EP0956364A1 - Dosage cellulaire total - Google Patents

Dosage cellulaire total

Info

Publication number
EP0956364A1
EP0956364A1 EP97936237A EP97936237A EP0956364A1 EP 0956364 A1 EP0956364 A1 EP 0956364A1 EP 97936237 A EP97936237 A EP 97936237A EP 97936237 A EP97936237 A EP 97936237A EP 0956364 A1 EP0956364 A1 EP 0956364A1
Authority
EP
European Patent Office
Prior art keywords
cells
target cells
mrna
primers
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97936237A
Other languages
German (de)
English (en)
Inventor
Dominik Haudenschild
François BINETTE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genzyme Corp
Original Assignee
Genzyme Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Corp filed Critical Genzyme Corp
Publication of EP0956364A1 publication Critical patent/EP0956364A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • This invention relates to a rapid and sensitive assay and method, for confirming the presence of specific mRNA species which are present in a cell suspension.
  • the assay and method of this invention utilizes whole cells as a starting material for a reverse transcriptase polymerase chain reaction ("RT-PCR") analysis. Primers are designed and used to amplify specific cDNA sequences conforming to the mRNA. Specific and positive identification of cell types present in a mixed population of cells can thus be confirmed with only minimal time and sample manipulation.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • a second strategy for determining cell type is to look for protein markers known to be expressed only by specific cell types. Examples would be immunohistology or FACS technology. Although this is much more specific than examining morphology, these methods rely heavily on the availability of antibodies raised against the protein marker of interest. However, antibodies are often not readily available. In addition, every antibody-antigen interaction is unique, and requires conditions to be optimized on an individual basis.
  • a third strategy for cell typing is to examine the mRNA that is transcribed by cells. While every cell type has a unique mRNA profile, the methods employed for working with RNA are independent of the specific mRNA being examined. Techniques are applicable to a broad range of cell sources with at most very minor modifications .
  • Northern blotting and ribonuclease protection assays are two methods that can detect and quantify the presence of a specific mRNA. However, both of these methods require substantial amounts (1 to 20 micrograms) of RNA which generally needs to be purified first. In Si tu hybridization and m si tu PCR can be done using much less starting material, but both of these methods are technically difficult and lengthy to perform and difficult to analyze.
  • the RNase protection assay is an improvement over northern blot analysis since it can be quantitative, requires very little starting material, and can be performed directly on whole cells without prior RNA purification (Strauss and Jacobowitz, Brain Res . Mol . Brain Res .. 20, pages 229-239, (1993). However, RNase protection assays still require substantial amounts of time and manipulation.
  • the RT-PCR assay allows for the detection of rare mRNA transcripts from very little RNA, Klebe et al . , BioTechnicrues . 21 (6), pages 1094-1100 (1966).
  • RNA isolation and first strand cDNA synthesis are still required, including RNA isolation and first strand cDNA synthesis, followed by PCR amplification.
  • RNase protection assay or the RT-PCR assay as a rapid assay for screening cells for a specific target mRNA.
  • Figure 1 is an electrophoresis photograph showing the presence of aggrecan and GAPDH in passaged human chondrocytes and human dermal fibroblasts.
  • Figure 2a is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts .
  • Figure 2b is a photograph of a Southern blot showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts.
  • Figure 3 is a schematic diagram of genomic and cDNA templates with primer locations as indicated. Intervening sequences are shown in the genomic DNA but are absent from the cDNA and mRNA.
  • Figure 4 is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts with and without RNase.
  • Figure 5 is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts with and without RNase and DNase .
  • Figure 6 is a photograph of a Southern blot showing the presence of GAPDH in human chondrocytes and fibroblasts from genomic DNA template (250 bp) and mRNA template (146bp) .
  • Figure 7 is a photograph of an agarose gel comparing the presence of RNase A and RNase inhibitor on the detection of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • Figure 8 is a photograph of an agarose gel showing the presence of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • Figure 9 is a photograph of a Southern blot showing the presence of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • Figure 10 is a photograph of an agarose gel comparing the presence of RNase A and RNase inhibitor on the detection of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • This invention is directed to a rapid and accurate method for the determination of a specific type of cell, such as a chondrocyte cell, in a mixed population of cells.
  • the method of this invention uses whole cells as starting materials. Markers specific for the target cells are identified, and primers for the markers are constructed. Preferably, the primers are constructed to yield a nucleic acid product from reverse-transcribed RNA template which is smaller than DNA amplified from the corresponding genomic template .
  • the cells are separated from the remaining components of a liquid sample by any convenient means, such as centrifugation.
  • the cells are formed into pellets.
  • a reaction mixture is formed by combining the pellets, RT-PCR medium, a cell lysing agent or detergent, such as Tween-20, and optionally, an RNase inhibitor to minimize degradation of the mRNA.
  • the reaction is maintained at a sufficiently high temperature, i.e. from about 60° C to about 90° C, in order to reduce mRNA degradation by temporarily inactivating Rnases and to reduce false priming.
  • the method of this invention is particularly useful for analyzing samples of human cartilage tissue which are surgically removed from a patient as an adjunct to a cartilage repair procedure. After removal from the patient, the sample is analyzed for the presence of aggrecan mRNA which is specific to chondrocyte cells. If sufficient cells are present in the sample, as determined by the procedure of this invention, the cells may be cultured in order to form a patch to repair a cartilage defect. It will be readily appreciated that a similar approach could be used to replace keratinocytes .
  • the method of this invention utilizes molecular markers that are known to be specific for a certain cell type.
  • a modified single-tube RT-PCR analysis is performed to amplify the signal for these markers.
  • Such techniques are well known in the art, and are available commercially. It will be understood that any amplification technique known in the art may be used as long as it achieves the objectives of the instant method and assay.
  • the method and assay can be used in any procedure where it is necessary to confirm the presence of specific cell types in a mixed population of cells. More generally, it can be used wherever a specific RNA is expected to be transcribed by some or all cells.
  • chondrocytes aggrecan mRNA
  • keratinocytes keratin mRNA
  • viral or bacterial RNA cells expressing an mRNA isoform with a deletion or insertion mutation
  • RNA transcribed only in cancers RNA transcribed only in cancers .
  • the entire procedure can be carried out in a single tube with a single buffer and virtually no manipulation of the samples. In many situations, currently available methods of cell-typing are inadequate because they require too much time or manipulation, or because they are too subjective.
  • Primers with fairly high melting temperatures are chosen to amplify a short section of mRNA where an intron is present in the corresponding genomic sequence .
  • Such primers allow a distinction to be made between signal generated from a genomic DNA template, which is present in all cells, and the reverse-transcribed mRNA, which is cell-type specific.
  • a high primer annealing temperature allows for very specific interactions between primers and the template to occur. It also enables the use of a two- step PCR amplification in which the annealing and extension steps are combined. The short distance between primers, combined with the high processivity of the enzyme and the two-step PCR amplification, greatly reduces the cycling times required to generate a signal from specific mRNAs .
  • thermostable polymerase rTth is a thermostable enzyme with both reverse transcriptase and DNA polymerase activities, and the buffer system, such as the PCR reaction buffer available from Perkin Elmer Cetus, permits both activities.
  • the assay of this invention can be used for determining whether a specific gene is transcribed in a given cell population, by choosing primer pairs that distinguish RNA signal from genomic DNA signal.
  • the method utilized herein is able to generate a signal directly from whole cells, and proves to be a specific, simple, rapid and sensitive assay that requires minimal handling time and manipulation. This method can be used in order to confirm the presence of a specific target mRNA in a mixed population of cells .
  • the method of this invention is highly sensitive in detecting specific, low abundant mRNAs from less than about 1000 cells, and as few as 100 cells. Furthermore, the amplified DNA fragments are generated from transcribed genes, not from genomic DNA. This procedure simplifies qualitative gene expression analysis significantly, as whole cells are used as a template in a single tube, single buffer, one-enzyme RT-PCR reaction. Accurate quantitation of RNA using RT-PCR has been made possible by recent innovations that reduce the introduction of artifacts due to minor variations in conditions between samples during the reverse transcription and amplification steps.
  • An assay that allows high throughput and quantitative screening of cells for specific target mRNAs would have many potential applications. For example, conditions could be assayed that promote transcription of specific mRNAs by cells in vi tro, heterogenous cell populations could be tested for the abundance of a specific cell type, or transcription levels from plasmid transfection could be measured and optimized.
  • Primers were designed to amplify a 280bp region of the G3 domain of aggrecan mRNA, which is a chondrocyte specific marker. The primers were chosen so that they would not amplify sequence from genomic DNA template, since the region between the primers is predicted to span an intron too large to be amplified under the reaction conditions. Primers were also chosen as a positive controls for amplification. The primers were designed to co-amplify a 146bp region of GAPDH, which is a housekeeping gene transcribed in all cell types.
  • chondrocytes grown in monolayer on tissue culture treated plastic are released from the plastic with trypsin, which is inactivated by the addition of five volumes of cell media that contains 10% Fetal Bovine Serum (FBS) .
  • FBS Fetal Bovine Serum
  • a small aliquot of the cell suspension is removed for counting on a hemocytometer while the cells are pelleted in a clinical centrifuge.
  • the cell pellet is resuspended in 10ml of phosphate buffered saline (PBS), and 10,000 cells are pipetted into a 0.2ml thin-walled PCR tube. Cells are pelleted in the PCR tube by centrifugation, and the PBS supernatant is removed.
  • RT-PCR reaction is performed using techniques optimized to reduce mRNA degradation as described below.
  • RT-PCR reaction mix briefly preheated to 90° C in a thermocycler, is added directly to the cell pellet. This mixture consists of:
  • the specificity of the assay was established using human fibroblast cells as a template for RT-PCR.
  • the 280bp band corresponding to aggrecan was amplified only from chondrocytes or purified chondrocyte RNA, and not from fibroblasts or purified fibroblast RNA.
  • a similar assay run using purified RNA showed that there is no difference in the size of the amplified fragments from whole cell template versus isolated RNA template.
  • the amplified products are analyzed by agarose gel electrophore ⁇ is, and the results are shown in Figure 1.
  • Passaged human articular chondrocytes and dermal fibroblasts were grown in monolayer on tissue culture plastic and fed DMEM with 10% fetal bovine serum. Cells were released from the tissue culture treated plastic with trypsin/EDTA, which was then inactivated by addition of five volumes of media that contains 10% FBS . A small aliquot of the cell suspension was removed for counting on a hemacytometer while the cells were pelleted in a clinical centrifuge. The cell pellet was resuspended in PBS, and 10,000 cells were pipetted into a 0.2 ml thin- walled PCR tube. Cells were pelleted in the PCR tube by centrifugation at 3000 rpm in a table-top microcentrifuge, and then the PBS supernatant was removed .
  • Primers were designed using the Oligo 5.0 program (National Biosciences Inc . , Plymouth MN) . Primers have a predicted melting temperature of greater than 85° C, and a predicted optimal annealing temperature between 63° C and 64° C. Each primer was chosen to anneal completely within a single exon of mRNA sequence, and the region between the forward and reverse primer was predicted to span an intron. With this primer design, the sequence amplified from reverse transcribed RNA template yields a smaller product compared to the sequence amplified from genomic DNA template. The amplified product, including primers, was between 100 and 500 base pairs, which allowed for short cycle times . Primer sequences , 5 ' to 3 ' , are :
  • Aggrecan sense : CCAGGAGGTATGTGAGGAGGGCTGGAACAAG
  • GAPDH sense GCACCAGGTGGTCTCCTCTGACTTCAACAGCGA
  • RT-PCR reaction was performed using rTth enzyme and buffer conditions optimized by Perkin Elmer Cetus Corporation (EZ rTth RNA PCR Kit, Roche Molecular Systems Inc., Branchburg NJ) to allow both reverse transcriptase and DNA polymerase activity.
  • Reaction volume was 25 ⁇ l, consisting of 0.5% (v/v) Tween 20, 11.25 pmol each primer, 300 ⁇ M each dNTP, lx reaction buffer, 2.5 mM Manganese Acetate, and water.
  • Indicated samples had either 500 U/ml Placental RNase Inhibitor (Gibco, Grand Island NY) or RNase A/T.
  • the cDNA was then amplified by 35 cycles of 10 second 92° C denaturation steps and 20 second annealing/extension steps at 63.5° C. A final extension step of 3 minutes at 72° C completed the thermocycler program, and the reactions are held at 4°C until ready for agarose gel electrophoresis .
  • the program above was preceded by incubations for RNase or DNase digestion.
  • One fifth to one third of each reaction was run on a 3% NuSieve 3:1 agarose gel (FMC, Rockland ME) in TBE buffer with ethidium bromide, and bands were visualized by UV illumination. Southern blotting was done using the PosiBlot apparatus (Stratagene, La Jolla CA) according to manufacturer's instructions.
  • Random primed probes were made using Stratagene 's Random Primelt II procedure. Hybridization of the labeled probe to the membrane was done using Amersham Rapid-Hyb solution, followed by high stringency washes at 65° C in 0.1% SSC and 0.1% SDS.
  • the template used to generate the aggrecan probe was a plasmid that has sequence coding for the G3 domain of human aggrecan.
  • the template used to generate the GAPDH probe is a plasmid that has sequence coding for human GAPDH.
  • RNA from chondrocytes and fibroblasts was digested in lx RT-PCR buffer without rTth or primers for 50 minutes at 37° C with no enzyme (lanes 1 and 2), RNase A/T. (20U/800U per ml) (lanes 3 and 4), DNase I (80U/ml) (lanes 5 and 6) , or both (lanes 7 and 8) . After digestion, the reactions were heated to 90° C of two minutes, aggrecan and GAPDH primers and rTth enzyme were added, and the thermocycler program was started.
  • RNA from chondrocytes and fibroblasts was digested in lx RT-PCR buffer without rTth or primers for 60 minutes at 37° C with RNase A/T. (20U/800U per ml) . After digestion, aggrecan and GAPDH primers were added, the reaction was heated to 90° C, rTth enzyme was added, and the thermocycler program was started. A sample of the reaction was run on an agarose gel, blotted to a charged nylon membrane, and hybridized with a human GAPDH probe. Bands corresponding to amplified genomic DNA (250 bp) and cDNA (146 bp) are visible in Figure 6.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Procédé de détermination de la présence de types cellulaires spécifiques dans une population cellulaire mixte. Ce procédé consiste à identifier et à détecter des marqueurs pour les types cellulaires cibles, à préparer des amorces spécifiques des marqueurs, et à utiliser la technologie de la réaction à transcriptase inverse dans le but d'amplifier et de détecter ces marqueurs. Ledit procédé est suffisamment sensible pour détecter la présence d'à peine 100 cellules cibles dans une population cellulaire. Les cellules cibles peuvent être des chondrocytes humains et des kératinocytes humains.
EP97936237A 1996-07-26 1997-07-25 Dosage cellulaire total Withdrawn EP0956364A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US2263696P 1996-07-26 1996-07-26
US22636P 1996-07-26
US3541597P 1997-01-23 1997-01-23
US35415P 1997-01-23
PCT/US1997/013131 WO1998004742A1 (fr) 1996-07-26 1997-07-25 Dosage cellulaire total

Publications (1)

Publication Number Publication Date
EP0956364A1 true EP0956364A1 (fr) 1999-11-17

Family

ID=26696163

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97936237A Withdrawn EP0956364A1 (fr) 1996-07-26 1997-07-25 Dosage cellulaire total

Country Status (5)

Country Link
EP (1) EP0956364A1 (fr)
JP (1) JP2000515761A (fr)
AU (1) AU3895597A (fr)
CA (1) CA2262012A1 (fr)
WO (1) WO1998004742A1 (fr)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7598226B2 (en) 1998-12-28 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
US6969518B2 (en) 1998-12-28 2005-11-29 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
ES2281416T3 (es) * 2000-04-03 2007-10-01 Corixa Corporation Metodos, composiciones y sistemas para la deteccion y monitorizacion del cancer de mama.
EP1343973B2 (fr) 2000-11-16 2020-09-16 California Institute Of Technology Appareil et procedes pour effectuer des dosages et des criblages a haut rendement
EP1384022A4 (fr) 2001-04-06 2004-08-04 California Inst Of Techn Amplification d'acide nucleique au moyen de dispositifs microfluidiques
ES2403560T3 (es) 2001-11-30 2013-05-20 Fluidigm Corporation Dispositivo microfluídico y procedimientos de utilización del mismo
WO2003085379A2 (fr) 2002-04-01 2003-10-16 Fluidigm Corporation Systemes d'analyse de particules microfluidiques
EP2298448A3 (fr) 2002-09-25 2012-05-30 California Institute of Technology Intégration microfluidique à large échelle
US8871446B2 (en) 2002-10-02 2014-10-28 California Institute Of Technology Microfluidic nucleic acid analysis
US7604965B2 (en) 2003-04-03 2009-10-20 Fluidigm Corporation Thermal reaction device and method for using the same
US7815868B1 (en) 2006-02-28 2010-10-19 Fluidigm Corporation Microfluidic reaction apparatus for high throughput screening
PT2132562E (pt) * 2007-04-06 2012-04-19 Genzyme Corp Métodos para avaliação de células e culturas celulares

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
DE69214243T2 (de) * 1991-09-23 1997-02-06 Pfizer Verfahren für die Detektion von spezifische mRNS und DNS in Zellen
CA2128891A1 (fr) * 1992-01-29 1993-08-05 Cylia Keller Polynucleotides immobilises sur support

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9804742A1 *

Also Published As

Publication number Publication date
JP2000515761A (ja) 2000-11-28
CA2262012A1 (fr) 1998-02-05
AU3895597A (en) 1998-02-20
WO1998004742A1 (fr) 1998-02-05

Similar Documents

Publication Publication Date Title
Liu et al. Alu transcripts: cytoplasmic localisation and regulation by DNA methylation
Liang et al. Distribution and cloning of eukaryotic mRNAs by means of differential display: refinements and optimization
Liang et al. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction
US5741677A (en) Methods for measuring telomere length
JP2843675B2 (ja) メッセンジャーｒｎａの同定、単離およびクローニング
Fakharzadeh et al. Structure and organization of amplified DNA on double minutes containing the mdm2 oncogene
EP1272668A2 (fr) Methodes, compositions et necessaires correspondants servant au depistage et a la surveillance du cancer du sein
WO2000075356A1 (fr) Amplification en chaine d'arn par polymerase
EP0956364A1 (fr) Dosage cellulaire total
Sbisa et al. The complete and symmetric transcription of the main non coding region of rat mitochondrial genome: in vivo mapping of heavy and light transcripts
EP3775269A1 (fr) Préparations de bibliothèques intégrées d'adn et d'arn et leurs utilisations
KR20140123437A (ko) 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
US20160083790A1 (en) Regulator targetting fatty acid synthase and method of using the same for improving meat quality
US20220275450A1 (en) Method for conducting early detection of colon cancer and/or of colon cancer precursor cells and for monitoring colon cancer recurrence
Gazziola et al. Malignant fibrous histiocytoma: a proposed cellular origin and identification of its characterizing gene transcripts
CN110546274A (zh) minor BCR-ABL1基因的检测方法
CN111378742A (zh) microRNA生物标志物及其在制备自身免疫疾病检测试剂盒中的应用
CN110819715A (zh) 用于结直肠癌检测的免疫基因标志物及试剂盒
WO1999001581A1 (fr) Expression genetique influencee par p53
Kuromitsu et al. A unique downregulation of h2-calponin gene expression in Down syndrome: a possible attenuation mechanism for fetal survival by methylation at the CpG island in the trisomic chromosome 21
Nagel et al. Screening for ribosomal-based false positives following prokaryotic mRNA differential display
US20030165931A1 (en) Qualitative differential screening
US9644208B2 (en) MiRNA for regulating FABP6 gene and method of using the same
WO1998014619A1 (fr) Procedes de generation et d'analyse de marqueurs de transcrits
CN112501304A (zh) miRNA-424作为脑垂体瘤诊断标志物的应用

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990125

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20010201