EP0988052A2 - Vaccin comprenant de l'adn a enveloppe du virus de la grippe - Google Patents

Vaccin comprenant de l'adn a enveloppe du virus de la grippe

Info

Publication number
EP0988052A2
EP0988052A2 EP98929369A EP98929369A EP0988052A2 EP 0988052 A2 EP0988052 A2 EP 0988052A2 EP 98929369 A EP98929369 A EP 98929369A EP 98929369 A EP98929369 A EP 98929369A EP 0988052 A2 EP0988052 A2 EP 0988052A2
Authority
EP
European Patent Office
Prior art keywords
virus
vaccine according
mumps
vaccine
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP98929369A
Other languages
German (de)
English (en)
Inventor
Maria Grazia Cusi
Reinhard Glück
Ernst WÄLTI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cilag GmbH International
Original Assignee
Schweiz Serum und Impfinstitut Bern
Schweiz Serum und Impfinstitut und Institut zur Erforschung der Infektionskrankheiten
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Schweiz Serum und Impfinstitut Bern, Schweiz Serum und Impfinstitut und Institut zur Erforschung der Infektionskrankheiten filed Critical Schweiz Serum und Impfinstitut Bern
Priority to EP98929369A priority Critical patent/EP0988052A2/fr
Publication of EP0988052A2 publication Critical patent/EP0988052A2/fr
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
    • A61K39/165—Mumps or measles virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Liposomes
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers with substantial amounts of non-phosphatidyl, i.e. non-acylglycerophosphate, surfactants as bilayer-forming substances, e.g. cationic lipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5258—Virus-like particles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541—Mucosal route
    • A61K2039/543—Mucosal route intranasal
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6075—Viral proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18711—Rubulavirus, e.g. mumps virus, parainfluenza 2,4
    • C12N2760/18734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to virosomes comprising cationic lipids, biologically active influenza hemagglutinin protein or biologically active derivatives thereof and nucleic acids encoding antigens from pathogenic sources in their insides.
  • the nucleic acids are most advantageously DNA. It is preferred that the DNA encodes antigens from mumps virus wherein said antigens are derived from conserved external and internal proteins of said virus.
  • the virosomes of the invention may advantageously be formulated as vaccines. It could be shown in accordance with the present invention that such vaccines induce strong neutralizing antibody as well as cytotoxic T cell responses. Most importantly, protection to pathogenic sources such as a mumps virus could be demonstrated.
  • the present invention further relates to vaccines comprising recombinant DNA derived from DNA encoding conserved external and internal proteins from mumps virus.
  • Plasmid DNA vaccines may find application as preventive vaccines, immunizing agents for the preparation of hyperimmune globuline products or diagnostics and therapeutic vaccines for infectious diseases or for other indications such as cancer.
  • Plasmid DNA vaccines are defined as purified preparations of plasmid DNA designed to contain a gene or genes for the intended vaccine antigen as well as genes incorporated into the construct to allow for production in a suitable host system. Plasmid DNA vaccines currently under development are constructs derived from bacterial plasmids that contain one or more genes from an infectious agent.
  • plasmids possess DNA sequences necessary for selection and replication in bacteria, eukaryotic promoters and enhancers and transcription termination/ polyadenylation addition sequences for gene expression.
  • efficient gene transfer techniques have to be employed for an acceptable vaccine in humans.
  • transformation or transfection is one of the most powerful and far-reacting methodologies to come out of molecular biology. It has played a critical role in the study of gene expression and protein structure and function.
  • many standard techniques work on only limited ranges of host cells and others are labor intensive or require large numbers of cells.
  • Virus mediated gene transfer Genes can be introduced stably and efficiently into mammalian cells by retroviral vectors. However, the efficiency is very low for cells that are non-replicating because retroviruses infect only dividing cells. Further, general safety concerns are associated with the use of retroviral vectors relating to, for instance, the possible activation of oncogenes. Replication-defective adenovirus has become the gene transfer vector-of-choice for a majority of investigators. The adenovirus vector mediated gene delivery involves either the insertion of the desired gene into deleted adenovirus particles or the formation of a complex between the DNA to be inserted and the viral coat of adenovirus by a transferrin-polylysine bridge.
  • HVJ Sendai virus
  • HVJ Sendai virus
  • This method has successfully been used for gene transfer in vivo to many tissues.
  • cellular uptake to antisense oligonucleotides by HVJ-liposomes was reported (Morishita et al. 1993; J. Cell. Biochem. 17E, 239).
  • a particular disadvantage is, however, that the HVJ-liposomes show non-specific binding to red blood cells.
  • Lipid mediated gene transfer Positively charged liposomes made of cationic lipids appear to be safe, easy to use and efficient for in vitro transfer of DNA and antisense oligonucleotides. The highly negatively charged nucleic acids interact spontaneously with cationic liposomes. Already by simple mixing of the polynucleotides with preformed cationic liposomes a complete formation of DNA-liposome complexes is achieved.
  • Biolistics as gene transfer methods The term "biolistics" (biological ballistics) is used to define processes that literally shoot high velocity microprojectiles, carrying DNA, into cells. The biolistic process was originally developed by Sanford et al. (Sanford, J.C., Klein, T.M., Wolf, E.D., Allen, N.: Delivery of substances into cells and tissues using a particle bombardment process. J. Part. Sci. Technol. 1987. 5: 27-37) as a means of introducing DNA into plant cells. The limitations of existing methods of gene transfer stimulated the idea of shooting tungsten or gold particles coated with DNA directly into cells.
  • the technical problem underlying the present invention was to overcome the disadvantages associated with the development of the prior art nucleic acid vaccines and provide a means that can successfully be used in the formulation of highly protective and safe vaccines.
  • the solution to said technical problem is achieved by providing the embodiments characterized in the claims.
  • the present invention relates to a vaccine comprising a virosome, said virosome comprising
  • HA hemagglutinin protein
  • nucleic acid comprising a nucleic acid encoding an antigen derived from a pathogen located in the inside.
  • the vaccine of the invention optionally comprises a pharmaceutically acceptable carrier and/or diluent and is preferably formulated according to conventional protocols.
  • cationic lipid refers to cationic and/or polycationic lipids. Said term thus describes an organic molecule that contains a cationic component and a nonpolar tail, a so-called head-to-tail amphiphile, such as N-[(l,2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium chloride (DOTMA) (Feigner et al. 1987; Proc. Natl. Acad. USA 84: 7413-7417), N-[l,2,3-dioleoyloxy)-propyl]-N,N,N-trimethylammonium-methyl-sulfate
  • DOTMA N-[(l,2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium-methyl-sulfate
  • DOTAP N-t-butyl-N'-tetradecyl-3-tetradecylaminopropionamidine
  • polycationic lipid refers to an organic molecule that contains a polycationic component and a nonpolar tail such as the lipospermine: 1,3- dipalmitoyl-2-phosphatidylethanolamido-spermine (DPPES) and dioctadecylamidoglycyl- spermine (DOGS) (Behr et al. 1989; Proc.
  • the cationic lipids used in accordance with the present invention optionally contain phospholipids such as phosphatidylethanolamine and phosphatidylcholine. It has proved advantageous to choose a lipid composition of the membrane comprising-band on total lipids, either
  • cationic lipids for example comprising polycationic lipids and 10% influenza virus envelope phospholipids
  • 80 to 90% by weight of cationic lipids for example comprising polycationic lipids, 5 to 10% influenza virus envelope phospholipids and 5 to 10% by weight of phosphatidyl-ethanolamine
  • 40 to 80% by weight of cationic lipids comprising, for example, polycationic lipids, 5 to 20% by weight of influenza virus envelope phospholipids, 5 to 15% by weight of phosphatidyl-ethanolamine and 5 to 50% by weight of phosphatidyl-choline.
  • the cationic vesicles with the HA component advantageously have a mean diameter of approximately 100 - 200 nm and a completely closed lipid bilayer.
  • the structure of the cationic bilayer membrane is such that the hydrophilic, positively charged heads of the lipids are oriented towards the center of the bilayer.
  • cationic virosomes need not fuse with or destabilize the plasma cell membrane to enter the cytoplasm.
  • Cationic virosomes enter the host cells via a two step mechanism: (1) attachment and (2) penetration. In the first step they bind via hemagglutinin and/or the cell-specific markers to cell receptors, particularly to membrane glycoproteins or glycolipids with a terminal sialic acid, and are then very efficiently incorporated by receptor-mediated endocytosis.
  • the term "influenza hemagglutinin protein (HA) or derivative thereof which is biologically active and capable of inducing the fusion of said virosome with cellular membranes and of inducing the lysis of said virosome after endocytosis by antigen presenting cells” relates to (poly)peptides which substantially display the full biological activity of native hemagglutinin and are thus capable of mediating the adsorption of the cationic vesicles of the present invention to their target cells via sialic acid- containing receptors.
  • the reconstituted viral spike proteins hemagglutinin and preferably also neuraminidase
  • the biologically active hemagglutinin referred to in this specification preferably refers to the fusion peptide which is incorporated into the trimeric hemagglutinin molecule of influenza virus.
  • biologically active hemagglutinin may refer to the complete hemagglutinin trimer of viral surface spikes or to one monomer or to one or both cleaved subunits, the glycopeptides HA1 and HA2, containing the functional fusion peptide.
  • said term refers to the fusion peptide itself, isolated or synthetically produced.
  • the fusion peptide mediates the entry of the plasmid-influenza envelope complex into the cytoplasm by a membrane-fusion event and finally leads to the release of the transported plasmid into the cell where it will be expressed.
  • the virosomes are incorporated via receptor-mediated endocytosis in the course of which the virosomes get entrapped in endosomes.
  • the developing acidic pH (pH 5-6) within the endosomes activates the hemagglutinin fusion peptide and triggers the fusion of the virosomal membrane with the endosomal membrane (Wiley, D.C. and Skehel, J.J., Ann. Rev. Biochem. 56 (1987), 365).
  • the membrane fusion reaction opens the lipid envelope of the virosomes and liberates the entrapped genetic material into the cytosol.
  • the encapsulated material is released shortly after endocytosis so as to avoid an undesired long stay in the endosomes which would give rise to unspecific degradation of the substances contained in the virosomes.
  • the molecules mechanisms underlying the subsequent expression of said genetic material is expected to follow conventional and well-known rules.
  • the reconstituted virosomes of the present invention have essentially the same fusion activity towards target cells as the intact virus from which they are reconstituted.
  • the comparison of fusogenicity is drawn to intact influenza A virus.
  • the fusion activity is measured according to known procedures, preferably as reported by Hoekstra et al. (1984), Biochemistry 23: 5675-5681 and L ⁇ scher et al. (1993), Arch. Virol. 130: 317-326.
  • the HA or derivative thereof may be obtained from natural sources, it may further be of recombinant or semisynthetic origin or may be chemically produced.
  • the vaccine of the present invention has the additional advantage that large DNA concentrations in the vaccine are avoided.
  • nucleic acid comprising a nucleic acid encoding an antigen derived from a pathogen refers to nucleic acids carrying, for example, mumps genes or other microbial genes. Said nucleic acids encode at least one antigen from a pathogenic source. Advantageously, said nucleic acids are cloned under appropriate promoter control.
  • the corresponding construct is a vector and preferably a plasmid. The preferred inoculated plasmid DNA seems to persist episomally without replication in the nuclei of myocytes without integrating into the genome.
  • antigen denotes a two- or three-dimensional proteinaceous, including lipoproteinaceous and glycoproteinaceous structure forming at least one epitope specific for a pathogen that is recognized in a B cell or T cell response.
  • the antigen is "derived” from the pathogen e.g. by using a nucleic acid directly obtained from said pathogen which is then translated.
  • the term “derived” also includes that the nucleic acid encoding said antigen which was obtained from a natural source has been altered by recombinant means, as long as the immunological characteristics leading to protection against the pathogenic features of said source remain essentially unaltered.
  • Said nucleic acids as well as the antigens may also be produced by synthetic or semisynthetic methods.
  • the virosome of the invention also comprises intact neuraminidase molecules that are preferably also derived from influenza virus.
  • Viral neuraminidase is an exoglycosidase that hydrolyzes terminal sialic acid residues from any glycoconjugate, including the viral glycoprotein themselves.
  • the virion NA spikes are tetramers of the NA molecules that are anchored in the lipid bilayer by an amino-terminal hydrophobic amino acid sequence (Shaw, M.W., et al., 1992: New Aspects of Influenza Viruses. Clin. Microbiol. Reviews, 74-92). Recently it could be demonstrated that inhibition of the neuraminidase activity, e.g. through antibodies, leads to the reduction of influenza infectivity in human.
  • said cationic lipid is an organic molecule that contains a (poly)cationic component and a non-polar tail, wherein said
  • (poly)cationic compounds comprise at least one member selected from the group consisting of:
  • N-t-butyl-N'-tetradecyl-3-tetradecylaminopropionamidine; and the polycationic lipids comprise at least one member selected from the group consisting of
  • DPES dipalmitoyl-2- ⁇ hosphatidylethanolamido-spermine
  • DOGS dioctadecylamidoglycyl spermine
  • DOSPA 2,3-dioleyloxy-N-[sperminecarboxamido)ethyl]-N,N-dimethyl-l-propane-aminiumtrifluoro- acetate
  • DOSPER 2,3-dioleyloxy-2-(6-carboxy-spermyl)-propylamide
  • TDOB N,N,N ⁇ N'-tetramethyl-N,N'-bis(2-hydroxyethyl)-2,3-dioleoyloxy-l,4-butanediammonium iodide
  • said nucleic acid is DNA.
  • the nucleic acid is advantageously cloned in DNA vectors which are particularly stable in comparison to RNA molecules.
  • said nucleic acid is RNA. This embodiment may be advantageous if direct expression of the nucleic acid is desired, i.e. the nucleic acid has not to enter the nucleus to be transcribed into expressible RNA.
  • nucleic acid contained in said virosome is a polycistronic acid.
  • the various cistrons may encode at least two antigens of the same or different pathogens.
  • one cistron may encode an antigen of mumps virus and the other cistron may encode an antigen from a different microbial source.
  • Coexpression of different proteins in stochiometrically defined ratios within a single cell can be achieved by polycistronic expression constructs. Following the intramuscular inoculation of "naked" plasmid DNA encoding an antigen, humoral and cellular immune response against the respective antigen expressed by the construct can be primed.
  • polycistronic nucleotide vectors in DNA-based immunization allows the use of at least two novel options for genetic immunizations:
  • Polycistronic nucleotide vectors can be used to deliver with a single injection a multivalent vaccine that efficiently stimulates a broad spectrum of immune reactivities against several antigens from the same or different pathogens.
  • Polycistronic vectors can be constructed that limit the life span of the in vivo transfected cell. This is achieved by co-expressing an inducible suicide gene within the antigen-presenting cell. The construct thereby allows expression of the antigen for a few weeks, sufficient to prime an immune response, but allows subsequent elimination of cells expressing the foreign expression constructs.
  • a particularly preferred embodiment according to the invention concerns a polycistronic construct, which is characterized by a suicide gene preferably inducible with a therapeutically acceptable drug.
  • the suicide gene may be comprised in the nucleic acid together with one or more nucleic acid sequences encoding antigenes from the same or different pathogens.
  • said pathogen is a bacterium, a prion, a parasite or a virus.
  • said virus is a single-stranded, non-segmented, genome negative-sense RNA virus, preferably of the family Paramyxoviridae and most preferably mumps virus or measles virus.
  • the mumps virus belongs to the paramyxoviridae, subclass paramyxovirus. It is a pathogen causing the contagious infantile illness which consists of the inflammation of parotid glands. During the incubation period following infection, the virus replicates in the respiratory epithelium and then disseminates into secretory ducts of the parotid glands. Other glands may become infected thereafter and numerous cases of meningitis have been reported. Among complications related to the infection, encephalitis is a serious one, with a mortality rate of about 1%; deafness cases have also been reported.
  • a vaccine against mumps is available: it is made of an attenuated live virus, produced by culturing infected embryonic chicken cells or human diploid cells.
  • the vaccine leads to the seroconversion in vaccinated individuals in about 90 - 95%> but the protection rate in the field is far smaller than expected from the seroconversion rate.
  • several "classical" mumps vaccine strains had to be withdrawn from the market due to a high encephalotropic potential after vaccination.
  • live mumps virus vaccines are relatively low in heat stability reducing their use in the field, specially in developing countries, where it is difficult to maintain a cold chain.
  • said nucleic acid is a recombinant vector, preferably a plasmid.
  • the "naked" mumps DNA plasmids contain genes encoding the hemagglutinin-neuraminidase (HN) antigen of mumpsvirus, the fusion (F) protein of mumps virus and the nucleoprotein (NP) of mumps virus.
  • HN hemagglutinin-neuraminidase
  • F fusion protein of mumps virus
  • NP nucleoprotein
  • the invention provides an influenza enveloped mumps DNA vaccine which contains the following components:
  • mumps polynucleotide monocistronic expression vectors or polycistronic expression vectors may be done as follows:
  • pCMV promoter insertion and construction of mono- or poly- cistronic expression vectors Promoter sequence of the immediate early region of the human cytomegalo- virus or of the desmin gene have been shown to support expression of an immunogenic gene product after intramuscular injection of plasmid DNA.
  • Recombinant plasmids of this invention contain one or several gene inserts of mumps virus or other microbial agents (e.g.
  • hepatitis A, B, C, D or E -virus RSV, Dengue virus, HIV, Rabies virus, Influenza virus, Measles virus, Parainfluenza virus, Rhinovirus, Pseudomonas, Klebsiella, Escherichia coli, Salmonella typhi, Haemophilus influenzae, Bordetella pertussis or Plasmodium falciparum).
  • the fusion between two vectors can generate dicistronic pCMV, etc.
  • This most preferred expression construct according to the invention may also be characterized in that the CMVp sequence is replaced for the SV40p sequence.
  • the invention further relates to a vaccine comprising a vector encoding the hemagglutinin- neuraminidase antigen of mumps virus, the fusion protein of mumps virus and the nucleoprotein of mumps virus.
  • said vector is GC9, GC23 or GCNP or GCDC described in the examples hereinafter.
  • the present invention relates to a method simulating the immune system of a patient in need thereof, comprising administering a suitable dosage of the vaccine described herein above.
  • a suitable dosage may be in the range of Influenza HA 1 - 50 meg
  • the aforedescribed method is for the prophylaxis of infectious diseases.
  • the above described vaccines are designed to be administered via nasal routes.
  • the design and formulation, respectively, may be effected according to conventional procedures.
  • Figure 1 Immunofluorescence test carried out on Vero cells infected by DOTAP -virosomes encapsulating mumps plasmids by using anti-mumps polyclonal antibodies
  • Figure 2 Visualization of FITC plasmids through virosomes into Vero cells
  • Figure 3 Influenza virosomes containing plasmids expressing mumps F-antigen; negatively stained with phosphatungstate, magnification x 100.000
  • Figure 4 pH fusion reaction of DOTAP-virosomes expressed as fluorescence dequencing
  • Figure 5 Visualization of FITC Mumps plasmids through virosomes into Vero cells The examples illustrate the invention.
  • the recombinant plasmids of the present invention can be produced by recombinant DNA techniques, such as those set forth generally by Maniatis et al, MOLECULAR CLONING, A Laboratory Manual, Cold Spring Harbor Laboratory (1982).
  • hemagglutinin gene (1749 bp) of the Urabe strain of the mumps virus (Yamanishi et al., (1970), Studies on live mumps vaccine III. Evaluation of newly developed live mumps vaccine. Biken Journal 13, 157-161) was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). RNA was extracted from viral genomic RNA, using the guanidinium thiocyanate-phenol-chloroform method, described by Chomczynski and Sacchi (1987, Anal. Biochem. 162).
  • the synthesis of the cDNA was performed in a 25 ⁇ l reaction volume containing 50 mM KC1, 10 mM Tris-HCl pH 8.3, 5 mM MgCl 2 , 1 mM dNTP mixture (1 mM each), 20 U RNase inhibitor (Boehringer Mannheim, Germany) 40 U MMLV-RT (Perkin- Elmer Cetus, USA) and 0.75 mM of the sense primer after a denaturation step at 80°C. The mixture was incubated at 37°C for 30 min, followed by 3 min denaturation at 94°C, and cooled on ice.
  • the PCR was performed in a 100 ⁇ l volume containing 25 ⁇ l of the cDNA reaction, 10 ⁇ l of the PCR buffer (100 mM Tris-HCl pH 8.3, 500 mM KC1 and 25 mM MgCl 2 ), 20 pmol each of sense primer (5 * GGATCCAGATGGAGCCCTCGAAA3') and anti- sense primer (5'GATCCTTATCAAGTGATAGTCAATCT3'), 0.125 mM dNTP mixture and 2 U of Taq polymerase (Perkin-Elmer Cetus, USA). The samples were subjected to 40 cycles of thermal cycling for 94°C 1 m in, 56°C 40 s, 72°C 90 s.
  • Both the primers contained the restriction site for BamHI.
  • the PCR product was purified with the QIAQUICK PCR purification kit (QIAGEN, Germany) and digested with the restriction enzyme BamHI (1.5 U) in a 100 ⁇ l volume containing the specific buffer (10 ⁇ l) (Boehringer Mannheim, Germany) at 37°C overnight.
  • the insert was then purified from the agarose gel by using the QIAquick gel extraction kit (QIAGEN, Germany) and cloned in plasmid pcDNA3 (InVitrogen) which had previously been cut by BamHI and treated with the calf intestine phosphatase (CUP) (Boehringer Mannheim, Germany) in order to eliminate the circularization of the vector itself.
  • QIAquick gel extraction kit QIAGEN, Germany
  • CUP calf intestine phosphatase
  • Plasmid pcDNA3 is a 5.4 Kb vector containing the CMV promoter (bases 209-863), the BGH polyadenylation site (bases 1018-1249), the polylinker (bases 889-994), the SV40 promoter (bases 1790-2115) and the SV40 polyadenylation site (bases 3120-3250).
  • the recombinant plasmids containing the HN gene of the Urabe strain (GC9) or the wild type (GC19) of the Mumps virus were used to transform the E.coli bacteria (DH5 ⁇ strain) and some transformants were obtained.
  • the DNA plasmids were recovered from the cells and the HN genes were sequenced by the dideoxy method using Sequenase (U.S.
  • pCMV ⁇ 7.2 Kb
  • This vector contains a CMV promoter, an RNA splice site, an SV40 polyadenylation site and the full length E.coli ⁇ -gal gene located within a pair of NotI restriction sites (bases 820-4294) for excision and replacement with the HN gene of the Mumps virus (GD9 and GDI 9).
  • the genes were inserted in another eukaryotic plasmid vector, pCI (4 Kb) (Promega, USA) which contains a CMV promoter, an SV40 polyadenylation site and a multiple cloning site where the HN gene of the Mumps virus was placed.
  • pCI 4 Kb
  • the procedure followed for these new constructs was the same of the one above mentioned, except for the primers used for the amplification of the HN gene, both of which contained the NotI restriction site (sense primer: 5' GCGGCCGCAGATGGAGCCCTCGAAA3' and anti-sense primer: 5'
  • the F gene (1713 bp) of the Mumps virus (Urabe strain) (Cusi M.G. et al. Gene 161, 1995) deleted of the trans-membrane fragment (nt 1492) at the carboxy-terminal (GC 23) was amplified by RT-PCR from the virus genome and sequenced. The procedure used for this reaction was the same of the above mentioned.
  • the primers used containing the Bgl II site for the insertion in the pcDNA3 plasmid cut by BamHI were: sense primer 5 * ACAGATCTGATCAGTAATCATGAA3' and anti-sense primer
  • the primers used containing the NotI site for the insertion in the pCMV ⁇ (GD23) and pCI plasmid were: sense primer 5'GCGGCCGCGATCAGTAATCATGAA3' and anti-sense primer
  • NP nucleocapsid (NP) gene (1657 nt) of the Mumps virus (Urabe strain) was amplified by RT-PCR from the virus genome. The procedure used for this reaction was the same of the above mentioned.
  • the primers used containing the Hindlll site for the insertion of the NP gene in the pcDNA3 vector (GC/NP) cut by Hindlll were: sense primer 5 ⁇ AGCTTATGTCGTCTGTGCTCAAA3' and anti-sense primer
  • a chimera containing the Mumps virus F and HN genes linked by a linker was cloned in BamHI of the pcDNA3 vector.
  • the F gene was deleted of the transmembrane fragment at the carboxy-terminal and the HN gene was deleted of its hydrophobic region at the amino- terminal.
  • the linker codes for 8 glycines and 2 serines; its sequence is: 5'GGTGGCGGTGGATCCGGTGGCGGCGGATCA3'.
  • a new vector was obtained from pcDNA3, after the deletion of a sequence coding for the resistance to the neomycin.
  • pcDNA3 was cut by RsrII (at position 2796 nt) and Smal (at position 2093 nt), treated with the Klenow polymerase and recircularized. It could be important not to vehiculate resistance to antibiotics in DNA vaccination or in gene therapy.
  • the Mumps virus HN and F genes were also cloned in this vector (GC 42) as described above.
  • Mumps virus HN or F genes were cloned in BamHI and Bglll sites, respectively, as described above.
  • the N gene (1176 bp) of the Respiratory Syncytial Virus was amplified by RT-PCR from the virus genome (wild type strain, isolated in the Siena area, Italy).
  • the synthesis of the cDNA was performed in a 25 ⁇ l reaction volume containing 50 mM KC1, 10 mM Tris-HCl pH 8.3, 5 mM MgCl 2 , 1 mM dNTP mixture (1 mM each), 20 U RNase inhibitor (Boehringer Mannheim Biochemicals, Germany) 40- U MMLV-RT (Perkin-Elmer Cetus, USA) and 0.75 mM of the sense primer (5'GCGGCCGCATGGCTCTTAGCAAAGTCAA3') after a denaturation step at 80°C.
  • the mixture was incubated at 37°C for 30 min, followed by 3 min denaturation at 94°C, and cooled on ice.
  • the PCR was performed in a 100 ⁇ l volume containing 25 ⁇ l of the cDNA reaction, 10 ⁇ l of the PCR buffer (100 mM Tris-HCl pH 8.3, 500 mM KC1 and 25 mM MgCl 2 ), 20 pmol of sense primer (5'GCGGCCGCATGGCTCTTAGCAAAGTCAA3') and anti-sense primer (5'GCGGCCGCTCAAAGCTCTACATCA3'), 0.125 mM dNTP mixture and 2 U of Taq polymerase (Perkin-Elmer Cetus, USA).
  • the samples were subjected to 40 cycles of thermal cycling for 94°C 1 min, 60°C 40 s, 72°C 90 s. Both the primers contained the restriction site for Not I.
  • the PCR product was purified with QIAQUICK PCR purification kit (QIAGEN, Germany) and digested with the restriction enzyme NotI (1.5 U) in a 100 ⁇ l volume containing the specific buffer (10 ⁇ l) (Boehringer Mannheim, Germany) at 37°C overnight.
  • the insert was then purified from the agarose gel by using the QUIAquick gel extraction kit (QIAGEN, Germany) and cloned in pCMV ⁇ and pCI previously cut by NotI and treated with CIP.
  • the S gene (875 bp) or the Pre-Sl, Pre-S2, S ORF (1364 bp) of the Hepatitis B Virus was amplified by PCR from the plasmid containing the HBV genome (ATCC 45020).
  • the synthesis of the DNA was performed in a 100 ⁇ l volume containing 200 ng of the DNA, 10 ⁇ l of the PCR buffer (100 mM Tris-HCl pH 8.3, 500 mM KCl and 25 mM MgCl 2 ), 20 pmol of sense primer (5'GCGGCCGCATGGAGAACATCACATCA3') for the S gene or sense primer (5'GCGGCCGCATGGGGCAGAATCTTTCCA3') for the Pre-Sl, Pre-S2,S ORF and antisense primer (5'GCGGCCGCTTAAATGTATACCCAAAGA3') , 0.125 mM dNTP mixture and 2 U of Taq polymerase (Perkin-Elmer Cetus, USA). The samples were subjected to 40 cycles of thermal cycling for 94°C 1 min, 60°C 40 s, 72°C 90 s.
  • Both the primers contained the restriction site for Not I.
  • the PCR product was purified with the QIAQUICK PCR purification kit (QIAGEN, Germany) and digested with the restriction enzyme Not I (1.5 U) in a 100 ⁇ l volume containing the specific buffer (10 ⁇ l) (Boehringer Mannheim, Germany) at 37°C overnight.
  • the insert was then purified from the agarose gel by using the QUIAquick gel extraction kit (QIAGEN, Germany) and cloned in pCMV ⁇ and pCI previously cut by NotI and treated with CIP.
  • mice Four-week-old B ALB/c female mice were obtained from Charles River Laboratories and were immunized two times at 4-week intervals in both hind legs with 50 ⁇ g of DNA (GC9) in 100 ⁇ l of saline. Ten animals were in each immunization group. While under Ketamine-xylazine anesthesia, DNA (GC9 or pcDNA3) was administered intramuscularly. Ten days after the last immunization, mice were anesthetized and sacrificed. Serum, liver and muscle samples were collected from each mouse. Antibody responses were assayed by immunofluorescence (IF) test described by Just, M., Berger, R., Glucj, R., Wegmann, A.
  • IF immunofluorescence
  • the PCR was performed in a final volume of 100 ⁇ l using 200 ng of DNA, Taq polymerase (2.5 U, Promega Corporation USA) in the specific buffer, with deoxyribonucleoside triphosphate mix (1.25 mM each) and 50 pmol of each primer (GIBCO, BRL).
  • the primers used were located on the Mumps virus HN gene : sense primer 5AAGGATCCATGGAGCCCTCGAAA3' (nt 88-111) and the anti-sense primer 5 AGGCATGTTGAGTGGATGG3' (nt 570-589).
  • DNA technology can prophylactically be applied to a vaccinee in need thereof, a number of technical problems, particularly relating to the development of a suitable carrier system, need to be solved beforehand.
  • genetic material such as, e.g., a plasmid
  • plasmid can be unstable and break down or be otherwise more or less inactivated before it reaches the target cells and it may thus be necessary to use large quantities of such material. Due to these large amounts a question arises about the potential risk in the human or animal body.
  • the cationic virosomes of the present invention as carriers for the plasmid these problems can be successfully overcome and potential toxicity can be considerably decreased.
  • the present cationic virosomes have a far higher activity and efficiency for the transfer of entrapped material, particularly of genetic material such as plasmids expressing mumps genes, into target cells than liposomes or normal virosomes known hitherto.
  • Hemagglutinin (HA) from the A/Singapore/6/86 strain of influenza virus was isolated as described by Skehel and Schild (1971), Proc. Natl. Acad. Sci. USA 79: 968-972. In short, virus was grown in the allantoic cavity of hen eggs, and was purified twice by ultracentrifugation in a sucrose gradient.
  • Purified virus was stabilized in a buffer containing 7.9 mg/ml NaCl, 4.4 mg/ml trisodiumcitrate • 2H2O, 2.1 mg/ml 2-morpholinoethane sulfonic acid, and 1.2 mg/ml N-hydroxyethyl-piperazine-N'-2-ethane sulfonic acid, pH 7.3. 53 ml of the virus suspension containing 345 ⁇ g HA per ml were pelletted by ultracentrifugation at 100,000 x g for 10 min.
  • the solution was sterilized by passage through a 0.2 ⁇ m filter and then transferred to a glass container containing 1.15 g of sterile Biobeads SM-2.
  • the container was shaken for 1 hour by using a shaker REAX2 from Heidolph (Kelheim, Germany). This procedure was repeated three times with 0.58 mg of Biobeads. After these procedures a slightly transparent solution of DOTAP virosomes was obtained.
  • HA was isolated according to Example 9. To the supernatant containing the solubilized HA trimer (6 mg HA), 5.4 mg DOTAP and 0.6 mg PC were added and dissolved. The formation of virosomes was obtained according to Example 9.
  • HA was isolated according to Example 9. To the supernatant containing the solubilized HA trimer (6 mg HA), 2.7 mg DOTAP, 0.6 mg PC and 2.7 mg PE were added and dissolved. The formation of virosomes was obtained according to Example 9.
  • the plasmids of Example (1) were used for the demonstration of the high efficiency of cationic virosomes in transfection.
  • 5'-FITC plasmids were synthesized via phosphoramidite chemistry (Microsynth GmbH, Balgach, Switzerland).
  • a mixed sequence control (msc) plasmid consisting of the same length of nucleotides as the FITC-plasmid was used.
  • DOTAP virosomes or DOTAP-PC virosomes 1 ml of DOTAP virosomes or DOTAP-PC virosomes was added to each of a) 2 mg of FITC-plasmid (1.3 ⁇ mol), and b) 3.1 mg plasmid (1.3 ⁇ mol)
  • FITC-plasmids and plasmids were incorporated into DOTAP virosomes according to Example 9.
  • Non-encapsulated plasmids were separated from the virosomes by gel filtration on a High Load Superdex 200 column (Pharmacia, Sweden). The column was equilibrated with sterile PBS. The void volume fractions containing the DOTAP virosomes with encapsulated plasmids were eluted with PBS and collected.
  • Virosome-entrapped FITC plasmid concentrations were determined fluorometrically after the virosomes were fully dissolved in 0.1 M NaOH containing 0.1 % (v/v) Triton X-100. For calibration of the fluorescence scale the fluorescence of empty DOTAP -virosomes that were dissolved in the above detergent solution was set to zero.
  • DOTAP -virosomes with encapsulated plasmids were used for tranfection experiments in vitro and in vivo.
  • Figure 1 shows the mumps antigen expression of Vero cells which were incubated four days before with DOTAP virosomes encapsulating mumps plasmids.
  • the mumps antigen expression is expressed through staining with a fluorescent polyclonal antibody from rabbit against mumps virus.
  • DOTAP -virosomes with encapsulated FITC plasmids were used for visualization of the high transfer-rate of plasmid through virosomes into Vero cells ( Figure 2). No fluorescence could be detected after giving the same amount of FITC-plasmid without virosomal encapsulation.
  • Micrographs of DOTAP virosomes confirm the unilamellar structure of the vesicles with an average diameter of approximately 120 to 180 nm as determined by laser light scattering.
  • the HA protein spikes of the influenza virus are clearly visible (Figure 3).
  • the fusion activity of the present DOTAP virosomes was measured by the quantitative assay based on fluorescence dequenching described by Hoekstra et al. (1984), Biochemistry 23: 5675-5681 and L ⁇ scher et al. (1993), Arch. Virol. 130: 317-326.
  • the fluorescent probe octadecyl rhodamine B chloride (R18) (obtained from Molecular Probes Inc., Eugene, USA) was inserted at high densities into the membrane of DOTAP virosomes by adding the buffered OEG (Ci 2Eg) solution containing DOTAP and HA to a thin dry film of the fluorescent probe, followed by shaking for 5 to 10 min for dissolving the probe, then continuing as described above under "Preparation of a cationic vesicle".
  • Vero cells were grown in 2-well tissue culture chamber slides (Nunc, Naperville, IL 60566, USA). 50 ⁇ l of FITC-mumps plasmid virosomes were added to the cells. They were incubated for 5, 15, and 30 min at 37°C, washed twice with PBS and then examined by fluorescence microscopy. DOTAP virosomes with encapsulated FITC-mumps-plasmid were rapidly incorporated into the cells as can be seen in Figure 5.
  • Vero cells were cultured in 24- well Costar plates at an initial concentration of 1 x 10 ⁇ per well and per ml. After an incubation of 24 hours, medium was removed and 625 ⁇ l of fresh medium containing 0.5 ⁇ Ci thymidine, 52.0 mCi/mmol; Amersham, England) and 75 ⁇ l of DOTAP virosomes containing 0.2 nmol of either mumps plasmid or FITC-mumps plasmid were added. The cultures were gently shaken at very slow agitation for 1 hr at 37°C and then transferred to the incubator. After 48 hours the cell suspension was removed, transferred to centrifuge vials, and centrifuged. Obtained cell pellets were washed twice. When the cells could not sufficiently be dispersed into a single cell suspension, they were exposed briefly to a trypsin EDTA solution.
  • OEG was removed by Biobeads as described in Example 9.
  • a second mixture of NaCl, HEPES and OEG, 3 mg PC, 1 mg PE and 1 mg HA were subjected to the same biobeads treatment to form neutral virosomes.
  • the DOTAP plasmid liposomes were fused with the neutral HA-virosomes by treatment with ultrasonication during 60 seconds.
  • the obtained solution was diluted 1 : 1000 with PBS. 20 ⁇ l and 50 ⁇ l of this solution containing 1 ng and 2.5 ng plasmid, respectively, were added to 2 x 10" Vero cells. After 48 h incubation the supernatants of the cell cultures were tested for HN antigen by an ELISA assay. A content of 20 to 45 pg HN per ml was measured. Comparison of transfection efficiency of mumps plasmid (HN) loaded DOTAP virosomes with mumps plasmid loaded DOTAP liposomes.
  • mice BALB/c mice (5 animals per group) were injected intramuscularly with "naked" plasmid DNA or with virosomal plasmid DNA. The response was read out 4 weeks post- immunization. Mean values ( ⁇ SD) are given.
  • Cytotoxicity assay for specific T cell reactivity (refers to in the table 1)
  • Spleen cells from immunized mice were suspended in a-MEM tissue culture medium supplemented with lO mM HEPES buffer, 5 x 10 ⁇ 5 M 2- ⁇ -mercaptoethanol, antibiotics and
  • Antibodies against mumps virus were detected in mouse sera using an immune fluorescence test described by Just, M., Berger, R., Gl ⁇ ck, R., Wegmann, A. (1985) Feldfried mit für neuartigen human-diploiden Zellvakzine (HDCV) gegen Masern, Mumps und Roteln. Sau Med Wschr 115: 1727-1730. Concentrations of anti-mumps were standardized against a WHO-reference standard.
  • the tested sera were diluted so that the measured OD values were between standard serum one and six. Values presented in this paper are calculated by multiplying the serum dilution with the measured antibody level (mlU/ml). Serum titers shown are the mean of 5 individual mice ( ⁇ SD) (Tab. 1).
  • virosomal mumps plasmid (GC9 and GC23) was evaluated in a conventional newborn hamster model as described previously, by e.g. Overman et. al., 1953; Burr and Nagler, 1953; Love et al., Microb. Pathog. 1 (1986), 149-158; J. Virol. 58 (1986), 220-222; Develop. Neurosc. 7 (1985), 65-72; J. Virol. 53 (1985), 67-74 and references cited therein.
  • mice Female BALB/c mice 4 weeks old (Charles River) were used. Mice were anesthetized with ketamine-xylazine and immunized i.n. with 30 ⁇ l (less then l ⁇ g of DNA) of virosomes-DNA or virosomes alone. The mice inhaled these preparations simply by breathing. The same procedure was used for repeated immunizations one, three, and four weeks after the first inoculation. Group A, B and C were immunized with the plasmid expressing the mumps virus HN protein (GC9), groups D, E and F received the plasmid coding the mumps virus F antigen (GC23).
  • GC9 mumps virus HN protein
  • groups D, E and F received the plasmid coding the mumps virus F antigen (GC23).
  • Groups A and D received an intramuscular priming with influenza virus vaccine (lOO ⁇ l containing 3 ⁇ g of HA).
  • Group G received the vector plasmid pcDNA3 entrapped into virosomes.
  • Each group was represented by 5 mice.
  • BAL bronchoalveolar lavages
  • NW nasal washes
  • mice were sacrificed by cervical dislocation under anesthetization. Collection of bronchoalveolar lavages (BAL) and nasal washes (NW) from mice were performed as described elsewhere (Takao S-I, Kiyotani K, Sakaguchi T., Fujli Y., Seno M., Yoshida T. 1997 Protection of mice from respiratory Sendai virus infections by recombinant vaccinia viruses. J Virol. 71 : 832-838.).
  • Mumps virus-specific IgG and IgA antibodies were measured by enzyme-linked immunosorbent assay (ELISA).
  • ELISA enzyme-linked immunosorbent assay
  • Purified virions of mumps virus were diluted in coating buffer (0.05M NaHCO 3 /Na 2 CO 3 , pH 9.6) to l ⁇ g of protein per ml, and dispensed to a 96 well plate at lOO ⁇ l well. After allowing to absorb overnight at 4°C, the wells were washed with PBS-0.05% Brij 35 and blocked for preventing nonspecific binding by incubation with 5%> heat inactivated foetal calf serum (FCS) in PBS-Brij 35 for 2h at room temperature.
  • FCS foetal calf serum
  • TMB 3,3',5,5' Tetramethylbenzidine
  • Splenocytes were cultured as described above with the same panel of antigens, except that after 24h in culture, cell-free supernatants were harvested for the presence of IL-2 and after 48h for the presence of IFN- ⁇ , IL-4 and IL-10. Samples were stored at -80°C. Briefly, microtiter plates were coated overnight at 4°C with lOO ⁇ l of anti-cytokine capture MAb (Pharmingen, Milan, Italy) at l ⁇ g/ml. The plates were washed twice with PBS-Tween and blocked with lOO ⁇ l of 10% FCS in PBS per well per 2h at room temperature.
  • Mumps virus-stimulated cells from mice inoculated with DNA-virosomes induced the production of IL-2 and IFN- ⁇ , whereas it induced the production of IL-2 and IL-10 in cells taken from mumps virus-immunized animals.
  • Immunization with DNA-virosomes such as the control immunization with the purified antigens co ⁇ elated with Thl phenotype.

Abstract

L'invention concerne des virosomes comprenant des lipides cationiques, de la protéine d'hémagglutinine de la grippe biologiquement active, ou des dérivés biologiquement actifs de ces derniers, et des acides nucléiques codant des antigènes à partir de sources pathogènes dans leurs intérieurs, de préférence, des antigènes provenant du virus des oreillons. Ces antigènes sont dérivés de protéines externes et internes conservées de ce virus. L'invention traite aussi de virosomes qui peuvent être formulés, de manière avantageuse, comme vaccins permettant d'induire des réponses des lymphocytes T cytotoxiques et des anticorps à forte neutralisation, ainsi qu'une protection contre les sources pathogènes comme le virus des oreillons. En outre, l'invention a pour objet des vaccins comprenant de l'ADN de recombinaison dérivés de l'ADN codant des protéines internes et externes conservées, provenant du virus des oreillons.
EP98929369A 1997-05-23 1998-05-22 Vaccin comprenant de l'adn a enveloppe du virus de la grippe Ceased EP0988052A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP98929369A EP0988052A2 (fr) 1997-05-23 1998-05-22 Vaccin comprenant de l'adn a enveloppe du virus de la grippe

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP97108390 1997-05-23
EP97108390 1997-05-23
PCT/EP1998/003050 WO1998052603A2 (fr) 1997-05-23 1998-05-22 Vaccin comprenant de l'adn a enveloppe du virus de la grippe
EP98929369A EP0988052A2 (fr) 1997-05-23 1998-05-22 Vaccin comprenant de l'adn a enveloppe du virus de la grippe

Publications (1)

Publication Number Publication Date
EP0988052A2 true EP0988052A2 (fr) 2000-03-29

Family

ID=8226824

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98929369A Ceased EP0988052A2 (fr) 1997-05-23 1998-05-22 Vaccin comprenant de l'adn a enveloppe du virus de la grippe

Country Status (3)

Country Link
EP (1) EP0988052A2 (fr)
AU (1) AU7915398A (fr)
WO (1) WO1998052603A2 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040185057A1 (en) * 2001-06-15 2004-09-23 Kirkby Nikolai Soren Therapeutical vaccination
EA008497B1 (ru) * 2002-11-21 2007-06-29 Певион Биотех Лтд. Высокоэффективные способные к слиянию везикулы, способ их получения и фармацевтическая композиция, их содержащая
US9603921B2 (en) 2004-10-27 2017-03-28 Janssen Vaccines Ag Virosome particles comprising antigens from influenza virus and hepatitis b virus
EP1676569A1 (fr) * 2004-12-30 2006-07-05 Pevion Biotech Ltd. Lyophilisation de virosomes
AU2005338519B2 (en) * 2005-11-24 2011-06-16 National Institute Of Biomedical Innovation Recombinant polyvalent vaccine
US7682619B2 (en) 2006-04-06 2010-03-23 Cornell Research Foundation, Inc. Canine influenza virus
CA2819635A1 (fr) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Administration dirigee d'agents a une anatomie neuronale

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5550289A (en) * 1985-01-07 1996-08-27 Syntex (U.S.A.) Inc. N-(1,(1-1)-dialkyloxy)-and N-(1,(1-1)-dialkenyloxy alk-1-yl-N-N,N-tetrasubstituted ammonium lipids and uses therefor
FR2617715B1 (fr) * 1987-07-07 1990-08-31 Transgene Sa Vecteur viral et adn recombinant codant pour une ou des proteines de surface (ha et/ou f) d'un morbillivirus, culture cellulaire infectee, proteines obtenues, vaccin et anticorps obtenus
CA2086831C (fr) * 1991-05-08 1999-03-16 Reinhard Gluck Virosomes de la grippe reconstitues par immunostimulation et immunopotentialisation et vaccins contenant ceux-ci
GB9308963D0 (en) * 1993-04-30 1993-06-16 Smithkline Beecham Biolog Novel compounds
US5550017A (en) * 1993-10-12 1996-08-27 Emory University Anti-paramyxovirus screening method and vaccine
US5830878A (en) * 1995-06-07 1998-11-03 Megabios Corporation Cationic lipid: DNA complexes for gene targeting

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9852603A2 *

Also Published As

Publication number Publication date
WO1998052603A3 (fr) 1999-05-14
AU7915398A (en) 1998-12-11
WO1998052603A2 (fr) 1998-11-26

Similar Documents

Publication Publication Date Title
US11771652B2 (en) Lipid nanoparticles for delivering mRNA vaccines
Bungener et al. Virosome-mediated delivery of protein antigens in vivo: efficient induction of class I MHC-restricted cytotoxic T lymphocyte activity
Daemen et al. Virosomes for antigen and DNA delivery
CN116322758A (zh) 基于核酸的组合疫苗
EP1833465B1 (fr) Lyophilisation de virosomes
AU710170B2 (en) Cationic virosomes as transfer system for genetic material
KR20100033969A (ko) 세포 주에서 생산된 인플루엔자 바이러스로부터 유래한 헤마글루티닌을 포함하는 바이로솜, 그의 조성물, 제조 방법, 용도
US20230043128A1 (en) Multivalent influenza vaccines
JP2024511206A (ja) 免疫原性組成物
WO1998040499A1 (fr) Apport de genes dans l'epithelium muqueux a des fins therapeutiques ou d'immunisation
WO1998052603A2 (fr) Vaccin comprenant de l'adn a enveloppe du virus de la grippe
US20030113347A1 (en) Immunostimulating and immunopotentiating reconstituted influenza virosomes and vaccines containing them
CN111148528A (zh) 流感疫苗
WO2023091766A2 (fr) Compositions et méthodes pour vaccins contre le virus respiratoire syncytial (rsv) à base d'acide ribonucléique
CN115957187A (zh) 一种脂质纳米颗粒组合物以及由其制备的药物递送系统
US20230310571A1 (en) Human metapneumovirus vaccines
WO2024055273A1 (fr) Vaccin contre l'arnm de la rage et sa préparation et son utilisation
CN117721150A (zh) 一种狂犬病mRNA疫苗、其制备及应用
JP2023550600A (ja) ｍＲＮＡワクチンを送達するための脂質ナノ粒子
CA3203442A1 (fr) Nucleases effectrices de type activateur de transcription (talens) ciblant le vhb
CN117580568A (zh) 多价流感疫苗

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19991223

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20031201

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20051209