preferred immunoassays are the various types of enzyme linked immunosorbent assays (ELISA) and radioimmunoassays (RIA) known in the art.
  • ELISA enzyme linked immunosorbent assays
  • RIA radioimmunoassays
  • antibodies binding to the secreted proteins of the invention are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition containing the secreted polypeptide is added to the wells. After binding and washing to remove non-specifically bound immune complexes, the bound antibody may be detected. Detection is generally achieved by the addition of a second antibody specific for the target protein, that is linked to a detectable label. This type of ELISA is a simple "sandwich ELISA". Detection may also be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
  • the samples containing the secreted polypeptide are immobilized onto the well surface and then contacted with the antibodies of the invention. After binding and washing to remove non-specifically bound immune complexes, the bound antigen is detected. Where the initial antibodies are linked to a detectable label, the immune complexes may be detected directly. Again, the immune complexes may be detected using a second antibody that has binding affinity for the first antibody, with the second antibody being linked to a detectable label.
  • Another ELISA in which the proteins or peptides are immobilized involves the use of antibody competition in the detection.
  • labeled antibodies are added to the wells, allowed to bind to the secreted protein, and detected by means of their label.
  • the amount of marker antigen in an unknown sample is then determined by mixing the sample with the labeled antibodies before or during incubation with coated wells.
  • the presence of marker antigen in the sample acts to reduce the amount of antibody available for binding to the well and thus reduces the ultimate signal. This is appropriate for detecting antibodies in an unknown sample, where the unlabeled antibodies bind to the antigen-coated wells and also reduces the amount of antigen available to bind the labeled antibodies.
  • ELISAs have certain features in common, such as coating, incubating or binding, washing to remove non-specifically bound species, and detecting the bound immune complexes. These are described as follows:
  • a plate with either antigen or antibody In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA). casein and solutions of milk powder.
  • BSA bovine serum albumin
  • casein casein
  • the coating of nonspecific adso ⁇ tion sites on the immobilizing surface reduces the background caused by nonspecific binding of antisera to the surface.
  • a secondary or tertiary detection means rather than a direct procedure.
  • the immobilizing surface is contacted with the control and/or clinical or biological sample to be tested under conditions effective to allow immune complex (antigen/antibody) formation.
  • Detection of the immune complex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.
  • Under conditions effective to allow immune complex (antigen/antibody) formation means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/TweenTM. These added agents also tend to assist in the reduction of nonspecific background.
  • BSA bovine gamma globulin
  • PBS phosphate buffered saline
  • suitable conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about
  • the contacted surface is washed so as to remove non-complexed material.
  • a preferred washing procedure includes washing with a solution such as PBS/TweenTM. or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occurrence of even minute amounts of immune complexes may be determined.
  • the second or third antibody will have an associated label to allow detection.
  • this label will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate.
  • a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation (e.g., incubation for 2 hours at room temperature in a PBS -containing solution such as PBS-
  • the amount of label is quantified, e.g., by incubation with a chromogenic substrate such as urea and bromocresol pu ⁇ le or 2,2'-azido-di-(3-ethyl-benzthiazoline-6- sulfonic acid [ABTS] and H 2 O 2 , in the case of peroxidase as the enzyme label. Quantitation is then achieved by measuring the degree of color generation, e.g., using a visible spectra spectrophotometer.
  • a chromogenic substrate such as urea and bromocresol pu ⁇ le or 2,2'-azido-di-(3-ethyl-benzthiazoline-6- sulfonic acid [ABTS] and H 2 O 2 , in the case of peroxidase as the enzyme label.
  • Quantitation is then achieved by measuring the degree of color generation, e.g., using a visible spectra spectrophotometer.
  • the screening assay uses live cells in the 96-well format has long been the standard used as the format lends itself to automation and robotics handling.
  • the 96- well plate format allows for a variety of different candidate substances to be tested in one plate.
  • use of live cells for the pu ⁇ ose of drug screening has inherent problems associated with the handling of the cells. Handling attachment dependent cell culture in the 96-well format becomes difficult when there is a need for several exchanges of solution. The forces of surface tension associated with the meniscus on the well wall stress and even damages cells on the bottom of the well as aqueous solutions are removed or added.
  • the cells are encapsulated in highly porous, biocompatible hydrogels in a bead form.
  • the encapsulated cells are placed in a 96-well plates that inco ⁇ orates a filter-bottom.
  • the cells are then incubated with the candidate substance for a suitable period of time to allow the cell to secrete the polypeptide of interest. This incubation step is followed by the harvesting of the media from the cells by the application of a vacuum below the plate to empty all wells in one step.
  • the detection assays may be radioimmunoassays as described by various groups (Halban et al.. 1986; Pieber, el al, 1994). Standard commercially available radioimmunoassays are available from Coat-a-count. Diagnostic Products Co ⁇ ., Los Angeles for insulin, and rat amylin immunoassay (Peninsula Laboratories, EIAH-7323. Immunoreactive species of glucagon, glucagon-like peptide 1 (7-37.
  • glucagon-like peptide (7-36, amide) were determined as described by the suppliers of the respective commercial kits (all purchased from Peninsula Laboratories Inc. Cat #s RIK-7165, RIK-7123 and RIK-7168, respectively)
  • non-immunologic procedures in the measuring the secretory function according to the of the present invention.
  • non-immunologic procedures for example, when examining molecules that are involved in receptor interactions, it is possible to set up assays that look at the occupancy of relevant receptor molecules. This can be performed, for example, by using labeled ligand molecules that will be compete with the ligand (stimulators and inhibitor) in the sample. The more ligand in the sample, the less labeled receptor that will be bound to the receptor.
  • Labels include radiolabels, fluorescent labels and chemilluminescent labels.
  • diagnostic assays include those that look for the presence of biological activity of the secreted polypeptide.
  • the present invention also provides for the testing of candidate substances for their ability to modulate secretory function of cell in in vivo contexts.
  • This approach has the added advantage of assessing (i) the function of cells under normal, physiologic conditions including the presence of various intercellular signaling mechanisms and (ii) the ability of candidate substances to target cells local, regional or distal to their site of administration and (iii) localization and/or tissue distribution of a secreted metabolite or downstream effector metabolite.
  • Different formulations including time release compositions also may be assessed.
  • this format permits testing on the basis of physiologic states rather than the mere increase or decrease of secretory function. This provides additional information on the actual potential therapeutic benefit of the substance for the host, testing of therapeutic vs. toxic concentrations to establish therapeutic ranges and drug safety parameters, as well as allowing for in vivo interactions to be monitored.
  • the preferred embodiment for in vivo screening of candidate substances involves the use of a nude rodent model.
  • the nude mouse lacks immune functions that might compromise or interfere with testing of implanted cells of the present invention.
  • This system is well characterized and is used for a variety of other pu ⁇ oses including a model of transplanted human cancer.
  • Yet another preferred model is one in which the animal has diabetes (IDDM or NIDDM).
  • immortalized secretory cells of the present invention will be transferred, as part of an implantable device (described elsewhere in this document) into a suitable site of the host animal.
  • a suitable site of the host animal typically, subcutaneous implant on the flank, back or hindlimb of the animal, or intraperitoneal insertion, is preferred.
  • Particular issues that will affect the choice of implantation site include (i) similarity to the normal site the cells might be found or implanted clinically and (ii) the importance of establishing a supporting vasculature structure for the implant.
  • the initial step involves the determination of steady state levels of any metabolite that will be used as a read-out for effects on modulation of the implanted cells. This often will involve taking peripheral blood measurements of the metabolite of interest.
  • Such metabolites include, but are not limited to, glucose, insulin, glucagon. GLP-1, amylin, leptin, somatostatin, growth hormone.
  • functional attributes of the animal such as alteration in blood glucose in the case of insulin and loss of body fat in the case of leptin.
  • Other parameters that could be monitored include, in body weight, food intake, blood pressure, metabolic rate, body temperature, serum minerals, etc.
  • the metabolite will be tested from the appropriate tissue or fluid from the host animal. Fluids include blood, lymph, saliva, sputum, feces, urine, semen or tears. Tissues that may be sampled include liver, brain, muscle, pancreas, spleen, testis, ovarian, stomach, intestine, endocrine glands, adrenal glands and kidney. Depending on the metabolite, different methodology, also described above, will be used to separate and identify the presence, quantity and/distribution of the metabolite. In addition, histologic examination, involving microscopy, may be performed. Modulation of the metabolite or function, in the presence of the candidate substance, as compared with the levels determined prior to provision of the candidate substances, will indicate that the candidate substance is a modulator of that metabolite or function.
  • rescue of the implant may be performed for the pu ⁇ ose of determining the secretory status of the implant cells. Any change in the behavior or characteristics of the cells could impact the results.
  • Proper controls will include animals implanted with empty devices and animals implanted with devices populated with "placebo" (non-responsive, non-secretory) cells.
  • the cells of the present invention may be present propagated as non-anchorage dependent cells growing freely in suspension throughout the bulk of the culture; or as anchorage-dependent cells requiring attachment to a solid substrate for their propagation (i.e., a monolayer type of cell growth).
  • WO publication numbers WO 97/26334 (published July 24, 1997) and WO 97/26321 (published July 24, 1997) are specifically inco ⁇ orated herein by reference and describe the different modes of cell culture that can be employed to maintain the cells of the present invention.
  • the cells that will be used for the screening of modulators of secretory function may be in a microcarrier culture van Wezel (1967).
  • This mode of the culture propagation on the microcarriers makes it possible to use this system for cellular manipulations, such as cell transfer without the use of proteolytic enzymes, co-cultivation of cells, transplantation into animals, and perfusion of the culture using decanters, columns, fluidized beds, or hollow fibers for microcarrier retainment.
  • microencapsulation of cells because this system readily lends itself to batch screening methods such as 96-well plate screening and also provides a useful mode of providing the cells to an animal model for in vivo testing.
  • the cells are retained inside a semipermeable hydrogel membrane.
  • a porous membrane is formed around the cells permitting the exchange of nutrients, gases, and metabolic products with the bulk medium surrounding the capsule.
  • Several methods have been developed that are gentle, rapid and non-toxic and where the resulting membrane is sufficiently porous and strong to sustain the growing cell mass throughout the term of the culture. These methods are all based on soluble alginate gelled by droplet contact with a calcium-containing solution.
  • Lim (1982) describes cells concentrated in an approximately 1%) solution of sodium alginate which are forced through a small orifice, forming droplets, and breaking free into an approximately 1% calcium chloride solution. The droplets are then cast in a layer of polyamino acid that ionically bonds to the surface alginate. Finally the alginate is reliquified by treating the droplet in a chelating agent to remove the calcium ions. Other methods use cells in a calcium solution to be dropped into a alginate solution, thus creating a hollow alginate sphere. A similar approach involves cells in a chitosan solution dropped into alginate, also creating hollow spheres.
  • Microencapsulated cells are easily propagated in stirred tank reactors and, with beads sizes in the range of 150-1500 ⁇ m in diameter, are easily retained in a perfused reactor using a fine-meshed screen.
  • the ratio of capsule volume to total media volume can kept from as dense as 1 :2 to 1 : 10. With intracapsular cell densities of up to 10 , the effective cell density in the culture is 1-5 x 10 .
  • microencapsulation over other processes include the protection from the deleterious effects of shear stresses which occur from sparging and agitation, the ability to easily retain beads for the pu ⁇ ose of using perfused systems, scale up is relatively straightforward and the ability to use the beads for use in 96-well screening assays and in implantation.
  • the cells of the present invention may. irrespective of the culture method chosen, be used in protein production and as cells for in vitro cellular assays and screens as part of drug development protocols.
  • compositions of the stable cells in a form appropriate for the intended application, which will most usually be within a selectively permeable membrane. Nonetheless, the cells will generally be prepared as a composition that is essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
  • Aqueous compositions of the present invention comprise an effective amount of stable neuroendocrine cells dispersed in a pharmaceutically acceptable carrier or aqueous medium, and preferably encapsulated.
  • phrases "pharmaceutically or pharmacologically acceptable” refer to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and abso ⁇ tion delaying agents and the like. As used herein, this term is particularly intended to include biocompatible implantable devices and encapsulated cell populations. The use of such media and agents for pharmaceutically active substances is well know in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells of the present invention, its use in therapeutic compositions is contemplated.
  • Supplementary active ingredients also can be inco ⁇ orated into the compositions.
  • the cell preparations may further contain a preservative to prevent growth of microorganisms.
  • Intravenous vehicles include fluid and nutrient replenishers.
  • Preservatives include antimicrobial agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components in the pharmaceutical are adjusted according to well-known parameters.
  • the engineered cells of the present invention may be introduced into animals, including human subjects, so that modulators of secretion identified by the present invention can provide a controlled secretion of a desired polypeptide.
  • modulators of secretion identified by the present invention can provide a controlled secretion of a desired polypeptide.
  • cells are engineered to achieve glucose dose responsiveness resembling that of islets.
  • other cells will also achieve advantages in accordance with the invention. It should be pointed out that the studies of Madsen and coworkers have shown that implantation of poorly differentiated rat insulinoma cells into animals results in a return to a more differentiated state, marked by enhanced insulin secretion in response to metabolic fuels (Madsen et al, 1988). These studies suggest that exposure of engineered cell lines to the in vivo milieu may have some effects on their response(s) to secretagogues.
  • a preferred method of providing the cells to an animal involves the encapsulation of the engineered cells in a biocompatible coating.
  • the cells are entrapped in a capsular coating that protects the contents from immunological responses.
  • One preferred encapsulation technique involves encapsulation with alginate-polylysine-alginate. Capsules made employing this technique generally have a diameter of approximately 0.5 to 1 mm and should contain several hundred cells. Cells may thus be implanted using the alginate-polylysine encapsulation technique of O'Shea and Sun (1986). with modifications, as later described by Fritschy et al. ( 1991 ; both references inco ⁇ orated herein by reference).
  • the engineered cells are suspended in 1.3% sodium alginate and encapsulated by extrusion of drops of the cell/alginate suspension through a syringe into CaCl 2 . After several washing steps, the droplets are suspended in polylysine and rewashed. The alginate within the capsules is then reliquified by suspension in 1 mM EGTA and then rewashed with Krebs balanced salt buffer.
  • An alternative approach is to seed Amicon fibers with stable cells of the present invention.
  • the cells become enmeshed in the fibers, which are semipermeable, and are thus protected in a manner similar to the micro encapsulates (Altman et al, 1986; incorporated herein by reference).
  • the cells may be implanted intraperitoneally. usually by injection into the peritoneal cavity through a large gauge needle (23 gauge).
  • a tubular semi-permeable membrane was coiled inside a protective housing to provide a compartment for the islet cells.
  • Each end of the membrane was then connected to an arterial polytetrafluoroethylene (PTFE) graft that extended beyond the housing and joined the device to the vascular system as an arteriovenous shunt.
  • PTFE polytetrafluoroethylene
  • the implantation of such a device containing islet allografts into pancreatectomized dogs was reported to result in the control of fasting glucose levels in 6/10 animals. Grafts of this type encapsulating engineered cells could also be used in accordance with the present invention.
  • U.S. Patent 5,626,561 specifically inco ⁇ orated herein by reference, describes an implantable containment apparatus for a therapeutic device and method for loading and reloading the device.
  • the implantable containment apparatus is made of selectively permeable material and can be used to contain a therapeutic device, such as a drug delivery device, a cell encapsulation device, or a gene therapy device.
  • a therapeutic device can be easily placed and replaced in the apparatus without damaging tissues associated with the selectively permeable material of the apparatus.
  • U.S. Patent 4,402,694 also is inco ⁇ orated herein by reference and describes a body cavity access device containing a hormone source.
  • the device supplies a hormone to a patient.
  • the device is made of an implantable housing which is placed in the body and has an impermeable extraco ⁇ oreal segment and a semipermeable subcutaneous segment.
  • a hormone source such as live, hormone-producing cells, e.g., pancreatic islet cells or the engineered human cells of the present invention are then removably positioned in the housing to provide a hormone/ and or other peptide supply to the patient.
  • Such a device also can contain a sensor located within the subcutaneous segment and operably associated with a dispenser to release medication into the housing and to the patient.
  • Hydrophilic polymeric chambers for encapsulating biologically active tissue and methods for their preparation are described in U.S. Patent 4,298,002.
  • the tissue refers to those essential cellular components of a particular organ that is capable of receiving, modifying or secreting hormones.
  • a device comprising such chamber and such tissue is fabricated and implanted in a living body so that said tissue is permitted normal function without being rejected by the host's immunological system.
  • the viability of the tissue in the device is maintained by a correlation of factors including pore size and membrane thickness of the hydrophilic chamber.
  • the implanted device allows the inflow of essential nutrients and gases, and outflow of metabolites and products while simultaneously excluding the ingress of cellular components of the host's immunological system.
  • the device described therein can be used to implant the engineered cells of the present invention.
  • U.S. Patent 4,298,002 is inco ⁇ orated by reference herein.
  • U.S. Patent 5,01 1 ,472 describes devices and methods to provide hybrid, modular systems for the constitutive delivery of appropriate dosages of active factor to a subject and, in some instances, to specific anatomical regions of the subject.
  • This patent is inco ⁇ orated herein by reference in that it contains devices and methods that may be useful in conjunction with the present invention.
  • This system includes a cell reservoir containing living cells capable of secreting an active agent, which is preferably adapted for implantation within the body of the subject and further includes at least one semipermeable membrane, whereby the transplanted cells can be nourished by nutrients transported across the membrane while at the same time protected from immunological, bacterial, and viral assault.
  • the systems further include a pumping means, which can be implantable or extraco ⁇ oreal, for drawing a body fluid from the subject into the cell reservoir and for actively transporting the secreted biological factors from the cell reservoir to a selected region of the subject.
  • U.S. Patent 4,892,538 describes methods and compositions for the in vivo delivery of neurotransmitters by implanted, encapsulated cells and the technology described therein may be useful in combination with the present invention.
  • U.S. Patent 5,002,661 describes an artificial pancreatic perfusion device in which a hollow fiber having an inner diameter of about 5 mm is surrounded by islets of Langerhans enclosed in a housing. The islets are suspended in a semi-solid matrix which ensures desired distribution of the cells about the hollow fiber. The hollow fiber and suspended islets are enclosed in a housing which further aids the desired distribution of islets about the hollow fiber.
  • the hollow fiber has a porosity which selectively allows passage of substances having a molecular weight of less than about 100,000 Daltons.
  • the semi-solid matrix in which the islets are embedded and suspended is formed of an appropriate supporting material such as alginate or agar. This device may be used with the present invention in that the engineered cells of the present invention may substitute for the islet cells.
  • U.S. Patent 5,549,675 inco ⁇ orated herein by reference, describes additional methods for implanting tissue in a host.
  • the method comprises creating an implant assembly for holding cells including a wall for forming a porous boundary between the host tissue and the implanted cells in the device and implanting the device and then adding the cells.
  • the pore size of the boundary is such that it is sufficient to isolate the implanted cells from the immune response.
  • U.S. Patent 5,545,223 describes methods of making and using ported tissue implant systems and is therefore inco ⁇ orated herein by reference.
  • U.S. Patent 5,569, 462 In certain instances it may be necessary to enhance vascularization of implant devices, methods for achieving such an aim are disclosed in U.S. Patent 5,569, 462.
  • the methods involve placing a population of therapeutic substance-producing cells into the cell receiving chamber of an immunoisolation apparatus, implanting the apparatus into a patient, and administering an immunomodulatory agent to the patient.
  • the immunomodulatory agent increases the number of close vascular structures in the vicinity of the implanted device, which increases the long term survival of the cell population housed therein.
  • An alternate approach to encapsulation is to simply inject glucose-sensing cells into the scapular region or peritoneal cavity of diabetic mice or rats, where these cells are reported to form tumors (Sato et al. 1962). Implantation by this approach may circumvent problems with viability or function, at least for the short term, that may be encountered with the encapsulation strategy. This approach will allow testing of the function of the cells in experimental animals, which is a viable use of the present invention, but certainly is not applicable as an ultimate strategy for treating human diabetes. Nonetheless, as a pre-clinical test, this will be understood to have significant utility.
  • biohybrid artificial organs encompass all devices which substitute for an organ or tissue function and inco ⁇ orate both synthetic materials and living cells.
  • Implantable immunoisolation devices will preferably be used in forms in which the tissue is protected from immune rejection by enclosure within a semipermeable membrane.
  • Those of skill in the art will understand device design and performance, as it relates to maintenance of cell viability and function. Attention is to be focused on oxygen supply, tissue density and the development of materials that induce neovasclarization at the host tissue-membrane interface; and also on protection from immune rejection. Membrane properties may even be further adapted to prevent immune rejection, thus creating clinically useful implantable immunoisolation devices.
  • unit dose refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired response in association with its administration, i.e., the appropriate route and treatment regimen.
  • the quantity to be administered both according to number of treatments and unit dose, depends on the subject to be treated, the state of the subject, and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual.
  • ⁇ G 49/206 was chosen as representative of an engineered ⁇ -cell line that reproducibly responds to a variety of secretagogues. This line has been engineered to stably express functional glucose transporter (GLUT-2) and glucokinase proteins and biologically active human insulin (Clark et al, 1997).
  • HEPES Buffered Biological Salt Solution HEPES Buffered Biological Salt Solution (HBBSS; in mmol/1: 1 14 NaCl, 4.7 KCI, 1.21 KH,P0 . 1.16 MgSO 4 , 25.5 NaHCO 3 , 2.5 CaCb.
  • HBBSS 10 mM HEPES. 0.1% BSA
  • 0.5 ml of HBBSS supplemented with secretagogue(s) was added to each well and allowed to incubate for 2 hours at 37°C.
  • HBBSS was harvested from each well and assayed for insulin. Results are expressed in terms of fold stimulation over a basal sample containing HBBSS only.
  • the cell lines of the present invention show stable insulin secretion with time in continuous culture.
  • the cell lines chosen represent established lines that have undergone more than 100 population doublings (2-3 years) during which two or three genes were iteratively introduced, including time for clonal selection for each gene introduced.
  • the cells therefore already have shown long term stability during the engineering process.
  • Cells thawed from cryogenic storage for experimentation are kept in maintenance culture in parallel. From these cultures, cells are harvested and plated for two more repeat experiments two to three weeks apart. This will prove stability over the course of a couple of months, demonstrating a window of time in which it is possible to validate reproducible results.
  • Secretagogues have been selected to represent agents that signal via discrete pathways. i.e., glucose and amino acids via metabolic signals, IBMX and GLP-1 via cAMP, carbachol via muscarinic receptors, sulfonylureas via the K +" -ATP channels, and phorbol esters via protein kinase C. Cells are stimulated with the following:
  • the parental cell line had been stable for over two years, undergone more than 100 PDs. and subjected to two more engineering steps. Through all these manipulations, the cells have maintained a remarkably stable phenotype. In the last experiments the cells had undergone further 8 PDs (approx. 16 days) in continuous culture.
  • Glyburide in the absence or presence of glucose, elicit a 7-15 fold response, as the sulfonylurea inhibits the K + channel and causes depolarization of the cell membrane.
  • PMA acting directly on protein kinase C has an 8-10 fold effect on basal secretion in the absence of glucose and a strong 30-40 fold response in the presence of glucose.
  • a stimulatory cocktail that includes glucose, IBMX, amino acids, and carbachol, yields a 30-40 fold response.
  • EXAMPLE 2 Maintenance of Secretagogue Responsiveness Through Bulk Cell Production
  • engineered ⁇ -cell lines were bulk produced in a bioreactor, harvested and frozen to establish a homogeneous repository of cells. Cells undergoing this process should continue to secrete complex, fully biologically active polypeptides into the growth media with no significant differences in the response to glucose and other secretagogues pre-bulk, post-bulk and post-thaw .
  • ⁇ G 49/206 (described in example 1 ) was selected as a representative engineered ⁇ -cell line to undergo the complete process; bulk production, harvest, freeze and thaw. Representative samples from each step were analyzed for response to various secretagogues. Each of the procedures and the secretion profile are described in detail below.
  • ⁇ G cell lines were bulk produced in the CellCube TM system (Corning Costar) and frozen as described in example 30.
  • Frozen vials of ⁇ G 49/206 representing each stage of the bulk production process were thawed and allowed to recover prior to testing their insulin response to various secretagogues.
  • the cells were ready to plate for testing of cell response to various secretagogues 48- 72 hours after thawing. This assay was done to demonstrate that each of the processes described; bulk production, harvest, freeze and thaw, has no appreciable effect on the secretory response of ⁇ G 49/206 cells.
  • the secretory response of pre-bulk, post bulk and harvest, and freeze/thaw samples was studied using the secretagogues listed in the table below. Each of the listed secretagogues and their signaling pathway has been previously described. The data are as follows:
  • Stimulus PD18 Pre-Freeze PD29 PD29 lOO ⁇ M Carbachol + Glucose 23.22 17.59 18.57 lOnM GLP-1 2.12 2.24 1.82 lOnM GLP-1 + Glucose 22.55 21.37 16.78
  • alginate encapsulated cells Use of alginate encapsulated cells to enhance stability of the cells and their secretory response.
  • Cells in suspension in alginate were encapsulated in approx. 800 ⁇ m beads (approx. 4,000 cells/bead) by dripping and congealing the slurry into a Ca containing solution.
  • a suspension of alginate beads was aliquoted into polystyrene plastic 48-well or 96- well tissue culture plates yielding approx. 50 beads per well.
  • 49/206 cells were encapsulated in alginate using the following procedure. Trypsinized and PBS-washed cells are evenly suspended in a 1.5 - 2% final concentration of sodium alginate (50:50 mixture of LV low viscosity and HV high viscosity, Kelco, CA) in growth medium without serum. The suspension is loaded in a syringe and then dispensed through a 27 gauge needle at approx. 0.3 ml/min. The droplets leaving the tip of the needle are blown off by a continuous air stream. By adjusting the velocity of the air stream, beads averaging approx. 800 ⁇ m can be achieved reproducibly.
  • sodium alginate 50:50 mixture of LV low viscosity and HV high viscosity, Kelco, CA
  • the droplets are blown into a container holding a 1.35% (w/v) CaCl 2 /20 mM HEPES solution.
  • the beads are allowed to fully congeal for approx. 10 min in the CaCl 2 solution. Beads are washed twice in growth medium without serum and placed a T-flask with regular growth medium and incubated for about 72 hours with one feeding at 48 hours.
  • FIG. 5 demonstrate that it is possible to encapsulate engineered RIN cells and maintain comparable responses to secretagogues relative to non-encapsulated cells.
  • the fold responses are essentially equivalent to the data in FIG. 3 and FIG. 4 with regard to fold stimulation. It should be noted that the data falls within a narrower range as indicated by the smaller standard deviation values derived. This observation is indicative of better control of total remaining cell number at time of stimulation and of more stable conditions for all cells in the individual wells.
  • EXAMPLE 4 Maintenance of secretion performance in a 96- well format.
  • the screens must be adaptable to a microtiter plate screening format.
  • the read-out or signal from an assay must be compatible with data management software so information can be tracked and integrated.
  • total screen time should be minimized.
  • assays should be sensitive and precise.
  • BetaGene cell lines are sensitive and precise (Hohmeier et al.. 1997). It is important to determine if these properties can be maintained when the cells are cultured and assayed in microtiter plates. As shown in FIG. 6, the performance of ⁇ G 49/206 cells was compared in 48- well and 96-well formats. Cells were plated, cultured, and assayed in 48-well dishes (100,000/well) as described in the legend to FIG. 3. For 96-well assays, ⁇ G 49/206 cells
  • BetaGene Medium 2.5% fetal bovine serum: washed twice (20 min each, in 200 ⁇ l in HBBSS), and stimulated with glucose or glucose plus IBMX.
  • the pattern of secretory responsiveness is maintained when ⁇ G 49/206 cells were plated, cultured, and assayed in a 96-well format: the inclusion of diazoxide in the medium provides a slight clamp to basal secretion, glucose alone is potently stimulator ⁇ '. and the glucose response can be augmented by the inclusion of IBMX as a secretagogue.
  • Receptors of interest include the following: alpha-2 adrenergic receptor (ATTC number 59303, HPalpha2GEN Genbank accession numbers Ml 8415, M23533, inco ⁇ orated herein by reference), glucagon-like peptide I receptor (Genbank accession numbers: L23503, U10037, U01156, U01104: each inco ⁇ orated herein by reference), somatostatin receptor V (mouse Genbank accession number AF004740; human Genbank accession numbers: L 14865, L14856, M81830, M96738, M81829, L07833 each inco ⁇ orated herein by reference).
  • receptors to be used include the SUR channel (Genbank accession numbers L78207, U63455, L78243, inco ⁇ orated herein by reference), KIR channel (Genbank accession number D50582. inco ⁇ orated herein by reference), pancreatic polypeptide receptor (Genbank accession numbers: Z66526, U42387, U42389 each inco ⁇ orated herein by reference), muscarinic receptors (Genbank accession numbers: X52068, XI 5264, XI 5265, XI 5266, AF026263 each inco ⁇ orated herein by reference); glucocorticoid receptor (Genbank accession numbers: M l 0901, Ml 1050 each inco ⁇ orated herein by reference), human (glucose- dependent insulinotropic peptide) GIP receptor (Genbank accession number X81832, inco ⁇ orated herein by reference) human PACAP/VIP receptor (Genbank accession numbers L36566, D17516, U 18810,
  • DNAs encoding the receptors were ligated into plasmids suitable for the stable transfection of mammalian cells.
  • Such plasmids contain genes that confer resistance to antibiotics and cloning sites for transgene insertion and expression.
  • Resistance to hygromycin hygromycin phosphotransferase
  • pCB7 resistance to zeomycin is encoded in CW102 (pZeocmv).
  • CW102 was created by replacing the SV40 promoter in pZeoSV with the CMV promoter.
  • pZeoSV was digested with Bam HI and the ends were blunted-ended by a fill-in reaction with
  • the CMV promoter was excised from pAC/CMV by digestion with Not I and prepared for blunt-end ligations by treatment with Klenow. There are two copies of the CMV promoter in CW102: one driving the expresssion of the zeomycin resistance gene and the other for transcribing transgenes of interest.
  • RIN 1046-38 cells and derived cell lines were grown BetaGene Medium containing 7.8 mM glucose and supplemented with 3.5% fetal bovine serum (JRH Biosciences, Lenexa. KS), 100 milliunits/ml penicillin and 100 ⁇ g/ml streptomycin. Cells were passaged weekK using
  • trypsin-EDTA solution 0.05%) trypsin-EDTA solution and cultured in an atmosphere of 95%> air and 5% CO2 at 37°C.
  • RIN cell lines were grown to 50 to 75% confluence, harvested by trypsinization, washed once with phosphate-buffered saline (PBS), and resuspended in PBS for counting.
  • PBS phosphate-buffered saline
  • 1 x 10 7 cells were pelleted by centrifugation at 1000 ⁇ m for 2 minutes and resuspended in 0.4 ml electroporation buffer (137 mM NaCl. 6 mM glucose, 5 mM KCI, 0.7 mM Na ⁇ HPO , 20 mM Hepes, pH 7.0 ; or in BetaGene medium without serum). DNA was added to the cell suspension to achieve a final concentration of 30- 50 ⁇ g/ml.
  • DNA was electroporated into the cells in a 2 mm cuvette at 170 volts, 510 ⁇ F and 129 ohms using an Electro Cell Manipulator 600 (BTX, Inc.). Stably transfected cells were selected by culturing in the appropriate drug for about 2 weeks.
  • the drug concentrations used were- 500 ⁇ g/ml active fraction G418 (Geneticin, Gibco Life Sciences); 300 ⁇ g/ml for hygromycin (Boehringer Mannheim); 400 ⁇ g/ml for zeomicin (InVitroGen).
  • the gene encoding the human alpha-2A receptor ( ⁇ 2AR) inserted into a plasmid backbone was purchased from the American Type Culture Collection. Following replication and preparation of this plasmid at BetaGene, the DNA was designated BX700. BX700 plasmid DNA was digested with restriction endonucleases Kpn I, Nhe I, and Hind III to release the ⁇ 2AR genomic fragment.
  • This fragment was ligated into pBluescript II SK plasmid that had been digested with Spe I, treated with the large fragment (Klenow) of DNA polymerase I to fill-in the overhangs created by Spe I digestion, and dephosphorylated with calf intestinal alkaline phosphatase (CIAP).
  • the plasmid resulting from this ligation, CE406, was digested with Kpn I and Xba I, and the ⁇ 2AR DNA was ligated in to pCB7 to create CE616 plasmid DNA.
  • GLP-1 human glucagon-like peptide I receptor mRNA
  • RT-PCR polymerase chain reaction
  • RNA was isolated from tissues using RNAzol B RNA isolation reagent (Cinna/Biotex Laboratories International). RT-PCR was performed using the Titan One Tube RT-PCR System (Beohringer Mannheim). For the amplification of a portion of the rat GLP-1 receptor mRNA, 100 ng of B17/I total RNA was transcribed at 55° C using AMV reverse transcriptase and amplified with a blend of Taq DNA polymerase and Pwo DNA polymerase.
  • the full-length human GLP-1 mRNA was amplified from RNA isolated from a human small cell lung line (ATCC: HTB-184, NCI: H510A) using oligonucleotides IDK3 (5'TGGTGGAATTCCTGAACTCCCCC3 " SEQ ID NO:3) and IDK6 (5OATTGGCCACCCGGCCTGCA3' SEQ ID NO:4).
  • IDK3 5'TGGTGGAATTCCTGAACTCCCCC3 " SEQ ID NO:3
  • IDK6 5OATTGGCCACCCGGCCTGCA3' SEQ ID NO:4
  • the human PCR product was subcloned into pBluescript KS that had been digested with EcoR V and the resulting plasmid was designated CX800.
  • the GLP-1 receptor fragment was isolated from CX800 following digestion with EcoR I and Hind III, and ligated with CW102 that had been digested with EcoR I and H/ / M.
  • the human pancreatic polypeptide receptor (PPR) mRNA was amplified from RNAs isolated from human lung cell lines (ATCC number: CRL-5816; NCI- ⁇ 810) using the Titan
  • RNA was transcribed at 55° C; 35 rounds of amplification were performed with 94°C denaturation (30 sees), 57°C annealing (30 sees), and 68° C extension (2 min).
  • PCR products were subcloned into pBluescript SK that had been digested with Hind III and filled in with Klenow to create plasmid DG105.
  • the PPR fragment form DG 105 was ligated into CW102 as a EcoR II Kpn I fragment.
  • the mouse somatostatin receptor, type V gene ligated into pBluescript was received from the Dr. F. Charles Brunicardi, Baylor Medical Center, Houston, Texas. Following replication of the plasmid at BGene the DNA was designated CW000. CW000 was digested with PpuM I and treated with Klenow. The SSTRV DNA was ligated in CW102 that had been digested with Bam H I and treated with Klenow and CIAP. and the resulting plasmid was designated CX503.
  • Transgenic overexpression of the ⁇ 2AR improves the response of RIN cells to Clonidine, an analogue of epinephrine.
  • Epinephrine participates in regulating circulating glucose levels by stimulating glucose production from the liver and inhibiting insulin secretion from the pancreatic ⁇ -cell.
  • ⁇ G18/3El cells are relatively refractory to epinephrine and Clonidine, an analogue of epinephrine.
  • Clonidine an analogue of epinephrine.
  • human pancreatic islets are about 10-fold more sensitive to this compound than ⁇ G18/3El cells. It was reasoned that the sensitivity of ⁇ G18/3El cells to Clonidine could be increased by the transgenic overexpression of the ⁇ 2AR.
  • ⁇ G18/3El cells were electroporated (EP265) with plasmid CE616. Following selection with hygromycin and growth, single colonies were assayed by immunocytochemisty for the expression of the transgenic ⁇ 2AR.
  • ⁇ G18/3El cells and single clones derived from EP265 were plated on Falcon 8-chamber culture slides and maintained for 2 days in BetaGene Medium. Following fixation, cells were incubated with ⁇ 2AR antibody (diluted 1 :200; Dr. John Regan. University of Arizona, Arlington). Following incubation with a secondary antibody (antichicken IgG .alkaline phosphatase) immune complexes were detected colormetrically. The specificity of the ⁇ 2AR antibody was confirmed by competition assays with a ⁇ 2AR-glutathione-S transferase fusion protein. Eight individual clones were analyzed for sensitivity to Clonidine in insulin-secretion assays.
  • the capacity of the cell lines to secrete mature insulin during stimulation of the regulated secretory pathway was determined by incubating for 1 hour in a mixture of secretagogues.
  • the mixture consisted of RPMI medium (JRH BioSciences) with 5 mM glucose, supplemented with 0.1% BSA, 100 ⁇ M carbachol, and 100 ⁇ M of isobutylmethylxanthine (IBMX).
  • IBMX isobutylmethylxanthine
  • ⁇ G265/2 cell lines were encapsulated in alginate and injected into the intraperitoneal cavity of Zucker diabetic rats to test if an enhanced sensitivity to Clonidine would extend to in vivo conditions. Beads were maintained in vivo for 3 - 5 days, or until blood glucose normalized. Animals were injected with Clonidine, an agonist of the ⁇ 2AR (50 ⁇ g/kg) or
  • Yohimbine an antagonist of the ⁇ 2AR (75 ⁇ g/kg). Blood glucose, rat C-peptide II, and human insulin levels were monitored at 20 minute intervals post-injection. As shown in FIG. 9, Clonidine injection resulted in a 50% reduction of human insulin in plasma; whereas,
  • NIDDM The progression of NIDDM is characterized by metabolic failure of the pancreatic ⁇ - cell and the subsequent extinction of glucose-stimulated insulin secretion. There is currently no optimal in vitro system that models the progressive ⁇ -cell dysfunction that occurs in vivo in
  • FIG. 10A graphically represents insulin secretion from engineered cell lines that have been maintained in culture for one week with ⁇ Gene medium, supplemented or non- supplemented with 3% fetal bovine serum (FBS).
  • FBS fetal bovine serum
  • withdrawal of serum for one week results in the complete ablation of stimulated insulin secretion; however, basal secretion is relatively unchanged relative to controls cells that have been maintained in FBS- supplemented growth medium.
  • the lack of FBS in BetaGene medium has very mild effects on growth, resulting in only a 10 - 20% reduction in total cell number relative to controls following 9 days of culture (FIG. 10B).
  • FIG. 10A and FIG. 10B The loss of stimulated insulin secretion from engineered ⁇ -cell lines that occurs in the absence of FBS in the culture medium (FIG. 10A and FIG. 10B) provides an in vitro system for modeling the loss of insulin secretion that occurs in NIDDM. All the aspects of engineered ⁇ - cells that make them suitable for the identification of insulin-modulating compounds also create an ideal reagent for modeling ⁇ -cell dysfunction. The effects of FBS-deprivation shown in
  • FIG. 10 are relatively rapid, reproducible, and amenable to high-throughput screening.
  • Experiments could be designed to identify serum factors that are involved in the maintenance of stimulated secretion, identify candidate genes and proteins whose expression patterns are modulated by FBS-deprivation, or screen for compounds that maintain stimulated insulin secretion despite the absence of FBS in the culture medium. Information from any ol " these screens could be informative as to biology of ⁇ -cell dysfunction in NIDDM and provide new insights into the design of therapeutic compounds.
  • Somatostatin (SS-28) is a peptide hormone
  • BetaGene, Inc. has introduced transgenes to achieve physiologically relevant glucose-sensing in beta-cell lines. More recently as described in the present invention, the introduction of transgenic receptors also has been contemplated so that implanted cell lines can sense and respond to a variety of post-prandial and/or hypoglycemic signals.
  • cDNAs encoding the following cell-surface proteins: subunits of the K ATP channel, SUR and Kir, alpha-2 adrenergic receptor, pancreatic polypeptide receptor, glucagon like peptide receptor, glucocorticoid receptor, and somatostatin receptor.
  • the mouse somatostatin receptor, type V gene (SSTRV, Genbank accession number AF004740) ligated into pBluescript and a rabbit polyclonal antibody that recognizes the receptor (Ab9462) were received from the Dr. F. Charles Brunicardi, Baylor Medical Center, Houston, Texas. Following replication of the plasmid at BetaGene the DNA was designated CW000. CW000 was digested with PpmM I and treated with Klenow. The SSTRV DNA was ligated in CW102 that had been digested with Bam HI, filled in with Klenow, and treated with CIAP, and the resulting plasmid was designated CX503.
  • ⁇ G 40/110 cells (clonal derivatives of RIN 1046-38 overexpressing human insulin and glucokinase) were transfected (EP 603) with plasmid CX503. Following selection in Zeomycin, 13 colonies were selected for further analysis and growth. Portions of the clones were plated onto cover slides and assayed by immunocytochemistry for the expression of SSTRV. The primary antibody Ab9462 was diluted 1/1000 and immune complexes were colorimetrically detected following incubation with a secondary antibody, goat anti-rabbit linked alkaline phosphatase. Of the 13 clones, one was a high expressor of SSTRV ( ⁇ G 603/1 1 ), and two expressed low levels of the receptor ( ⁇ G 603/8 and 10). In the other clones (including ⁇ G 603/7) levels of SSTRV were below detection limits of the assay and indistinguishable from the unengineered clones.
  • Two clones (a high expressor, ⁇ G603/l 1 and a non-expressor, ⁇ G 603/7) were tested at basal and stimulatory conditions with various concentrations of SS-28 added to media under 2 hr. stimulation conditions.
  • glucose-stimulated (10 mM glucose) insulin secretion from ⁇ G 603/1 1 cells were potently inhibited by 50 pM SS-28; whereas, ⁇ G 603/7 cells were resistant to all concentrations of SS-28.
  • the effects of SS-28 were such that stimulated secretion from ⁇ G 630/1 1 could be reduced to levels below those observed for basal.
  • SS-28 was tested as an inhibitor of various secretagogues of insulin secretion. As shown in FIG. 1 IB, at 5 nM SS-28 effectively inhibits stimulated insulin secretion in the presence of BetaGene Medium with no glucose and under conditions of maximum stimulation, Stimulatory Cocktail (BetaGene Media supplemented with 10 mM glucose. 10 mM each of glutamine, leucine, and arginine, 100 ⁇ M carbachol, and 100 ⁇ M IBMX,).
  • BetaGene plasmid AA603 simian virus promoter 40 (SV40) driving expression of neomycin phosphotransferase and cytomegalovirus (CMV) promoter driving expression of human insulin
  • SV40 simian virus promoter 40
  • CMV cytomegalovirus
  • Three clones expressing relatively high levels of insulin were selected for further study: ⁇ G 498/20, ⁇ G 498/44, and ⁇ G 498/45: secreting about 100, 20, and 50 ng/ million cells/ 24 hrs, respectively.
  • the cellular contents and culture medium of ⁇ G 498/20 were extracted with acetic acid and fractionated by high-performance liquid chromatography.
  • Immunoreactive insulin species were quantified by radioimmunoassay using human insulin standards. Proinsulin was effectively processed to mature insulin, with mature insulin representing the majority of the total insulin both in whole cell and media extracts (FIG. 12A and FIG. 12B). The chromatography in FIG. 12A was derived the cellular contents of ⁇ G
  • FIG. 12B is derived from insulin secreted into the media. These data verify that the proconvertases are active and function efficiently to process insulin in the clonal cell lines. The stability of insulin output for ⁇ G 498/45 has been maintained for > 50 population doublings.
  • Regulated secretory pathway in ⁇ G H03 cells ⁇ G 498/20, ⁇ G 498/44, and ⁇ G 498/45 were also studied for the capacity to secrete insulin from the regulated pathway and respond to modulators of secretion.
  • Cells were plated in 12-well tissue culture dishes (250,000 cells/well), maintained for 72 hrs in BetaGene Medium, and washed twice, 20 min each, in HEPES/bicarbonate-buffered salt solution
  • HBSS HBSS
  • HBBSS HBBSS containing 0.1% BSA
  • 10 mM IBMX 100 ⁇ M carbachol, or 10 nM of the phorbol ester, PMA; all in the presence of absence of 10 mM glucose.
  • ⁇ G 498/20 respond robustly to carbachol and PMA (about 10 - 15 fold over basal), however, the cells were unresponsive to glucose and IBMX.
  • ⁇ G 498/44 and ⁇ G 498/45 were nearly identical in their secretion profiles as compared to ⁇ G 498/20. These data are consistent with the presence of a regulated secretory pathway; and it appears that protein kinase C-mediated events dominate in the regulation of secretion.
  • these lung neuroendocrine cell lines do not mimic the response of pancreatic ⁇ -cells or ⁇ -cell lines to glucose alone or the glucose-potentiator, IBMX.
  • ⁇ G 498/45 was further engineered for increased levels of insulin expression by the introduction of number of plasmids, all of which encoded human insulin but varied in the genes encoding antibiotic resistance.
  • the 793, 794, and 796 cell lines are resistant to mycophenolic acid, puromycin. and hygromycin, respectively.
  • the data in FIG. 13B show the presence of a regulated secretory pathway in the progenitor cell line (498/45) and the maintenance of this capacity through a second round of engineering (793, 794, and 796 cell lines). Insulin content and secretion were increased by about 3- to 4-fold in second generation clonal cell lines.
  • the insulin secreted from two of these high-producing clones (793/28 and 793/15) was fractionated by high-performance liquid chromatography, and immunoreactive insulin species were quantified by radioimmunoassay using human insulin standards.
  • Proinsulin was effectively processed to mature insulin, with mature insulin representing the majority of the total insulin in media extracts.
  • BetaGene media Cells were mixed and evenly suspended in a 2% final concentration of sodium alginate (50:50 mixture of LV low viscosity and HV high viscosity, Kelco. CA) in HEPES buffered BetaGene Medium. Cells were transferred to a syringe and the suspension was dispensed through a 25 gauge needle at approx. 0.3 ml/min. Droplets were blown into a container holding a 1.35% (w/v) CaCl 2 /20 mM HEPES solution. The beads were allowed to fully congeal for approx. 10 min in the CaCl 2 solution. Beads were washed twice in growth medium without serum and placed a T-flask with regular growth medium and incubated for about 72 hours with one feeding at 48 hours.
  • NIH nude rats (Strain F344/Ncr-rnu form the National Cancer Institute, Frederick, MC) were housed in a sterile isolation facility with free access to sterile standard laboratory diets and water. Immune-competent Wistar and Zucker rats were housed in standard facilities and had free access to standard laboratory diets and water.
  • IDM insulin-dependent diabetes mellitus
  • pancreatic beta cells were selectively destroyed in nude and Wistar rats by intracardiac administration of streptozotocin (STZ (70 mg/kg body weight). Blood glucose was monitored to confirm inducement of diabetes; all animals that received cellular transplants had blood glucose levels of greater than 375 mg/dl within 2 days of STZ treatment.
  • FIG. 14A, FIG. 14B, and FIG. 14C demonstrate that ⁇ G 498/20 cells can reverse hyperglycemia in nude and immunocompetent hosts, and insulin delivery in vivo by this cell line is an effective treatment for both IDDM and NIDDM.
  • FIG. 14A cells were implanted into STZ-treated, diabetic nude NIH rats (25 million/ 100 grams body weight).
  • the blood glucose values of the control group show that the unengineered parental line ( ⁇ G H03) does not impact blood glucose.
  • ⁇ G 498/20 cells were implanted into STZ-treated, diabetic male Wistar rats (FIG. 14B).
  • Serum analysis of human insulin and C-peptide and rat C-peptide are consistent with the effects on hyperglycemia resulting from secretions from ⁇ G 498/20.
  • rat C-peptide was reduced to about 4% of normal pre-implant, and on day 7, post-implant, was less than 10% of normal C-peptide levels.
  • secretion by ⁇ G 498/20 of human insulin and detection of human C-peptide in the serum correlated well with cell number (FIG. 15) and the effects observed on blood glucose (FIG. 14B).
  • NIDDM Zucker diabetic fatty (ZDF) rats.
  • EXAMPLE 13 Improved Glucose Tolerance by Treatment with Cells Derived from ⁇ G H03
  • Glucose tolerance testing was performed on the STZ-treated Wistar rats on day 19 post- transplantation. As shown in FIG. 16A, only the higher dose of cells is functioning to correct hyperglycemia at this time point. Likewise, with 25 million ⁇ G 498/20 cells per 100 gm body weight, there is a clamping of hyperglycemic excursion following a glucose bolus. The rats that received a low dose of ⁇ G 498/20 and ⁇ G H03 were glucose intolerant. As shown in FIG. 16B, treatment of ZDF rats with ⁇ G 498/20 cells results in a similar pattern: low cell doses that fail to correct hyperglycemia do not correct glucose intolerance; however cell doses sufficient to reduce blood glucose also improve glucose tolerance. The glucose tolerance test in ZDF rats was performed on day 13 post-transplantation. EXAMPLE 14 Reduction of Glycated Hemoglobin using ⁇ G H03 cells.
  • glycated hemoglobin A marker that predicts susceptibility to the long-term complications associated with diabetes is glycated hemoglobin (GHb). Sustained, poor glycemic control correlates with an excessive glycation of hemoglobin and the subsequent development of retinopathy, neuropathy, and nephropathy. Consequently, an important criterion for the effectiveness of any given therapy for diabetes is a reduction in percent of hemoglobin that is glycated. Blood samples were taken from rats and glycated hemoglobin in the blood was determined with Helena Glyco- Tek affinity columns (cat number 5351, Helena Laboratories) as recommended by the manufacturer. As shown, in FIG.
  • ⁇ G 498/20 cells were as effective and durable in immune-competent rats as they were in nude rats (FIG. 14A versus FIG. 14B and FIG. 14C). Though alginate provides time-limited and partial protection from the immunotoxicity of the host, it was expected that graft survival in the Wistar and Zucker rat strains would be much reduced from that observed in the nude rat. The prolonged survival of encapsulated ⁇ G 498/20 in two immune-competent hosts suggests that this cell line may be intrinsically resistant to the effects of immune-mediated killing and cytotoxicity. and/or somewhat invisible to immune surveillance. In an initial set of experiments to test this possibility, ⁇ G 498/20 and ⁇ G H03 cells were exposed to a number of human cytokines that are known to participate in immune-mediated cytotoxicity (FIG. 18A).
  • ⁇ G H03 and its clonal derivative ⁇ G 498/20 were resistant to various concentrations of Interleukin -lbeta (IL-l ⁇ ), interferon gamma (IFN ⁇ ). tumor necrosis factor-alpha (TNF ⁇ ), and the combined actions of all three of these cytokines.
  • IL-l ⁇ Interleukin -lbeta
  • IFN ⁇ interferon gamma
  • TNF ⁇ tumor necrosis factor-alpha
  • HEPES/bicarbonate-buffered salt solution HEPES/bicarbonate-buffered salt solution
  • HBBSS HEPES/bicarbonate-buffered salt solution
  • Insulin secretion was stimulated by incubating the cells in HBBSS containing 0.1 %> BSA and supplemented with 10 mM glucose, or 10 mM glucose plus either 100 ⁇ M carbachol or 10 nM PMA.
  • INS-1 and RIN beta-cell lines are susceptible to cell-killing by IFN ⁇ and that IL-1 ⁇ is cytotoxic to INS-1 cells (Hohmeier et al, 1 98).
  • IL-1 ⁇ is cytotoxic to INS-1 cells.
  • protection from IL-l ⁇ in these studies was induced by the overexpression of manganese superoxide dismutase in the INS-1 cells, a cell line that is inherently cytokine- resistant may be a preferred starting material for cell-based delivery of therapeutic products in immune-competent hosts.
  • EXAMPLE 16 High levels of transgene expression in ⁇ G H03 and ⁇ G H04 cells
  • ⁇ G H03 cells have been engineered to express glucagon like peptide 1 (GLP-1) and human growth hormone (hGH).
  • GLP-1 glucagon like peptide 1
  • hGH human growth hormone
  • the human neuroendocrine cell line ⁇ G HO4 was stably transfected with BetaGene plasmid AA603 (SV40 driving the expression of neomycin phosphotransferase and CMV driving expression of human insulin) resulting in monoclonal cell lines ⁇ G 707/55, 707/63, 707/76, 707/94 and 707/96.
  • the clonal cell lines were studied for their ability to secrete insulin in response to various modulators of secretion, as previously described. In each of the 5 clonal cell lines insulin secretion did not change with respect to basal in response to stimulation by 10 mM IBMX, 100 mM carbachol, or 10 nM PMA; and 10 mM glucose.
  • FIG. 19 illustrates the secretion response of ⁇ G 707/55, 63, 76, 94, 96 clones and the a clonal derivative of ⁇ G HO3 ( ⁇ G 498/45) to the secretagogue cocktail described above.
  • ⁇ G 498/45 cellos secrete in excess of 500 ng/flask/hour of insulin.
  • ⁇ G 707 clonal lines secrete a negligible amount of insulin under these conditions.
  • Cell content of ⁇ G 707/55 was analyzed by HPLC for insulin. A small proinsulin peak was detected, however no mature insulin was detected within these cells.
  • BetaGene plasmid CD303 (CMV driving expression of human growth hormone, SV40 driving neomycin resistance) was used to establish cell lines resistant to G418.
  • the monoclonal cell line ⁇ G 785/5 was analyzed for cell content versus secreted human growth hormone on a Western blot. The results indicated a small fraction of human growth hormone stored within the cells and a large fraction of this peptide in the medium.
  • ⁇ G HO4 cell line despite the presence of multiple proteins associated with a neuroendocrine phenotype is not a preferred candidate for secretion of transgenic peptides from the regulated secretory .
  • These cells use a constitutive mode of secretion, rather than a regulated secretory pathway, perhaps due to an inability to depolarize the cell membrane or an absence of dense core granules for peptide storage.
  • Several factors controlling peptide trafficking also may be missing in these cells, further complicating regulated peptide release.
  • the ⁇ G HO4 cells do not process insulin to its mature form.
  • fusion proteins containing a furin site between a given prohormone sequence and the sequence encoding the mature peptide hormone may provide the capacity for processing of the transgenic fusion protein through the constitutive pathway that apparently dominates secretion from these cells.
  • the overexpression of PCI and/or PC2 proteins involved in granule formation such as chromagranin A and chromagranin B, or proteins required for trafficking through the regulated secretory pathway such as carboxypeptidase E may be required for restoration of a functional regulated secretory pathway in the ⁇ G H04 cell line.
  • Carboxypeptidase E is a particularly attractive candidate, as carboxypeptidase E is not expressed in ⁇ G H04 cells.
  • a preferred embodiment in the in vivo delivery of peptides via transplantation of engineered cell lines is the installation of a mechanism that allows for the transplanted cells to be "turned-off in both secretory function and growth potential.
  • Scenarios where this "off switch" may need to be employed include a malfunction in the graft, an alteration in the physiology of the host creating an incapability with the graft, or a breach in the encapsulation device rendering it permeable to cells.
  • an "off switch" for the transplanted cells will be non-invasive to the host; easy to administer; have short-term, immediate effects; and be selective for the grafted cells and non-toxic to the host.
  • a negative selection system that can fulfill these criteria is the installation of a negative selection system into the transplanted cells.
  • the cells would be engineered to express a protein that converts a non-toxic substance to a cytotoxic one, through catalysis, transport, or binding.
  • negative selection systems include he ⁇ es simples virus thymidine kinase in combination with gancyclovir; cytosine deaminase in combination with 5-fluorocytosine; glucose transporter, type 2 (GLUT-2) in combination with streptozotocin (STZ) and the use of nitroreductase.
  • Patent application serial number 08/546,934 and PCT publication WO 97/15668 are specifically inco ⁇ orated herein by reference in that the referenced documents provide methods and compositions comprising GLUT-2 and GLUT-2 chimeras, as such the techniques described therein emphasize the utility of negative selection aspects with the present invention.
  • ⁇ G 498/20 cells a human neuroendocrine cell line engineered to express insulin, was tested for sensitivity to STZ and found to be resistant to cell killing at concentrations up to 10 mM.
  • ⁇ G 498/20 cells were electroporated (EP642) with plasmid AD402 (CMVp-
  • GLUT2/SV40p-Hygro selected for resistance to hygromycin, and tested by Western blotting for the expression of the GLUT-2 transporter.
  • ⁇ G 642 clones expressed variable levels of the transgenic GLUT-2. and those cells transfected with a plasmid conferring hygromycin resistance alone ( ⁇ G 640-v) did not express detectable levels of the transporter.
  • measuring insulin in the media of cultured cells is a convenient method for assessing secretory function, it may be desirable to create additional read-outs of cellular performance that require less time, are compatible with assays currently in use in the drug discovery industry, and relate to various aspect of beta-cell metabolism.
  • the present example discusses such alternative detection methods.
  • ATP and Ca Two important molecules in ⁇ -cell signaling are ATP and Ca .
  • the metabolism of glucose is converted to a secretory signal in large part by altering ATP/ADP ratios. Increases in this ratio, resulting from increased glycolytic flux, cause closing of the K A H > channel. depolarization of the plasma membrane, and increases in cytosolic Ca .
  • Ca is a common mechanism by which secretagogues stimulate insulin exocytosis.
  • Intracellular Ca " ⁇ and ATP can both be detected with assays that are compatible with HTS.
  • Numerous methods are currently in use for the detection of Ca "* by fluorescence including those that use dyes, or more recent techniques that depend on transgenic expression of proteins that fluoresce in a Ca "+ -dependent fashion (Scheenen and Pozzan, 1998).
  • Calcium- binding dyes that increase in intensity of fluorescence in a dose-dependent fashion such as Fluo-3 and Calcium green, are widely used in cell-based assays in the pharmaceutical industry.
  • ⁇ G 49/206 and ⁇ G 40/1 10 cells are washed to achieve a basal state in secretion, loaded with Calcium green, and stimulated with various secretagogues. Insulin secretion should correlate with increases in calcium-dependent fluorescence.
  • the Ca ⁇ + -sensitive photoprotein aequorin in either ⁇ G 49/206 or ⁇ G 490/1 10 cells. It has recently been shown that this protein could be targeted to either the cytoplasm and/or mitochondria of the rodent ⁇ -cell line INS-1, and stably transfected clonal derivatives provided a model for studying the effects of nutrient-stimulated insulin secretion on subcellular Ca (Maechler et al., 1997; Kennedy et al., 1996). Studies from this same group have shown that INS-1 cells transfected with cytosolic luciferase served as a model to monitor ATP changes in living cells. Luciferase-expressing clones were monitored by photon detection, and shown to be a model for tracking ATP changes simultaneously with stimulated insulin secretion (Maechler et al., 1998).
  • Preferred starting materials will consist of either a surgically removed human neuroendocrine tumor such as an insulinoma. or isolated primary tissue such as human islets.
  • the ⁇ -cells in these tissues proliferate at a very slow rate, therefore, the first step is to get them to grow. This will be accomplished by infecting insulinoma and/or islets with a recombinant adenovirus expressing an oncogene under the control of the rat insulin 1 gene promoter (RIP).
  • Adenovirus is the preferred viral vector because it will infect and express its transgene in nondividing cells. RIP will selectively express the oncogene. in this case, temperature sensitive SV40 T-antigen (tsTAG), in only ⁇ cells. In response to tsTAG expression the ⁇ cells should proliferate while other cell types remain quiescent.
  • tsTAG temperature sensitive SV40 T-antigen
  • the drawback and advantage is that adenovirus does not integrate into the genome and thus will not give long-term expression of tsTAG, therefore, a second transformation step is required.
  • the second step is to immortalize the proliferating ⁇ -cells by infection with a recombinant retrovirus also expressing an oncogene like tsTAG under the control of RIP.
  • Retroviruses require cellular division in order to integrate into the genome. Once integrated the transgene should be stably expressed resulting in an immortalized cell.
  • EXAMPLE 20 Culturing of Human Insulinomas
  • the present invention contemplates the use of cell lines derived from human insulinomas as starting cells for the instant methods to produce immortalized human neuroendocrine cells. This example describes the culturing of human insulinomas.
  • tissue culture media BetaGene medium supplemented with 3.5%> fetal bovine serum (FBS), 200 U and ⁇ g/ml penicillin/streptomycin, and 50 ⁇ g/ml gentamycin).
  • FBS fetal bovine serum
  • the tissue is kept on ice and sterile, keeping the transit time to less than 30 minutes.
  • the tissue is minced with iris scissors until it is reduced to pieces 1 mm or smaller.
  • the tumor is then transferred to 40 mesh tissue sieve through which the large pieces are forced using rubber pestle.
  • the cells are then washed twice for a period of 15 minutes each with fresh culture media containing antibiotics.
  • the tissue is then split onto standard Falcon tissue culture dishes and dishes coated with matrigel extracellular matrix.
  • the tissue is maintained under standard tissue culture atmospheric conditions of 37°C; 5%> CO 2 /95%> air; and humidified.
  • the tissue is then cultured with media composed of 30% conditioned tissue culture media (BetaGene medium containing 3.5%) fetal bovine serum (FBS) conditioned by culture with ⁇ G 261/13.
  • a rat ⁇ -cell line stably transfected with pCB6 expressing the full length human growth hormone coding region
  • BetaGene Medium product # 62469-79P 1% FBS, 50 ⁇ g/ml gentamycin.
  • Rat islets from adult animals weighing 150-200 g were isolated using the following protocol. Rats were anesthetized with i.p. injection of Nembutal. placed on their back ventral side up, and the abdominal area was wetted with 70% alcohol. Using large forceps and large scissors a midsagittal cut through the skin and musculature from hip level to xiphoid process was made to expose the abdominal cavity. Lateral cuts through skin and musculature were made at the level of the ribs to fold abdominal walls down. The duodenum was located under and adjacent to the liver on the animals right side. The bile duct was clamped where it enters the duodenum with a hemostat, which was positioned so the bile duct was straightened out but not stretched.
  • the bile duct was blunt dissected from liver adhesions and connective tissue at the level of the liver hilus, while being careful not to rupture the descending aorta directly beneath bile duct.
  • the bile duct was held with fine forceps as close to the hilus bifurcation as possible. While the bile duct was lifted slightly, microscissors were used to nick the bile duct just downstream of the forceps hold.
  • the beveled end of cannula was inserted into the bile duct lumen through the nick, and the end of the cannula was worked down the bile duct to a level past the bile duct branches to the liver lobes.
  • the duodenum and attached pancreas was removed from abdominal cavity by cutting the connections to the dorsal cavity wall, the spleen and the gut. The pancreas was then placed in weight dish and any remaining fat and lymph nodes were trimmed off. The pancreas was transferred to a 50 cc tube on ice, and digested in a 37°C water bath for 17 minutes. The digestion was stopped by adding ice cold Ml 99/5% NBS to the 40 ml mark. The tube was then shaken sha ⁇ ly for 5 strokes, and then centrifuged at 1000 ⁇ m for 2 minutes. The supernatant was decanted, and the 40 ml wash was repeated with ice cold M199/%5 NBS a total of 3 times. Any remaining undigested connective tissue was removed.
  • the pellet was resuspended in 20 ml of media, and the digest was poured through a tissue sieve and collected in a fresh 50 ml tube.
  • the original tube was rinsed with 20 ml of media, and the rinse was poured through the tissue sieve.
  • the sample was centrifuged at 1000 ⁇ m for 2 min, the media was poured off, and the tube was drained upside down on a paper towel to remove as much media as possible.
  • 10 ml of Histopaque-1077 Sigma 1077-1 was added, and the pellet was resuspend by vortexing maximally for an instant (2 sec). At this point, 10 ml of media was slowly added to form the top layer of the gradient.
  • the sample was centrifuged in a swinging bucket rotor centrifuge at 2400 rpm for 20 min.
  • the islet tissue settled at the interface between the histopaque and the media.
  • the islets were removed with a pipette, placed in a fresh 50 cc tube, and washed twice with media.
  • the islets can be stored for several hours at 4°C.
  • the islets were transferred to a petri dish and visualized with a stereoscopic dissecting microscope and a lateral fiber optic light source.
  • the islets were separated from non-islet tissue debris prior to use with an eppendorf microtip.
  • 6000 islet equivalents were placed in a 50 ml tube, brought up in PBS (calcium and magnesium free), and then centrifuged to pellet the islets.
  • the islets were resuspended in 5 ml of trypsin/DN Ase solution ( 1 mg/ml trypsin, 30 ⁇ g/ml DNAse final in PBS), and incubated for 15 min at 37°C, shaking vigorously every 5 minutes.
  • the sample was refluxed through a 10 ml pipet if large pieces were visible.
  • 5 ml. of ice cold media was added, and the sample was placed on ice.
  • the cells were pelleted at 600 ⁇ m for 5 min, and resuspend in 6 ml fresh media.
  • the islets were cultured on two types of matrices.
  • Matrigel collaborative Biomedical, #40234
  • Matrigel was thawed overnight at 4 °C and then diluted 1 :4 with Medium 199 without FBS. 2 ml was added to each well of a 6 well plate, and the excess was removed. The matrix was polymerized for 1 hour at room temperature, followed by a rinse with PBS. Coated plates were then placed at 50°C for 2 hours to further dry the matrix. Coated plates are stored at - 20°C, and then thawed and rinsed once with PBS prior to plating cells.
  • HTB-9 American Type Culture Collection. ATCC HTB-9 (5637)
  • HTB-9 matrix was prepared by culturing the cells to confluency in RPMI 1640 with 10% FBS as indicated the supplier. Media was aspirated and cells washed and lysed in water. This was repeated two times to ensure complete cell lysis. The remaining matrix was incubated for 10 to 15 minutes in PBS, rinsed two more times with PBS. and then stored indefinitely under PBS at 4°C. Prior to plating of dispersed cells, the PBS is aspirated. Cells are plated onto both Matrigel or the HTB-9 matrix in Medium 199 containing 4% FBS.
  • the islet cells spread from the periphery to form a monolayer ring comprising approximately 50% of the islet cells with the remaining islet cells in the central multilayer islet remnant after 2 days culture on HTB-9 matrix. Attachment and spreading of both dispersed and whole islets on matrigel extracellular matrix was slower and less complete than that observed for HTB-9 matrix. After 6 days culture, about 70% of dispersed islet cells were in monolayer plaques, and peripheral monolayer zones were just forming on whole islet plaques. In general islet cells on matrigel matrix tended to be taller and rounded in contrast to HTB-9 cultures in which the cells were flattened and spread over a larger area. Fibroblasts from the islets were observed in both the matrigel and HTB-9 matrix cultures but were a minor population (1 to 5%) compared to the epithelial like presumed endocrine cells.
  • IEQ islet equivalents
  • An islet equivalent is the number of cells/volume that is found in an islet with a diameter of a 150 ⁇ m. Insulin content and secretory response of the islets was assayed first upon receipt and second after culture in BetaGene medium. Proper insulin processing was also analyzed before and after culture in BetaGene medium.
  • Islet preparation suspensions were spun down in a bench top centrifuge at 1000 ⁇ m for
  • BetaGene medium supplemented with 2% fetal bovine serum, 500 mg/ml gentamycin, 200 units/ml penicillin, and 200 mg/ml streptomycin was added to each suspension and allowed to incubate at room temperature for 15 minutes.
  • the samples were spun down a second time, all but 5 ml of the medium was aspirated, and a fresh aliquot of BetaGene medium with supplements was added and allowed to incubate for another 15 minutes. After the second and final incubation, the islets were spun down and all of the medium was removed. The pellet was resuspended in complete BetaGene medium at a density of 1000 IEQ per milliliter. 2. Alginate Encapsulation of Human Islets
  • Islet cells do not divide in culture and may be overrun by various replicating cells which are present in islet preps as shipped. Encapsulating the cells immediately upon receipt minimizes the growth of fibroblasts and other cell types.
  • the islets were resuspended in a 2% sodium alginate solution (50% high viscosity and 50% low viscosity sodium alginate made up in complete BetaGene medium) at a concentration of 1000 IEQ per 1 milliliter of alginate.
  • the suspension is transferred to a syringe and allowed to sit at room temperature for 5 minutes to allow all air bubbles to rise to the surface.
  • a 25 gauge needle is attached to the syringe and the islet/alginate slurry is dispensed through the syringe into a 50 ml conical tube containing approximately 35 mis of 1.35% CaC ⁇ /20 mM
  • Beads are formed as the slurry hits the surface of the CaCl2 solution, and are completely polymerized after about 10 minutes.
  • the CaCl2 solution is removed carefully and the beads are washed with two volumes of BetaGene medium / 20 mM HEPES.
  • the encapsulated islets were then cultured with the medium under conditions described for each study.
  • each islet preparation was used to assess insulin content of the islets upon receipt.
  • Prior to culture in BetaGene medium 2000 IEQ were removed from the stock and spun down to pellet the islets. The medium was removed completely without disturbing the cell pellet.
  • the islets were washed one time with phosphate-buffered saline (PBS) and spun down. The pellet was dispersed in 0.5 ml content buffer (IM acetic acid. 0.1 % BSA) and frozen at -80°C.
  • the cells were thawed, sonicated (3 bursts at setting 5-6) and the insoluble debris were pelleted at 14.000 ⁇ m for 10 minutes at 4°C.
  • the supernatant was then transferred to a clean tube and a portion was analyzed by HPLC.
  • HPLC system used for resolving insulin from its precursor, proinsulin:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Food Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Neurology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Neurosurgery (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des méthodes de criblage pour la détection de modulateurs de fonction sécrétoires. En particulier, l'invention décrit des cellules sécrétoires neuro-endocriniennes immortalisées permettant de cribler de nouvelles substances pouvant s'utiliser pour réguler la fonction sécrétoire in vitro et in vivo.
PCT/US1999/000551 1998-01-12 1999-01-11 Lignees cellulaires recombinees pour le criblage de medicaments WO1999035495A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU21121/99A AU2112199A (en) 1998-01-12 1999-01-11 Recombinant cell lines for drug screening
CA 2318379 CA2318379A1 (fr) 1998-01-12 1999-01-11 Lignees cellulaires recombinees pour le criblage de medicaments
EP99901421A EP1047938A2 (fr) 1998-01-12 1999-01-11 Lignees cellulaires recombinees pour le criblage de medicaments

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US7255698P 1998-01-12 1998-01-12
US7119398P 1998-01-12 1998-01-12
US7120998P 1998-01-12 1998-01-12
US60/071,209 1998-01-12
US60/071,193 1998-01-12
US60/072,556 1998-01-12
US8782198P 1998-06-03 1998-06-03
US8784898P 1998-06-03 1998-06-03
US60/087,821 1998-06-03
US60/087,848 1998-06-03

Publications (2)

Publication Number Publication Date
WO1999035495A2 true WO1999035495A2 (fr) 1999-07-15
WO1999035495A3 WO1999035495A3 (fr) 1999-11-25

Family

ID=27535873

Family Applications (3)

Application Number Title Priority Date Filing Date
PCT/US1999/000633 WO1999035242A1 (fr) 1998-01-12 1999-01-11 Milieu de culture de cellules neuroendocrines
PCT/US1999/000551 WO1999035495A2 (fr) 1998-01-12 1999-01-11 Lignees cellulaires recombinees pour le criblage de medicaments
PCT/US1999/000631 WO1999035255A2 (fr) 1998-01-12 1999-01-11 Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US1999/000633 WO1999035242A1 (fr) 1998-01-12 1999-01-11 Milieu de culture de cellules neuroendocrines

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/US1999/000631 WO1999035255A2 (fr) 1998-01-12 1999-01-11 Compositions et procedes regulant la secretion de lignees de cellules neuroendocrines

Country Status (4)

Country Link
EP (2) EP1047938A2 (fr)
AU (3) AU2112199A (fr)
CA (2) CA2318379A1 (fr)
WO (3) WO1999035242A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012115955A2 (fr) 2011-02-22 2012-08-30 Cytonet, Llp Système de remplissage permettant de fournir des concentrations et des volumes uniformes, et procédés associés
US8945876B2 (en) 2011-11-23 2015-02-03 University Of Hawaii Auto-processing domains for polypeptide expression
US10918110B2 (en) 2015-07-08 2021-02-16 Corning Incorporated Antimicrobial phase-separating glass and glass ceramic articles and laminates
CN114561337A (zh) * 2022-03-09 2022-05-31 广州源井生物科技有限公司 一种提高HepG2细胞克隆形成率的单克隆增强培养基和方法

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR0109336A (pt) * 2000-03-17 2003-06-24 Ajinomoto C0 Inc Medicamento para a prevenção, melhora e/ou tratamento de uma complicação diabética, droga medicinal adequada ou utilizável como o mesmo, método para prevenir, melhorar e/ou tratar a complicação diabética, e a neuropatia, e, usos de um agente redutor do açúcar no sangue pós-prandial e pelo menos um agente selecionado de um agente anti-hipertensivo, um agente vasodilatador e um agente anti-hiperlipidêmico
EP1370134B1 (fr) 2001-03-23 2016-03-23 University Of Ottawa Procedes et compositions pour la cryoconservation de cellules animales primaires dissociees
US7166463B2 (en) 2001-11-16 2007-01-23 The Regents Of The University Of Colorado Nucleic acids encoding modified olfactory cyclic nucleotide gated ion channels
NZ565049A (en) 2005-06-17 2012-02-24 Vital Health Sciences Pty Ltd A carrier comprising one or more DI and/or mono-(electron transfer agent) phosphate derivatives or complexes thereof
ES2336575T3 (es) 2005-09-22 2010-04-14 Biocompatibles Uk Limited Polipeptidos de fusion glp-1 (peptido-1 similar al glucagon) con resistencia aumentada a la peptidasa.
PL2522717T3 (pl) * 2006-01-04 2014-08-29 Baxalta Inc Pożywki do hodowli komórkowych wolne od oligopeptydów
DE602006009631D1 (de) 2006-05-10 2009-11-19 Biocompatibles Uk Ltd GLP-1 Peptide enthaltende kugelförmige Mikrokapseln, deren Produktion und deren Verwendung
EP3255141B1 (fr) 2006-07-13 2021-12-01 Wyeth LLC Production de anticorps avec une gycosylation amelioree
PL2167644T3 (pl) 2007-05-01 2017-06-30 Vitrolife Sweden Ab Pożywki hodowlane dla komórek rozwojowych zawierające podwyższone stężenia kwasu liponowego
KR20100058555A (ko) * 2007-09-11 2010-06-03 몬도바이오테크 래보래토리즈 아게 치료제로서의 ｂｐｐ－ｂ의 용도
EP2163243A1 (fr) * 2008-09-12 2010-03-17 Biocompatibles UK Limited Traitement de l'infarctus du myocarde (AMI) utilisant des cellules encapsulées codant et sécrétant des peptides GLP-1 ou analogues associés
KR20180010324A (ko) * 2009-08-11 2018-01-30 제넨테크, 인크. 글루타민-비함유 세포 배양 배지에서의 단백질의 생성
EP2531047A4 (fr) 2010-02-05 2014-03-19 Phosphagenics Ltd Vecteur comprenant du phosphate de tocophéryle non neutralisé
EP2531219A4 (fr) * 2010-02-05 2015-01-14 Phosphagenics Ltd Composition de support
EP2552486B1 (fr) 2010-03-30 2020-08-12 Phosphagenics Limited Timbre transdermique
US9561243B2 (en) 2011-03-15 2017-02-07 Phosphagenics Limited Composition comprising non-neutralised tocol phosphate and a vitamin A compound
WO2013082458A1 (fr) 2011-12-02 2013-06-06 The Regents Of The University Of California Solution de protection de reperfusion et ses utilisations
AR095196A1 (es) 2013-03-15 2015-09-30 Regeneron Pharma Medio de cultivo celular libre de suero
WO2015066631A2 (fr) * 2013-11-01 2015-05-07 University Of Notre Dame Du Lac Milieu de culture cellulaire et optimisation des bioprocessus
EP3071027B1 (fr) 2013-11-22 2018-12-26 Centre National de la Recherche Scientifique (CNRS) Cellule congelée prêt-pour-essai et procédé pour minimiser la variabilité de la leur performance
TW202330904A (zh) 2015-08-04 2023-08-01 美商再生元醫藥公司 補充牛磺酸之細胞培養基及用法
JP6882321B2 (ja) 2015-12-09 2021-06-02 フォスファージニクス リミテッド 医薬製剤
AU2017381395A1 (en) 2016-12-21 2019-06-20 Phosphagenics Limited Process
KR102569522B1 (ko) * 2017-11-24 2023-08-24 주식회사 차바이오랩 세포 동결 보존용 조성물 및 이를 이용한 세포 동결 보존 방법
US20230091910A1 (en) * 2019-04-02 2023-03-23 Centagen, Inc. Engineered System of Stem Cell Rejuvenation to Treat Aging and Disease
CN114868736B (zh) * 2022-03-08 2022-12-09 四川中科奥格生物科技有限公司 一种胰岛细胞稳定液及其制备方法和用途

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992021979A1 (fr) * 1991-06-03 1992-12-10 Board Of Regents, The University Of Texas System Procedes et compositions relatives a des cellules mises au point par genie genetique produisant de l'insuline en reponse a du glucose
US5180662A (en) * 1988-01-05 1993-01-19 The United States Of America As Represented By The Department Of Health And Human Services Cytotoxic T lymphocyte activation assay
WO1996011278A1 (fr) * 1994-10-10 1996-04-18 Association Pour Le Developpement De L'immunologie Moleculaire-Adim Lignees immortalisees de cellules endotheliales cerebrales et leurs applications therapeutiques

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2051092C (fr) * 1990-09-12 2002-07-23 Stephen A. Livesey Methode et appareillage pour la cryopreservation, la stabilisation a sec et la rehydratation de suspensions biologiques
WO1993002183A1 (fr) * 1991-07-18 1993-02-04 Fuji Yakuhin Kogyo Kabushiki Kaisha Milieu de culture tissulaire sans serum, contenant un inhibiteur tissulaire de metalloproteinase, et procede de croissance cellulaire
GB9125052D0 (en) * 1991-11-26 1992-01-22 Isis Innovation Culture of bone cells
AU718254B2 (en) * 1996-01-19 2000-04-13 Betagene, Inc. Recombinant expression of proteins from secretory cell lines

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5180662A (en) * 1988-01-05 1993-01-19 The United States Of America As Represented By The Department Of Health And Human Services Cytotoxic T lymphocyte activation assay
WO1992021979A1 (fr) * 1991-06-03 1992-12-10 Board Of Regents, The University Of Texas System Procedes et compositions relatives a des cellules mises au point par genie genetique produisant de l'insuline en reponse a du glucose
WO1996011278A1 (fr) * 1994-10-10 1996-04-18 Association Pour Le Developpement De L'immunologie Moleculaire-Adim Lignees immortalisees de cellules endotheliales cerebrales et leurs applications therapeutiques

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012115955A2 (fr) 2011-02-22 2012-08-30 Cytonet, Llp Système de remplissage permettant de fournir des concentrations et des volumes uniformes, et procédés associés
EP2678415A2 (fr) * 2011-02-22 2014-01-01 Cytonet, LLC Système de remplissage permettant de fournir des concentrations et des volumes uniformes, et procédés associés
EP2678415A4 (fr) * 2011-02-22 2014-12-17 Cytonet Llc Système de remplissage permettant de fournir des concentrations et des volumes uniformes, et procédés associés
US8945876B2 (en) 2011-11-23 2015-02-03 University Of Hawaii Auto-processing domains for polypeptide expression
US10918110B2 (en) 2015-07-08 2021-02-16 Corning Incorporated Antimicrobial phase-separating glass and glass ceramic articles and laminates
CN114561337A (zh) * 2022-03-09 2022-05-31 广州源井生物科技有限公司 一种提高HepG2细胞克隆形成率的单克隆增强培养基和方法
CN114561337B (zh) * 2022-03-09 2023-10-03 广州源井生物科技有限公司 一种提高HepG2细胞克隆形成率的单克隆增强培养基和方法

Also Published As

Publication number Publication date
WO1999035255A9 (fr) 2001-05-31
EP1047938A2 (fr) 2000-11-02
WO1999035255A8 (fr) 1999-09-10
WO1999035255A3 (fr) 1999-10-28
AU2113199A (en) 1999-07-26
WO1999035242A9 (fr) 1999-09-30
WO1999035242A1 (fr) 1999-07-15
EP1045898A2 (fr) 2000-10-25
CA2318379A1 (fr) 1999-07-15
AU2112199A (en) 1999-07-26
CA2318376A1 (fr) 1999-07-15
WO1999035255A2 (fr) 1999-07-15
AU2455199A (en) 1999-07-26
WO1999035495A3 (fr) 1999-11-25

Similar Documents

Publication Publication Date Title
WO1999035495A2 (fr) Lignees cellulaires recombinees pour le criblage de medicaments
EP1354942B1 (fr) Induction de cellules produisant de l'insuline
US11453858B2 (en) Human plasma-like medium
Calderari et al. Defective IGF2 and IGF1R protein production in embryonic pancreas precedes beta cell mass anomaly in the Goto–Kakizaki rat model of type 2 diabetes
Behnia et al. Xenobiotic metabolism by cultured primary porcine hepatocytes
CA2246268A1 (fr) Expression par recombinaison de proteines issues de lignees cellulaires secretoires
Tosh et al. Differentiated properties of hepatocytes induced from pancreatic cells
Kelly et al. Comparison of insulin release from MIN6 pseudoislets and pancreatic islets of Langerhans reveals importance of homotypic cell interactions
BG102837A (bg) Среда за култивиране на клетки от бозайници
US9732329B2 (en) Cells genetically modified to comprise pancreatic islet glucokinase and uses thereof
WO1999035245A9 (fr) Procedes pour preparer et utiliser des cellules neuroendocriniennes humaines immortalisees
US20050064587A1 (en) Pancreatic small cells and uses thereof
US6171856B1 (en) Methods and compositions relating to no-mediated cytotoxicity
US20150056173A1 (en) Beta cell growth and differentiation
US20240124843A1 (en) Functional feline pancreatic cells from adipose tissue
WO1999006059A2 (fr) Procedes et compositions relatifs a la cytotoxicite induite par l'oxyde nitrique
Sekine et al. Glucose-Induced Insulin Secretion in INS-1 Cells Depends on Factors Present in Fetal Calf Serum and Rat Islet–Conditioned Medium
WO2019217487A1 (fr) Cellules alpha dérivées de cellules souches et leurs procédés de génération
Han et al. Insulin stimulates Ca2+ uptake via PKC, cAMP, and p38 MAPK in mouse embryonic stem cells
WO2007075956A2 (fr) Procede de production et d’utilisation de cellules endocrines pancreatiques
Rawdon et al. Effects of tri-iodothyronine (T3), insulin, insulin-like growth factor I (IGF-I) and transforming growth factor beta1 (TGFβ1) on the proportion of insulin cells in cultured embryonic chick pancreas
WO1995032740A1 (fr) Lignee de cellules transformees qui proviennent d'un carcinome hepatocellulaire humain et qui sont capables de produire de l'insuline
WO2001005943A2 (fr) Compositions a base de lignees cellulaires de recombinaison secretant lcat, et methodes associees
WO2004010933A2 (fr) Compositions cellulaires produisant de l'insuline et procedes associes
YOON et al. In Vitro and In Vivo Functions of Rat Pancreatic A-Cell Lines

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US US US US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US US US US US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2318379

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2318379

Country of ref document: CA

NENP Non-entry into the national phase in:

Ref country code: KR

WWE Wipo information: entry into national phase

Ref document number: 1999901421

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1999901421

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999901421

Country of ref document: EP