EP1007687A1 - Vaccin anti-vif - Google Patents

Vaccin anti-vif

Info

Publication number
EP1007687A1
EP1007687A1 EP98912585A EP98912585A EP1007687A1 EP 1007687 A1 EP1007687 A1 EP 1007687A1 EP 98912585 A EP98912585 A EP 98912585A EP 98912585 A EP98912585 A EP 98912585A EP 1007687 A1 EP1007687 A1 EP 1007687A1
Authority
EP
European Patent Office
Prior art keywords
fipv
fiv
polynucleotide
deletion
pol gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98912585A
Other languages
German (de)
English (en)
Inventor
James Charles Neil
Mark Alan Rigby
James Oswald Jarrett
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Glasgow
Original Assignee
University of Glasgow
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Glasgow filed Critical University of Glasgow
Publication of EP1007687A1 publication Critical patent/EP1007687A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a feline immunodeficiency proviral (FIPV) polynucleotide fragment comprising a dysfunctional pol gene region, a recombinant vector comprising said FIVP polynucleotide fragment, a host cell containing said FIPV polynucleotide fragment, a feline immunodeficiency virus (FIV) vaccine comprising said FIPV polynucleotide fragment, a method of treating FIV-related disease, and pharmaceutical compositions comprising said FIPV polynucleotide fragment for use as a prophylactic and/or therapeutic agent in cats.
  • FIPV feline immunodeficiency proviral
  • Feline immunodeficiency virus is a member of the Retroviridae; it is a lentivirus which is associated with a debilitating immunodeficiency syndrome in cats (Pedersen N.C. et al., Science (1987) Vol. 235, pp. 790-793).
  • Lentiviruses by nature do display a large degree of molecular and biological variation. This natural variation is thought to be in part ascribable to the low fidelity of the viral enzyme reverse transcriptase in the process of copying the viral genomic RNA to DNA (Preston et al., Science 242: 1168-1171 (1988), Roberts et al., Science 242: 1171-1173 (1988)). As a result, several variant FIV-strains have been found.
  • FIV has a complex genome structure comprising group antigen proteins (GAG) , which are the major structural proteins of the virus; POL, proteins of the polymerase gene; and ENV, proteins of the envelope gene.
  • GAG group antigen proteins
  • the gag gene encodes matrix, capsid and nucleocapsid proteins
  • the pol gene encodes protease, reverse transcriptase, dUTPase and integrase.
  • the env gene encodes surface and transmembrane envelope glycoproteins.
  • at least three more genes are present in FIV (Miyazawa T., Arch. Virol. (1994) Vol. 134 pp. 221-234).
  • the integrated genome of FIV is bordered by long terminal repeats (LTRs) comprised of U5 , R, and U3 domains.
  • LTRs long terminal repeats
  • gag, pol and env are encoded in the approximate 9500 base pair genome.
  • FIV encodes several short open reading frames (sORFs) . Details of the genomic organisation of FIV may be , found in "Infectious Agents and Disease Vol. 2 pp. 361-374 (1994)" under the review paper by John H. Elder and Tom R. Phillips.
  • WO 94/20622 describes the provision of a vaccine against FIV comprising a polypeptide fragment of an FIV surface protein which is capable of inducing neutralising antibodies against FIV.
  • a vaccine against FIV comprising a polypeptide fragment of an FIV surface protein which is capable of inducing neutralising antibodies against FIV.
  • proviral FIV DNA in the production of DNA vaccines against FIV infection.
  • Development of protective FIV vaccines has proven difficult (Hosie M.J. and Yamamoto J.K. (1995) Feline Immunology and Immunodeficiency (Willett B.J. and Jarrett 0. Eds.) Oxford University Press, New York, pp. 263-278) .
  • An initial success was reported with the development of a cell line (FL4) that constitutively releases large numbers of FIV particles (Yamamoto J.K. et al.
  • FIV pol region deletion mutants comprising a dysfunctional reverse transcriptase (RT) gene region in the manufacture and use of vaccines against FIV related disease.
  • RT reverse transcriptase
  • DNA delivery may improve the prospects for the use of attenuated viral vaccines, since it may be possible to deliver more comprehensively disabled viral derivatives that cannot be obtained as stable high-titer viruses.
  • the present invention seeks to mitigate against the disadvantages associated with the prior art.
  • a vaccine formulation comprising a feline immunodeficiency provirus (FIPV) polynucleotide comprising a dysfunctional pol gene which is substantially incapable of encoding a functionally competent reverse transcriptase (RT) or a functional RT fragment thereof.
  • FIPV feline immunodeficiency provirus
  • a "FIPV" polynucleotide can be viewed as a polynucleotide fragment of an FIV capable of integration into a host cell genome.
  • Host cells comprising FIPV of the invention are capable of producing FIV proteins, except for functionally competent RT or functionally competent fragments thereof.
  • host cells for the FIPV of the invention are able to release non-infectious FIV viral particles i.e. FIV particles which are substantially incapable of replication.
  • a "dysfunctional pol gene" is one which is substantially incapable of coding for a native RT or a functional equivalent thereof.
  • a "dysfunctional pol gene” means that the pol gene has been modified by an in-frame deletion, insertion or substitution (or other change in the DNA sequence such as rearrangement) such that the pol gene is generally unable to express a functionally competent RT or a functionally competent equivalent polypeptide product thereof.
  • pol genes of the invention which are substantially incapable of encoding a functionally competent RT may be rendered dysfunctional by any one of several ways:
  • a deletion of the entire in-frame RT coding domain of the pol gene from a wild type FIPV genome For example, depending on the wild type of FIPV or FIV of concern, a deletion of the nucleotide sequence from a wild type FIPV or FIV genome between about nucleotide 2337 ⁇ 12 bases to about nucleotide 4013 ⁇ 12 bases can be made.
  • An example of a FIV clone from which a deletion can be made is the F14 clone of FIV. Using this clone a deletion of the entire in-frame RT coding region can be made between nucleotide 2337 and nucleotide 4013.
  • the in-frame deletion should be such so as not to substantially affect the expression of other gene products from the FIV or FIPV genome.
  • a deletion of a portion of the in-frame RT coding domain of the pol gene of a wild type FIPV genome means a polynucleotide fragment which by its deletion from the RT coding region is sufficient to render any RT or fragment or fragments thereof encoded and/or expressible thereby, substantially incapable of a physiological activity attributable to that of a functional RT produced by a FIV or FIPV.
  • the deletion portion of RT may comprise a deletion of a small number of nucleotides, for example, 1, 2 or more nucleotides. Such deletions within the RT encoding domain of the pol gene can be achieved using recombinant DNA technology.
  • the translational ORF for an RT can be altered resulting in the production of a protein which lacks the physiological functionality or functional competence of an RT found under native circumstances, for example, an RT derived from a pol gene in a wild type FIPV or FIV.
  • the skilled addressee will also appreciate that such deletions in the translational ORF of the RT domain of the pol gene may also give rise to a dysfunctional pol gene which is substantially incapable of coding for a functionally competent RT, truncated RT even any RT or polypeptide fragment thereof.
  • Such proteins/polypeptides, if produced, generally lack the functional competence typical of the enzyme, RT.
  • telomere deletions can include genes which express polypeptides capable of augmenting an immune response, such as feline cytokines, for example, feline interferon or other genes such as marker genes.
  • Suitable marker genes may include but are not restricted to enzyme marker genes, for example the lac-Z gene from E.coli, antibiotic marker genes such as hygromycin, neomycin and the like. Generally, marker genes, if any, may be employed in an RT deletion. FIPV or FIV mutants of the invention should be such so as to not cause substantial deleterious or long lasting side-effects to a recipient animal.
  • the "gap" made by the deletion of the or a portion of the RT domain of the pol gene from a FIPV is not filled with a polynucleotide insert, the cut ends of the deletion site being ligated together using conventional recombinant DNA technology.
  • the "gap" left by the partial or total deletion of the RT encoding region of the pol gene may be filled with a polynucleotide sequence which is a nonsense nucleotide sequence or an anti-sense sequence: In both instances any defective RT which may be produced from a polynucleotide fragment including such sequences should be incapable of RT functionality.
  • Nucleotide insertions can also be made at suitable restriction enzyme sites within the RT coding region using recombinant DNA technology. Such insertions can give rise to a dysfunctional RT or fragment (s) thereof which are substantially incapable of an RT activity.
  • stop codons may be inserted into the RT region at suitable insertion sites such as at the Pac 1 restriction site (nucleotide 3540 to 3547) of the RT encoding region of the pol gene, which can result in the production of a non-functional fragment (s) of RT.
  • a "functionally competent reverse transcriptase" is one which is capable of RT functionality.
  • an RT functionality permitting the copying of a ribose nucleic acid to a deoxyribose nucleic acid form, for example, in a host cell or in the genome of a host organism such as a feline.
  • FIPV's of the invention comprising dysfunctional pol genes are substantially incapable of giving rise to infectious FIV particles.
  • the FIPV polynucleotide comprises a deletion, still preferably an in-frame deletion, within the RT domain of the pol gene.
  • a defective FIPV polynucleotide fragment comprising an in-frame deletion and/or insertion comprising at least one nucleotide in the RT region within the RT domain of the pol gene.
  • the deletion should be such that coding sequences for other gene products of the FIPV, for example the pol gene products and other FIPV gene products, upstream _ and/or downstream from the RT domain are not substantially affected. That is to say that other gene products ordinarily having an immunogenic function and which are expressed from the FIPV substantially retain their immunogenic function.
  • the deletion may be made between about nucleotide 2337 ⁇ 12 bases and 4013 ⁇ 12 bases of the RT domain of the pol gene depending on the FIV isolated.
  • the deletion can be of any size so long as any RT polypeptide product which may be generated, such as an RT fragment thereof (or RT fragments thereof) does (do) not possess RT functionality and any coding sequences upstream or downstream thereof are not substantially affected.
  • the deletion can be made starting at any suitable restriction enzyme site located in the RT region of the pol gene. However, it is preferred if the deletion is made starting at a restriction site which is unique to within the RT domain of the pol gene, if not the whole FIPV such as Ncol, Pac 1 and Sph 1.
  • a suitable example of a starting restriction enzyme site, thought to be unique to at least within the RT region of the FIV F14 clone is the Pac 1 site located at nucleotides 3540-3547 thereof.
  • FIV or FIPV isolates comprising similar enzyme restriction sites within the RT domain of the pol gene are encompassed by the present invention.
  • a defective FIPV comprising a polynucleotide fragment deletion in the RT domain of the pol gene wherein the deletion is from nucleotide 3497 to nucleotide 3595 of the RT domain.
  • the defective FIVP can form part of a recombinant nucleic acid molecule comprising a replication defective FIPV under the control of regulatory sequences which enable expression of viral gene products in a host cell genome and production of FIV proteins other than functional RT or functional fragments thereof.
  • Regulatory sequences enabling integration and/or production of FIV proteins other than functional RT or functional fragments thereof can be promoter sequences which may or may not be associated with appropriate enhancer sequences. Suitable promoters include those as outlined by Norimine J. et al., (1992) J. Vet. Med. Sci. 51(1) pp. 189-191, and may include promoters obtained or derived from prokaryotic, eucaryotic and/or viral origins.
  • promoters include but are not limited to the cytomegalovirus (CMV) promoter immediate early (IE) promoter region, for example the human cytomegalovirus (HCMV) immediate early (IE) promoter region, the Rous sarcoma virus (RSV) long terminal repeat (LTR) , feline leukaemia virus (FeLV) LTR, simian immunodeficiency virus from African green monkey (SIV AGM) LTR, and the SV40 early-promoter region.
  • CMV cytomegalovirus
  • HCMV human cytomegalovirus
  • IE Rous sarcoma virus
  • LTR Rous sarcoma virus
  • FeLV feline leukaemia virus
  • SIV AGM simian immunodeficiency virus from African green monkey
  • the natural promoter sequence of the defective FIPV carrying a dysfunctional pol gene i.e. located in the 5' LTR thereof
  • FIPV of the invention can be obtained by taking cDNA encompassing the genome of an appropriate FIV isolate and inserting it into a suitable vector, such as a pGEM vector or a lambda vector.
  • a suitable FIV clone is the F14 clone of FIV- Petaluma described by Olmsted R.A. et al. (1989) Proc. Natl. Acad. Sci . . (USA) Vol. 86 pp. 8088-8092.
  • the FIV clone can then be linearised using an appropriate restriction enzyme such as Nco 1, Sph 1, Bae 1 Pac 1 and the like, the linearised vector is then purified, for example by precipitation followed by digestion with a suitable exonuclease such as Bal31 under appropriate exonuclease digestion conditions for a desired period of time (Maniatis et al. Molecular Cloning - a Laboratory Manual; Cold Spring Harbor Laboratory Press First Edition (1989) p 135) .
  • an appropriate restriction enzyme such as Nco 1, Sph 1, Bae 1 Pac 1 and the like
  • appropriately exonuclease digested nucleic acid molecules can be re-circularised by ligation and the products thereof used to transform an appropriate host cell, such as a bacterium host cell, e.g. E.coli.
  • Clones thus obtained may then be characterised by polymerase chain reaction (PCR) amplification across the nucleic acid molecule in order to ascertain the size and location of the deletion in the RT domain of the pol gene (i.e. in-frame or otherwise).
  • PCR polymerase chain reaction
  • a suitably sized deletion region has been found to be a 235 bp region of the pol gene of the FIV Petaluma strain within which is- found the Pac 1 restriction enzyme site.
  • the deletion generally has to be made in the RT domain of the pol gene in a position such that any defective FIPV incorporated into a host cell genome retains a sufficient immunogenic function to elicit, on expression of protein or polypeptides encoded by the FIPV, at least a cellular immune response (such as a cytotoxic T-cell response) in a host animal, such as a feline.
  • a cellular immune response such as a cytotoxic T-cell response
  • Suitable clones comprising deletion regions of the invention can be further characterised using DNA sequence analysis using primers of any acceptable length, such as primers of up to 60 nucleotide bases in length, preferably primers of about 20 to 60 nucleotide bases in length. More preferably such primers are from 20 to 30 nucleotides in length.
  • the selection of vector is not critical provided that it is able to carry the desired FIV clone into a suitable host cell.
  • the host cell can be one in which replication of the recombinant vector molecule can occur.
  • the host cell can be a cell in which regulatory sequences of the or at least one other vector can also be recognised such that at least a further polypeptide fragment (s) , such as a fragment capable of augmenting or eliciting at least an immune response as described above, can be expressed.
  • a further vector encoding an appropriate adjuvant protein or polypeptide such as a cytokine coding vector, for example, a feline ⁇ interferon ( ⁇ IFN) coding vector, can also be employed as a component of a vaccine or pharmaceutical composition of the invention.
  • cytokine coding vector for example, a feline ⁇ interferon ( ⁇ IFN) coding vector
  • ⁇ IFN feline ⁇ interferon
  • International Patent Application WO 96/03435 describes the provision of a feline ⁇ interferon, and includes the provision of a polynucleotide fragment encoding feline ⁇ interferon and vectors therefor.
  • Such polynucleotide fragments as described in WO 96/03435 can be administered in conjunction with vectors coding for defective FIPV of the invention to animals in need thereof.
  • vectors for use in bacteria, e.g. pBR322, 325 and 328, various pUC-vectors a.o.
  • a vector comprising a defective FIPV in recombinant form under the control of regulatory sequences enabling expression of viral proteins of the FIPV yet which is substantially unable to express a functional RT or a functional fragment thereof.
  • a host cell comprising a dysfunctional FIVP or the present invention under the control of a regulatory sequence enabling expression of viral proteins of the FIPV yet which is substantially unable to express a functional RT or a functional fragment thereof.
  • a host cell may be a cell of bacterial origin, e.g. Escherichia coli, Bacillus subtilus and Lactobacillus species, in combination with bacteria-based vectors as PBR322, or bacterial expression vectors as pGEX, or with bacteriophages.
  • the host cell may also be of eukaryotic origin, e.g. yeast-cells in combination with yeast-specific vector molecules, or higher eukaryotic cells such as insect cells (Luckow et al; Biotechnology 6: 47-55 (1988)) in combination with vectors or recombinant baculoviruses, plant cells in combination with e.g. Ti-plasmid based vectors or plant viral vectors (Barton, K.A.
  • the FIPV fragment according to the present invention may be cloned under the control of a promoter sequence or not under the control of a promoter sequence in a viral genome, as the case may be. In such a manner, the virus may be used as a means of transporting the FIPV fragment into a target cell.
  • Such recombinant viruses are called vector viruses.
  • the site of integration may be a site in a gene not essential to the virus, or a site in an intergenic region. Viruses often used as vectors are Vaccinia viruses (Panicali et al; Proc. Natl. Acad. Sci. USA,
  • the invention also comprises a virus vector containing a FIPV fragment or a recombinant nucleic acid molecule encoding the FIPV fragment under the control of regulating sequences enabling expression of the protein encoded by said nucleic acid sequence.
  • defective FIPV polynucleotides of the invention may be applied directly to the cells of an animal in vivo, or by in vitro transfection of cells taken from the said animal, which cells are then introduced back into the animal.
  • Defective FIPV may be delivered to various cells of the animal body including muscle, skin or blood cells thereof.
  • the defective FIPV may be loaded for example, into muscle or skin using a suitable loading means such as a syringe.
  • defective FIPV polynucleotides of the invention may be administered as pharmaceutically acceptable salts to animals in need thereof.
  • Polynucleotide salts Administration of pharmaceutically acceptable salts of the polynucleotides described herein is included within the scope of the invention.
  • Such salts may be prepared from pharmaceutically acceptable non-toxic bases including organic bases and inorganic bases.
  • Salts derived from inorganic bases include sodium, potassium, lithium, ammonium, calcium, magnesium, and the like.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, basic amino acids, and the like. Further pharmaceutical salts are described in, S.M. Berge et al., Journal of Pharmaceutical Sciences 66: 1-19 (1977) .
  • Polynucleotides for injection may be prepared in unit dosage form in ampules, or in multidose containers.
  • the polynucleotides may be present in such forms as suspensions, solutions, or emulsions in oily or preferably aqueous vehicles.
  • the polynucleotide salt may be in lyophilized form for reconstitution, at the time of delivery, with a suitable vehicle, such as sterile pyrogen-free water.
  • a suitable vehicle such as sterile pyrogen-free water.
  • Both liquid as well as lyophilized forms that are to be reconstituted will comprise agents, preferably buffers, in amounts necessary to suitably adjust the pH of the injected solution.
  • the total concentration of solutes should be controlled to make the preparation isotonic, hypotonic, or weakly hypertonic.
  • Nonionic materials such as sugars, are preferred for adjusting tonicity, and sucrose is particularly preferred. Any of these forms may further comprise suitable formulatory agents, such as starch or sugar, glycerol or saline.
  • suitable formulatory agents such as starch or sugar, glycerol or saline.
  • the compositions per unit dosage, whether liquid or solid, may contain from 0.1% to 99% of polynucleotide material.
  • a vaccine against FIV comprising a defective FIPV polynucleotide fragment of the invention.
  • the FIPV fragment may take the form of a naked FIPV polynucleotide fragment, that is, a FIPV polynucleotide fragment not bound up in a vector form, such as a plasmid form.
  • the vaccine of the invention may optionally include a further polynucleotide fragment encoding a further compound having an immunogenic function such as a cytokine, for example, feline ⁇ interferon.
  • the additional polynucleotide fragment may be in the form of a further vector as described herein, for example an additional plasmid vector.
  • the additional polynucleotide can be in the form of a naked DNA.
  • naked DNA may be adhered to a microprojectile or in an appropriate holding solution, such as a saline solution.
  • the FIPV polynucleotide fragment can be available in the form of a vector or of a host cell.
  • the vaccine may also comprise a dysfunctional FIPV polynucleotide fragment as described hereinbefore in combination with a further vector or further polynucleotide fragment encoding a gene which when expressed the gene product thereof retains an immunogenic function.
  • a suitable further polynucleotide fragment for use in a vaccine of the invention can be selected from those described in WO 96/03435, such as vectors encoding feline ⁇ interferon.
  • the vaccine can also comprise an adjuvant.
  • Adjuvants in general comprise substances that boost the immune response of the host in a non-specific manner.
  • adjuvants may include Freund's Complete adjuvant, Freund's Incomplete adjuvant, liposomes, and niosomes as described in WO 90/11092, mineral and non-mineral oil-based water-in-oil emulsion adjuvants, cytokines, short immunostimulatory polynucleotide sequences, for example in plasmid DNA containing CpG dinucleotides such as those described by Sato Y. et al. (1996) Science Vol. 273 pp.
  • Further adjuvants of use in the invention include encapsulators comprising agents capable of forming icrospheres (1-10 ⁇ m) such as poly (lactide-coglycolide) , facilitating agents which are capable of interacting with polynucleotides such that the said polynucleotide is protected from degradation and which agents facilitate entry of polynucleotides such as DNA into cells.
  • encapsulators comprising agents capable of forming icrospheres (1-10 ⁇ m) such as poly (lactide-coglycolide) , facilitating agents which are capable of interacting with polynucleotides such that the said polynucleotide is protected from degradation and which agents facilitate entry of polynucleotides such as DNA into cells.
  • Suitable facilitating agents include cationic lipid vectors such as: l,3-di-oleoyloxy-2-(6-carboxy-spermyl) -propylamid (DOSPER) , N- [ 1- ( 2 , 3 -dioleoyloxy) propyl ] -N , N , N- trimethylammoniummethylsulfate (DOTAP) ,
  • Such cationic lipid vectors can be combined with further agents such as L-dioleoyl phosphatidyl ethanolamine (DOPE) to form multilamellar vesicles such as liposomes.
  • DOPE L-dioleoyl phosphatidyl ethanolamine
  • the vaccine may also comprise a so-called "vehicle".
  • a vehicle is a compound, or substrate to which the FIPV polynucleotide fragment can adhere, without being covalently bound thereto.
  • Typical "vehicle” compounds include gold particles, silica particles such as glass and the like.
  • FIPV polynucleotides of the invention can be introduced into appropriate cells using biolistic methods such as the high- velocity bombardment method using polynucleotide coated gold particles as described in the art (Williams R.S. et al. (1991) Proc. Natl. Acad. Sci. USA 88 pp. 2726-2730; Fynan E.F. et al. (1993) Proc. Natl. Acad Sci. USA Vol. 90 pp. 11478-11482).
  • the vaccine may comprise one or more suitable surface-active compounds or e ulsifiers, e.g. Span or Tween.
  • a FIPV polynucleotide fragment as described herein for producing at least a cell mediated immunity to FIV which comprises a defective FIPV as described above for the manufacture of a FIV vaccine for the prophylaxis and/or treatment of FIV- related disease.
  • a FIPV polynucleotide fragment in naked or vector form for the manufacture of a FIV vaccine for the prophylaxis and/or treatment of FIV infection.
  • the use is in felines.
  • a method of treating animals which comprises administering thereto a vaccine composition comprising a defective FIPV polynucleotide fragment as described herein to animals in need thereof.
  • the animals are felines.
  • the vaccine formulation may be formulated for administration by oral dosage (e.g. as an enteric coated tablet), by parenteral injection or otherwise.
  • the invention also provides a process for preparing a FIV virus vaccine, which process comprises admixing a defective FIVP polynucleotide fragment in naked or vector form as herein described with a suitable carrier or adjuvant.
  • the mode of administration of the vaccine of the invention may be by any suitable route which delivers an immunoprotective amount of the virus of the invention to the subject.
  • the vaccine is preferably administered parenterally via the intramuscular or deep subcutaneous routes.
  • Other modes of administration may also be employed, where desired, such as oral administration or via other parenteral routes, i.e., intradermally, intranasally , or intravenously.
  • the vaccine will usually be presented as a pharmaceutical formulation including a carrier or excipient, for example an injectable carrier such as saline or a pyrogenic water.
  • a carrier or excipient for example an injectable carrier such as saline or a pyrogenic water.
  • the formulation may be prepared by conventional means.
  • the specific dose level for any particular recipient animal will depend upon a variety of factors including age, general health, and sex; the time of administration; the route of administration; synergistic effects with any other drugs being administered; and the degree of protection being sought. Of course, the administration can be repeated at suitable intervals if necessary.
  • a polynucleotide fragment encoding for an FIPV which is substantially incapable of encoding a functional RT or a functional RT fragment thereof for use as a medicament for FIV- related disease.
  • a deletion may be made in the RT domain of the pol gene which deletion may be an in-frame deletion as described herein.
  • insertions into deletion sites may be made to FIPV of the invention as utilised under this aspect of the invention as described herein.
  • an FIPV comprising a dysfunctional pol gene in the manufacture of a vaccine for the prophylaxis and/or therapy of FIV-related disease.
  • the pol gene comprises a deletion within its_ RT domain, such as an in-frame deletion as described herein.
  • insertions into deletion sites may be made to FIPV of the invention as utilised under this aspect of the invention as described herein.
  • Figure 1 Nucleotide sequence of FIV F14 (Petaluma strains) showing ⁇ RT site (3496 to 3595) (Sequence ID. No. 5) Pac I, Ncol and Sph I sites.
  • Figure 5 Genome Map of FIV RT deletion mutant. Fi ⁇ ure 6; Peripheral blood viral loads in a) trial-6(a) at
  • Figure 7 Sequence of the Hind III - Not I fragment in plasmid pRSV- ⁇ -IFN (Sequence ID. No. 7) .
  • FIV-Petaluma The F14 clone of FIV-Petaluma was modified by introducing a deletion centred on a unique Pad restriction site in the RT domain of the pol gene, in a region homologous to the "connection" domain of human immunodeficiency virus RT.
  • a clone with a 33-codon, in-frame deletion was identified and designated FIV- ⁇ RT. This clone was characterised in vitro by transfection into fibroblasts.
  • Fibroblast cell lines were derived from skin biopsy samples (4mm in diameter) obtained from all cats under general anaesthesia prior to immunisation or challenge, and maintained in minimal essential medium (MEM) ALPHA medium with ribonucleosides and deoxyribonucleosides (Biological Industries, Paisley, UK) supplemented with 10% foetal bovine serum (FBS) , 2mM L-glutamine, and 100IU of penicillin, lOO ⁇ g streptomycin, lOng of human epidermal growth factor (Sigma, Poole, UK) per ml.
  • MEM minimal essential medium
  • FBS foetal bovine serum
  • FBS foetal bovine serum
  • streptomycin 2mM L-glutamine
  • Virus-specific effector CTL present in the fresh PBMC were detected using autologous or allogeneic skin fibroblast target cells labelled with 50 ⁇ Ci of sodium [ 51 Cr] chromate (Amersham International, Aylesbury, UK)/10 b cells for 18 hours at 37°C, washed three times, and then infected with 5 to 10 plaque-forming units/cell of recombinant vaccinia virus expressing either the gag or env gene product from FIV/Glasgow-14 or FIV/Petaluma, respectively, or with wild-type vaccinia virus for 1 hour at 37°C.
  • PBMC Peripheral blood mononuclear cells
  • PBMC peripheral blood mononuclear cells
  • Ficoll-Paque separation Pulcoll-Paque separation
  • Decreasing numbers of PBMC (2 x 10 6 , 2 x 10 5 , 2 x 10 4 , 2 x 10 3 , 2 x 10 2 , 20 and 2) were co-cultivated in duplicate in 24-well plates with 5 x 10 5 Miyazawa-1 cells in 1.5ml RPMI-1640 medium (Gibco) supplemented with 10% foetal bovine serum (Imperial Laboratories) , 2 mmol/1 glutamine, 100 IU penicillin, lOOmg/ml streptomycin (all from Gibco BRL) and 5 x 10 "5 mol/1 2-mercaptoethanol (Sigma Chemical Co.). Twice weekly, 0.5ml of the culture supernatant was removed and replaced with fresh medium. The culture supernatant collected on day 14 was tested by
  • the F14 clone of FIV/Petaluma (Olmsted et al. 1989 supra) which includes approximately 9 kb of uncharacterised feline genomic DNA flanking the proviral sequence within the vector pGEM-7Zf + (Pro ega) includes a unique Pac 1 site within the RT region of the pol gene (nucleotides 3540-3547) .
  • Linearised plasmid was purified by precipitation then digested with Bal31 exonuclease under conditions calculated to allow a rate of 30 bp/minute (Maniatis T. et al. supra) .
  • Clones were examined by polymerase chain reaction (PCR) amplification across a 235 bp region of pol encompassing the Pac 1 site.
  • PCR polymerase chain reaction
  • ⁇ RT One clone
  • FIV- ⁇ RT 50 ⁇ g plasmid DNA
  • the parental F14 plasmid served as positive control.
  • syncytia were observed in the transfected cultures but not in mock-transfected cells (no DNA) . This result implied that cells expressing the deleted provirus were able to fuse with neighbouring cells, presumably because they elaborated functional envelope glycoprotein.
  • Syncytia were readily stained by immunofluorescence using serum pooled from FIV-infected cats.
  • Gag capsid protein p24
  • F14 or ⁇ RT commercial antigen ELISA
  • Other viral proteins in cell lysates were analysed by SDS PAGE and immunoblotting using serum pooled from FIV-infected cats. Gag precursor and mature (capsid) proteins, and also envelope surface glycoprotein, were observed.
  • the capsid antigen could be pelleted from cell supernatants by ultracentrifugation, as detected by ELISA and immunoblotting. Thus the defective provirus was still capable of directing synthesis of antigenic particles.
  • RT activity was measured in culture supernatants. Cultures corresponding to wild type F14 were strongly positive, whereas cells transfected with FIV- ⁇ RT showed no activity above background levels (Table 1) .
  • a region from the 5 'LTR to the primer binding site in F14 ⁇ RT was replaced by the immediate early promoter from human cytomegalovirus. This procedure was designed both to enhance expression of FIV antigens, and to reduce the risk of reversion to a replicating provirus, in tissues after inoculation of DNA.
  • the construct was designated CMV ⁇ RT, and its construction was achieved as follows:
  • Sal I and Sst I were used to digest plasmid F14 ⁇ RT, the resulting mixture of fragments was religated and used to transform E.coli (DS941) , and a clone with the structure expected of ⁇ RT-Sal/Sst was identified. CMV sequences could then be introduced upstream of the Sst I site.
  • a PCR product encompassing FIV sequences from the primer binding site to a point downstream of the Sst I site was derived from the F14 plasmid using Taq polymerase (Perkin Elmer) and the method of Saiki et al (1985) Science 230 pp. 1350-1354;
  • the primers used (corresponding to co-ordinates 356-376 (Sequence ID No. 3) and 1963-1980 (Sequence ID No. 4) of the F14 provirus) were constructed with additional Sal I "tails", and had the sequences: GATCGTCGACGTTGGCGCCCGAACAGGACT (5') and GATCGTCGACTTATAAATCCAATAGTTT (3').
  • This PCR product was cloned into the Hinc II site of plasmid vector pIC19R (Marsh et al. (1984) Gene 32 pp 481-485) to yield pPBSGAG.
  • FIV sequence from pPBSGAG was then released as a Sal I fragment and cloned into the Sal I site of pIC20H (Marsh et al. supra) to give pPBSSal.
  • the CMV IE promoter was cloned infront of these FIV sequences as a Bgl II-Kpn I fragment from expression vector pcDNA3 (Invitrogen) , yielding pCMVPBS.
  • Sst I fragment from this clone including the IE promoter and FIV sequences from the primer binding site to the proviral Sst I site, was then cloned into the Sst I site in ⁇ RT-Sal/Sst.
  • the resulting DNA sequence from within the CMV IE promoter to a point downstream of the FIV proviral Sst I site was confirmed by direct sequencing.
  • Feline ⁇ -interferon cDNA was available as a cDNA clone in pCR-ScriptSK(+) (Stratagene) as described in Argyle D.J. et al. (1995) (DNA Sequence 5, 169-171) .
  • the cDNA sequence was excised with restriction enzymes Hindlll and NOtI (Sequence ID No. 7) and inserted into pRc/RSV expression vector (Invitrogen) to produce the pRSV- ⁇ IFN plasmid.
  • the efficacy of DNA immunisation to protect cats from infection with feline immunodeficiency virus (FIV) was determined. Twenty 12 week old kittens were randomised into 4 groups of 5.
  • the DNA used in the inoculations comprised a plasmid ⁇ RT, either alone or in conjunction with feline ⁇ -IFN DNA, as shown below:
  • the cats were inoculated intramuscularly with test DNA at each of 4 sites with lOO ⁇ g DNA in 200 ⁇ l PBS on weeks 0, 10 and 23.
  • the cats were challenged intraperitoneally on week 26 with 25 cat infectious doses 50% (CID 50 ) of FIV-Petaluma derived from the F-14 molecular clone, propagated in Q201 cells (Willett et al. (1991) AIDS Vol. 5 pp. 1469-1475).
  • Antibody responses were measured by immunoblotting according to the method of Hosie M. J. , 0. Jarrett (1990) AIDS 4 pp. 215-220 and to peptides representing two immunodominant epitopes from the viral envelope proteins (V3 and TM) by enzyme linked immunosorbent assay (ELISA) (Hosie M.J. and Flynn J.N., (1996) J. Virol. 70 pp. 7561-7568) 3 weeks after each vaccination and 3, 6, 9, and 12 weeks following challenge.
  • ELISA enzyme linked immunosorbent assay
  • FIV Gag- and Env-specific effector CTL activity was detected following the method of Hosie M.J. and Flynn J.N. (1996) supra, in the fresh peripheral blood of all cats immunised with the ⁇ RT plasmid (A481-A485) three weeks following vector delivery.
  • the response was only observed on autologous target cells, suggesting that the response was MHC-restricted.
  • the FIF Gag- specific responses appeared higher than (A481 and A482) or similar to the levels of Env- specific lysis observed at an E:T ratio 50:1 and levels ranged between 20 and 54%.
  • the boost at week 10 had the effect of raising the FIV Gag- specific CTL activity in 3 out of 5 cats immunised with the ⁇ RT construct, in addition non-specific responses were detected in 2 cats.
  • a similar effect was noted in cats immunised with ⁇ RT and ⁇ -IFN, with Gag-specific CTL activity boosted in 2 cats.
  • A490 maintained similar levels of Env-specific lysis to that observed at week 10. Negligible FIV-specific lysis was recorded in control cats.
  • Virus isolation from PBMC was attempted following immunisation but was negative at all times prior to and including the day of challenge, indicating that there was no reversion to virulence of the mutant provirus during this period.
  • cats were monitored for infection by virus isolation.
  • 5/5 control cats receiving no DNA had become infected, together with 5/5 cats inoculated with feline ⁇ -IFN DNA.
  • there was evidence of protection in the groups inoculated with ⁇ RT DNA (Table 3) . No virus could be isolated from one of the 5 cats in group 1 or from 3/5 cats in group 2.
  • A485 4 A495 6 mean 2.6 1 4.8
  • A490 0 A500 4 mean 1.4 2 4.6
  • TM titre of antibodies recognizing TM peptide
  • TM titre of antibodies recognizing TM peptide nd : not done

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des formulations de vaccins contre les maladies liées au VIF (virus de l'immunodéficience féline), comportant un polynucléotide PVIF (provirus de l'immunodéficience féline) renfermant un gène pol dysfonctionnel, des fragments du polynucléotide PVIF et leurs utilisations dans la prophylaxie et/ou le traitement de maladies liées au VIF.
EP98912585A 1997-03-11 1998-03-10 Vaccin anti-vif Withdrawn EP1007687A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB9704977 1997-03-11
GBGB9704977.9A GB9704977D0 (en) 1997-03-11 1997-03-11 FIV vaccine
PCT/GB1998/000715 WO1998040493A1 (fr) 1997-03-11 1998-03-10 Vaccin anti-vif

Publications (1)

Publication Number Publication Date
EP1007687A1 true EP1007687A1 (fr) 2000-06-14

Family

ID=10809020

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98912585A Withdrawn EP1007687A1 (fr) 1997-03-11 1998-03-10 Vaccin anti-vif

Country Status (6)

Country Link
EP (1) EP1007687A1 (fr)
JP (1) JP2002501369A (fr)
AU (1) AU6736998A (fr)
CA (1) CA2283490A1 (fr)
GB (1) GB9704977D0 (fr)
WO (1) WO1998040493A1 (fr)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2314683A1 (fr) * 1997-12-12 1999-06-24 Luigi Naldini Emploi therapeutique de vecteurs lentiviraux
US6764676B1 (en) 1998-08-24 2004-07-20 Pfizer Inc. Compositions and methods for protecting animals from lentivirus-associated disease such as feline immunodeficiency virus
DE69929024T2 (de) * 1998-08-24 2006-06-22 Pfizer Products Inc., Groton Immunschwächevirus Stamm FIV-141 der Katze und dessen Verwendungen
EP1074625A3 (fr) 1999-06-14 2002-01-02 Pfizer Products Inc. ADN vaccin contre le virus de l'immunodéficience chez les félins
US8473414B2 (en) * 2010-04-09 2013-06-25 Visa International Service Association System and method including chip-based device processing for transaction

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9414752D0 (en) * 1994-07-21 1994-09-07 Q One Biotech Ltd Feline gamma-interferon
US6004799A (en) * 1996-03-05 1999-12-21 The Regents Of The University Of California Recombinant live feline immunodeficiency virus and proviral DNA vaccines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9840493A1 *

Also Published As

Publication number Publication date
CA2283490A1 (fr) 1998-09-17
GB9704977D0 (en) 1997-04-30
WO1998040493A1 (fr) 1998-09-17
AU6736998A (en) 1998-09-29
JP2002501369A (ja) 2002-01-15

Similar Documents

Publication Publication Date Title
JP4749481B2 (ja) 弱毒化された非機能性ｖｉｆタンパク質による免疫応答性誘導
JP5339687B2 (ja) 多種サブタイプｆｉｖワクチン
US8703145B2 (en) Materials and methods for immunizing against FIV infection
US6004799A (en) Recombinant live feline immunodeficiency virus and proviral DNA vaccines
KR19990087126A (ko) 합성 사람 면역결핍 바이러스 유전자
JP2009005706A (ja) 抗−ネコ免疫不全ウイルス（ｆｉｖ）ワクチン
US20080095791A1 (en) Recombinant HIV-1 gp120 Immunogen with Three Different V3 Loops from Viruses of Different Clades
Billaut-Mulot et al. Interleukin-18 modulates immune responses induced by HIV-1 Nef DNA prime/protein boost vaccine
GARDNER Vaccination against SIV infection and disease
JP4477770B2 (ja) ネコ免疫不全ウイルスのｅｎｖ遺伝子に由来するペプチド、およびその使用
KR100347220B1 (ko) 재조합아데노바이러스hiv백신
WO1998040493A1 (fr) Vaccin anti-vif
KR20030047667A (ko) ＳＩＶｍａｃ239의 면역원성 플라스미드 및 이들을 함유한ＡＩＤＳ ＤＮＡ 백신
GRANGE et al. Induction of neutralizing antibodies against HTLV-I envelope proteins after combined genetic and protein immunizations in mice
US20030118601A1 (en) FIV vaccine
EP0328390B1 (fr) Traitement aux peptides de maladies infectieuses rebelles
KR20030016374A (ko) Ｈｉｖ 보조 단백질을 암호화하는 ｄｎａ 백신
KR101059721B1 (ko) 면역원성 조성물 및 의약
by Coadministration Feline Leukemia Virus DNA Vaccine
WO2004041997A2 (fr) Regimes d'immunotherapie chez des patients atteints du vih
WO2005103302A2 (fr) Acides nucleiques viraux mutants et vaccin en contenant
JP2001169784A (ja) Ｄｎａワクチン

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990827

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20030725

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20041112