Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
  • A61K38/179—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
  • A61K38/1891—Angiogenesic factors; Angiogenin
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
  • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
  • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
  • G01N2333/52—Assays involving cytokines
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2800/00—Detection or diagnosis of diseases
  • G01N2800/32—Cardiovascular disorders
  • G01N2800/321—Arterial hypertension

Definitions

• This invention relates, inter alia, to a method of diagnosing hypertensive disorders in pregnant women, and methods of treating such conditions.
• VEGF Vascular endothelial growth factor
• VPF vascular permeability factor
• VEGF is widely expressed in human adult tissues and may play a role in the maintenance of the endothelium (Alon et al. , 1995 Nature Medicine 1, 1024-1028). It is over-expressed in a variety of pathological conditions, particularly solid tumors, whose growth can be prevented by the inhibition of VEGF action (Kim et al. , 1993 Nature 362, 841-844; Millauer et al , 1994 Nature 367, 576-579). Transgenic mice bearing heterozygous and homozygous deletions of the VEGF gene fail to survive beyond embryonic day 12, showing that VEGF is essential for embryonic development (Ferrara et al. , 1996 Nature 380, 439-442; Carmeliet et al.
• VEGF vascular endothelial growth factor
• flt-1 fms-like tyrosine kinase
• KDR kinase domain receptor
• flt-1 (not KDR) is highly expressed by trophoblast cells (Charnock- Jones et al , 1994 Biol. Reprod. 51, 524-530; Clark et al, 1996 Hum. Reprod. 11, 1090-1098).
• Monocytes and peritoneal fluid macrophages respond to VEGF (Clauss et al , 1990 J. Exp. Med. 172, 1535-1545; McLaren et al, 1996 J. Clin. Invest. 98, 482-489) and melanoma and some ovarian tumours have also been shown to express VEGF receptors (Potgens, et al, 1995 Am. J. Pathol. 146, 197-209; Boocock, et al, 1995 J. Natl. Can. Inst. 78, 506-516).
• Angiogenesis is a complex process necessitating the interaction of numerous cell types which leads to the co-ordinated development of a complex vascular 3-D structure, there are many factors involved in angiogenesis and it is the balance of stimulators such as VEGF and inhibitors like angiostatin that determines the end result (O'Reilly, et al, 1994 Cell 79, 315-328; Hanahan & Folkman 1996 Cell 86, 353-364). In the placenta there is profound angiogenesis as high capacity transport between the maternal and the growing fetal circulation develops. However, in the human, it is notable that little angiogenesis occurs in the maternal tissue while there is obvious capillary growth within the placental villi. This suggests that there are locally acting factors which regulate vascular growth.
• VEGF is highly expressed in the placenta and that early in gestation maternal macrophages within the decidua contain large amounts of VEGF mRNA (Sharkey et al , 1995 Int. J. Biochem. Cell Biol. 28, 81-89; Charnock- Jones, et al , 1994 Biol. Reprod. 51, 524-530). It has also been shown that villous and extravillous trophoblast contain very high levels of mRNA encoding flt-1 (Charnock- Jones, et al. , 1994 Biol. Reprod. 51, 524-530; Clark, et al, 1996 Hum. Reprod. 11, 1090-1098).
• vascular endotruncated forms of fit arise by variant splicing of the fit mRNA and lack the transmembrane domain, and so are secreted from cells in soluble form (called "sflt", or soluble fit).
• soluble receptors which retain binding affinity for VEGF may act as VEGF-antagonists, as they can compete with the cell-surface receptors for binding to VEGF.
• the maternal syndrome of pre-eclampsia is characterised by hypertension and proteinuria.
• Shankling & Sibai Ultrastructural Aspects of Pre-eclampsia 1. Placental bed and uterine boundary vessels; American Journal of Obstetrics and Gynaecology 1989 161, 735-741
• Their major finding was that there was extensive endothelial cell injury, particularly in placental venules where there was some fibrin deposition.
• pre-eclampsia In normal pregnancies the invasion of the decidual arterioles by extravillous trophoblast transforms them into high capacity, low resistance vessels. This does not occur in pre- eclampsia, since the trophoblast does not invade sufficiently far into the decidua.
• Anodier clinical feature of pre-eclampsia is increased incidence of disseminated intravascular coagulation (DIC). It is thought this may arise from increased fibrin deposition, mainly in thi ⁇ placenta (Dewhurst Textbook of Obstetrics and Gynaecology for Postgraduates, p209 & 221, publ. Blackwell Scientific Publications).
• Pre-eclampsia is also characterised by a reduction in birth-weight of the infant.
• the invention provides a method for treating a hypertensive disorder in a pregnant woman, the method comprising administering to the pregnant woman an amount of a therapeutic substance which regulates the amount, and/or activity, of VEGF in the woman effective to ameliorate the hypertensive disorder.
• the hypertensive disorder to be treated by the method of the invention is pre- eclampsia, a very serious pathology associated with foetal and/or maternal morbidity or mortality.
• VEGF activity is herein defined as that set of characteristics which enable abnormalities in VEGF levels to cause pathological conditions (e.g. the ability to bind in a specific manner to cell-membrane VEGF receptors, so as to cause angiogenesis in susceptible tissues). VEGF activity therefore encompasses such characteristics as stimulation of angiogenesis (growth and formation of blood vessels), promotion of endothelial cell proliferation and migration, increased vascular permeability, increased protease and von Willebrand factor production, and tissue factor induction.
• the present inventors have found that abnormalities in the level of VEGF activity are of critical importance in the development of the symptoms of pre-eclampsia such that the method of the invention can have a substantial therapeutic effect, either by adjusting the amount of active VEGF in the patient, and/or adjusting the activity thereof, to normal levels. In general, the inventors consider that a therapeutic effect will best be obtained by reducing VEGF amounts and/or activity in the patient, rather than increasing the same.
• VEGF vascular endothelial growth factor
• Such substances might comprise nucleic acids (especially short RNA molecules), polypeptides and peptides (naturally-occurring or synthetic) or synthetic compounds.
• VEGF vascular endothelial growth factor
• affinity of the inhibitor for VEGF, or for VEGF receptor will be comparable to the binding affinity between VEGF and its FLT-1 receptor, which affinity is approximately 10-20 picomolar.
• lower binding affinities of inhibitors can be compensated by the administration of large amounts of inhibitor, so as to create a comparatively high concentration of inhibitor in the patient relative to the concentration of VEGF, or VEGF receptor, as appropriate, such that the inhibitor competes effectively with VEGF.
• the method of treatment in accordance with the invention comprises administering a therapeutic substance which down-regulates (i.e. reduces) the amount and/or activity of free VEGF in the patient, preferably to, or slightly below, the level of free VEGF associated with a normal pregnancy.
• a therapeutic substance which down-regulates (i.e. reduces) the amount and/or activity of free VEGF in the patient, preferably to, or slightly below, the level of free VEGF associated with a normal pregnancy.
• free VEGF is the amount of uncomplexed VEGF (not bound to receptor) in the patient. It is possible that VEGF binds weakly in the circulation to albumen. Such interaction, if it occurs, is thoght to be quite weak and does not appear likely to affect the activity of the VEGF. Accordingly VEGF bound weakly to albumen or similar plasma protein is considered for present purposes as uncomplexed, and thus "free VEGF”. Conveniently, a measure of the amount of free VEGF can be made by assaying VEGF levels in the serum of the patient.
• the invention encompasses within its scope the administration of a substance which antagonizes VEGF, either by reducing the amount of VEGF available to its receptor, competitively inhibiting VEGF from binding to its receptor, or inhibiting the tyrosine kinase activity of VEGF.
• Substances which are useful according to the invention include soluble VEGF receptors (such as sflt-K, or the soluble fit variants disclosed by Charnock-Jones et al, in PCT/GB95/01213).
• Charnock-Jones et al disclose soluble forms of the fit polypeptide that are capable of binding to VEGF and exerting an inhibitor effect thereon, the polypeptide including five or fewer complete immunoglobulin-like domains.
• the soluble forms do not contain a transmembrane domain.
• Two such soluble forms are FLT4 and FLT15. Both include at their N-terminus the amino acid sequence corresponding to the equivalent portion of the unaltered wild-type fit polypeptide (i.e.
• FLT4 and FLT15 are provided in Charnock-Jones et al Aiello et al (1995 Proc. Natl. Acad. Sci. USA 92, 10457-10461) demonstrated the efficacy of a soluble receptor as a VEGF antagonist in mice in inhibiting angiogenesis.
• PIGF Placental Growth Factor
• VEGF and PIGF both bind to FLT and to soluble forms of FLT
• administration of a substance which regulates the balance between VEGF, PIGF and FLT may have a therapeutic effect.
• administration of PIGF or SFLT may have a beneficial effect, as described above, and similarly administration of other substances which affect the level and/or activity of VEGF, PIGF or FLT may also be effective.
• soluble substances with suitable VEGF-antagonistic activity include anti-VEGF immunoglobulin molecules (or effective portions thereof), that is, having specific binding affinity for VEGF.
• effective portions of immunoglobulin molecules include scFv, Fv, Fab and Fab 2 fragments, all of which are known to those skilled in the art.
• the immunoglobulin molecule or portion thereof may be a naturally-occurring or engineered antibody (e.g. chimeric antibody, "humanised” antibody and the like) such as those taught by PCT/US92/09218.
• the soluble VEGF antagonist may be a chimeric polypeptide (e.g. comprising a VEGF-binding portion of a VEGF receptor, fused to another moiety, such as an immunoglobulin).
• a chimeric polypeptide e.g. comprising a VEGF-binding portion of a VEGF receptor, fused to another moiety, such as an immunoglobulin.
• Aiello et al describe one molecule containing the entire extracellular domain (758 residues) of the human high affinity VEGF receptor flk-1 fused to the sequence coding for amino acids 216-443 of the human IgG l heavy chain.
• the VEGF antagonist may be a chimeric polypeptide comprising an immunoglobulin molecule, or an effective portion thereof, having specific binding activity for VEGF or for the VEGF receptor FLT-1 or KDR.
• substances according to the invention include truncated forms of a receptor in which the transmembrane and cytoplasmic domains are deleted from the receptor, and fusion proteins in which non-human VEGF receptor polymers or polypeptides are conjugated to the human VEGF receptor (hVEGFr) or truncated forms thereof.
• hVEGFr human VEGF receptor
• An example of such a non-hVEGF polypeptide is an immunoglobulin.
• the extracellular domain of the hVEGFr is substituted for the Fv domain of an immunoglobulin light or heavy chain, with the C-terminus of the receptor extracellular domain covalently joined to the amino terminus of the Chi, hinge, CH2 or other fragment of the heavy chain.
• Such variants are made in the same fashion as known immunoadhesons.
• the hVEGFr is conjugated to a nonproteinaceous polymer such as PEG (Davis et al, USP 4,179,337; Goodson et al, Biotech. 8:343, 1990).
• HVEGFr is used substantially in the same fashion as antibodies to hVEGF, taking into account the affinity of the antagonist and its valency for hVEGF.
• the optimum dose administered to a patient in need of treatment according to the invention will depend on the efficacy of the substance in question.
• the amount to be administered may be determined by measuring the resultant increase or decrease in VEGF relative to a normal level of VEGF (i.e. found in a healthy pregnant woman) or it may be determined by monitoring the hypertensive condition, i.e. , looking for a reduction in symptoms associated with hypertension and pre-eclampsia.
• An "effective amount" of a substance which reduces or increases the VEGF level or activity in a patient is that amount which is effective to bring VEGF to a normal level or to reduce symptoms of hypertension in a pregnant woman or to reduce the symptoms of pre- eclampsia.
• the dosage of peptide (naturally occurring or synthetic) or polypeptide will be in the range of lOOng - lO ⁇ g/kg body weight.
• the substance administered is a nucleic acid, such as an RNA molecule
• the dosage is in the range of lOng-l ⁇ g/kg body weight.
• VEGF levels may be useful in monitoring the efficacy of treatment.
• Reduction in the amount of VEGF available to its receptor may involve measuring the physiological level of VEGF and administering the substance in an amount sufficient to reduce the VEGF level to a level which is normal in a pregnant woman, i.e. a level which does not result in hypertension.
• a "normal" level (or amount) of VEGF is dependent upon the assay method employed to measure VEGF.
• Baker et al (1995, Obstetrics & Gynaecology 86:815) measure VEGF in a healthy individual at 5.5pmol/L; Sharkey et al (1996, Eur. Jour. Clin. Invest.
• Serum samples are collected from a pregnant woman and maintained at 26 °C before centrifugation at 2000 x g for 20 min, then aliquoted under sterile conditions and stored at -80°C.
• Levels of VEGF in the sample were measured using a modification of the human VEGF assay described by Yeo et al, (1992, Clin. Chem. 98:71), hereby inco ⁇ orated by reference.
• rabbit polyclonal antibodies developed against recombinant human VEGF are used as both the capture and detection antibodies.
• Affinity- purified anti-VEGF IgG is labelled with Eu4-3-chelate and used as second antibodies.
• VEGF In the presence of VEGF, a sandwich is formed, and after a final wash, Eu+3 is dissociated from second antibodies with an enhancement buffer containing ⁇ -diketone (Pharmacia, Gaithersburg, MD) to produce a highly fluorescent chelate that was measured in a time- resolved fluorimeter.
• Human recombinant VEGF purchased from R&D systems (Mpls, MN) was used to calibrate the assay. The lower limit of detection of VEGF (+3 SDs of the zero standard) was 5.5 pmol/L.
• a medical doctor will be able to determine an appropriate dosage based on the degree of hypertension exhibited by the patient. These symptoms include but are not limited to proteinuria and hyperuricemia.
• “Hypertension” is herein defined as an increase of 30 mmHg systolic or 15 mmHg diastolic blood pressure, compared with values obtained before 20 week's gestation, or an absolute blood pressure of at least 140/90 mmHg after 20 weeks if blood pressure recordings in the first half of pregnancy are unknown.
• “Proteinuria” is herein defined as more than 500 mg per 24 hour collection, or at least 2+ on a voided or at least 1 + on a catheterized random urine specimen.
• “Hyperuricemia” is herein defined as at least one standard deviation above the normal mean concentration (5.5 mg/dl at term).
• the therapeutic substance will generally be delivered by injection, mixed in a composition comprising a physiologically acceptable carrier, such as sterile saline solution and the like.
• a physiologically acceptable carrier such as sterile saline solution and the like.
• the therapeutic substance may be administered by intra- venous drip, as most patients with pre-eclampsia are hospitalized.
• the invention provides for use of a therapeutic substance, which regulates the amount and/or activity of VEGF in a human subject, in the manufacture of a medicament to treat a hypertensive disorder in a pregnant woman.
• the therapeutic substance conveniently causes a down-regulation in VEGF levels/activity (e.g. may be a VEGF antagonist), and the medicament is typically used to treat pre- eclampsia.
• the medicament will comprise one or more of the therapeutic substances defined above in connection with the first aspect of the invention.
• the invention provides a method of diagnosing a hypertensive disorder (particularly, pre-eclampsia) in a pregnant woman, the method comprising obtaining a sample of body fluid from the patient and determining, either qualitatively or quantitatively, the amount of VEGF in the sample.
• the sample of body fluid will comprise a blood or urine sample.
• the method will comprise a binding assay to measure the amount of VEGF in the sample, and will comprise the use of a binding partner having specific binding activity for VEGF (such as a VEGF receptor, or an anti-VEGF immunoglobulin molecule or portion thereof).
• Suitable assays are known to those skilled in the art and include those working on the principles of ELISA, RIA, Western blotting etc.
• suitable kits are commercially available and obtainable, for example, from Peninsular Laboratories, USA (a competitive enzyme inhibition assay) or R & D Laboratories, Abingdon, Oxford (an ELISA test).
• the invention provides a method of diagnosing a hypertensive disorder (particularly pre-eclampsia) in a pregnant woman, the method comprising obtaining a sample of body fluid from the woman and determining, either qualitatively or quantitatively, the amount of soluble VEGF receptor (e.g. sflt) in the sample.
• the sample of body fluid conveniently comprises a blood or urine sample, and the amount of soluble receptor will conveniently be determined by a specific binding assay. Again, suitable binding assays will be apparent to those skilled in the art.
• the same body fluid sample taken from the patient may be divided into portions and respective portions used to determine the amount of VEGF and the amount of soluble receptor.
• soluble fit sflt
• sflt soluble fit
• diagnostic methods of the third and fourth aspects of the invention will conveniently be performed in conjunction with other tests for diagnostic indicators (e.g. measuring blood pressure).
• the invention provides a method of diagnosing a hypertensive disorder (particularly pre-eclampsia) in a pregnant woman, the method comprising obtaining a sample of body fluid (e.g. blood or urine) from the woman and determining, either qualitatively or quantitatively, the amount of Placental Growth Factor (PIGF) in the sample.
• a sample of body fluid e.g. blood or urine
• PIGF Placental Growth Factor
• the present inventors have found a statistically extremely significant correlation between the amount of PIGF in the serum and development of hypertension during pregnancy: in normotensive pregnant women, the average amount of PIGF in the serum is about 500pg/ml. In contrast, in pre-eclamptic pregnant women the average concentration of PIGF in serum is much lower, about 150-185 pg/ml. The inventors have also found that the amount of PIGF in normotensive pregnant women falls with increasing length of gestation, such that the difference in PIGF levels between normal and pre-eclamptic pregnancies is most marked before 36 weeks' gestation.
• the diagnostic method of the fifth aspect will conveniently comprise a specific binding assay (e.g. involving PIGF-specific immunoglobulins or effective portions thereof, and/or PIGF-specific receptor molecules, such as FLT-1 or effective portions thereof). Suitable assay techniques (e.g. ELISA, RIA, Western blotting) are known to those skilled in the art.
• the sample of body fluid may conveniently comprise a blood or urine sample.
• the method of the fifth aspect may be performed in conjunction with the method of the third and/or fourth aspects of the invention, so as to provide maximum diagnostic information to the clinician.
• the diagnostic method of the third, fourth or fifth aspect of the invention may be used not only to confirm a clinician's suspicion that a pregnant woman is suffering from a hypertensive disorder but may also, unexpectedly, be used predictively to ascertain those women who may be at increased risk of developing such a disorder before any symptoms become apparent. Clearly this is extremely advantageous as the health of such women may be monitored more closely and appropriate remedial measures taken at an early stage.
• the inventors have found that the levels of PIGF are significantly lower in women who go on to develop pre-eclampsia, and that the distinction between normal women and those at risk of developing pre-eclampsia can be made at an early stage in pregnancy (e.g. by 25 weeks in nearly all cases, and as early as 16-20 weeks for some women).
• the invention provides a kit for use in diagnosing a hypertensive disorder in a pregnant woman, the kit comprising a reagent having specific binding activity for VEGF and/or a reagent having specific binding activity for sflt, and/or a reagent having specific binding activity for PIGF and instructions for use according to the method of the third and/or fourth and/or fifth aspects of the invention.
• the kit will preferably comprise one or more reagents immobilised on an inert support (e.g. a microtitre plate) and conveniently may further comprise one or more control samples comprising known concentrations of VEGF and/or sflt, and/or PIGF, and appropriate packaging materials.
• kit will comprise a dipstick-type test which can be performed using a urine sample.
• Test kits of this type are familiar to those skilled in the art from pregnancy-testing kits, commercially available.
• the invention provides a method of making a medicament for the treatment of a hypertensive disorder in a pregnant woman, the method comprising combining a therapeutic substance, which regulates the amount and/or activity of VEGF in the woman, with a physiologically acceptable carrier, excipient or diluent.
• a physiologically acceptable carrier excipient or diluent.
• carriers, excipients or diluents are known to those skilled in the art and include, for example, saline solution phosphate-buffered saline and the like.
• the resulting medicament will typically be substantially sterile and suitable for injection or administration by other means to the pregnant woman.
• Figures 1A-1C are micrographs of sections labelled with 125 I-VEGF (A, B) or anti-CD34 (C), (magnification X85);
• Figures 2A-2F are micrographs of sections treated with 125 I-VEGF (A, C-E), unlabelled VEGF (F), or anti-CD34 (B);
• Figure 3 shows a number of panels (5), each with traces of representative results obtained when different samples were subjected to gel filtration chromatography on an S-200 column;
• Figure 4 shows the results of polyacrylamide gel electrophoresis (PAGE) analysis of 125 I- VEGF cross-linked serum samples
• Figure 5 shows the results of PAGE analysis of 125 I-VEGF cross-linked culture supernatants
• Figure 6 shows the results of PAGE analysis of 1 5 I-VEGF cross-linked recombinant sflt
• Figures 7 and 10 are bar charts showing inhibition of 125 I-VEGF binding to bovine aortic endothelial (BAE) cells by various samples;
• Figure 8 is a photograph of a Coomassie-stained gel
• Figure 9 shows the results of PAGE analysis of purified culture supernatants cross-linked with 125 -VEGF
• Figure 11 shows a graph of PIGF levels in serum (pg/ml) for pre-eclamptic (circles) and normotensive (crosses) pregnant women, for the interval from 26 weeks' gestation to term;
• Figure 12 shows a graph of PIGF levels in serum (pg/ml) for pre-eclamptic (lozenges) and a normotensive (squares) pregnant women for the interval from 15 weeks' gestation to term.
• Gestational dates were calculated from the first day of the last menstrual period and were within ⁇ _ 7 days of those estimated at an ultrasound scan performed in the first trimester of pregnancy.
• First trimester placental tissue was obtained from surgical terminations of pregnancy conducted between weeks 8 and 12 of gestation and third trimester material was obtained from normal placentae at term after Caesarean delivery. In the latter case a thin slice of tissue was taken from the maternal surface of the placenta, which contained a significant amount of extravillous trophoblast and decidua; and also a 1 cm 3 block excised from deeper in the placental cotyledon, containing only villous tissue. A sample from each area was checked by histology. Samples were either snap- frozen or fixed overnight in 10% buffered formalin and embedded in paraffin wax. Maternal serum samples were collected in non-heparinised tubes and after clotting and centrifugation, aliquotted and frozen.
• I25 I-VEGF Frozen tissue was sectioned and binding of I25 I-VEGF conducted according to the method of Shweiki et al (1993 J. Clin. Invest. 91, 2235-2243). Sections were pre-incubated with 0.2% gelatin and 1 mg/ml heparin in phosphate buffered saline (PBS) for 30 min at room temperature. 125 I-VEGF (Amersham International pic, 1500 Ci/mMol) was then added at a concentration of 100 pM in PBS. Serial control sections contained competitor VEGF (R&D Systems) at a concentration of 3 nM in the binding medium.
• PBS phosphate buffered saline
• a cDNA library prepared in ⁇ gtl 1 from mRNA obtained from term placenta (Clontech) was screened using a probe specific for a portion of the extracellular domain of flt-1.
• This probe shows minimal homology between flt-1 and other related receptors and was obtained by PCR using the primers described by Boocock et al , (1995 J. Natl. Can. Inst. 78, 506-516). Screening was performed as described in Charnock-Jones et al, (1995 Int. J. Biochem. Cell Biol. 28, 81-89).
• DNA was prepared from this plasmid using a Qiagen miniprep and then cotransfected into Sf9 cells with baculogold DNA (Pharmingen) to allow in vivo site-specific recombination to occur and the subsequent generation of recombinant viruses.
• the recombinant viruses were plaque-purified in soft agar and the plaques were identified by visual examination under strong illumination over a dark background. High titer viral stocks were then prepared as described in the Pharmingen baculo virus manual.
• Protein expression was accomplished by infecting small scale liquid cultures of approximately 100ml of Sf9 cells at density of approximately 2xl0 6 per ml with a high titer viral stock at a multiplicity of infection of between 2 and 10. Cells were grown in complete TMN-FH medium (Pharmingen) or SF 900-11 serum free medium (GIBCO/BRL).
• Soluble receptor was purified using the method described by Kendall and Thomas (1993 Proc. Natl. Acad Sci USA 90, 10705-10709).
• Conditioned medium (45ml) from the baculoviral infected Sf9 cells was clarified and then passed through a 1 ml heparin Sepharose affinity column (Hi-trap column, Pharmacia Biotech.) which had been previously equilibrated with 0.15 M NaCl in 10 mM sodium phosphate (pH 6.2). The column was washed with this buffer and also with a similar buffer containing 0.6 M NaCl. Soluble receptor was eluted from the column using 1.0 M NaCl in sodium phosphate buffer. The protein was desalted and concentrated further by centrifugal ultrafiltration (Centricon 30, Amicon Inc.).
• 125 I labelled VEGF (Amersham International pic) was incubated at a final concentration of 15 pM with 400 ⁇ l of serum obtained from healthy male or female volunteers and pregnant women at different stages of gestation. Samples of recombinant sflt-K and villous culture supernatant were also examined. After incubation overnight at room temperature samples were analysed by gel filtration chromatography on a 12.5 ml S-200 Sephadex column (dimensions of 0.8 cm x 25 cm) as described by Hill et al , (1995 J. Clin. Endocrinol. & Metab. 80, 1822-1831). The column was equilibrated in PBS and eluted in the same buffer.
• Serum (5 ml) was mixed with an equal volume of 10 mM sodium phosphate (pH 6.2) with 0.15 M NaCl and passed through a 1 ml heparin Sepharose affinity column as described above for sflt-K.
• the 0.6 M wash and 1.0 M eluted fractions were collected (6 ml of each), desalted and concentrated 6 fold in Centricon 50 tubes (Amicon Inc.).
• Crosslinking and polyacrylamide gel electrophoresis was conducted as described below.
• 125 I-VEGF at a concentration of 900 pM was incubated with samples overnight at room temperature. Control experiments where undertaken with 25 ng of VEGF (Amgen) which competed with the 125 I-VEGF. Complexes were crosslinked with 5 mM bis(sulfosuccinimidyl)suberate (Pierce) dissolved in 5 mM Na Citrate (pH 5.0), for 5 min at room temperature. The reaction was terminated with Tris-HCl (pH 6.8) containing 10% SDS and 8% glycerol. Samples were reduced with a 2% volume of ⁇ - mercaptoethanol and subjected to electrophoresis on 4-15% gradient polyacrylamide gels (Biorad).
• BAE cells were cultured to confluence in 24 or 48 well plates and all experiments were conducted in triplicate at 4°C.
• Cells were rinsed in wash buffer (PBS containing BSA 1 mg/ml and KI 10 "7 M).
• 125 I-VEGF at a final concentration of 20 pM was added to the binding medium (DMEM/F12, HEPES 25 mM, BSA 1 mg/ml, KI 10 7 M, heparin 10 ⁇ g/ml).
• DMEM/F12, HEPES 25 mM binding medium
• BSA 1 mg/ml KI 10 7 M
• heparin 10 ⁇ g/ml heparin 10 ⁇ g/ml
• the elutate was collected in 2 fractions of 3 ml each. Control 0.6 M wash, and 1.0 M NaCl eluted fractions were desalted in Centricon 30 tubes (Amicon Inc.) and concentrated to 500 ⁇ l. Control medium was purified by the same method. Samples were reduced with jS-mercaptoethanol and subjected to electrophoresis on 4-15% gradient gels (Biorad) before being stained with Coomassie Blue.
• RT-PCR Reverse Transcriptase Polymerase Chain Reaction
• PCR primers specific for the amplification of sflt-K were 5' GCAAGGTGTGACTTTTGTTC 3' and 5' CTTTGTGTGGTACAATC 3' (Seq. ID Nos. 1 and 2 respectively) ; the latter being after the splice site for sflt-K as described by Kendall and Thomas (cited above).
• the method used was essentially that of Charnock-Jones (1994 J. Reprod. & Fertil. 101, 421-426).
• a flt-1-specific probe was generated which corresponded to base pairs 2014 to 2297 according to the flt-1 EMBL sequence (accession number UOl 134). This spans the region where sflt-K and the membrane bound form differ so that the full length probe was protected for sflt-K while a smaller 205 bp fragment of RNA was protected for full length flt-1.
• the antisense probe was labelled with a total of 60 ⁇ Ci of ⁇ [ 32 P]UTP (800 Ci/mmol, Amersham International pic) using the MAXIscript in vitro transcription kit (Ambion).
• the resulting probe was treated with RNase-free DNase to remove the template before being purified by preparative PAGE and eluted from the polyacrylamide.
• 100,000 cpm of probe was mixed and precipitated before addition of the hybridisation buffer (RPAII kit, Ambion). This mix was heat denatured and then hybridised overnight at 45 °C.
• Excess probe was digested with RNase A and the hybridised probe precipitated with ethanol and loaded onto a 6% polyacrylamide sequencing gel.
• Placental RNA samples examined were from the surface and deep regions of term placenta and from the villi of first trimester placenta collected as already described. Five samples from each group were examined. Results were expressed as a ratio of sflt-K to full length flt-1 mRNA.
• Figure 1A is a dark field image with specific binding in defined regions around a villus and associated widi blood vessels (v) within the villus core.
• Figure IB is a dark field on bright field of the same section as in 'A'. Binding sites were not on the trophoblast layers (arrow) but just within it. Villous stroma had some low level binding visible in both 'A' and 'B'. Binding was present around the edge of the villi but not in a continuous layer.
• Figures 2A-2F The results are shown in Figures 2A-2F.
• Figure 2 A is a dark field photograph of binding within villi in the placenta.
• Figure 2B is a serial section immunostained with anti-CD34, staining blood vessels within the placenta and revaling a similar localization pattern as seen in 2A. There is some light background staining around the large villus in 2B, and within the large villus the blood vessels are particularly evident as well as there being diffuse grains within the stroma.
• Figure 2C is a bright field micrograph at higher magnification and Figure 2D is a micrograph in which a dark field and a bright field image have been merged.
• Figure 2C reveals that I25 I-VEGF binding was not over the trophoblast but within the villous core (arrowed), more particularly the blood vessels (v) within the villi, and to a lesser extent the stromal core.
• Figures 2E and 2F are micrographs of serial sections: 2E (dark field on bright field) shows diffuse labelling is apparent on the decidua (asterisked) and within the villi (right hand side of the micrograph).
• the serial section shown in Figure 2F (which had the addition of 3nM unlabelled VEGF in the binding mix) confirms that the binding seen 2E is specific.
• the background level of 125 I-VEGF binding seen in 2F is representative of background levels found in control sections for Figures 1 and 2.
• the 125 I-VEGF is supplied in BSA and therefore it is highly probable that the binding seen at faction 15 is to BSA.
• the three samples of male serum and non-pregnant female serum also gave a peak around fraction 15 as indicated by the arrow labelled BSA/ VEGF (Fig. 3, Male).
• BSA/ VEGF Fig. 3, Male
• 125 I-VEGF binds to a larger serum protein and this comes off the column around fractions 10-11 (Fig. 3, large arrow). This binding competes with the BSA/ VEGF peak.
• one out of the three samples had very high levels of binding in this fraction.
• the method of crosslinking of human serum with 125 I-VEGF and gel electrophoresis was as follows: non-pregnant and a term pregnant serum were placed on a heparin column and the 0.6 M control and 1.0 M NaCl fractions collected. Samples were incubated with 125 I- VEGF and crosslinked before PAGE.
• the gel was loaded as follows: Lane 1, 1.0 M NaCl fraction of term pregnant serum (with bound 125 I-VEGF); Lane 2, 1.0 M NaCl fraction of non-pregnant serum (with only unbound VEGF); Lane 3, unlabelled VEGF; Lane 4, 0.6 M NaCl fraction from term pregnant serum; Lane 5, 0.6 M NaCl fraction from non-pregnant serum.
• the 1.0 M NaCl fraction contained a VEGF binding protein which when complexed with 125 I-VEGF gave a molecular weight just over 250 kDa (lane 1). This protein was not present in the non-pregnant samples (lane 2) and could be competed for with unlabelled VEGF (Lane 3).
• the control 0.6 M fraction from pregnant serum (Lane 4) had a small amount of bound 125 I-VEGF at the same molecular weight as the 1.0 M fraction. It is likely that this is the same binding protein and that a small amount was eluted from the column in the washes. No binding was evident with the 0.6 M non-pregnant samples (Lane 5). Unbound VEGF was detectable as both a monomer and as a dimeric (at 23 and 46 KD respectively).
• villus supernatant "V.S. ”
• V.S. villus supernatant
• Fig. 5 VEGF/V.S. bands were found at approximately 250 and 160 kDa, which could be displaced by the addition of unlabelled ("cold") VEGF.
• Villous cultures were thus found to produce a soluble factor(s) capable of binding VEGF.
• Recombinant sflt-K was also crosslinked with 125 I-VEGF and this resulted in bands, of similar molecular weight to those of the villus cultures (Fig. 6). Again, unbound monomeric or dimeric VEGF is apparent at about 23 and 46 KD respectively.
• the binding of 125 I-VEGF to BAE cells was used to assay for the inhibitory activity of factors binding VEGF as follows: first trimester villous from three individuals (l.V.S. to 3. V.S.) was cultured for 48 h in 6 ml of media and 5 ⁇ l or 25 ⁇ l of this supernatant used in a 500 ⁇ l I25 I-VEGF binding assay conducted in the presence of heparin. Results are presented (in Figure 7) as the percentage of control.
• lanes 1 and 2 of the gel were loaded with the first and second fractions of the 1.0M NaCl eluate, pre-incubated with 125 I-VEGF.
• Lane 3 was loaded with the 0.6M NaCl washing, similarly treated, and Lane 4 is the control containing 1.0M NaCl-eluted medium rather than culture supernatant.
• the first fraction gave a band predominantly in the 250 kDa range, which is consistent with high concentrations of sflt-K forming predominantly dimers with VEGF (Fig. 9, lane 1).
• Fraction 2 of the 1.0 M elution gave 250 kDa and 160 kDa bands consistent with lower concentrations of sflt-K binding as both a dimer and a monomer to the VEGF.
• Control fractions had very little binding activity (Fig. 9, lanes 3 and 4).
• HPVS refers to heparin-purified villous culture supernatants (0.5, 2.0 and 8.0 ⁇ l). The assay volume was 200 ⁇ l.
• RT-PCR revealed that the mRNA for sflt-K was present in the placenta throughout pregnancy.
• An RNase protection assay was designed to determine levels of both full length flt-1 and sflt-K in the placenta.
• the RNase protection assay detected bands for both full length flt-1 and sflt-K after only one day's autoradiography. This suggested that there was a significant amount of mRNA present for both these proteins. In all samples the full length flt-1 band was stronger than that for sflt-K.
• the ratio of sflt-K to full length was approximately 0.45 in all three sampling areas.
• the present inventors have used ligand binding to clarify where the VEGF binding sites are in the human placenta, and have characterised a soluble VEGF binding protein which is produced by the placental villi, can be identified in maternal circulation and is indistinguishable from sflt-K (Kendall & Thomas 1993 Proc. Natl. Acad Sci USA 90 10705-10709) by a number of criteria.
• 125 I-VEGF was found to bind principally to the fetal blood vessels within the villi with only isolated areas of trophoblast showing low level binding (Fig. 1 and 2). Under the conditions used it is likely that the 125 I-VEGF would have bound to both flt-1 and KDR although estimates of the K D values for these receptors of VEGF vary dramatically (Olander et al, 1991 Biochem. Biophys. Res. Comm. 176, 68-76; Waltenberger et al, 1994 J. Biol. Chem. 269, 26988-26995; Seetharam et al.
• Clark et al (1996 Hum. Reprod. 11, 1090-1098) used in in situ hybridisation probe specific for the extracellular domain of flt-1 and detected very strong signal over the extravillous trophoblast cells throughout pregnancy.
• Immunohistochemical localisation with antibodies directed against the intracellular carboxyl terminus of flt-1 indicated that at least some of the flt-1 produced by these cells is membrane bound (Clark et al , cited above; Ahmed et al, 1995 Growth Factors 12, 235-243; Cooper et al , 1995 J. Reprod. & Fertil. 105, 205-213).
• VEGF binding would suggest that either the mRNA detected by in situ hybridisation is not translated or that the majority of the flt-1 produced by these cells is a secreted form which is not retained on the surface of the extravillous trophoblast cells.
• the existence of such variants of flt-1 have been reported (Kendall & Thomas 1993 Proc. Natl. Acad Sci USA 90 10705-10709; Boocock et al , 1995 J. Natl. Can. Inst. 78, 506-516), but there has been little or no evidence hitherto that such molecules are produced in substantial quantities in vivo.
• Reverse transcriptase-PCR using primers which specifically amplify sflt-K confirmed that there was mRNA encoding sflt-K in the placenta throughout pregnancy. Furthermore RNase protection assays revealed that there was significant amounts of both full length flt- 1 and sflt-K mRNA present in the placenta. Although there was more full length flt-1 mRNA detected, the mRNA encoding sflt-K was also readily detectable. As yet it is not known whether there are differences in the half lives of these two species or whether the ratio observed for the mRNA is reflected in the protein levels. Analysis of superficial and deep samples of placenta (i.e.
• tissue samples with and without substantial quantities of extravillous trophoblast cells present showed that the ratio of fit: sflt-K mRNA was the same. This suggests that in the first trimester as well as at term the villous trophoblast is an important source of sflt-K mRNA.
• first trimester villi were cultured in serum free media and the supernatant analysed. Incubation of the villous supernatant with 125 I-VEGF and subsequent fractionation by gel filtration chromatography showed a binding peak that was similar to that observed when recombinant sflt-K was used (Fig. 3). Crosslinking to 1 5 I-VEGF and gel electrophoresis revealed the complexes of approximately 250 and 160 kDa.
• VEGF binding activity could be identified in the serum of pregnant women. Using the binding and gel filtration assay described above serum from women in the first trimester of pregnancy and at term had binding activity which was not detectable in the serum from non-pregnant women or males (Fig. 3). A VEGF binding protein was also purified from term pregnant serum by the method used by Kendall and Thomas for sflt-K but was not detected in non-pregnant serum (Fig. 4).
• VEGF-receptor chimeric proteins can block VEGF induced retinal neovascularisation (Aiello et al , 1995 Proc. Natl. Acad. Sci. USA 92, 10457-10461). This indicates that such proteins could play a role in the regulation of VEGF action in vivo.
• the sflt-K produced by the trophoblast provides a mechanism for regulating the action of VEGF in the decidua. This is a site where large amounts of VEGF are produced by the macrophages in Nitabuch's stria during the first trimester of pregnancy; but where the process of vascular transformation is required rather than angiogenesis.
• the present inventors developed the hypothesis that, in pregnancy, the level of bioactive VEGF is of great importance and is tightly regulated by the placental production of a soluble receptor for VEGF. Therefore, perturbation of this system, either by production of excess VEGF or insufficient VEGF antagonist (soluble receptor) could lead to homeostasis problems which may cause some of the placental pathology observed in pre- eclampsia. To investigate this possibility in vivo experiments were performed.
• VEGF 165 is so-named because each polypeptide chain present in the dimeric molecule comprises 165 amino acids.
• the other most common form of VEGF is VEGF121.
• VEGF 165 was provided by colleagues of the inventors at Amgen and was prepared by expression of the relevant nucleotide sequence (reviewed by Ferrara et al , 1992 Endocrine Reviews 13, 1) in E. coll However, equivalent VEGF165 is commercially available from a number of sources, including R & D Laboratories (Abingdon, Oxford, UK, catalogue number 293/VE).
• Control mice were injected with vehicle (PBS) alone on the same days. Histological examination of the placentae from the treated animals revealed several important features:
• the table shows the number of resorption sites in the uterus (where the embryo has died and the embryo and placenta are being broken down and resorbed), in pregnant mice treated either with vehicle (PBS, control group) or with VEGF 165 in PBS. There is a statistically significant difference between the results for the two groups.
• Table 2 shows the weights of embryos in pregnant mice treated either with vehicle (PBS, control group) or with VEGF 165 in PBS. There is a statistically significant difference between the results for the two groups.
• transgenic animals with the VEGF gene overexpressed
• Such animals preferably laboratory mammals, conveniently mice or rats
• Such animals could then be used in trials to discover new substances with efficacy in the treatment of pre-eclampsia. This represents a significant develpoment, as hitherto no suitable animal model has been found.
• PIGF Placental Growth Factor
• PIGF is a dimeric, secreted factor capable of promoting endothelial cell proliferation in vitro which is structurally related to VEGF (Maglione et al., 1991 Proc. Natl. Acad. Sci. 88, 9267-9271).
• VEGF vascular endothelial growth factor
• Three alternatively spliced variants have been identified with P1GF-2 having affinity for heparin (Cao et al., 1997 J. Biol. Chem. 271, 3154-3162).
• Recombinant P1GF-1 produced by overexpressing eukaryotic cells is highly active on endothelial cells in chemotactic, mitogenic and angiogenic assays (Ziche et al, 1997 Lab. Invest. 76, 517- 531).
• Human umbilical vein endothelial cells display two classes of binding sites for PIGF homodimers. The high affinity binding is to FLT-1 while the lower affinity receptor is yet to be identified (Park et al, 1994 J. Biol. Chem. 269, 25,646-25,654; Clauss et al, 1996 J. Biol. Chem. 271, 17629-17634). P1GF/VEGF heterodimers have been found which bind to the KDR receptor (Cao et al, 1996). PIGF and VEGF can thus act in unison on both monocyte and endothelial cells (Clauss et al, 1996).
• the ability of PIGF to bind the VEGF receptors indicates that it may be important in regulating the VEGF system as well as inducing angiogenesis itself.
• the inventors have investigated a): the localisation of PIGF and VEGF in the placenta to determine whether there is any co-localisation and thus whether heterodimer formation is likely to occur, and b): the levels of PIGF in the plasma of pregnant women before the onset of pre-eclampsia (levels were also determined in gestationally age-matched control women who did not subsequently develop pre-eclampsia).
• Plasma samples were collected in EDTA tubes from normotensive and pre-eclamptic women and were matched for gestational age (within 7 days). Plasma samples were also collected from five non-pregnant women. Diagnosis of pre-eclampsia required a blood pressure of at least 140/90 mmHg, or an increase in diastolic blood pressure of greater than 25 mmHg. These patients also developed proteinurea which was at least 2+ of protein of a catheterized specimen or at least 300 mg in a 24 hr collection as previously detailed by Sharkey et al. (1996 Eur.
• ELISA analysis of plasma samples are given in Fig. 11.
• the levels of PIGF were below the limit of detection of 7 pg/ml.
• the other three non-pregnant women (“Non-P" in Fig. 11) levels were from 7-8 pg/ml.
• the levels of PIGF in the plasma of pre-eclamptic women (circle symbols in Fig. 11) ranged from 21-1093 pg/ml but with only one sample over 257 pg/ml. The average for the pre-eclamptic plasma was 185 pg/ml.
• a diagnostic and/or predictive test could be based on the determination of the amount of any one of PIGF, VEGF or sFLT in the women, preferably a measurement of any two thereof, and most preferably a measurement of all three substances. It is possible that the ratio of any two or more of the substances may be more informative or predictive than the absolute levels of the substances.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Immunology (AREA)
• Chemical & Material Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Pharmacology & Pharmacy (AREA)
• Gastroenterology & Hepatology (AREA)
• Epidemiology (AREA)
• Animal Behavior & Ethology (AREA)
• Zoology (AREA)
• Public Health (AREA)
• Cell Biology (AREA)
• Urology & Nephrology (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Hematology (AREA)
• Microbiology (AREA)
• Biotechnology (AREA)
• Vascular Medicine (AREA)
• Food Science & Technology (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• Biochemistry (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Investigating Or Analysing Biological Materials (AREA)
• Medicines Containing Plant Substances (AREA)

Applications Claiming Priority (5)

Publications (1)

Family

ID=26310711

Family Applications (1)

Country Status (4)

Families Citing this family (22)

Family Cites Families (2)

• 1997
  • 1997-12-22 CA CA002275708A patent/CA2275708A1/en not_active Abandoned
  • 1997-12-22 WO PCT/GB1997/003519 patent/WO1998028006A1/en not_active Application Discontinuation
  • 1997-12-22 EP EP97950306A patent/EP0951298A1/de not_active Withdrawn
  • 1997-12-22 AU AU53312/98A patent/AU5331298A/en not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events