EP0839183A1 - Cellule tumorale epitheliale immortalisee - Google Patents

Cellule tumorale epitheliale immortalisee

Info

Publication number
EP0839183A1
EP0839183A1 EP96923904A EP96923904A EP0839183A1 EP 0839183 A1 EP0839183 A1 EP 0839183A1 EP 96923904 A EP96923904 A EP 96923904A EP 96923904 A EP96923904 A EP 96923904A EP 0839183 A1 EP0839183 A1 EP 0839183A1
Authority
EP
European Patent Office
Prior art keywords
tumor cell
cells
epithelial tumor
epithelial
cell according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96923904A
Other languages
German (de)
English (en)
Inventor
Achim Dickmanns
Ellen Vanderbilt University FANNING
Klaus Pantel
Gerhard RIETHMÜLLER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Amgen Research Munich GmbH
Original Assignee
Micromet GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Micromet GmbH filed Critical Micromet GmbH
Priority to EP96923904A priority Critical patent/EP0839183A1/fr
Publication of EP0839183A1 publication Critical patent/EP0839183A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001152—Transcription factors, e.g. SOX or c-MYC
    • A61K39/001153—Wilms tumor 1 [WT1]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001103—Receptors for growth factors
    • A61K39/001106—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ErbB4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001152—Transcription factors, e.g. SOX or c-MYC
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001154—Enzymes
    • A61K39/001164—GTPases, e.g. Ras or Rho
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5152—Tumor cells

Definitions

  • the present invention relates to epithelial tumor cells with metastatic potential which have integrated in their genome or another replicative genetic element at least one externally introduced immortalizing oncogene and optionally at least one gene encoding an immunostimulatory factor which are expressed in such tumor cells.
  • the invention further relates to antibodies which specifically recognize the epithelial tumor cells of the invention, to processes for the production of said tumor cells as well as pharmaceutical and diagnostic compositions comprising said tumor cells and antibodies, respectively.
  • the present invention relates to the use of the epithelial tumor cells and/or antibodies of the invention for the preparation of tumor vaccines and medicaments for the prophylaxis and/or treatment of cancer and/or the metastasis of cancer.
  • the prognosis factors considered for a therapy decision for the patient only depends on statistical indices of the prognosis.
  • Systemic adjuvant therapies applied after the surgical resection of the primary tumor for the secondary prevention of metastatic relapse are often accompanied by serious toxic side-effects (Hillner and Smith, New Engl. J. Med. 324:160, 1991; Early breast cancer trialists 1 collaborative group, loc. cit. ) .
  • DE-PS 44 22 570 discloses a method of transforming stromal cells with a replication deficient SV40 virus. Whereas this result might have been expected, since the transforming principle of SV40, the large T antigen, is known to interact (and inactivate or interfere with) the tumor suppressor gene p53 which in turn controls the transition of the GO into the Gl cell cycle phase, the person skilled in the art would not expect any corresponding result in the case of tumor cells (Levine et al. , Brit. J. Cancer, 69:409, 1994, Sussi et al. , In. J. Cancer, 57:1, 1994) .
  • the technical problem underlying the present invention was to provide an epithelial tumor cell with metastatic potential that can be used for the study and development of compounds or compositions of diagnostic and therapeutic value.
  • the present invention relates to an epithelial tumor cell with metastatic potential which has integrated in its genome or another replicative element an externally introduced immortalizing oncogene which is expressed in said cell.
  • the tumor cell of the present invention may be used to generate large quantities of cells that are derived from the earliest metastasizing cells and that apparently have conserved the phenotype of the residual tumor cells present in the patient.
  • the availability of such cells opens a new avenue to an in-depth molecular analysis of cancer micrometastasis and may, e.g., be useful as a novel source for autologous tumor cell vaccines.
  • the great advantage of this source is that it could be applied in the critical stage of minimal residual cancer, when the tumor load is minimal and the immune system is still intact.
  • the term "metastatic potential” describes the potential of said epithelial tumor cell to be the nucleus of metastatic formation. It is known that the formation of tumor cells is a complex and multistage process. The first step is the generation of cell variants in the primary tumor which subsequently detach from the tumor coenobium and proceed after invasion and penetration of the stromal tissue to the lymph or blood vessel system (Hart and Saimi, The Lancet 339:1453, 1992) . As is known from early work in this field, cell clones already develop in the early growth phase of a tumor which display significant differences in their metastatic behaviour. The generation of new variants can be observed during the subsequent stages of tumor progression. Molecular analysis has identified changes in cell surface marker expression to be correlated with the metastatic potential of tumor cells.
  • markers are ICAM- 1 and certain variants of CD44 (e.g. Mayer et al . , The Lancet 342:1019, 1993) . It has furthermore been found that the down regulation of the expression of desmosomal adhesion molecules such as E-cadherin and plakoglobin is involved in the detachment of tumor cells with metastatic potential from the coenobium (e.g. Birchmeier et al. , in "Contrib. Oncol.”, Rabes et al . , eds., Karcher, Basel 1992, 95) . Subsequently, the expression of motility factors (e.g.
  • immortalizing oncogene relates to an oncogene with the potential to immortalize the epithelial tumor cell of the invention such that said tumor cell is thereafter capable of being continuously kept in cell culture.
  • immortalizing therefore differs in the context of the present invention from the term “transforming” which denotes the capacity of a transforming principle to promote the transition of a normal cell into a dividing or non-dividing tumor cell.
  • a transformed cell is characterized by loss or reduction of adherence dependent growth, loss of contact inhibition, and serum or growth factor independence.
  • Said immortalizing oncogene is expressed upon integration into a chromosome or another replicative genetic element such as stable mini-chromosomes in said epithelial tumor cell.
  • viral DNA can be found in the cell as episomes.
  • said oncogene will usually employ the expression machinery of the immortalized cell, the regulatory sequences directing the expression of said oncogene may be both of intracellular or extracellular origin.
  • said epithelial tumor cell is a disseminated tumor cell.
  • the term "disseminated tumor cell” refers to the fact that the tumor cell has already detached from the coenobium. It may e.g be in the blood stream or in the lymph system or be settled in the final tissue of its migration such as bone marrow.
  • the tumor cell of the invention is an autologous tumor cell.
  • the term “autologous” means that the tumor cell is derived from the same organism into which it is, usually after genetic or other manipulation, reintroduced, e.g. for therapeutic purposes.
  • said term denotes the case that the epithelial tumor cells of the invention are kept or tested in cell culture with cells derived from the same organism.
  • the epithelial tumor cell of the invention is a human tumor cell.
  • said epithelial tumor cell with metastatic potential is derived from bone marrow.
  • derived from bone marrow means that the tumor cell has infiltrated bone marrow and may be detected therein or isolated therefrom. Said term is not intended to mean that said tumor cell was before transformation a normal bone marrow cell.
  • bone marrow as a preferred source of epithelial tumor cells with metastatic potential is based on the fact that the bone marrow compartment is a relatively easily accessible. Further, a number of epithelial tumors preferably invades the skeletal system (Zetter, New Engl. J. Med. 332:605, 1990) . This may be explained by the finding that the last three steps of the cascade to metastasis development, namely the so-called arrest, the extravasation and the proliferation into the invaded tissue strongly depend on tissue specific factors and are obviously favoured in the bone marrow.
  • a further preferred embodiment of the present invention relates to the above-characterized epithelial tumor cell wherein the immortalizing oncogene is a DNA encoding the early region of SV40 DNA and preferably the large T antigen of a replication deficient SV40 virus.
  • DNA encoding the early region of SV40 DNA is intended to mean any DNA molecule irrespective of the actual nucleotide sequence which encodes a large T antigen, small t antigen and/or the 17K T antigen, or a truncated form thereof, said T(t) antigen or truncated form thereof being capable of immortalizing the host cell.
  • the DNA encoding the large T antigen, small t antigen and/or 17K T antigen will be introduced into the tumor cell as a part of the complete or partial SV40 genome.
  • the proper expression requires the SV40 enhancer at the 5' end and the poly A signal (AATAAA) at the 3' end (bp 2603) of the SV40 sequence.
  • replication deficient SV40 virus relates to the fact that the origin of replication of the SV40 DNA is not capable of being replicated or unwound.
  • the replication deficiency can be caused by mutations in the origin of replication. Alternatively mutations in the SV40 early coding region can cause a replication defect.
  • the replication defect may most preferably be caused by (a) defect (s) such as (a) point mutation(s), (a) deletion(s), (an) insertion(s) etc. in the so-called “origin of replication” (ORl) of the SV40 genome.
  • a defect such as (a) point mutation(s), (a) deletion(s), (an) insertion(s) etc. in the so-called “origin of replication” (ORl) of the SV40 genome.
  • said replication defect is caused by one or more mutations, insertions, deletions etc. in the antigen coding region.
  • the defect e.g. in the large T coding region has the effect that immortalization of the host cell, but no virus DNA replication occurs, for example due to defects in the DNA-binding domain, helicase activity or other properties required for replication in SV40 large T antigen.
  • the replication deficiency in the SV40 DNA which is not necessary to carry out the invention but contributes to the overall safety of the system serves the purpose to prevent replication of the viral genome which could eventually lead to uncontrolled replication of the viral DNA and therewith to the destruction, and not the immortalization, of the hosting tumor cell.
  • said SV40 virus is non- infectious.
  • This most preferred embodiment is particularly suitable for the development of pharmaceutical compositions or tumor vaccines comprising the tumor cell of the invention. It is furthermore particularly suitable for any scientific or medical purpose where the non-infectiousness of the SV40 virus is desired or prescribed.
  • the viral core proteins may be inactivated such as by a deletion of a 546bp fragment in the DNA encoding VPl and VP2 which is further illustrated in the examples.
  • At least one additional oncogene is integrated in the genome of the epithelial tumor cell.
  • Said additional oncogene may enhance the percentages of tumor cells which are immortalized upon the integration of the externally introduced immortalized oncogene.
  • said additional oncogene is ras, mutant WT1 (Wilms tumor) , bcl-2, p53mut, myc, HER 2/neu, an HPVl6 oncogene, an HPVl8 oncogene or EIA.
  • an additional oncogene could enhance or supplement the effect of SV40 T(t) antigens and related proteins.
  • a further preferred embodiment of the present invention relates to a tumor cell which has additionally integrated in its genome or another replicative genetic element at least one externally introduced gene encoding an immunostimulatory factor.
  • cytokines e.g. IL-2, IL4, IFN- ⁇ , IFN- ⁇
  • said immunostimulatory factor is B7 or a cytokine, e.g. IL-2, IL-4, IL-7, IFN- ⁇ or IFN- ⁇ .
  • the present invention additionally relates to an antibody or fragment thereof or a derivative of said antibody or said fragment which specifically recognizes the epithelial tumor cell of the invention.
  • the term "specifically recognizes the epithelial tumor cell of the invention” means that the antibody is capable of distinguishing between the normal epithelial cell from which the tumor cell with metastatic potential is derived and a primary epithelial tumor cell on the one hand and the immortalized epithelial tumor cell with metastatic potential of the present invention on the other hand.
  • the antibody of the invention may be a polyclonal, a monoclonal, a chimeric, a synthetic or a semisynthetic antibody.
  • the generation of such antibodies including the design of immunogens, the immunization strategy as well as the isolation of the antibodies may follow well established protocols which are described e.g. in Harlow and Lane, Antibodies, A Laboratory Manual, CSH Press, Cold Spring Harbor 1988.
  • fragment of an antibody relates to any fragment capable of binding the tumor cell of the invention.
  • antibody fragments are Fab, F(ab)2 or Fv fragments.
  • derivative of said antibody or said fragment thereof refers to a modified antibody or fragment of the invention. This modification may be effected e.g. by genetic engineering or by chemical means.
  • the genetically engineered antibodies or fragments thereof comprise fusion proteins or single chain (VL or V H) derivatives.
  • the chemically modified antibodies or fragments thereof also include chemical conjugates such as bispecific antibodies.
  • said antibody is a monoclonal antibody.
  • the present invention relates further to an in vitro process for the production of the tumor cell of the invention comprising the step of incorporating DNA comprising DNA encoding at least one immortalizing oncogene and optionally at least one gene encoding an immunostimulatory factor into a non-immortalized epithelial tumor cell with metastatic potential.
  • the process of the present invention for the first time allows the specific and unlimited expansion of tumor cells of epithelial origin with metastatic potential.
  • the present invention can be applied to all cases where a selective expansion of a defined subpopulation of rare cells is wanted. Examples for such an application are the expansion of fetal erythroblasts from the maternal blood for the purpose of genetic diagnosis of inborn defects, and the expansion of hematopoiesis-supporting bone marrow stroma cells located in the close neighborhood of hematopoietic stem cell clusters, which could be used as feeder cells to enhance expansion of stem cells in vitro (e.g. for autologous stem cell transplantation of cancer patients undergoing high dose chemotherapy) .
  • the step of incorporation may comprise any suitable incorporation method.
  • said incorporation comprises microinjection or bombardement of the target cells with DNA-coated microvesicles.
  • the microinjection of cells has been well established in the art in the 1980 's and need not be described here further.
  • the microinjection step allows the specific introduction of the DNA encoding at least one oncogene capable of immortalizing the cells, preferably the large T antigen of SV40 into the desired tumor cells embedded e.g. in bone marrow tissue or kept in cell culture after enrichment. For a better identification, said cells may be tagged with a labelled antibody.
  • said cells may be cultivated and expanded and therefore establish a cell line with the characteristics of the present invention.
  • said process additionally comprises the step of carrying out a primary expansion of said non-immortalized epithelial tumor cells prior to the incorporation step.
  • This embodiment is particularly suitable for carrying out the process of the present invention because it allows the enrichment and selective proliferation of non-immortalized tumor cells prior to microinjection. Said expansion leads to an easier identification of the desired cells and, accordingly, significantly facilitates the incorporation, e.g. the microinjection process.
  • a standard culture medium (RPMI 1640) is supplemented with standard ingredients including 10 % fetal calf serum, 10 ⁇ g/ml transferrin, 5 ⁇ g/ml insulin, and 2 mM glutamine.
  • the media are changed once to twice a week and fresh growth factors (as indicated below) are added to the cultures.
  • the adherent cells including the epithelial tumor cells
  • a standard technique incubation with trypsin/EDTA
  • said primary expansion comprises the step of culturing tissue or a body fluid comprising non- immortalized epithelial tumor cells in a suitable medium promoting the expansion of said tumor cells.
  • said body fluid is bone marrow, blood, ascites or pleural exsudate.
  • the medium promoting the expansion of tumor cells comprises recombinant human (rh) EGF (epidermal growth factor) and/or rh bFGF (basic fibroblast growth factor) .
  • the culturing step comprised in the method of the invention is carried out in extracellular matrix (ECM) -coated tissue flasks and/or at reduced oxygen concentrations of 5-10%.
  • ECM extracellular matrix
  • the present invention relates additionally to a pharmaceutical composition
  • a pharmaceutical composition comprising the epithelial tumor cell of the invention and/or the antibody, derivative or fragment thereof of the invention, optionally in combination with a suitable pharmaceutical carrier.
  • the pharmaceutical composition of the present invention may be used for the prophylaxis of cancer.
  • the pharmaceutical composition of the present invention may further be used for the treatment of cancer and/or metastasis of cancer.
  • the pharmaceutical composition containing the epithelial tumor cell of the invention may form the basis of an autologous or allogenic tumor cell vaccine, generated by suitable formulation and/or genetic modification of the cells such as transfection with immune stimulatory molecules and/or cytokines.
  • the epithelial tumor cell or its genetic modification generated by transfection with immune stimulatory molecules and/or cytokines may be used to ex vivo stimulate a patient's immune cells isolated by known methods such as leukapheresis or isolation with magnetic beads. Reinfusion of such stimulated cells may generate an effective immune response to a patient's tumor.
  • the antibody, derivative or fragment thereof of the invention may be administered to a patient after surgical removal of a primary tumor in order to prevent tumor relapse .
  • a clear advantage of the minimal residual disease stage as target for a specific immunization approach is the accessibility of early disseminated cells, 'which frequently lodge in mesenchymal compartments, where potential effector cells abound (Riethm ⁇ ller and Johnson, Curr. Op. Immunol. 4:647, 1992; Pantel and Riethm ⁇ ller, Oncology Today 11:4, 1994) . Additionally, the present invention relates to a diagnostic composition comprising the epithelial tumor cell of the invention and/or the antibody of the invention.
  • the diagnostic composition of the present invention may be used for the detection of an epithelial tumor cell with metastatic potential in any suitable tissue such as blood and bone marrow.
  • the present invention relates to the use of the epithelial tumor cell of the invention- for the preparation of a medicament for the prophylaxis and/or treatment of cancer and/or metastasis of cancer.
  • the present invention also relates to the use of an antibody or derivative or fragment thereof of the invention for the preparation of a medicament for the prophylaxis and/or treatment of cancer and/or metastasis of cancer.
  • the present invention relates to the use of the epithelial tumor cell of the invention or the antibody or derivative or fragment thereof of the invention for the preparation of a tumor vaccine.
  • Fig. 1 Construction of transformation vector.
  • pUC12 is a member of a family of vectors with several common features. They contain a multiple cloning site in the lacZ-gene and carry an ampicillin resistance gene (Vieira, J. and Messing, J. , Gene, 19:259, 1982; Yanish-Perron, C, et al. , Gene, 33:103, 1985) .
  • pUCIn wt was cloned by introducing the 4697 basepair SV40 genome fragment BamHI (bp 2533) -origin of replication- PstI (bp 1988) containing the origin of replication, in the linker of pUC12. A 546 bp fragment in the late region of SV40 is deleted.
  • the plasmid pUCInl contains 7359bp.
  • Fig. 2 Principle of Microinjection of SV 40 early gene DNA
  • the tumor cells were plated onto petri dishes (3.5 cm in diameter, Costar, Germany) one day before injection with the microinjector model 5171 (Eppendorf, Hamburg, Germany) mounted on an inverted IM35 microscope (Carl Zeiss, Oberkochen, Germany) . After injection of 200 to 300 cells per plate, the cells were re-transferred into separate T25 culture flasks and cultured, as described above. An experienced worker needs about 30 minutes to inject 200 to 300 epithelial cells. Since non-injected cells normally die off after 4-8 weeks in culture, the SV40-transduced cells are selected by their persistent growth in culture.
  • Fig. 3 Expression of the SV40 large T antigen in microinjected epithelial cells from the bone marrow culture of a patient with bronchial carcinoma (magnification 125x) .
  • Fig. 4 Primary in vitro expansion and immortalization of micrometastatic cancer cells.
  • A-C Primary cultures of bone marrow from three individual patients with prostate cancer who were staged as free of overt metastasis by conventional tumor staging procedures. At the indicated time points, the cultured cells were trypsinized and immunocytochemical screening for CK-positive tumor cells was performed.
  • D, E SV 40 large T DNA- induced long term growth of micrometastatic tumor cells in culture. Primary bone marrow cultures established from a patient with either non-small cell lung cancer (D) or prostatic cancer (E) were microinjected with SV 40 large T antigen DNA. Cells were trypsinized at the indicated time points and immunostained for expression of cytokeratin (fjj) and large T antigen ( ⁇ )
  • Fig. 5 Detection of differential expression of surface markers on primary epithelial tumor cells and on immortalized epithelial tumor cells from bone marrow.
  • wt (Fig. 1) was cloned by integration of the SV40 genome fragments Pstl/BstXI (2471bp) and BstXl/BamHI (2226bp) from pSVInl (Cohen et al. , J. Virol 51:91, 1984) into pUC12.
  • the fragments from pSVInl contain a disrupted origin generated by an insertion of one bp in the center of the 27 bp palindrome, thereby destroying the Bgll site.
  • Bone marrow aspirates were obtained from both sides of the upper iliac crest through a aspiration needle.
  • the volumes of all aspirates ranged from 2 to 10 ml (mean: 4 ml) ,
  • slides were either stained immediately or stored at -80°C prior to use with preservation of epithelial antigens for at least two years.
  • CK2 and A45-B/B3 Two anti-cytokeratin (CK) mAbs (CK2 and A45-B/B3) were used for tumor cell detection in bone marrow cytospin preparations (Debus et al. , EMBO J. 1:1982; Karsten et al. , Eur. J. Cancer Clin. Oncol. 21:733, 1985; Schlimok et al . , Proc. Natl. Acad. Sci. USA 84:8672, 1987; Pantel et al. , J. Hematother. 3:165, 1994) (1) CK2 (IgGl; kindly provided by Dr. M. Osborn, Max-Planck-Institut G ⁇ ttingen, and later obtained from Dr. H.
  • CK18 cytokeratin polypeptide No. 18
  • CK2 stains all "normal" (non malignant) cells of simple epithelia and tumors derived thereof as well as transitional cell carcinomas and a major fraction of squamous cell lung carcinomas (Pantel et al. , Cancer. Res. 53:1027, 1993; Debus et al. , Am. J. Pathol. 114:121, 1984; Debus et al . , Embo. J.
  • mAb A45-B/B3 (IgG l; kindly provided by Dr. N. Karsten, Max-Delbr ⁇ ck Zentrum, Berlin, Germany) , which detects a common epitope of a variety of cytokeratin components, including CK8, 18 and 1 9 (Karsten et al. , Eur. J. Cancer Clin. Oncol. 21:733, 1985; Conrad et al . , Biomed. Biochim. Acta 47:697, 1988) .
  • the mAbs were used at optimal concentrations, ranging from 2.5 4 mg/ml. Appropriate dilutions of unrelated mouse myeloma proteins served as IgGl isotype control (MOPC21 from Sigma, Deisenhofen, Germany) .
  • the antibody reaction was developed with the alkaline phosphatase anti-alkaline phosphatase (AP AP) technique combined with the Neufuchsin-method for visualizing antibody binding (Cordell et al . , J. Hiche . Cytochem. 32:219, 1984) . Briefly, after incubation with the primary antibody, a polyvalent rabbit anti-mouse Ig antiserum (Z259, Dako, Hamburg, Germany) , and preformed complexes of alkaline phosphatase and monoclonal anti-alkaline phosphatase antibodies (D651, Dako, Hamburg, Germany) , were used at the dilutions recommended by the manufacturer (Dakopatts, Hamburg, Germany) . To allow a fast screening for mAb- positive cells on the slides, no counterstaining was performed.
  • AP AP alkaline phosphatase anti-alkaline phosphatase
  • a combined immunogold/enzymatic technique was used that has been successfully applied to the detection of histogenic and proliferation-associated markers on disseminated tumor cells (Riesenberg et al. , Histochemistry 99:61, 1993) . Briefly, cells were first incubated for 45 min. with mAb ER-PR8 (Gallee et al. , Prostate 9:33, 1986) directed to prostate-specific antigen (PSA) (IgGl, Dakopatts, Hamburg, Germany) . After a thorough wash with phosphate-buffered saline, gold-conjugated goat anti-mouse immunoglobulins were incubated for 45 min.
  • PSA prostate-specific antigen
  • the slides were washed and exposed to 2% glutaraldehyde diluted in phosphate-buffered saline for 5 min.
  • the following immunoenzymatic step was similar to the single labelling method described above, except for the use of biotinylated mAb CK2, which was developed with preformed complexes of streptavidin and alkaline phosphatase.
  • the freshly prepared silver enhancement mixture (Amersham, Braunschweig, Germany) was applied for about 20 min and the reaction was monitored every 5 min by placing the slides under the microscope. To abrogate the enhancement reaction, the slides were rinsed in distilled water. All slides were examined by two independent observers in a double-blinded fashion.
  • the culture medium contained RPMI 1640 medium supplemented with 10% fetal calf serum, 10 mg/ml transferrin, 5 mg/ml insulin, 2 mM glutamine, 10 ng/ml recombinant human epidermal growth factor (Boehringer Mannheim, Mannheim, Germany) and 10 ng/ml recombinant human basic fibroblast growth factor (PBH, Hannover, Germany) .
  • the concentration of CK+ cells increased with time since the hematopoietic bone marrow cells waned and died off, as demonstrated by sequential staining for the common leukocyte antigen CD 45, using mAb T9/33 (Trowbridge, J. Exp. Med. 148:313, 1978) .
  • the growth rates observed in vitro do not necessarily reflect the in vivo growth patterns.
  • In bone-seeking tumors like cancer of the prostate, lung and breast culturing of bone marrow did not lead more frequently to outgrowth of epithelial cells than in colorectal cancer (Table 2) , in whom manifest metastasis of skeleton is rare (Weiss L., Grundmann E. Thorhorst J. et al. , Haematogenous metastatic patterns in colonic carcinoma: an analysis of 1541 necropsies. J. Pathol 150:195-203, 1986) .
  • micrometastatic cancer cells are presumably selected in vivo for their disseminative capability, the in vitro growth potential of these cells remains heterogeneous.
  • Epithelial cells as defined by CK-staining, were not detected in bone marrow cultures from 17 patients without evidence of malignant epithelial tumors (Table 2) . Also, the primary aspirates of their bone marrow were negative for CK+ cells. Therefore it appears unlikely that ectopic expression of cytokeratins (Traweek et al . , Am. J. Pathol 142:1111, 1993; Galmiche et al . , Blood 82:66, 1993) is induced by specific culture conditions described herein.
  • Microinjection was chosen as an efficient route of gene transfer (Bartek et al. , Int. J. Cancer 45:1105, 1990; Fauth et al., Renal Physiol. Biochem. 14:128, 1991) that allowed the selective transduction of epithelial tumor cells in the established primary marrow cultures.
  • the tumor cells were plated onto petri dishes (3.5 cm in diameter, Costar, Germany) one day before injection with the microinjector model 5171 (Eppendorf, Hamburg, Germany) mounted on an inverted IM35 microscope (Carl Zeiss, Oberkochen, Germany) . After injection of 200 to 300 cells per plate, the cells were re-transferred into separate T25 culture flasks and cultured, as described above. At different time points the adherent cells were detached by trypsin-EDTA treatment and immunostained using the APAAP method.
  • RNA was reverse transcriptase PCR (RT-PCR) analysis.
  • Total RNA of about 10° cells of each evaluated culture was purified with the guanidine thiocyanate method. 2 ml total RNA was reverse transcribed into cDNA using specific primers for intestine-specific annexin (ACTATGCGAATCAACGTC) , prostate-specific antigen (TGACGTGATACCTTGAAGCA) and gross- cystic disease-fluid-protein-15/prolactin-inducible-protein (GTGTGGCAAACAGACAGG) (Schulz et al. , Nucleic. Acids. Res. 16:6226, 1988; Wice and Gordon, J. Cell Biol.
  • T antigen mutants Recent analyses of a number of T antigen mutants have clearly shown that the specific DNA binding properties of T antigen are not essential for immortalization (Fanning and Knippers, Annu. Rev. Biochem. 61:55, 1992; Dobbelstein et al . , Oncogene 7:837, 1992) .
  • SV40 large T antigen interacts specifically with the products of two known tumor suppressor genes, the p300 or related functions (Yaciuk et al., Mol. Cell. Biol. 11:2116, 1991) and with retinoblastoma susceptibility (RB) gene and the p53 gene, thereby neutralizing the growth-arresting properties of both proteins (Fanning ' and Knippers, Annu. Rev. Biochem.
  • the method established here appears to be a feasible way to generate large quantities of cells that are derived from the earliest metastasizing cells and that apparently have conserved the phenotype of the residual tumor cells present in the patient.
  • the availability of such cells opens a new avenue to an in-depth molecular analysis of cancer micrometastasis and may, e.g., be useful as a novel source for autologous tumor cell vaccines.
  • the great advantage of this source is that it could be applied in the critical stage of minimal residual cancer, when the tumor load is minimal and the immune system is still intact (Riethm ⁇ ller, G. and Johnson J.P., Current Opinion in Immunology 4 (1992), 647-655).
  • micrometastatic cancer cells themselves are the ideal target candidates.
  • the evaluation of the immune response against these tumor cells is, however, hampered by their extremely low frequency (e.g. 10 - 10 ° in bone marrow) .
  • culture conditions allowing a more than 10, 000-fold transient expansion of early disseminated epithelial tumor cells present in bone marrow were established. Expanded cells were immortalized by selective microinjection with SV 40 large tumor antigen DNA without gross changes in the expression pattern of epithelial antigens.
  • the gene encoding for the co-stimulatory molecule B7 was transduced in a retroviral vector. Immunostaining of these cells revealed the following phenotype: HLA-A2 + /A3 + , HLA-Bw4 ⁇ /Bw6 + and ICAM1 + . Incubation with lOU/ml IFN- ⁇ for 72 h increased the expression of these molecules except for Bw4.
  • mRNA was prepared from tumor cells (renal cell carcinoma) and from CK+ cells from bone marrow and reverse transcribed into cDNA using oligo-dT-priming.
  • "Hot" PCR i.e. PCR with radioactively labeled material was carried out with random and oligo-dT-primers. The products of said PCR were analysed using urea-polyacrylamide electrophoresis.
  • Fig. 5 shows the results of two such experiments. In Fig. 5a tumor specific bands and in Fig. 5b bands specific for CK+ cells are clearly visible. Next, the bands that were differentially amplified were isolated, cloned and sequenced.
  • Full length cDNA was obtained using conventional DNA libraries obtained from the above cells. Full-length cDNAs were cloned in E.coli, followed by recombinant protein expression in E.coli. The recombinant proteins were used to generate specific polyclonal antisera in mice. Specificity of the sera tumor cells from bone marrow was confirmed using native tumor probes. Finally, monoclonal antibodies were generated against the specific proteins.
  • MNC mononuclear cells isolated from bone marrow aspirates were immunostained, using the APAAP-staining technique with anti- cytokeratin mAbs CK2 and A45-B/B3.
  • Tumour type Number of Frequency of CK-positive cells in bone marrow * patients (number of patients with n CK + cells analysed per 8 x 10 5 MNC)
  • Prostate cancer 22 12 (54.5%) 11000 l x lO 5
  • Renal cell cancer 12 6 (50.0%) 690 8.8 x IO 3
  • Tumour type Number of Number of passages Epithelial markers patients (mean value) (Number of positive cultures)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention se rapporte à des cellules tumorales épithéliales ayant un potentiel métastatique qui ont intégré dans leur génome ou dans un autre élément génétique de répétition au moins un oncogène immortalisant introduit de façon externe et éventuellement au moins un gène codant un facteur immunostimulateur, qui sont exprimés dans de telles cellules tumorales. En outre, l'invention se rapporte à des anticorps reconnaissant spécifiquement les cellules tumorales épithéliales de cette invention, à des procédés pour la production desdites cellules tumorales ainsi qu'à des compositions pharmaceutiques et de diagnostic comportant respectivement lesdites cellules tumorales et lesdits anticorps. Enfin, l'invention décrit l'utilisation des cellules tumorales épithéliales et/ou anticorps pour la préparation de vaccins antitumoraux et de médicaments pour la prophylaxie et/ou le traitement du cancer et/ou de la métastase du cancer.
EP96923904A 1995-06-23 1996-06-24 Cellule tumorale epitheliale immortalisee Withdrawn EP0839183A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP96923904A EP0839183A1 (fr) 1995-06-23 1996-06-24 Cellule tumorale epitheliale immortalisee

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP95109860 1995-06-23
EP95109860 1995-06-23
PCT/EP1996/002747 WO1997000946A1 (fr) 1995-06-23 1996-06-24 Cellule tumorale epitheliale immortalisee
EP96923904A EP0839183A1 (fr) 1995-06-23 1996-06-24 Cellule tumorale epitheliale immortalisee

Publications (1)

Publication Number Publication Date
EP0839183A1 true EP0839183A1 (fr) 1998-05-06

Family

ID=8219387

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96923904A Withdrawn EP0839183A1 (fr) 1995-06-23 1996-06-24 Cellule tumorale epitheliale immortalisee

Country Status (6)

Country Link
EP (1) EP0839183A1 (fr)
JP (1) JPH11507834A (fr)
AU (1) AU6415396A (fr)
CA (1) CA2224797A1 (fr)
NO (1) NO976036L (fr)
WO (1) WO1997000946A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6004791A (en) * 1996-11-13 1999-12-21 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Protein tyrosine phosphatase PTP20 and related products and methods
US6921975B2 (en) 2003-04-18 2005-07-26 Freescale Semiconductor, Inc. Circuit device with at least partial packaging, exposed active surface and a voltage reference plane
CN113789350A (zh) * 2021-09-08 2021-12-14 汉姆德(宁波)智能医疗科技有限公司 哺乳类食管鳞状上皮永生化细胞系的构建方法、构建的细胞系及其类器官

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3627326A1 (de) * 1986-08-12 1988-02-18 Boehringer Mannheim Gmbh Immortalisierung durch dns-uebertragung

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9700946A1 *

Also Published As

Publication number Publication date
WO1997000946A1 (fr) 1997-01-09
CA2224797A1 (fr) 1997-01-09
JPH11507834A (ja) 1999-07-13
NO976036L (no) 1998-02-03
AU6415396A (en) 1997-01-22
NO976036D0 (no) 1997-12-22

Similar Documents

Publication Publication Date Title
CN110684739B (zh) 一种嵌合抗原受体t细胞及其应用
JP7049406B2 (ja) 赤血球の産生及び使用
Peshwa et al. Induction of prostate tumor‐specific CD8+ cytotoxic T‐lymphocytes in vitro using antigen‐presenting cells pulsed with prostatic acid phosphatase peptide
Liu et al. Induction of human autologous cytotoxic T lymphocytes on formalin-fixed and paraffin-embedded tumour sections
Fisch et al. Generation of antigen‐presenting cells for soluble protein antigens ex vivo from peripheral blood CD34+ hematopoietic progenitor cells in cancer patients
Roth et al. Cultured, AIDS‐related Kaposi's sarcoma cells express endothelial cell markers and are weakly malignant in vitro
Braun et al. Prognostic significance of micrometastatic bone marrow involvement
JP2006122052A (ja) ヒト前立腺上皮不死細胞の細胞株およびクローンおよびそれらの研究および前立腺癌治療に対する応用
JP2002529073A (ja) 三次元装置における造血前駆細胞からのリンパ様組織特異的細胞の生成
Ghosh et al. Tumour-infiltrating lymphocytes in cervical carcinoma
Meng et al. Immunization of stromal cell targeting fibroblast activation protein providing immunotherapy to breast cancer mouse model
Ringquist et al. Understanding and improving cellular immunotherapies against cancer: From cell-manufacturing to tumor-immune models
Howard et al. Temporal order and functional analysis of mutations within the Fli-1 and
US6613565B1 (en) Use of delta-like protein to inhibit the differentiation of stem cells
JP5097387B2 (ja) 人工皮膚
CA3149478A1 (fr) Compositions cellulaires comprenant des vecteurs viraux et procedes de traitement
EP0839183A1 (fr) Cellule tumorale epitheliale immortalisee
CA2265925A1 (fr) Hybrides semi-allogenes de cellules servant de vaccins preventifs et curatifs pour le cancer et le sida
JP3995248B2 (ja) エプスタインバーウイルス陰性のｎｋ細胞株
JPH09507643A (ja) 抗原特異的細胞障害性ｔ細胞の養子移入の手段による免疫調節の方法
Attard et al. A novel, spontaneously immortalized, human prostate cancer cell line, Bob, offers a unique model for pre‐clinical prostate cancer studies
Whitehead et al. A new gastric carcinoma cell line (LIM1839) derived from a young Caucasian male
Sun et al. Enhanced NK cell proficiency in solid tumors through antigen-specific memory via NKG2C/A-HLA-E/ABC recruited to tumors by CXCR2
Mueller et al. Characterization of cell markers in type B retroviral-induced thymic lymphomas—I. Surface antigen phenotype and karyotype in developing and primary lymphomas
Sgagias et al. Cellular characterization and retroviral transduction of short-term breast cancer cells

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19971230

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: MICROMET AG

17Q First examination report despatched

Effective date: 20031028

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050101