Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
  • C12N9/1241—Nucleotidyltransferases (2.7.7)
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide
  • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
  • C12N2770/00011—Details
  • C12N2770/24011—Flaviviridae
  • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
  • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

• This invention relates generally to an assay for identifying the presence in a sample of an antibody which is immunologically reactive with a hepatitis C virus antigen and specifically to an assay for detecting a complex of an antibody and recombinant antigens representing distinct regions of the HCV genome.
• Recombinant antigens derived from the molecular cloning and expression in a heterologous expression system of the synthetic DNA sequences representing distinct antigenic regions of the HCV genome can be used as reagents for the detection of antibodies and antigen in body fluids from individuals exposed to hepatitis C virus (HCV).
• Acute viral hepatitis is clinically diagnosed by a well-defined set of patient symptoms, including jaundice, hepatic tenderness, and an increase in the serum levels of alanine am inotransf erase (ALT) and aspartate aminotransferase. Additional serologic immunoassays are generally performed to diagnose the specific type of viral causative agent. Historically, patients presenting clinical hepatitis symptoms and not otherwise infected by hepatitis A, hepatitis B, Epstein-Barr or cytomegalovirus were clinically diagnosed as having non-A non-B hepatitis (NANBH) by default. The disease may result in chronic liver damage.
• NANBH non-A non-B hepatitis
• hepatitis A virus HAV
• HBV hepatitis B virus
• HBV hepatitis D virus
• HDV High-V-V
• HCV hepatitis C virus
• the cDNA sequences associated with HCV were isolated from a cDNA library prepared from the RNA obtained from pooled serum from a chimpanzee with chronic HCV infection.
• the cDNA library contained cDNA sequences of approximate mean size of about 200 base pairs.
• the cDNA library was screened for encoded epitopes expressed in clones that could bind to antibodies in sera from patients who had previously experienced NANBH.
• SOD superoxide dismutase fusion poiypeptides
• c100-3 The most complex SOD fusion polypeptide described in the European Patent Application, designated c100-3, was described as containing 154 amino acids of human SOD at the aminotermi ⁇ us, 5 amino acid residues derived from the expression of a synthetic DNA adapter containing a restriction site, EcoRI, 363 amino acids derived from the expression of a cloned HCV cDNA fragment, and 5 carboxyl terminal amino acids derived from an MS2 cloning vector nucleotide sequence.
• the DNA sequence encoding this polypeptide was transformed into yeast cells using a plasmid.
• the transformed cells were cultured and expressed a 54,000 molecular weight polypeptide which was purified to about 80% purity by differential extraction.
• Other SOD fusion poiypeptides designated SOD-NANB5-1-1 and SOD- NANB ⁇ i were expressed in recombinant bacteria.
• the E.coli fusion poiypeptides were purified by differential extraction and by chromatography using anion and cation exchange columns. The purification procedures were able to produce SOD- NANB5.-1 _ ⁇ as about 80% pure and SOD-NAN38, as about 50% pure.
• microtiter wells or polystyrene beads coated on microtiter wells or polystyrene beads and used to assay serum samples. Briefly, coated microtiter wells were incubated with a sample in a diluent. After incubation, the microtiter wells were washed and then developed using either a radioactively labelled sheep anti-human antibody or a mouse antihuman IgG-HRP (horseradish peroxidase) conjugate. These assays were used to detect both post acute phase and chronic phase HCV infection.
• assay specificity required adding yeast or E.coli extracts to the samples in order to prevent undesired immunological reactions with any yeast or E.coli antibodies present in samples.
• Ortho Diagnostic Systems Inc. have developed a immunoenzyme assay to detect antibodies to HCV antigens.
• the Ortho assay procedure is a three-stage test for serum/plasma carried out in a microwell coated with the recombinant yeast hepatitis C virus SOD fusion polypeptide dOO-3.
• a test specimen is diluted directly in the test well and incubated for a specified length of time. If antibodies to HCV antigens are present in the specimen, antigen-antibody complexes will be formed on the microwell surface.
• anti-human IgG murine monoclonal antibody horseradish peroxidase conjugate is added to the microwell.
• the conjugate binds specifically to the antibody portion of the antigen-antibody complexes. If antigen-antibody complexes are not present, the unbound conjugate will also be removed by a washing step.
• an enzyme detection system composed of 0- phenyienediamine 2HCI (OPD) and hydrogen peroxide is added to the test well. If bound conjugate is present, the OPD will be oxidized, resulting in a colored end product. After formation of the colored end product, dilute sulfuric acid is added to the microwell to stop the color-forming detection reaction.
• OPD 0- phenyienediamine 2HCI
• the intensity of the colored end product is measured with a microwell reader.
• the assay may be used to screen patient serum and plasma. It is established that HCV may be transmitted by contaminated blood and blood products. In transfused patients, as many as 10% will suffer from post- transfusion hepatitis. Of these, approximately 90% are the result of infections diagnosed as HCV. The prevention of transmission of HCV by blood and blood products requires reliable, sensitive and specific diagnosis and prognostic tools to identify HCV carriers as well as contaminated blood and blood products. Thus, there exists a need for an HCV assay which uses reliable and efficient reagents and methods to accurately detect the presence of HCV antibodies in samples.
• the present invention provides an improved assay for detecting the presence of an antibody to an HCV antigen in a sample by contacting the sample with at least one recombinant protein representing a distinct antigenic region of the HCV genome.
• Recombinant antigens which are derived from the molecular cloning and expression of synthetic DNA sequences in heterologous hosts are provided. Briefly, synthetic DNA sequences which encode the desired proteins representing distinct antigenic regions of the HCV genome are optimized for expression in E.coli by specific codon selection. Specifically, recombinant proteins representing five distinct antigenic regions of NS1 of the HCV genome are described. The proteins are expressed as chimeric fusions with E.coli CMP-KDO synthetase (CKS) gene.
• the first protein, expressed by plasmid pHCV-77 (identified as SEQ. ID. NO. 1) represents amino acids 365-579 of the HCV sequence of NS1 and, based on analogy to the genomic organization of other flaviviruses, has been named HCV CKS-NS1S1.
• pHCV-77 will also refer to the fusion protein itself and that pHCV-77' will be the designation for a polypeptide representing the NS1 region from about amino acids 365-579 of the HCV sequence prepared using other recombinant or synthetic methodologies. Other recombinant methodologies would include the preparation of pHCV-77', utilizing different expression systems.
• the methodology for the preparation of synthetic peptides of HCV is described in U.S. Serial No. 456,162, filed December 22, 1989, and U.S. Serial No. 610,180, filed November 7, 1990, which enjoy common ownership and are incorporated herein by reference.
• the next protein is expressed by plasmid pHCV-65, identified as SEQ. ID. NO.
• pHCV-65 has been named HCV CKS-NS1S2 and is expressed by the plasmid pHCV-65.
• the fusion protein itself will also be referred to as pHCV-65 and pHCV- 65' shall be the designation for a polypeptide from the NS-1 region representing from about amino acids 565-731 of the HCV sequence prepared using other recombinant or synthetic methodologies.
• the next recombinant antigen represents amino acids 717-847 of the NS1 region of the HCV sequence, and is expressed by the plasmid pHCV-78 (identified by SEQ. ID. NO. 3).
• the fusion protein will be referred to as pHCV-78 and pHCV-78' shall be the designation for a polypeptide from the NS1 region representing from about amino acids 717-847 of the HCV sequence prepared using other recombinant or synthetic methodologies. It has been designated clone HCV CKS-NS1S3 based on the strategy used in its construction. Figure 44 illustrates the position of pHCV-77, pHCV-65 and pHCV-78 in the NS1 region of the HCV genome.
• the recombinant antigen produced by pHCV-80 is identified as SEQ. ID. NO.4 and is designated HCV CKS-NS1S1-NS1S2.
• the fusion protein is also designated by pHCV-80 and pHCV-80' refers to the polypeptide located in the NS1 region of HCV, representing amino acids 365-731 of the HCV genome prepared using different recombinant methodologies.
• Figure 45 illustrates the position of pHCV-80 within the HCV genome.
• HCV CKS-Full Length NS1 is the designation for the recombinant protein pHCV-92 (SEQ. ID. NO. 5). It represents amino acids 365-847 of the HCV genome.
• the fusion proteins will be referred to as pHCV-92 and pHCV 92' shall be the designation for the polypeptide from the NS1 region representing amino acids 365-847 of the HCV sequence prepared using other recombinant or synthetic methodologies.
• Figure 46 illustrates the position of pHCV-92 in the HCV genome. These antigens are used in the inventive immunoassays to detect the presence of HCV antibodies in samples.
• One assay format provides a screening assay for identifying the presence of an antibody that is immunologically reactive with an HCV antigen. Briefly, a fluid sample is incubated with a solid support containing the commonly bound recombinant proteins. Finally, the antibody-antigen complex is detected. In a modification of the screening assay the solid support additionally contains recombinant polypeptide c1OO-3.
• Another assay format provides a confirmatory assay for unequivocally identifying the presence of an antibody that is immunologically reactive with an HCV antigen.
• the confirmatory assay includes synthetic peptides or recombinant antigens representing the epitopes contained within the NS1 region of the HCV genome, which are the same regions represented by the recombinant proteins described in the screening assay. These are pHCV-77, pHCV-65, pHCV-78, pHCV-
• Recombinant proteins used in the confirmatory assay should have a heterologous source of antigen to that used in the primary screening assay (i.e. should not be an E.coli-derived recombinant antigen nor a recombinant antigen composed in part, of CKS sequences).
• specimens repeatedly reactive in the primary screening assay are retested in the confirmatory assay. Aliquots containing identical amounts of specimen are contacted with a synthetic peptide or recombinant antigen individually coated onto a solid support. Finally, the antibody- antigen complex is detected.
• poiypeptides or recombinant proteins can be utilized as indicated or combined with other poiypeptides and recombinant proteins a described herein and also described in U.S. Serial No. 456,162 entitled “Hepatitis C Assay", filed December 22, 1989, which enjoys common ownership and is incorporated herein by reference.
• Another assay format provides a competition assay or neutralization assay directed to the confirmation that positive results are not false by identifying the presence of an antibody that is immunologically reactive with an HCV antigen in a fluid sample where the sample is used to prepare first and second immunologically equivalent aliquots.
• the first aliquot is contacted with solid support containing a bound polypeptide which contains at least one epitope of an HCV antigen under conditions suitable for complexing with the antibody to form a detectable antibody ⁇ polypeptide complex and the second aliquot is first contacted with the same solid support containing bound polypeptide.
• the preferred recombinant poiypeptides include pHCV-77, pHCV-65, pHCV-78, pHCV-80 and pHCV-92.
• Another assay format provides an immunodot assay for identifying the presence of an antibody that is immunologically reactive with an HCV antigen by concurrently contacting a sample with recombinant poiypeptides each containing distinct epitopes of an HCV antigen under conditions suitable for complexing the antibody with at least one of the poiypeptides and detecting the antibodypolypeptide complex by reacting the complex with colorproducing reagents.
• the preferred recombinant poiypeptides employed include those recombinant poiypeptides derived from pHCV-77, pHCV-65, pHCV-78, pHCV-80, as well as pHCV-92.
• the sample is preferably diluted before contacting the polypeptide absorbed on a solid support.
• Samples may be obtained from different biological samples such as whole blood, serum, plasma, cerebral spinal fluid, and lymphocyte or cell culture supernatants.
• Solid support materials may include cellulose materials, such as paper and nitrocellulose, natural and synthetic polymeric materials, such as poiyacrylamide, polystyrene, and cotton, porous gels such as silica gel, agarose, dextran and gelatin, and inorganic materials such as deactivated alumina, magnesium sulfate and glass.
• Suitable solid support materials may be used in assays in a variety of well known physical configurations, including microtiter wells, test tubes, beads, strips, membranes, and microparticles.
• a preferred solid support for a non-immunodot assay is a polystyrene bead.
• a preferred solid support for an immunodot assay is nitrocellulose.
• Suitable methods and reagents for detecting an antibody-antigen complex in an assay of the present invention are commercially available or known in the relevant art. Representative methods may employ detection reagents such as enzymatic, radioisotopic, fluorescent, luminescent, or chemiluminescent reagents. These reagents may be used to prepare hapten-labelled antihapten detection systems according to known procedures, for example, a biotin-labelled antibiotin system may be used to detect an antibody-antigen complex.
• the present invention also encompasses assay kits including poiypeptides which contain at least one epitope of an HCV antigen bound to a solid support as well as needed sample preparation reagents, wash reagents, detection reagents and signal producing reagents.
• assay kits including poiypeptides which contain at least one epitope of an HCV antigen bound to a solid support as well as needed sample preparation reagents, wash reagents, detection reagents and signal producing reagents.
• E.coli strains containing plasmids useful for constructs of the invention have been deposited at the American Type Culture Collection, Rockville, Maryland on August 10, 1990, under the accession Nos. ATCC 68380 (pHCV-23), ATCC 68381 (pHCV-29), ATCC 68382 (pHCV-31), ATCC 68383 (pHCV-34) and on November 6, 1990 for E.coli strains containing plasmids useful for constructs under the accession Nos.
• ATCC 68458 (pHCV-50), ATCC 68459 (pHCV-57), ATCC 68460 (pHCV-103), ATCC 68461 (pHCV-102), ATCC 68462 (pHCV-51), ATCC 68463 (pHCV-105), ATCC 68464 (pHCV-107), ATCC 68465 (pHCV-104), ATCC 68466 (pHCV-45), ATCC 68467 (pHCV-48),ATCC 68468 (pHCV-49), ATCC 68469 (pHCV-58) and ATCC 68470 (pHCV-101).
• E. coli strains containing plasmids useful for constructs of the invention have been deposited at the A.T.C.C.
• ATCC 68690 (pHCV-77), ATCC 68696 (pHCV-65), ATCC 68689 (pHCV-78), ATCC 68688 (pHCV-80) and ATCC 68695 (pHCV-92).
• FIGURE 1 illustrates the HCV genome.
• FIGURE 2 illustrates the use of recombinant poiypeptides to identify the presence of antibodies in a chimpanzee inoculated with HCV.
• FIGURE 3 illustrates the sensitivity and specificity increase in using the screening assay using pHCV-34 and pHCV-31 antigens.
• FIGURE 4 illustrates the construction of plasmid pHCV-34.
• FIGURE 5 illustrates fusion protein pHCV-34.
• FIGURE 6 illustrates the expression of pHCV-34 proteins in E.coli.
• FIGURE 7 illustrates the construction of plasmid pHCV-23.
• FIGURE 8 illustrates the construction of plasmid pHCV-29.
• FIGURE 9 illustrates the construction of plasmid pHCV-31.
• FIGURE 10 illustrates the fusion protein pHCV-31.
• FIGURE 11 illustrates the expression of pHCV-29 in E.coli.
• FIGURE 12 illustrates the expression of pHCV-23 in E.coli.
• FIGURE 13 illustrates the expression of pHCV-31 in E.coli.
• FIGURE 14 illustrates the increased sensitivity using the screening assay utilizing the pHCV-34.
• FIGURE 15 illustrates the increased specificity with the screening assay utilizing pHCV-34 and pHCV-31.
• FIGURE 16 illustrates the results in hemodialysis patients using the screening and confirmatory assays.
• FIGURE 17 illustrates earlier detection of HCV in a hemodialysis patient using the screening assay.
• FIGURE 18 illustrates the results of the screening assay utilizing pHCV-34 and pHCV-31 on samples from individuals with acute NANBH.
• FIGURE 19 illustrates the results of the confirmatory assay of the same population group as in Figure 18.
• FIGURE 20 illustrates the results of the screening and confirmatory assays on individuals infected with chronic NANBH.
• FIGURE 21 illustrates preferred buffers, pH conditions, and spotting concentrations for the HCV immunodot assay.
• FIGURE 22 illustrates the results of the HCV immunodot assay.
• FIGURE 23 illustrates the fusion protein pHCV-45.
• FIGURE 24 illustrates the expression of pHCV-45 in E.coli.
• FIGURE 25 illustrates the fusion protein pHCV-48.
• FIGURE 26 illustrates the expression of pHCV-48 in E.coli.
• FIGURE 27 illustrates the fusion protein pHCV-51.
• FIGURE 28 illustrates the expression of pHCV-51 in E.coli.
• FIGURE 29 illustrates the fusion protein pHCV-50.
• FIGURE 30 illustrates the expression of pHCV-50 in E.coli.
• FIGURE 31 illustrates the fusion protein pHCV-49.
• FIGURE 32 illustrates the expression of pHCV-49 in E.coli.
• FIGURE 33 illustrates an immunoblot of pHCV-23, pHCV-45, pHCV-48, pHCV-51 , pHCV-50 and pHCV-49.
• FIGURE 34 illustrates the fusion proteins pHCV-24, pHCV-57, pHCV-58.
• FIGURE 35 illustrates the expression of pHCV-24, pHCV-57, and pHCV-58 in E.coli.
• FIGURE 36 illustrates the fusion protein pHCV-105.
• FIGURE 37 illustrates the expression of pHCV-105 in E.coli.
• FIGURE 38 illustrates the fusion protein pHCV-103.
• FIGURE 39 illustrates the fusion protein pHCV-101.
• FIGURE 40 illustrates the fusion protein pHCV-102.
• FIGURE 41 illustrates the expression of pHCV-102 in E.coli.
• FIGURE 42 illustrates the fusion protein pHCV-107.
• FIGURE 43 illustrates the fusion protein pHCV-104.
• FIGURE 44 illustrates the NS1 region of the HCV genome, and in particular, the locations of pHCV-77, pHCV-65 and pHCV-78.
• FIGURE 45 illustrates the NS1 region of the HCV genome, and in particular, the location of pHCV-80.
• FIGURE 46 illustrates the NS1 region of the HCV genome, and in particlar, the location of pHCV-92.
• FIGURE 47A illustrates the expression of pHCV-77 in E. coli: and FIGURE 47B illustrates an immunblot of pHCV-77 in E. coli.
• FIGURE 48A illustrates the expression of pHCV-65 in E. coli and FIGURE 48B illustrates an immunoblot of pHCV-65 in E. coli.
• FIGURE 49A illustrates the expression of pHCV-80 in E. coli and FIGURE
• 49B illustrates an immunoblot of pHCV-80 in E. coli.
• the present invention is directed to an assay to detect an antibody to an HCV antigen in a sample.
• Human serum or plasma is preferably diluted in a sample diluent and incubated with a polystyrene bead coated with a recombinant polypeptide that represents a distinct antigenic region of the HCV genome. If antibodies are present in the sample they will form a complex with the antigenic polypeptide and become affixed to the polystyrene bead. After the complex has formed, unbound materials and reagents are removed by washing the bead and the bead-antigen- antibody complex is reacted with a solution containing horseradish peroxidase labeled goat antibodies directed against human antibodies.
• This peroxidase enzyme then binds to the antigen-antibody complex already fixed to the bead.
• the horseradish peroxidase is contacted with o-phenylenediamine and hydrogen peroxide which results in a yellow-orange color.
• the intensity of the color is proportional to the amount of antibody which initially binds to the antigen fixed to the bead.
• the preferred recombinant poiypeptides having HCV antigenic epitopes were selected from portions of the HCV genome which encoded poiypeptides which possessed amino acid sequences similar to other known immunologically reactive agents and which were identified as having some immunological reactivity.
• the immunological reactivity of a polypeptide was initially identified by reacting the cellular extract of E.coli clones which had been transformed with cDNA fragments of the HCV genome with HCV infected serum. Poiypeptides expressed by clone containing the incorporated cDNA were immunologically reactive with serum known to contain antibody to HCV antigens.)
• An analysis of a given amino acid sequence only provides rough guides to predicting immunological reactivity. There is no invariably predictable way to ensure immunological activity short of preparing a given amino acid sequence and testing the suspected sequence in an assay.
• the poiypeptides useful in the practice of this invention are produced using recombinant technologies.
• the DNA sequences which encode the desired poiypeptides are preferably assembled from fragments of the total desired sequence. Synthetic DNA fragments of the HCV genome can be synthesized based on their corresponding amino acid sequences. Once the amino acid sequence is chosen, this is then reverse translated to determine the complementary DNA sequence using codons optimized to facilitate expression in the chosen system.
• the fragments are generally prepared using well known automated processes and apparatus. After the complete sequence has been prepared the desired sequence is incorporated into an expression vector which is transformed into a host cell. The DNA sequence is then expressed by the host cell to give the desired polypeptide which is harvested from the host cell or from the medium in which the host cell is cultured.
• PCR polymerase chain reaction
• Vector systems which can be used include plant, bacterial, yeast, insect, and mammalian expression systems. It is preferred that the codons are optimized for expression in the system used.
• a preferred expression system utilizes a carrier gene for a fusion system where the recombinant HCV proteins are expressed as a fusion protein of an E.coli enzyme, CKS (CTP:CMP-3-deoxy-ma_ ⁇ __-octulosonate cytidylyl transferase or CMP-KDO synthetase).
• CKS CTP:CMP-3-deoxy-ma_ ⁇ __-octulosonate cytidylyl transferase or CMP-KDO synthetase.
• lambda PL vector system whose features include a strong lambda pL promoter, a strong three-frame translation terminator rrnBtl, and translation starting at an ATG codon.
• the amino acid sequences encoding for the recombinant HCV antigens of interest were reverse translated using codons optimized to facilitate high level expression in E.coli.
• Individual oligonucleotides were synthesized by the method of oligonucieotide directed double-stranded break repair disclosed in U.S. Patent Application Serial No. 883,242, filed July 8, 1986 by Mandecki (EPO 87109357.1) which enjoys common ownership and is incorporated herein by reference.
• the individual oligonucleotides may be synthesized on the Applied Biosystem 380A DNA synthesizer using methods and reagents recommended by the manufacturer.
• the DNA sequences of the individual oligonucleotides were confirmed using the Sanger dideoxy chain termination method (Sanger et al., J. Mole. Biol.. 162:729 (1982)). These individual gene fragments were then annealed and ligated together and cloned as EcoRI-BamHI subfragments in the CKS fusion vector pJO200. After subsequent DNA sequence confirmation by the Sanger dideoxy chain termination method, the subfragments were digested with appropriate restriction enzymes, gel purified, ligated and cloned again as an EcoRI-BamHI fragment in the CKS fusion vector pJO2OO.
• the resulting clones were mapped to identify a hybrid gene consisting of the EcoRI-BamHI HCV fragment inserted at the 3' end of the CKS (CMP-KDO synthetase) gene.
• the resultant fusion proteins under control of the promoter, consist of 239 amino acids of the CKS protein fused to the various regions of HCV.
• Examples 1 and 2 describe the synthesis and cloning of CKS-Core and CKS-33-BCD, respectively.
• Example 3 describes a screening assay.
• Example 4 describes a confirmatory assay.
• Example 5 describes a competition assay.
• Example 6 describes an immunodot assay.
• Example 7 describes the synthesis and cloning of HCV CKS-NS5E, CKS-NS5F, CKS-NS5G, CKS-NS5H and CKS-NS5I.
• Example 8 describes the preparation of HCV CKS-C100 vectors.
• Example 9 describes the preparation of HCV PCR derived expression vectors.
• Example 10 describes the synthesis and characterization of pHCV-77 of NS1.
• Example 11 describes the synthesis and characterization of pHCV-65 of NS1.
• Example 12 describes the synthesis and characterization of pHCV-78 of NS1.
• Example 13 describes the synthesis and characterization of pHCV-80 of NS1.
• Example 14 describes the synthesis and characterization of pHCV-92 of NS1.
• REAGE ⁇ SANP EN_YMES Media such as Luria-Berta ⁇ i (LB) and Superbroth II (Dri Form) were obtained from Gibco Laboratories Life Technologies, Inc., Madison Wisconsin. Restriction enzymes, Klenow fragment of DNA polymerase I, T4 DNA iigase, T4 polynucleotide kinase, nucleic acid molecular weight standards, M13 sequencing system, X-gal (5-bromo-4-chloro-3-indonyl- ⁇ -D-galactoside), IPTG (isopropyl- ⁇ -D-thiogalactoside), glycerol, Dithiothreitol, 4-chloro-1 -naphthol were purchased from Boehringer Mannheim Biochemicals, Indianapolis, Indiana; or New England Biolabs, Inc., Beverly, Massachusetts; or Bethesda Research Laboratories Life Technologies, Inc., Gaithersburg, Maryland.
• Prestained protein molecular weight standards, acrylamide (crystallized, electrophoretic grade >99%); N-N'-Methylene-bis-acrylamide (BIS); N,N,N ⁇ N',- Tetramethylethylenediamine (TEMED) and sodium dodecylsulfate (SDS) were purchased from BioRad Laboratories, Richmond, California. Lysozyme and ampiciliin were obtained from Sigma Chemical Co., St. Louis, Missouri. Horseradish peroxidase (HRPO) labeled secondary antibodies were obtained from Kirkegaard & Perry Laboratories, Inc., Gaithersburg, Maryland. Seaplaque® agarose (low melting agarose) was purchased from FMC Bioproducts, Rockland, Maine.
• T50E10 contained 50mM Tris, pH 8.0, lOmM EDTA; 1X TG contained 1OOmM Tris, pH 7.5 and 10% glycerol; 2X SDS/PAGE loading buffer consisted of 15% glycerol, 5% SDS, lOOmM Tris base, 1 M ⁇ -mercaptoethanol and 0.8% Bromophenol blue dye; TBS container 50 mM Tris, pH 8.0, and 150 mM sodium chloride; Blocking solution consisted of 5% Carnation nonfat dry milk in TBS.
• pUC8 pUC18, pUC19 and M13 cloning vectors were purchased from Pharmacia LKB Biotechnology, Inc., Piscataway, New Jersey; Competent EpicureanTM coli stains XL1 -Blue and JM109 were purchased from
• RR1 cells were obtained from Coli Genetic Stock Center, Yale University, New Haven, Connecticut; and E.coli CAG456 cells from Dr. Carol Gross, University of Wisconsin, Madison, Wisconsin.
• Vector pRK248.cits was obtained from Dr. Donald R. Helinski, University of California, San Diego, California.
• EXAMPLE 1 CKS-CORE A. Construction of the Plasmid pJ0200 The cloning vector pJO200 allows the fusion of recombinant proteins to the
• the plasmid consists of the plasmid pBR322 with a modified Jac promoter fused to a KdsB gene fragment (encoding the first 239 of the entire 248 amino acids of the E.coli CMP-KDO synthetase of CKS protein), and a synthetic linker fused to the end of the KdsB gene fragment.
• the cloning vector pJO200 is a modification of vector pTB210.
• the synthetic linker includes: multiple restriction sites for insertion of genes; translational stop signals, and the trpA rho- independent transcriptional terminator.
• the pHCV-34 plasmid and the CKS plasmid pTB210 were transformed into E.coli K-12 strain xL-l (recAI, endAI, gyrA96, thi-1 , hsdRI7, supE44, relAI, lac/F', proAB, laclqZDMl 5, TN10) cells made competent by the calcium chloride method.
• E.coli K-12 strain xL-l recAI, endAI, gyrA96, thi-1 , hsdRI7, supE44, relAI, lac/F', proAB, laclqZDMl 5, TN10
• pHCV-34/XL-1 culture was grown overnight at 37°C in growth media consisting of yeast extract, trytone, phosphate salts, glucose, and ampicillin. When the culture reached an OD600 of 1.0, IPTG was added to a final concentration of 1 mM to induce expression. Samples (1.5 ml) were removed at 1 hour intervals, and cells were pelleted and resuspended to an OD600 of 1.0 in 2X SDS/PAGE loading buffer. Aliquots (15ul) of the prepared samples were separated on duplicate 12.5% SDS/PAGE gels.
• One gel was fixed in a solution of 50% methanol and 10% acetic acid for 20 minutes at room temperature, and then stained with 0.25% Coomassie blue dye in a solution of 50% methanol and 10% acetic acid for 30 minutes. Destaining was carried out using a solution of 10% methanol and 7% acetic acid for 3-4 hours, or until a clear background was obtained.
• Figure 6 presents the expression of pHCV-34 proteins in E.coli.
• Molecular weight standards were run in Lane M.
• Lane 1 contains the plasmid pJ0200-the CKS vector without the HCV sequence.
• the arrows on the left indicate the mobilities of the molecular weight markers from top to bottom: 110,000; 84,000; 47,000; 33,000; 24,000; and 16,000 daltons.
• the arrows on the right indicate the mobilities of the recombinant HCV proteins.
• Lane 2 contains the E.coli lysate containing pHCV-34 expressing CKS-Core (amino acids 1 to 150) prior to induction; and Lane 3 after 3 hours of induction.
• the results show that the recombinant protein pHCV-34 has an apparent mobility corresponding to a molecular size of 48,000 daltons. This compares acceptably with the predicted molecular mass of 43,750 daltons.
• Proteins from the second 12.5% SDS/PAGE gel were electrophoretically transferred to nitrocellulose for immunoblotting.
• the nitrocellulose sheet containing the transferred proteins was incubated with Blocking Solution for one hour and incubated overnight at 4°C with HCV patients' sera diluted in TBS containing E.coli K-12 strain XL-I lysate.
• the nitrocellulose sheet was washed three times in TBS, then incubated with HRPO-labeled goat anti-human IgG, diluted in TBS containing 10% fetal calf sera.
• the nitrocellulose was washed three times with TBS and the color was developed in TBS containing 2 mg/ml 4-chloro-1- napthol, 0.02% hydrogen peroxide and 17% methanol.
• Clone HCV-34 demonstrated a strong immu no reactive band at 48,000 daltons with the HCV patients' sera. Thus, the major protein in the Coomassie stained protein gel was immunoreactive. Normal human serum did not react with any component of pHCV-34.
• HCV CKS-33C-BCD A. Preparation of HCV CKS-33c-BCD Expression Vector The construction of this recombinant clone expressing the HCV CKS-33-BCD antigen was carried out in three steps described below. First, a clone expressing the HCV CKS-BCD antigen was constructed, designated pHCV-23. Second, a clone expressing the HCV CKS-33 antigen was constructed, designated pHCV-29. Lastly, the HCV BCD region was excised from pHCV-23 and inserted into pHCV-29 to construct a clone expressing the HCV CKS-33-BCD antigen, designated pHCV-31 (SEQ.ID.NO. 8 and 9).
• pHCV-23 To construct the plasmid pHCV-23, thirteen individual oligonucleotides representing amino acids 1676-1931 of the HCV genome were ligated together and cloned as three separate EcoRI-BamHI subfragments into the CKS fusion vector pJO200. After subsequent DNA sequence confirmation, the three subfragments, designated B, C, and D respectively, were digested with the appropriate restriction enzymes, gel purified, ligated together, and cloned as a 781 base pair EcoRI-BamHI fragment in the CKS fusion vector pJO200, as illustrated in Figure 7. The resulting plasmid, designated pHCV-23, expresses the HCV CKS-BCD antigen under control of the jac promoter.
• the HCV CKS-BCD antigen consists of 239 amino acids of CKS, seven amino acids contributed by linker DNA sequences, 256 amino acids from the HCV NS4 region (amino acids 1676-1931 , and 10 additional amino acids contributed by linker DNA sequences.
• the two subfragments were digested with the appropriate restriction enzymes, gel purified, ligated together and cloned again as an 816 base pair EcoRI-BamHI fragment in the CKS fusion vector pJO200, as illustrated in Figure 8.
• the resulting plasmid designated pHCV-29, expresses the CKS-33 antigen under control of the jac promoter.
• the HCV CKS-33 antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 266 amino acids from the HCV NS3 region (amino acids 1192- 1 457) .
• pHCV-31 To construct the plasmid pHCV-31 , the 781 base pair EcoRI-BamHI fragment from pHCV-23 representing the HCV-BCD region was linker-adapted to produce a Cla1-BamHl fragment which was then gel purified and ligated into pHCV- 29 at the Cla1-BamHl sites as illustrated in Figure 9.
• the resulting plasmid, designated pHCV-31 expresses the pHCV-31 antigen under control of the jac promoter.
• the complete DNA sequence of pHCV-31 and the entire amino acid sequence of the HCV CKS-33-BCD recombinant antigen produced is presented in SEQ.ID.NO. 8 and 9.
• the HCV CKS-33-BCD antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, 266 amino acids of the HCV NS3 region (amino acids 1192-1457), 2 amino acids contributed by linker DNA sequences, 256 amino acids of the HCV NS4 region (amino acids 1676-1931), and 10 additional amino acids contributed by linker DNA sequences.
• Figure 12 presents a schematic representation of the pHCV-31 antigen.
• the pHCV-31 plasmid was transformed into E.coli K-12 strain XL-I in a manner similar to the pHCV-34 and CKS-pTB210 plasmids of Example 1.
• pHCV CKS-33-BCD Characterization of pHCV CKS-33-BCD was carried out in a manner similar to pHCV CKS-Core of Example 1.
• pHCV-23, pHCV SDS/PAGE gels were run for E.coli lysates containing the plasmids pHCV-29 ( Figure 11), pHCV-23 ( Figure 12), and pHCV-31 ( Figure 13) expressing the recombinant fusion proteins CKS- 33c, CKS-BCD, and CKS-33-BCD, respectively.
• molecular weight standards were run in Lane M, with the arrows on the left indicating mobilities of the molecular weight markers the from top to bottom: 110,000; 84,000; 47,000; 33,000; 24,000; and 16,000 daltons.
• Lane 1 contained the E.coli lysate containing pHCV-29 expressing HCV CKS-33c (amino acids 1192 to 1457) prior to induction and lane 2 after 4 hours induction. These results show that the recombinant pHCV-29 fusion protein has an apparent mobility corresponding to a molecular size of 60,000 daltons. This compares acceptably to the predicted molecular mass of 54,911.
• Lane 1 contained the E.coli lysate containing pJO200- the CKS vector without the HCV sequence.
• Lane 2 contained pHCV-20 expressing the
• HCV CKS-B (amino acids 1676 to 1790).
• Lane 3 contained the fusion protein pHCV-23 (amino acids 1676-1931).
• Lane 1 contained the E.coli lysate containing pJO200 the CKS vector without the HCV sequences.
• Lane 2 contained pHCV-31 expressing the CKS- 33C-BCD fusion protein (amino acids 1192 to 1447 and 1676 to 1931) prior to induction and lane 3 after 2 hours induction.
• the procedure uses two E.coli expressed recombinant proteins, CKS-Core (pHCV-34) and CKS-33-BCD (pHCV- 31), representing three distinct regions of the HCV genome. These recombinant poiypeptides were prepared following procedures described above. In the screening assay, both recombinant antigens are coated onto the same polystyrene bead. In a modification of the screening assay the polystyrene bead may also be coated with the SOD-fusion polypeptide c100-3.
• the polystyrene beads are first washed with distilled water and propanol and then incubated with a solution containing recombinant pHCV-31 diluted to 0.5 to 2.0 ug/ml and pHCV-34 diluted to 0.1 to 0.5 ug/ml in 0.1 M aH2PO_>-H2 ⁇ with
• the beads are incubated in the antigen solution for 2 hours (plus or minus 10 minutes) at 38-42°C, washed in PBS and soaked in 0.1% (w/v) Triton X-100 in PBS for 60 minutes at 38-42°C. The beads are then washed two times in phosphate buffered saline (PBS), overcoated with a solution of 5.0% (w/v) bovine serum albumin (BSA) in PBS for 60 minutes at 38-42°C and washed one time in PBS. Finally, the beads are overcoated with 5% (w/v) sucrose in PBS, and dried under nitrogen or air.
• PBS phosphate buffered saline
• BSA bovine serum albumin
• the polystyrene beads coated with pHCV-31 and pHCV-34 are used in an antibody capture format. Ten microliters of sample are added to the wells of the reaction tray along with 400 ul of a sample diluent and the recombinant coated bead.
• the sample diluent consists of 10% (v/v) bovine serum and 20% (v/v) goat serum in 20 mM Tris phosphate buffer containing 0.15% (v/v) Triton X-100, 1%(w/v) BSA, 1% E.coli lysate and 500 ug/ml or less CKS lysate.
• yeast extracts typically about 200 ug/ml. The addition of yeast extracts to the sample diluent is used to prevent false positive results.
• the final material is sterile filtered and filled in plastic bottles, and preserved with 0.1% sodium azide.
• the beads After one hour of incubation at 40°C, the beads are washed and 200 ul of conjugate is added to the wells of the reaction tray.
• the preferred conjugate is goat anti-human IgG horseradish peroxidase conjugate.
• Concentrated conjugate is titered to determine a working concentration.
• a twenty-fold concentrate of the working conjugate solution is then prepared by diluting the concentrate in diluent.
• the 20X concentrate is sterile filtered and stored in plastic bottles.
• the conjugate diluent includes 10% (v/v) bovine serum, 10% (v/v) goat serum and 0.15% Triton-X100 in 20 mM Tris buffer, pH 7.5 with 0.01% gentamicin sulfate, 0.01% thimerosal and red dye.
• the conjugate is sterile filtered and filled in plastic bottles.
• Anti-HCV positive control is prepared from plasma units positive for antibodies to HCV.
• the pool of units used includes plasma with antibodies reactive to pHCV-31 and pHCV-34.
• the units are recalcified and heat inactivated at 59-61 °C for 12 hours with constant stirring.
• the pool is aliquoted and stored at -20°C or at 2-8°C.
• the stock solution is diluted with negative control containing 0.1% sodium azide as a preservative.
• the final material is sterile filtered and filled in plastic bottles.
• Anti-HCV negative control is prepared from recalcified human plasma, negative for antibodies to pHCV-31 and pHCV-34 proteins of HCV.
• the plasma is also negative for antibodies to human immunodeficiency virus (HIV) and negative for hepatitis B surface antigen (HBsAg).
• HIV human immunodeficiency virus
• HBsAg hepatitis B surface antigen
• the units are pooled, and 0.1% sodium azide is added as a preservative.
• the final material is sterile filtered and filled in plastic bottles.
• the beads After one hour of incubation with the conjugate at 40°C, the beads are washed, exposed to the OPD substrate for thirty minutes at room temperature and the reaction terminated by the addition of 1 N H2SO4. The absorbance is read at
• the cutoff for the assay should be at least 5-7 standard deviations above the absorbance value of the normal population mean. In addition, it has generally been observed that acceptable specificity is obtained when the population mean runs at a sample to cutoff (S/CO) value of 0.25 or less. Consistent with these criteria, a "preclinical" cutoff for the screening assay was selected which clearly separated most of the presumed "true negative” from "true positive” specimens. The cutoff value was calculated as the sum of the positive control mean absorbance value multiplied by 0.25 and the negative control mean absorbance value. The cutoff may be expressed algebraically as:
• Cutoff value 0.25 PCx + NCx. Testing may be performed by two methods which differ primarily in the degree of automation and the mechanism for reading the resulting color development in the assay.
• One method is referred to as the manual or QuantumTM method because Quantum or Quantumatic is used to read absorbance at 492 nm. It is also called the manual method because sample pipetting, washing and reagent additions are generally done manually by the technician, using appropriately calibrated pipettes, dispensers and wash instruments.
• the second method is referred to as the PPC method and utilizes the automated Abbott Commander® system.
• This system employs a pipetting device referred to as the Sample Management Center (SMC) and a wash/dispense/read device referred to as the Parallel Processing Center (PPC) disclosed in E.P.O. Publication No. 91114072.1.
• the optical reader used in the PPC has dual wavelength capabilities that can measure differential absorbencies (peak band and side band) from the sample wells. These readings are converted into results by the processor's Control Center.
• Table I summarizes the results of a study which followed the course of HCV infection in seven chimpanzees using a screening assay which utilized the c100-3 polypeptide, and the screening assay which utilized pHCV-31 and pHCV-34. Both assays gave negative results before inoculation and both assays detected the presence of antibodies after the animal had been infected with HCV. However, in the comparison of the two assays, the assay utilizing pHCV- 31 and pHCV-34 detected seroconversion to HCV antigens at an earlier or equivalent bleed date in six of the seven chimpanzees.
• Non-A. Non-B Panel II ( ⁇ . Alter. NIH,
• both screening tests identified 6 of 6 chronic NANBH carriers and 1 of 4 acute NANBH samples. Paired specimens from an implicated donor were non-reactive in the screening test utilizing c100-3 but were reactive in the screening test with pHCV-31 and pHCV-34. Thus, the screening test utilizing the recombinant antigens pHCV-31 and pHCV-34 appears to be more sensitive than the screening assay utilizing c100-3. None of the disease control specimens or pedigreed negative control specimens were reactive in either screening assay.
• CBER Reference Panel A reference panel for antibody to Hepatitis C was received from the Center for Biologies Evaluation and Research (CBER). This 10 member panel consists of eight reactive samples diluted in normal human sera negative for antibody to HCV and two sera that contain no detectable antibody to HCV. This panel was run on the Ortho first generation HCV EIA assay, the screening assay utilizing d 00-3 and the screening assay utilizing pHCV-31 and pHCV-34. The assay results are presented in Figure 15.
• the screening assay utilizing pHCV-31 and pHCV-34 detected all six of the HCV positive or borderline sample dilutions.
• the two non-reactive sample dilutions (709 and 710) appear to be diluted well beyond endpoint of antibody detectabiiity for both screening assays.
• a marked increase was observed in the sample to cutoff values for three of the members on the screening assay utilizing pHCV-31 and pHCV-34 compared to the screening assay utilizing c100-3 or the Ortho first generation test. All repeatably reactive specimens were confirmed.
• the confirmatory assay provides a means for unequivocally identifying the presence of an antibody that is immunologically reactive with an HCV antigen.
• the confirmatory assay includes synthetic peptides or recombinant antigens representing major epitopes contained within the three distinct regions of the HCV genome, which are the same regions represented by the two recombinant antigens described in the screening assay.
• Recombinant proteins used in the confirmatory assay should have a heterologous source of antigen to that used in the primary screening assay (i.e. should not be an E.coli-derived recombinant antigen nor a recombinant antigen composed in part, of CKS sequences).
• Specimens repeatedly reactive in the primary screening assay are retested in the confirmatory assay. Aliquots containing identical amounts of specimen are contacted with a synthetic peptide or recombinant antigen individually coated onto a polystyrene bead. Sero reactivity for epitopes within the c100-3 region of the HCV genome are confirmed by use of the synthetic peptides sp67 and sp65. The synthetic peptide sp117 can also be used to confirm seroreactivity with the c100-3 region. Seroreactivity for HCV epitopes within the putative core region of HCV are confirmed by the use of the synthetic peptide sp75.
• a recombinant antigen expressed as a chimeric protein with superoxide dismutase (SOD) in yeast is used. Finally, the antibody-antigen complex is detected.
• the assay protocols were similar to those described in Example 3 above.
• the peptides are each individually coated onto polystyrene beads and used in an antibody capture format similar to that described for the screening assay.
• Ten microliters of specimen are added to the wells of a reaction tray along with 400 ul of a specimen diluent and a peptide coated bead.
• the beads After one hour of incubation at 40°C, the beads are washed and 200 ul of conjugate (identical to that described in Example 3) is added to the wells of the reaction tray.
• the beads After one hour of incubation at 40°C, the beads are washed, exposed to the OPD substrate for 30 minutes at room temperature and the reaction terminated by the addition of 1 N H2SO4.
• the absorbance is read at 492 nm.
• the cutoff value for the peptide assay is 4 times the mean of the negative control absorbance value.
• a population of specimens was identified from individuals diagnosed as having acute or chronic NANBH. Specimens from individuals with acute cases of NANBH were received from Gary Gitnick, M.D. at the University of California, Los
• hepatitis was based on the presence of a cytolytic syndrome (ALT levels greater than 2X the upper normal limit) on at least 2 serum samples for a duration of less than 6 months with or without other biological abnormalities and clinical symptoms. All specimens were also negative for IgM antibodies to Hepatitis A Virus (HAV) and were negative for Hepatitis B surface Ag when tested with commercially available tests. Specimens from cases of chronic NANBH were obtained from two clinical sites. Individuals were diagnosed as having chronic NANBH based on the following criteria: persistently elevated ALT levels, liver biopsy results, and/or the absence of detectable HBsAg. Specimens with biopsy results were further categorized as either chronic active NANBH, chronic persistent NANBH, or chronic NANBH with cirrhosis.
• a cytolytic syndrome ALT levels greater than 2X the upper normal limit
• All specimens were also negative for IgM antibodies to Hepatitis A Virus (HAV) and were negative for Hepatitis B surface Ag when tested
• the C100-3 assay detected 4 of 32 specimens (12.50%) as repeatedly reactive, all of which was confirmed.
• the screening assay utilizing pHCV-34 and pHCV-31 detected 3 out of these 4 specimens (75%) as reactive.
• the one sample that was missed had an S/CO of 0.95 by the latter screening test.
• This sample was confirmed by the sp67 peptide ( Figure 18).
• the screening assay utilizing pHCV-34 and pHCV-31 detected 11 specimens not reactive in the c100-3 screening assay. Of the 9 specimens available for confirmation, 8 were confirmed by sp75 and 1 could not be confirmed but had an S/CO of 0.90 in the sp65 confirmatory test, (see Figure 19).
• Chronic NANBH chronic NANBH
• EXAMPLE 5 Competition ASSAY
• the recombinant poiypeptides containing antigenic HCV epitopes are useful for competition assays.
• a neutralization assay a recombinant polypeptide representing epitopes within the c100-3 region such as CKS-BCD (pHCV-23) is solubilized and mixed with a sample diluent to a final concentration of 0.5-50 ug/ml.
• Ten microliters of specimen or diluted specimen is added to a reaction well followed by 400 ul of the sample diluent containing the recombinant polypeptide and if desired, the mixture may be preincubated for about fifteen minutes to two hours.
• a bead coated with d 00-3 antigen is then added to the reaction well and incubated for one hour at 40°C. After washing, 200 ul of a peroxidase labeled goat anti-human IgG in conjugate diluent is added and incubated for one hour at 40°C. After washing, OPD substrate is added and incubated at room temperature for thirty minutes. The reaction is terminated by the addition of 1 N sulfuric acid and the absorbance read at 492 nm.
• Samples containing antibodies to the d 00-3 antigen generate a reduced signal caused by the competitive binding of the peptides to these antibodies in solution.
• the percentage of competitive binding may be calculated by comparing the absorbance value of the sample in the presence of a recombinant polypeptide to the absorbance value of the sample assayed in the absence of a recombinant polypeptide at the same dilution.
• the immunodot assay system uses a panel of purified recombinant poiypeptides placed in an array on a nitrocellulose solid support.
• the prepared solid support is contacted with a sample and captures specific antibodies to HCV antigens.
• the captured antibodies are detected by a conjugate-specific reaction.
• the conjugate specific reaction is quantified using a reflectance optics assembly within an instrument which has been described in U.S. Patent Applications Serial No. 07/227,408 filed August 2, 1988.
• the related U.S. Patent Applications Serial Nos. 07/227,272, 07/227,586 and 07/227,590 further describe specific methods and apparatus useful to perform an immunodot assay.
• the assay has also been described in U.S. Application Serial No.
• a nitrocellulose-base test cartridge is treated with multiple antigenic poiypeptides. Each polypeptide is contained within a specific reaction zone on the test cartridge. After all the antigenic poiypeptides have been placed on the nitrocellulose, excess binding sites on the nitrocellulose are blocked. The test cartridge is then contacted with a sample such that each antigenic polypeptide in each reaction zone will react if the sample contains the appropriate antibody. After reaction, the test cartridge is washed and any antigen-antibody reactions are identified using suitable well known reagents.
• the recombinant poiypeptides pHCV-23, pHCV-29, pHCV-34, and clOO-3 were diluted in the preferred buffers, pH conditions, and spotting concentrations as summarized in Figure 21 and applied to a preassembled nitrocellulose test cartridge. After drying the cartridge overnight at room temperature 37°C, the non-specific binding capacity of the nitro-cellulose phase was blocked.
• the blocking solution contained 1% porcine gelatin, 1% casein enzymatic hydrolysate, 5% Tween-20, 0.1% sodium azide, 0.5 M sodium chloride and 20 mM Tris, pH 7.5.
• sample A00642 was from a convalescent non-A, non-B hepatitis patient, diluted in negative human plasma from 1 :100 to 1 :12800.
• the other sample, 423 was from a paid plasma donor which tested positive in an assay using a recombinant c100-3 polypeptide, diluted in negative human plasma from 1 :40 to 1 :2560.
• sample A00642 was greatest with pHCV-29, and decreased for the remaining antigens pHCV-23, d OO-3, and pHCV-34.
• Sample 423 most strongly reacted with the recombinant proteins expressing pHCV-29 and pHCV-34, and to a lesser extent with pHCV-23 and c100- 3.
• HCV-45 Eight individual oligonucleotides representing amino acids 1932-2191 of the HCV genome were ligated together and cloned as a 793 base pair EcoRI-BamHI fragment into the CKS fusion vector pJ0200.
• the resulting plasmid designated pHCV-45 (SEQ.ID.NO 8), expresses the HCV CKS-NS5E antigen under control of the ]ac promoter.
• the HCV CKS-NS5E antigen consists of 239 amino acids of CKS, nine amino acids contributed by linker DNA sequences, and 260 amino acids from the HCV NS4/NS5 region (amino acids 1932-2191).
• Figure 23 presents a schematic representation of the recombinant antigen expressed by pHCV-45.
• SEQ.ID.NO. 10 and 11 presents the DNA and amino acid sequence of the HCV CKS-NS5E recombinant antigen produced by pHCV-45.
• Figure 24 presents the expression of pHCV-45 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-45 expressing the HCV CKS-NS5E antigen (amino acids 1932-2191) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
• These results show that the pHCV-45 fusion protein has an apparent mobility corresponding to a molecular size of 55,000 daltons. This compares acceptably to the predicted molecular mass of 57,597 daltons.
• HCV-48 expresses the HCV CKS-NS5F antigen under control of the lac promoter.
• the HCV CKS-NS5F antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 294 amino acids from the HCV NS5 region (amino acids 2188-2481).
• Figure 25 presents a schematic representation of the recombinant antigen expressed by pHCV-48. SEQ.ID.NO.
• FIG. 12 and 13 presents the DNA and amino acid sequence of the HCV CKS-NS5F recombinant antigen produced by pHCV-48.
• Figure 26 presents the expression of pHCV-48 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-48 expressing the HCV CKS-NS5F antigen (amino acids 2188-2481) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
• These results show that the pHCV-48 fusion protein has an apparent mobility corresponding to a molecular size of 65,000 daltons. This compares acceptably to the predicted molecular mass of 58,985 daltons.
• HCV CKS-NS5G Seven individual oligonucleotides representing amino acids 2480-2729 of the HCV genome were ligated together and cloned as a 769 base pair EcoRI-BamHI fragment into the CKS fusion vector pJ0200.
• the resulting plasmid designated pHCV-51 (SEQ.ID.NO. 10), expresses the HCV CKS-NS5G antigen under control of the lac promoter.
• the HCV CKS-NS5G antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 250 amino acids from the HCV NS5 region (amino acids 2480-2729).
• FIG 27 presents a schematic representation of the recombinant antigen expressed by pHCV-51.
• SEQ.NO.ID NO.14 and 15 presents the DNA and amino acid sequence of the HCV CKS-NS5G recombinant antigen produced by pHCV-51.
• Figure 28 presents the expression of pHCV-51 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-51 expressing the HCV CKS-NS5G antigen (amino acids 2480-2729) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
• These results show that the pHCV-51 fusion protein has an apparent mobility corresponding to a molecular size of 55,000 daltons. This compares acceptably to the predicted molecular mass of 54,720 daltons.
• pHCV-50 expresses the HCV CKS-NS5H antigen under control of the lac promoter.
• the HCV CKS-NS5H antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 140 amino acids from the HCV NS5 region (amino acids 2728-2867).
• Figure 29 presents a schematic representation of the recombinant antigen expressed by pHCV-50. SEQ.ID.NO.
• FIG. 16 and 17 presents the DNA and amino acid sequence of the HCV CKS-NS5H recombinant antigen produced by pHCV-50.
• Figure 30 presents the expression of pHCV-50 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-50 expressing the HCV CKS-NS5H antigen (amino acids 2728-2867) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
• These results show that the pHCV-50 fusion protein has an apparent mobility corresponding to a molecular size of 45,000 daltons. This compares acceptably to the predicted molecular mass of 42,783 daltons.
• HCV-49 Six individual oligonucleotides representing amino acids 2866-3011 of the HCV genome were ligated together and cloned as a 460 base pair EcoRI-BamHI fragment into the CKS fusion vector pJ0200.
• the resulting plasmid designated pHCV-49 (SEQ.NO.ID.NO. 12), expresses the HCV CKS-NS5I antigen under control of the lac promoter.
• the HCV CKS-NS5I antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 146 amino acids from the HCV NS5 region (amino acids 2866-3011).
• Figure 31 presents a schematic representation of the recombinant antigen expressed by pHCV-49.
• SEQ.ID.NO. 18 and 19 presents the DNA and amino acid sequence of the HCV CKS-NS5I recombinant antigen produced by pHCV-49.
• Figure 32 presents the expression of pHCV-49 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-49 expressing HCV CKS-NS5I antigen (amino acids 2866-3011) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
• These results show that the pHCV-49 fusion protein has an apparent mobility corresponding to a molecular size of 42,000 daltons. This compares acceptably to the predicted molecular mass of 43,497 daltons.
• Induced E.coli lysates containing pHCV-23, pHCV-45, pHCV-48, pHCV-51, pHCV-50, or pHCV-49 were individually run on preparative SDS/PAGE gels to separate the various HCV CKS-NS5 or HCV CKS-BCD recombinant antigens assay from the majority of other E.coli proteins.
• Gel slices containing the separated individual HCV CKS-NS5 or HCV CKS-BCD recombinant antigens were then electropheretically transferred to nitrocellulose, and the nitrocellulose sheet cut into strips.
• Figure 40 presents the results of a Western Blot analysis of various serum or plasma samples using these nitrocellulose strips.
• HCV CKS-NS5F pHCV-51
• HCV-50 HCV CKS-NS5H
• pHCV-49 HCV CKS-NS5I
• Panel A contained five normal human plasma
• panel B contained five normal human sera
• panel C contained twenty human sera positive in the Abbott HCV EIA test
• panel D contained two mouse sera directed against CKS
• panel E contained two normal mouse sera.
• Both the HCV CKS-NS5E antigen expressed by pHCV-45 and the HCV CKS-NS5F antigen expressed by pHCV-48 were immunoreactive when screened with human serum samples containing HCV antibodies.
• HCV CKS-C100 A. Preparation of HCV CKS-C100 Vectors Eighteen individual oligonucleotides representing amino acids 1569-1931 of the HCV genome were ligated together and cloned as four separate EcoRI-BamHI subfragments into the CKS fusion vector pJ0200. After subsequent DNA sequences confirmation, the four subfragments were digested with the appropriate restriction enzymes, gel purified, ligated together, and cloned as an 1 102 base pair EcoRI- BamHI fragment in the CKS fusion vector pJ0200. The resulting plasmid, designated pHCV-24, expresses the HCV CKS-C100 antigen under control of the ]ac promoter.
• the HCV CKS-c100 antigen consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, 363 amino acids from the HCV NS4 region (amino acids 1569-1931) and 10 additional amino acids contributed by linker DNA sequences.
• the HCV CKS-c100 antigen was expressed at very low levels by pHCV-24.
• FIG. 34 presents a schematic representation of the recombinant antigens expressed by pHCV-24, pHCV-57, and pHCV-58.
• SEQ.ID. NO. 13 presents the DNA and amino acid sequence of the HCV-C100D1 recombinant antigen produced by pHCV-57.
• Lane 14 presents the DNA and amino acid sequence of the HCV- C100D2 recombinant antigen produced by pHCV-58.
• Figure 35 presents the expression of pHCV-24, pHCV-57, and pHCV-58 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-24 expressing the HCV CKS-c100 antigen (amino acids 1569-1931) prior to induction and lanes 2 and 3 after 2 and 4 hours post induction, respectively.
• Lane 4 contained the E.coli lysate containing pHCV-57 expressing the HCV-CKS-C100D1 antigen (amino acids 1569-1574 and 1598-1931) prior to induction and lanes 5 and 6 after 2 and 4 hours induction, respectively.
• Lane 7 contained the E.coli lysate containing pHCV-58 expressing the HCV CKS-C100D2 antigen (amino acids 1569-1599 and 1621 -1931) prior to induction, and lanes 8 and 9 after 2 and 4 hours induction, respectively.
• HCV-105 expresses the HCV CKS-NS3 antigen under control of the ]ac promoter.
• the HCV CKS-NS3 antigen consists of 239 amino acids of CKS, 12 amino acids contributed by linker DNA sequences, 157 amino acids from the HCV NS3 region (amino acids 1473-1629), and 9 additional amino acids contributed by linker DNA sequences.
• Figure 36 presents a schematic representation of the pHCV-105 antigen.
• SEQ.ID.NO. 24 and 25 presents the DNA and amino acid sequence of the HCV CKS-NS3 recombinant antigen produced by pHCV-105.
• Figure 37 presents the expression of pHCV-105 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-105 expressing the HCV CKS-NS3 antigen (amino acids 1472-1629) prior to induction and lanes 2 and 3 after 2 and 4 hours induction, respectively.
• These results show that the pHCV-105 fusion protein has an apparent mobility corresponding to a molecular mass of 43,000 daltons. This compares acceptably to the predicted molecular mass of 46,454 daltons.
• C Preparation of HCV CKS-5'ENV
• a 489 base pair DNA fragment from the putative envelope region of HCV was generated by PCR.
• This fragment represents the HCV amino acids 1 14-276 and was cloned into the CKS expression vector pJ0202 using EcoRI-BamHI restriction sites.
• the resulting clone designated pHCV-103 (SEQ.ID.NO. 26 and 27), expresses the HCV CKS-5'ENV antigen under control of the lac promoter.
• the HCV CKS-5 ⁇ NV antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 163 amino acids from the HCV envelope region (amin ⁇ acids 1 14-276), and 16 additional amino acids contributed by linker DNA sequences.
• FIG 38 presents a schematic representation of the pHCV-103 antigen.
• SEQ.ID.NO. 26 and 27 presents the DNA and amino acid sequence of the HCV CKS-5'ENV recombinant antigen produced by pHCV-103.
• Figure 37 presents the expression of pHCV-103 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-103 expressing the HCV CKS- 5 ⁇ NV antigen (amino acids 1 14-276) prior to induction and lanes 5 and 6 after 2 and 4 hours induction, respectively.
• These results show that the pHCV-103 fusion protein has an apparent mobility corresponding to a molecular mass of 47,000 daltons. This compares acceptably to the predicted molecular mass of 46,091 daltons.
• a 621 base pair DNA fragment form the putative envelope region of HCV was generated by PCR.
• This fragment represents HCV amino acids 263-469 and was cloned into the CKS expression vector pJ0202 using EcoRI restriction sites.
• the resulting clone designated pHCV-101 (SEQ.ID.NO. 17), expresses the HCV CKS-3'ENV antigen under control of the lac promoter.
• the HCV CKS-3 ⁇ NV antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 207 amino acids from the HCV envelope region (amino acids 263-469), and 15 additional amino acids contributed by linker DNA sequences.
• Figure 39 presents a schematic representation of the pHCV-101 antigen.
• SEQ.ID.NO. 28 and 29 presents the DNA and amino acid sequence of the HCV CKS-3 ⁇ NV recombinant antigen produced by pHCV-101.
• Figure 37 presents the expression of pHCV-101 proteins in E.coli Lane 7 contained the E.coli lysate containing pHCV-101 expressing the HCV CKS-3 ⁇ NV antigen (amino acids 263-469) prior to induction and lanes 8 and 9 after 2 and 4 hours induction, respectively. These resulting show that the pHCV-101 fusion protein has an apparent mobility corresponding to a molecular mass of 47,000 daltons. This compares acceptably to the predicted molecular mass of 51 ,181 daltons.
• a 636 base pair DNA fragment from the putative NS2 region of HCV was generated by PCR. This fragment represents the HCV amino acids 994-1205 and was cloned into the CKS expression vector pJ0201 using EcoRI restriction sites. The resulting clone, designated pHCV-102, expresses the HCV CKS-NS2 antigen under control of the lac promoter.
• the HCV CKS-NS2 antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 212 amino acids from the HCV NS2 region (amino acids 994- 1205), and 16 additional amino acids contributed by linker DNA sequences.
• Figure 40 presents a schematic representation of the pHCV-102 antigen.
• SEQ.ID.NO. 30 and 31 presents the DNA and amino acid sequence of the HCV CKS-NS2 recombinant antigen produced by pHCV-102.
• Figure 41 presents the expression of pHCV-102 proteins in E.coli.
• Lane 1 contained the E.coli lysate containing pHCV-102 expressing the HCV CKS-NS2 antigen (amino acids 994-1205) prior to induction and lanes 2 and 3 after 2 and 4 hours induction, respectively.
• These results show that the pHCV-102 fusion protein has an apparent mobility corresponding to a molecular mass of 53,000 daltons. This compares acceptably to the predicted molecular mass of 51,213 daltons.
• HCV CKS-NS1 Using the methods detailed above, a 654 base pair DNA fragment from the putative NS1 region of HCV was generated by PCR. This fragment represents HCV amino acids 617-834 and was cloned into the CKS expression vector pJ0200 using EcoRI-BamHI restriction sites. The resulting clone, designated pHCV-107, expresses the HCV CKS-NS1 antigen under control of the Jac promoter.
• the HCV CKS-NS1 antigen consists of 239 amino acids of CKS, 10 amino acids contributed by linker DNA sequences, and 218 amino acids from the HCV NS1 region (amino acids 617-834).
• Figure 42 presents a schematic representation of the pHCV-107 antigen.
• SEQ.ID.NO. 32 and 33 presents the DNA and amino acid sequence of the HCV CKS-NS1 recombinant antigen produced by pHCV-107.
• HCV-104 expresses the HCV CKS-ENV antigen under control of the lac promoter.
• the HCV CKS-ENV antigen consists of 239 amino acids of CKS, 7 amino acids contributed by linker DNA sequences, 356 amino acids from the HCV envelope region (amino acids 114- 469), and 15 additional amino acids contributed by linker DNA sequences.
• Figure 43 presents a schematic representation of the pHCV-104 antigen.
• SEQ.ID.NO. 34 and 35 presents the DNA and amino acid sequence of the HCV CKS-ENV recombinant antigen produced by pHCV-104.
• the amino acid sequence of this antigen is designated as pHCV-77 (SEQ. ID. NO. 1).
• the resultant fusion protein HCV CKS-NS1S1 consists of 239 amino acids of CKS, seven amino acids contributed by linked DNA sequences, and 215 amino acids from the NS1 region of the HCV genome.
• HCV-NS1S1 pHCV-77 was transformed into E.coli K-12 strain XL-1 (recA1 , endA1 , gyrA96, thi-1 , hsdRl 7, SupE44, relA1 , Iac/f1 , p10AB, lacl1ADM15, TN10) cells.
• Expression analysis and characterization of the recombinant protein was done using polyacrylamide gel electrophoresis as described in Example 1.
• the apparent molecular weight of the pHCV-77 antigen was the same as the expected molecular weight of 50,228 as visualized on a coumassie stained gel.
• FIGURE 47A presents the expression of pHCV-77 in E. coli.
• FIGURE 47B presents an immunoblot of the pHCV-77 antigen expressed in E. coli.
• Lane 1 contained the E. coli lysate containing pHCV-77 expressing the HCV CKS-NS1S1 antigen prior to induction and Lanes 2 and 3 are 2 and 4 hours post-induction, respectfully.
• EXAMPLE 11 HCV CKS-NS1S2
• the resultant fusion protein HCV CKS-NS1S2 consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 167 amino acids from the NS1 region of the HCV genome.
• HCV-NS1S2 pHCV-65 was transformed into E.coli K-12 strain XL-1 (recA1 , endA1 , gyrA96, thi-1 , hsdR17, SupE44, relAI , lac/f 1 , p10AB, laclqAMD15, TN10) cells.
• Expression analysis and characterization of the recombinant protein was done using polyacrylamide gel electrophoresis as described in Example 1.
• the apparent molecular weight of the pHCV-65 antigen was the same as the expected molecular weight of 46,223 as visualized on a coumassie stained gel.
• FIGURE 48A presents the expression of pHCV-65 in E. coli.
• FIGURE 48B presents an immunoblot of the pHCV-65 antigen expressed in E. coli.
• Lane 1 contained the E. coli lysate containing pHCV-65 expressing the HCV CKS-NS1S2 antigen prior to induction and Lanes 2 and 3 are 2 and 4 hours post-induction, respectively.
• the resultant fusion protein HCV CKS-NS1S3 consists of 239 amino acids of CKS, eight amino acids contributed by linker DNA sequences, and 131 amino acids from the NS1 region of the HCV genome.
• pHCV-80 (NS1S1-NS1S2) involved using the SACI/BamHI insert from pHCV-65 and ligating that into the Sacl/BamHI vector backbone of pHCV-77.
• the resultant HCV gene represents amino acids 365-731 of the HCV genome. This resulted in a 1101 base pair EcoRI/BamHI fragment of HCV cloned into the CKS fusion vector pJO200.
• the complete amino acid sequence of this antigen is designated as pHCV-80 (SEQ. ID. NO. 4).
• the resultant fusion protein HCV CKS NS1S1-NS1S2 consists of 239 amino acids of CKS, seven amino acids contributed by linker DNA sequences, and 367 amino acids from the NS1 region of the HCV genome.
• HCV-NS1S1-NS1S2 pHCV-80 was transformed into E.coli K-12 strain XL-1 (recA1, endA1, gyrA96, thi-1 , hsdR17, SupE44, relAI , lac/f 1 , plOAB, laclqADMl ⁇ , TN10) cells.
• FIGURE 49A presents the expression of pHCV-80 in E. coli.
• FIGURE 49B presents an immunoblot of pHCV- 80 antigen expressed in E. coli.
• Lane 1 contained the E. coli lysate containing pHCV- 80 expressing the HCV CKS-NS1S1-NS1S2 antigen prior to induction and Lanes 2 and 3 are 2 and 4 hours post-induction, respectively.
• pHCV-92 SEQ. ID. NO. 5
• NS1 full length NS1
• the resultant fusion protein HCV CKS-full length NS1 consists of 239 amino acids of CKS, seven amino acids contributed by linker DNA sequences, and 483 amino acids from the NS1 region of the HCV genome.
• the present invention thus provides unique recombinant antigens representing distinct antigenic regions of the HCV genome which can be used as reagents for the detection and/or confirmation of antibodies and antigens in test samples from individuals exposed to HCV.
• the NS1 protein is considered to be a rron-structural membrane glycoprotei ⁇ and to be able to elicit a protective immune response of the host against lethal viral infection.
• recombinant antigens either alone or in combination, can be used in the assay formats provided herein and exemplified in the Examples. It also is contemplated that these recombinant antigens can be used to develop specific inhibitors of viral replication and used for therapeutic purposes, such as for vaccines. Other applications and modifications of the use of these antigens and the specific embodiments of this inventions as set forth herein, will be apparent to those skilled in the art. Accordingly, the invention is intended to be limited only in accordance with the appended claims.
• ATTORNEY/AGENT INFORMATION (A) NAME: POREMBSKI, PRISCILLA E. (B) REGISTRATION NUMBER: 33,207 (C) REFERENCE DOCKET NUMBER: 4834PC.02
• Trp Gly Gin lie Ser Tyr Ala Asn Gly Ser Gly Pro Asp Gin Arg Pro 355 360 365
• Gly Ala Pro Pro Cys Val lie Gly Gly Ala Gly Asn Asn Thr Leu ' 450 455 460
• Leu Val lie Leu Asn Ala Ala Ser Leu Ala Gly Thr His Gly Leu Val 645 650 655
• MOLECULE TYPE DNA (genomic)
• Gly Lys Val lie Asp Thr Leu Thr Cys Gly Phe Ala Asp Leu Met Gly 370 375 380
• AAAG (-OGV ⁇ TACGK_CG ⁇ GTGGGCTTTGTATGACAGCCAGG 1677
• Gly Gly Gin lie Val Gly Gly Val Tyr Leu Leu Pro Arg Arg Gly Pro 275 280 285
• MOLECULE TYPE DNA (genomic)
• ATC GAA ATG TTA GAG CAG CTT CGT GTT CTG TGG TAC GGC GAA AAA ATC 792 He Glu Met Leu Glu Gin Leu Arg Val Leu Trp Tyr Gly Glu Lys He 210 215 220 CAT GTT GCT GTT GCT CAG GAA GTT CCT GGC ACA GGT GTG GAT ACC CCT 840 His Val Ala Val Ala Gin Glu Val Pro Gly Thr Gly Val Asp Thr Pro 225 230 235
• Ser Gly Lys Pro Ala lie lie Pro Asp Arg Glu Val Leu Tyr Arg Glu 530 535 540
• Gin Thr Ala Ser Arg Gin Ala Glu Val lie Aia Pro Ala Val Gin Thr 580 585 590
• Pro Ala lie Ala Ser Leu Met Ala Phe Thr Ala Ala Val Thr Ser Pro 625 630 635 640
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• CAC CAC MC CTG GTT TAC TCT ACC ACC TCT CGT TCT GCT TGC CAG CGT 1584 His His Asn Leu Val Tyr Ser Thr Thr Ser Arg Ser Ala Cys Gin Arg 515 520 525
• Glu Ser Glu Asn Lys Val Val lie Leu Asp Ser Phe Asp Pro Leu Val 305 310 315 320
• MOLECULE TYPE DNA (genomic)
• GCT GAT MC CTC
• CAG CGT CAG GTG GGT ATG GCG ACT CTG GCG GTG 384 Ala Asp Asn Leu Ala Gin Arg Gin Val Gly Met Ala Thr Leu Ala Val 115 120 125
• GGT GTT CGT GTT TGC GM MA ATG GCT CTG TAC GAC GTT GTT ACC AM 1104 Gly Val Arg Val Cys Glu Lys Met Ala Leu Tyr Asp Val Val Thr Lys 355 360 365
• Glu Ser Asp He Arg Thr Glu Glu Ala lie Tyr Gin Cys Cys Asp Leu 420 425 430
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• GCT CGT CCG CGTTGG ATC TGG TTC TGC CTG CTG CTG CTG GCT GCT GGT 1152 Ala Arg Pro Arg Trp He Trp Phe Cys Leu Leu Leu Leu Ala Ala Gly 370 375 380

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Zoology (AREA)
• Engineering & Computer Science (AREA)
• Gastroenterology & Hepatology (AREA)
• Biophysics (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• Virology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• General Engineering & Computer Science (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (3)

Publications (2)

Family

ID=25009968

Family Applications (1)

Country Status (6)

Families Citing this family (7)

Citations (1)

Family Cites Families (3)

• 1992
  • 1992-08-21 EP EP92918853A patent/EP0600009A4/de not_active Withdrawn
  • 1992-08-21 JP JP5504658A patent/JPH06510191A/ja active Pending
  • 1992-08-21 WO PCT/US1992/007188 patent/WO1993004088A1/en not_active Application Discontinuation
  • 1992-08-21 CA CA 2115926 patent/CA2115926A1/en not_active Abandoned
  • 1992-08-21 AU AU25135/92A patent/AU2513592A/en not_active Abandoned
  • 1992-09-03 TW TW81106995A patent/TW213924B/zh active

Patent Citations (1)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events