DK175336B1 - DNA sequence coding for a peptide having granulocyte stimulating effect, recombinant vector and transformant containing this sequence, and method for producing the polypeptide - Google Patents

Description

· -T ... l -, 'ga: ^^ gB ^ "g" ^ ~ 1 -' —-i,. ,. j. ^ i i .., ν ^ Ν -. ^ ι DK 175336 B1 i

The present invention relates to a DNA sequence encoding a polypeptide having the effect of a human granulocyte colony-stimulating factor (hereafter abbreviated as CSP). The present invention also relates to a recombinant vector in which this DNA sequence is inserted, a transformant containing this vector, and a method for producing a polypeptide or glycoprotein having this CSF effect.

When bone marrow cells, as target cells, and kidney cells 10 or fetal cells were cultured by the double-layer soft agar culture method, the bone marrow cells being in the upper layer and the kidney cells or fetal cells in the lower tea layer, a portion of the cells in the upper layer grew and differentiated to form colonies! 5 and neutrophilic granulocytes (hereinafter simply referred to as granulocytes) - or monocytic macrophages. This observation has led to the assumption that there are factors in vivo that promote the formation of colonies [Pluznik and Sach, J. Cell. Comp. Physiol., 615, 319 (1965); and Bradley and Metcalf, Aust. J. Exp. Biol. With.

Sci. , AA, 287 (1966)].

It is known that these factors, collectively referred to as CSPs, are formed by cells such as T cells, monocytic macrophages, fibroblasts and endothelial cells.

25, which are usually widespread in vivo. Among subclasses of CSF include: granulocyte-monocytic macrophage CSF

(abbreviated as GM-CSF) acting on the stem cells for granulocytes or monocytic macrophages in such a way that they stimulate the growth of such stem cells 30 and induce differentiation thereof to form colonies of granulocytes or monocytic macrophages; monocytic macrophage CSF (abbreviated M-CSF), which is primarily capable of forming colonies of macrocytic H macrophages; multipotent CSF (abbreviated multi-CSF) that Λ *

5 acts on less differentiated multipotent stem cells; and in

In granulocyte CSF (abbreviated G-CSF) of the type being treated

easily in the present invention, and first of all I

are capable of forming granulocyte flasks. IN

Recently, multipotent CSF has been purified from

Cell line and characterized (L. Welte et al. 1985, Proc. I

In Nat Acad. Sci. USA, 82: 1526-1530).

Likewise, a human analogue of mouse G-CSF has become I

identified and purified (N.A. Nicola et al. 1985, Nature I

314: 625-628). It has recently been argued that target cells I

15 differentiation steps vary from a subclass of CSF to I

another [Asano, Taisha Metabolism and Disease, 22, 249 I

I (1985); and Yunis et al., "Growth and Maturation Factors", I

published by Guroff, John Wiley and Sons, NY, Vol. 1, 209 I

In (1983)].

20 Therefore, the purification of the individual CSF subclasses and I

closer examination of their chemical and biological properties

creates very important for the assessment of the mechanical

blood-induced formation and analysis of I

H pathomorphological I of various hematological diseases

25 aspects. The biological effects of G-CSF attracting I

get more and more attention from scientists, is their I

ability to induce differentiation of bone marrow 1 eukemia 1 -

and to enhance the effects of the pre-formed granulocytes, and

many expectations have been raised about the potential clinical I

30 benefits of G-CSF in the treatment and prevention of leukemia. IN

The attempts made so far to isolate and purify G-CSF I

is based on the cell culture method by which G-CSF is isolated

from the supernatant of a cell culture, but homogeneous G-CSF is still I

not prepared in large quantities by this process, G-I

35 CSF can only be produced in low concentration and complex purification

methods are needed to obtain trace amounts of G-CSF out I

from a large volume of the culture medium. Therefore, it has been strong

desired to obtain mass production of G-CSF by recombinant DNS-I

technology. IN

3 DK 175336 B1

It is an object of the present invention to provide a DNA sequence encoding a polypeptide having human G-CSF action.

Another object of the present invention '5 is to provide a recombinant vector containing this DNA sequence.

A further object of the present invention is to provide a transformant produced by transforming a host with this recombinant vector.

Another object of the present invention is to provide a method for producing a polypeptide or glycoprotein with human G-CSF action.

FIG. Figure 1 shows the sequences of three different probes, IWQ, A and LC; FIG. 2 shows the nucleotide sequence of a pHCS-1 insert; FIG. 3 (A) shows the nucleotide sequence of a cDNA insert in pBRG4; FIG. 3 (B) (I) shows the amino acid sequence of a human G-CSF precursor as deduced from pBRG4 cDNA; FIG. 3 (B) (II) shows the amino acid sequence of human complete G-CSF, as deduced from pBRG4 cDNA; FIG. 4 (A) shows the nucleotide sequence of a cDNA insert in pBRV2; FIG. 4 (B) (i) shows the amino acid sequence of a human G-CSF precursor which, derived from pBRV2 cDNA; FIG. 4 (B) (II) shows the amino acid sequence of human 30 G-CSF complete as deduced from pBRV2 cDNA; FIG. 5 shows the nucleotide sequence of a human chromosomal gene encoding human G-CSF; FIG. 6 shows the cleavage sites of the restriction enzymes for human G-CSF cDNA derived from pBRG4 or 35 pBRV2; In DK 175336 B1

In FIG. 7 shows the cleavage I of the restriction enzymes

sites for the human chromosomal gene encoding I

human G-CSF; IN

FIG. 8 is a partial presentation of progress 4 I

5 shows the way of producing a tac promoter-containing vector I

I (+ VSE line); IN

FIG. 9 is a presentation of the method of I

In the preparation of a Pjj promoter-containing vector (+ VSE-li- I

I don't); IN

10 FIG. 10 is a presentation of the method of I

H preparation of trp promoter-containing vector (+ VSE line); IN

FIG. 11 is a partial presentation of progress I

the method of producing a tac promoter-containing vector I

I (-VSE line); IN

In FIG. 12 is a presentation of the method of I

In the preparation of a Ρι, promoter-containing vector (-VSE line); IN

FIG. 13 is a presentation of the method of I

In the preparation of a trp promoter-containing vector (-VSE-li- I

I don't); IN

In FIG. 14 schematically shows the structure of pHGA410; IN

FIG. 15 is a presentation of the method of I

In constructing expression recombinant vectors, pTN-G4, I

In pTN-G4VAtt and pTN-64VAØ; IN

FIG. 16a and 16b show two methods of con

In the construction of pHGG4-dhfr; IN

FIG. 16c shows the methods of construction I

I of pG4DR1 and pG4DR2; IN

In FIG. 17 schematically shows the structure of pHGV2; IN

In FIG. 18 is a presentation of the methods I

30 for constructing the expression recombinant vectors, I

In pTN-V2, pTN-VAe and pTN-VA / 5; IN

FIG. 19a and 19b show two methods of con I

In the construction of an expression recombinant vector pHGV2-I

I dhfr; IN

In FIG. 19c shows the methods of construction I

I of pV2DR1 and pV2DR2; IN

5 DK 175336 B1 fig. 20 schematically shows the structure of pMLCE3a; FIG. 21 schematically shows the structure of pTNCE3a; and FIG. 22 schematically shows the structures of p, pD26SVCE3a and pDRCE3a.

The DNA sequence encoding a polypeptide having the human G-CSF effect of the present invention is a DNA (cDNA) which is complementary to the messenger RNA (mRNA) obtained as 15 The 17S fractions by sucrose density gradient centrifugation and encoding a polypeptide having the human G-CSF action. According to the present invention, two lines of this cDNA have been obtained.

The one-line cDNA has all or part of a gene encoding the polypeptide I or II shown in FIG.

3 (B). More specifically, this has the cDNA nucleotide sequence imaged from ATG at 32-34 nucleotide positions from the 5 'terminus [see FIG. 3 (A)] to CCC at 650-652 nucleotide positions, or from ACC at 122-124 positions to CCC at 650-652 positions. Alternatively, the cDNA 20 has the nucleotide sequence shown in FIG. 3 (A) or part thereof. This line's cDNA is then referred to as cDNA (+ VSE).

The second-line cDNA has all or part of the gene encoding the polypeptide I or II shown in FIG. 4 (B). More specifically, this cDNA has the nucleotide sequence imaged from ATG at 31-33 nucleotide positions from the 5 'terminus [see FIG. 4 (A)] to CCC at 640-642 nucleotide positions or from ACC at 121-123 positions to CCC at 640-642 positions. Alternatively, this cDNA may have the nucleotide sequence shown in FIG. 4 (A) or a portion thereof. The cDNA of this line is then referred to as cDNA (-VSE).

The DNA sequence described above can be obtained by the following methods: An mRNA-encoded G-CSF is first prepared from mammalian or human cells or other host cells capable of generating a G-CSF effect polypeptide. The mRNA is then converted to

I DK 175336 B1 I

I 6 I

In a double-stranded cDNA at any of the I

known methods, after which a plurality of recombinants I

I containing this cDNA (this quantity is hereinafter referred to as

I as a cDNA library) is subjected to screening by known I

In 5 methods. 'IN

In the DNA sequence of the present invention I

You also include a human chromosomal DNA sequence encoding “I

for a polypeptide having the human G-CSF effect. The hu- I

mane chromosomal DNA sequence contains a nucleotide sequence

In 10 friends taking part in transcriptional regulation, and I

In addition, you contain all or part of the nucleotide sequence

In the case shown in FIG. 5. I

A chromosomal gene can be obtained by first starting from I

human cells to produce a plurality of recombinants I

I containing a human chromosomal gene (the amount designated I

hereinafter referred to as a human chromosomal gene library), I

And then to expose this human chromosomal gene

In library for screening by known methods. IN

The human chromosomal gene can be provided

20 from any type of human cell, such as cell I

You have clay extracted from the liver or kidneys or cultured

In cells, such as tumor cells. A human chromosomal gene

library can be prepared from human cells at an I

In any of the known methods [see Mania-I

In Tis et al., Cell, 15, 687 (1978); and Maniatis et al., I

In Molecular Cloning, Cold Spring Harbor Laboratory, p 269 I

I ff. (1982)], as illustrated below; IN

I A human chromosomal DNA is extracted from an I

In source, such as human, fetal liver, with phenol or I

30 other suitable chemicals; the extracted DNA is exposed

for partial or complete digestion using an I

In appropriate restriction enzyme to obtain a DNA fragment I

Intended with a suitable length; The DNA fragment is inserted into I

a λ phage vector DNA fragment using a T4 DNA-I

In ligases or other suitable ligases, a linker containing I

In holding the restriction site of a suitable enzyme such as I

7 DK 175336 B1

Optionally, EcoRl is attached. Then, λ phage particles are obtained by in vitro packing methods, and host cells such as E. coli are transformed with the obtained λ phage particles.

. Examples of λ-phage particles which can be used as a vector in the methods described above include Charon 4A and EMBL-3 and EMBL-4.

Mammalian cells which can be used as a source of mRNA are a human, oral cavity-derived cell strain, CHU-2 (deposited by the Collection Nationale de Cultures de 10 Microorganisms, or C.N.C.M., under accession number 1-483). However, it is to be understood that cells which can be recovered from mammals or humans, or any other suitably established cell strain, may be used in place of such tumor cell strains.

Preparation of mRNA can be achieved by one of the methods already proposed for the cloning of genes for several other physiologically active proteins:

the whole RNA is first obtained by treatments with a surfactant and phenol in the presence of a ribonuclease inhibitor, such as a vanadyl-ribonucleoside complex [see Berger and Birkenmeier, Biochemistry, 18, 5143 (1979)] or by CsCl density gradient centrifugation after treatment with guanidine thiocyanate [see Chirgwin et al., Biochemistry, 1.8, 5294 (1979)], after which poly (A +) ~ 25 RNA (mRNA) is obtained by subjecting the entire RNA to batch adsorption or affinity column chromatography on oligo (dT ) -cellulose or poly-D-Sepharose using Sepharose 2B as a carrier. The poly (A +) RNA can be further fractionated by a suitable method such as sucrose density gradient centrifugation. The ability of the thus obtained mRNA to encode a polypeptide with G-CSF action can be confirmed by several methods. Eg. the mRNA is translated into a protein and its physiological effects investigated. Alternatively, the identity of this protein is determined by an anti-G-CSF antibody. More specifically, I is injected into DK 175336 B1

I I

In mRNA in oocytes of Xenopus laevls to induce I

In translation [see Gurdon et al., Nature, 233, 177 (1972)], I

I or translation reactions can be performed with rabbit reti

In colocytes or wheat germ [Schleif and Wenslnk, "Practi- i I

I 5 cal Methods in Molecular Biology ", Springer-Verlag, NY I

I (1981)]. The G-CSF effect can be tested using I

soft agar culture method using bone marrow I

In cells, and techniques for carrying out this process I

In the way reviewed [Metcalf, "Hemopoietic Colonies," i

In 10 Springer-Verlag, Berlin, Heidelberg, NY (1977)]. IN

A single-stranded cDNA is synthesized during use

As part of the thus obtained mRNA as template. One double

In the belt strand cDNA is synthesized from this single strand I

goat cDNA and the double-stranded cDNA is inserted into an I

15 to generate a recombinant plasmid I

mid. This recombinant plasmid can be used for transformation

mation of a suitable host, such as Escherichia coli, and her

by obtaining a group of DNA molecules in the transformants I

I (cDNA library). IN

A double-stranded cDNA can be obtained from mRNA1 and I

in one of the following two free modes: mRNA * a treatment

reads with a reverse transcriptase using oli- I

go (dT), which is complementary to the poly (A) chain at I

At the 3 'terminus, as the primer, or an oligonucleotide which I

25 corresponds to part of the amino acid sequence of G-CSF protein I

nets, synthesized, and a cDNA complementary to I

The mRNA is synthesized by treatment with a reverse trans I

In scriptase using the synthesized oligo- I

In nucleotide as primer. A double-stranded cDNA can also be

I 30 is obtained by the following methods: mRNA is decomposed

I and removed by treatment with a base and the obtained I

single-stranded cDNA is first treated with a reverse I

In transcriptase or DNA polymerase I (e.g., a Klenow I

In fragment), and then with S1 nuclease. Alternatively, you can

The 35 mRNA * is directly treated with RNase H and DNA polymerase I

I (e.g., E. coli polymerase I). For further information

it__ · * --- - ··: .r'-j.iiL «- ':;? _ · -: '· - - ϋ -; _ · ^^ r - ~ Λ -g ·. See Maniatis et al., "Molecular Cloning", Cold Spring Harbor Laboratory (1982); and Gubler and Hoffman,

Gene, 2b, 263 (1983).

The double-stranded cDNA thus obtained is inserted into a suitable vector, e.g. one of the EK-type plasmid vectors, which are typical examples of: pSC101, pDF41, ColE1, pMB9, pBR322, pBR327 and pACYCl, or one of the phage vectors which are typical examples of: Agt, Ac, Agt10 and AgtWES, and then the recombinant vector is used to transform a strain of JL-cole (e.g., X1776, HB101, DH1, or C600) so as to obtain a cDNA library (see, e.g., "Molecular Cloning", ibid.) .

The double-stranded cDNA can be bound to a vector by the following methods: A terminus of the cDNA is provided with an end which can be bound to the vector by attaching an appropriate chemically synthesized DNA fragment and a vector DNA. which is cut with a restriction enzyme, binds to this cDNA by treatment with a T4 phage DNA ligase in the presence of ATP.

Alternatively, dC, dG chains (or dT, dA chains) are attached to the double-stranded cDNA and a vector DNA, which have been cut with a restriction enzyme, and a solution containing both DNA molecules is annealed (see "Molecular Cloning ", ibid.).

A host cell can be transformed with the recombinant DNA thus obtained by any of the known methods. If the host cell is L coli. the method described by Hanahan [J. Moth. Biol., 166.

30557 (1983)], wherein recombinant DNA is added to a competent cell made in the presence of CACl2> MgCl2 or RbCl.

Screening for the cells containing the desired gene can be performed by several methods which include: The plus minus method used in cloning the interferon cDNA [Taniguchl et al., Proc. Jpn. Acad., 55.

I DK 175336 B1 I

I 10 I

In Ser. B., 464 (1979)], hybridization translation assay I

In the method [Nagata et al., Nature, 284. 316 (1980)] and co-I

In the lony or plague hybridization method using I

I of an oligonucleotide probe chemically synthesized on I

In the basis of the amino acid sequence of the protein with the human I

In G-CSP activity [Wallace et al., Nucleic Acids Res., 9, I

I 879 (1981); and Benton & Davis, Science, 196, 180 I

In (1977)]. IN

In the fragment containing the thus cloned I

In 10 gene encoding the polypeptide with human G-CSF activity

Injection, can be re-inserted into a suitable vector DNA with reference to I

Looking at transformation of other prokaryotic or eu- I

In karyotic host cells. By inserting an appropriate I

In promoter and an expression-associated sequence in vector I

In pure, the gene can be expressed in an individual host cell. IN

Examples of prokaryotic host cells include

In Escherichia coli, Bacillus subtills and Bacillus thermo- I

In philus. The gene of interest can be expressed in these I

In host cells by transforming them with a replicon I

I (e.g., a plasroid vector containing an initial I

I and regulator sequence) obtained from a cell type of I

Like the host. A desirable vector is a vector with I

In a sequence capable of imparting the transform I

In Selected Cell Selectivity for Expressed Characteristics I

I 25 (phenotype). IN

I For example, E. coli can be transformed with I

In pBR322, there is a vector capable of replicating I

In re in E _; _ coli [see Bolivar, Gene, 2, (1975)]. This vector I

You contain both ampicillin and tetracycline resistance

In 30 stone genes, and both of these properties can be used for I

In identifying the transformed cell. Examples of I

In the promoter needed for gene expression in pro-I

In karyotic hosts, the promoter of β-lactamase-I comprises

In the gene [Chan et al., Nature, 275, 615 (1978)], lactose-I

In the promoter [see Goeddel et al., Nature, 281, 544 (1979)] I

I and the tryptophan promoter [see Goeddel et al., Nucleic Acid I

11 DK 175336 B1

Res., 8, 4057 (1980)], etc. Any of these promoters can be used in the preparation of a polypeptide having the human G-CSF effect of the present invention.

A eukaryotic microorganism such as saccharomyces cerevisiae can be used as a host cell and transformed with a vector such as plasmid YRp7 [see Stinch-comb et al., Nature, 282, 39 (1979)]. This plasmid has the TRP1 gene as a selection marker for yeast strains lacking the ability to form tryptophan, so that the transformants can be selected by carrying out the culture without the presence of tryptophan. Examples of the promoter that can be used for gene expression include an acidic phosphatase gene promoter [Miyanohara et al., Proc. Natl.

15 Acad. Sci., USA, 80, 1 (1983)] and an alcohol dehydrogenase gene promoter [Valenzuela et al., Nature, 298. 347 (1982)].

The host cells can also be obtained from mammalian cells such as COS cells, Chinese hamster ovary cells 20 (CHO cells), C-127 cells, and Hela cells. An example of a vector that can be used to transform these cells is pSV2-gpt [see Mulligan and Berg; Proc.

Natl. Acad. Sci., USA, 78, 2072 (1981)]. The vectors used to transform these cells contain starting site, selection marker, a promoter located before the gene to be expressed, RNA splicing site, polyadenylation signal, etc.

Examples of promoters that can be used for gene expression in mammalian cells include the promoters 30 of a retrovirus, polyomavirus, adenovirus, simian virus 40 (SV40), etc. If the promoter of SV40 is used, the desired gene expression can be readily obtained by the method of Mulligan et al. , described in Nature, 277. 108 (1979).

Examples of starting sites that can be used include those obtained from SV40, polyomavirus,

I DK 175336 B1 I

I 12 I

novirus, bovine papilloma virus (BPV), etc. Examples of I

In selectable markers that may be used, phospho-I

In the transferase APH (3 *) II or I (neo) gene, thymidine I

In the kinase gene (TK gene), E. coli-xanthine quanidine phospho-I

In the rlbosyltransferase gene (Ecogpt gene), dihydrofolate I

In the reductase gene (DHFR gene), etc. I

I To obtain polypeptides with human G-CSF-I

In effect from the host vector system listed above

In more, the following methods may be used: The gene, I

I encoding the peptide with the human G-CSF effect I

inserted at a suitable location in any of the above I

In vectors, the host cell is transformed with the resulting I

In recombinant DNA and the obtained transformants are grown. IN

The desired polypeptide can be isolated and purified from I

In the cell or culture solution at any one

In the known methods. IN

In Eukaryotic genes, it is generally considered that you

You exhibit polymorphism as is known to the human in-

In the terferon [see Nlshi et al., J. Biochem. 97, 153 I

I 20 (1985)] and this phenomenon may cause substitution of I

In one or more amino acids or a change in nucleotide I

In the sequence, but no change in amino acid sequence I at all

In the quince. IN

The G-CSF effect may also be possessed by a polypeptide

For 25 hours, one or more of the amino acids of amino-I are missing

In the acid sequence shown in FIG. 3 (B) or 4 (B) or where I

In such amino acids is added to, or a polypeptide, I

In which one or more of these amino acids is replaced by I

In one or more amino acids. It is also known that a po- I

In 30 lypeptide obtained by converting each of the cysteine I

In codons 1, the human interleukin-2 gene (IL-2 gene) to I

In a serine codin, the effect of interleukin-2 [Wang et al

In al., Science, 224. 1431 (1984)]. All the genes encoding I

I for these polypeptides, recombinant vectors, containing I

In these, these genes, transformants, obtained by sowing

In forming recombinant vectors, and the polypeptides or gly- I

Therefore, the coproteins obtained by culturing such transformants are within the scope of the present invention, as long as the polypeptides, whether natural or chemically synthesized, have the human G-CSF effect.

In the following, the main features of the methods of producing the gene of the present invention which encode a polypeptide having the human G-CSF action, a recombinant vector containing this gene and a transformant containing this recombinant vector, and a polypeptide or glycoprotein having the human G-CSF effect, expressed in this transformant.

(1) Sample making.

A homogeneous human CSF protein was purified from the supernatant of a culture of the tumor cell line, CHU-2, and its amino acid sequence from the N-terminal snout was determined. Fragments were obtained by decomposition with bromocyan and treatment with trypsin, and the amino acid sequences of 20 of these fragments were also determined [Example 3 (i), (ii) and (iii)].

From the particular amino acid sequences, three nucleotide probes, (A), (LC) and (IWQ) were synthesized with the se sequences shown in Figs. 1 (Example 4). Probe (A) was the 25 mixed type composed of 14 successive nucleotides.

Probe (IWQ) was composed of 30 successive nucleotides with deoxyinosine and was a probe of the type used in the cloning of the human cholecystokin gene [Takahashi et al., Proc. Natl. Acad. Sci., USA, 82, 1931 (1985)].

Probe (LC) was a 24-nucleotide probe synthesized from the nucleotides at 32-39 positions from the N-terminus of the amino acid sequence shown in Example 3 (i) on the basis of the nucleotide sequence shown in FIG. Third

Chemical synthesis of the nucleotides can be achieved by using the improved phosphotriester method in connection with the solid phase method and has been reviewed by Na rank [Tetrahedron, 39, 3-22 (1983)].

In DK 175336 B1 H Try based on amino acid sequences at positions other than the positions in the probes described above can also be used.

(2) Construction of cDNA library.

5 CHU-2 cells were homogenized after addition

of a guanidine hydrocyanate solution, and the total RNA

was obtained by CsCl density gradient centrifugation.

Poly (A +) RNA was isolated from total RNA by column chromatography on oligo (dT) cellulose. Then, a single-stranded cDNA was synthesized by a reverse transcriptase; and RNase H and L coli-PNA polymerase I were added to obtain a double-stranded cDNA. A dC chain was attached to the obtained double-stranded cDNA, which was bound to a vector, pBR322, to which a d6 chain was attached at the Pst I cut site. The resulting recombinant DNA was used to transform a strain of E. coli. X1776, and a pBR322 line cDNA library was constructed (Examples 5 and 6).

Similarly, the double-stranded cDNA was bound to the Agt10 vector by the EcoRI linker, and an λ-phage line cDNA library was constructed (Example 7).

(3) Screening.

25 Recombinants obtained from the pBR322 lineage cDNA-I library were fixed to Whatmann 541 filter paper and a single clone could be selected by colony hybridization with 32p-labeled probe (IWQ). Further investigations by the Southern blotting method [Southern, J. Mol.

In Biol., 98, 503 (1975)], this clone also hybridized with probe (A). The nucleotide sequence of this clone I was determined by the dideoxy method [Singer, Science, 214, I 1205 (1981)].

In the nucleotide sequence of the cDNA insert obtained, I 35 is shown in FIG. 2, from which it can be seen that this insert consisted of 308 base pairs, including probes (IWQ) and (A), and had an open reading frame encoding 83 amino acids, containing the amino acid sequence shown in Example 3 (li ). The pBR322-derived plasmid containing these 308 base pairs is hereinafter referred to as pHCS-1 (Example 58).

A DNA fragment containing the 308 base pairs obtained from pHCS-1 was radiolabeled by the "nick translation method" (see Molecular Cloning, ibid.), And with this fragment used as a probe, the Agt10-derived cDNA-10 library was screened at plaque hybridization [Benton and Davis, Science, 196, 180 (1977)] to obtain five clones. The nucleotide sequence of a clone presumably containing cDNA was determined by the same procedure as described above (Fig. 3 (A)).

15 As shown in FIG. 3 (A), this cDNA insert had a single large open reading frame.

The amino acid sequence encoded by this cDNA can be deduced as shown in FIG. 3 (A).

Comparison with the N-terminal amino acid sequence of the G-CSP protein of Example 3 (i) showed that this cDNA contained a nucleotide sequence corresponding to both a signal peptide and 90 base pairs starting with the ATG sequence at 32 -34 nucleotide positions from the 5 'terminus and terminate at the GCC sequence at 119-221 positions, 25 codes, and a finalized G-CSP polypeptide, as 531 base pairs starting with the ACC sequence at 122-124 positions and ending The CCC sequence at 650-652 positions encodes. Therefore, the polypeptide consisted of the amino acid sequence shown in FIG. 3 (B) of 207 amino acids, and its 30 molecular weight was calculated to 22292.67 daltons. The amino acid sequence II polypeptide consisted of 177 amino acids and its molecular weight was calculated to 18986.74 daltons (Example 9).

It should be noted that the ATG at 32-34 positions 35 or at 68-70 positions can also be considered as the starting site of the protein. Escherichia coli strain X1776

I DK 175336 B1 I

I 16 I

I containing pBR322 which had this cDNA (+ VSE) at I

In the EcoRI cut-off site, was deposited at Fermenta-I

I tion Research Institute, the Agency of Industrial I

In Science and Technology (FERM BP-954). IN

In FIG. 6 shows the restriction enzymes' cut-off I

In places for this gene. IN

In This cDNA was bound to pBR327 [soberon et I

Gene, 9, 287 (1980)] at the EcoRl site, and it re

starving plasmid is hereinafter referred to as pBRG4. IN

The pBRG4 thus obtained was treated with an I

In restriction enzyme, EcoRI, to obtain a DNA fragment

In ment containing cDNA with approx. 1500 base pairs. This frag- I

Intended was radiolabelled by the "nick translation method" I

I (see Molecular Cloning, ibid.), And with this radiolabelled I

In 15 DNA fragments as a probe, the Xgt10 was derived cDNA-I

In library once again screened by plague hybridization I

I (see Benton and Davis, ibid.). By this plaque hybrid I

In series, two pieces of λ-phage DNA-fixed I were prepared

In nitrocellulose filter paper. One of these pieces was used

I turned to the aforementioned plague hybridization and I

others were subjected to plague hybridization with the all-I

Described probe (LC). The phages that were positive I

In opposite of both probes, were selected. A clone you had

In a full-length cDNA, was selected and nucleotide sequenced

In the vein of the cDNA insert, determined by the dideoxy method, I

As shown in FIG. 4 (A). IN

This cDNA had a single, large, open reading frame, I

And the amino acid sequence that this cDNA would encode,

I was deduced as shown in FIG. 4 (A). IN

I Comparison with the N-terminal amino acid sequence I

In the sequence of the G-CSF protein of Example 3 (i), I

This cDNA contained a nucleotide sequence that corresponded to I

I to both a signal peptide, such as 90 base pairs, starting with I

In the ATG sequence 31-33 nucleotide positions from 5 'terminus I

In 35 and ending with the GCC sequence after 118-120 positions, I

You encode and a finalized G-CSF polypeptide, such as 522 I

17 DK 175336 B1 base pairs, starting with the ACC sequence after 121-123 positions and ending with the CC sequence after 640-642 positions, encode. Therefore, the polypeptide consisted of the amino acid sequence I shown in FIG. 4 (B), of 204 amino acids, and its molecular weight was calculated to 21977.35 daltons. The amino acid sequence II polypeptide consisted of 174 amino acids and its molecular weight was calculated to 18671.42 daltons (Example 10).

It should be noted that at 58-60 positions 10 or at 67-69 positions, ATG can also be considered as the protein site.

Escherichia coli strain X1776 containing pBR322, which had this cDNA (-VSE) at the EcoRI cut-off site, was deposited by the Fermentation Research Institute of the Institute of Industrial Science and Technology (FERM BP-955).

FIG. Figure 6 shows the gene's cut-off sites for restriction enzymes. This cDNA was bound to pBR327 at the EcoRI site to form a plasmid, herein designated pBRV2.

(4) Screening of a human chromosomal gene library.

A human chromosomal gene library prepared in accordance with the method described by Maniatis et al. (Molecular Cloning, ibid.), Was screened for pHCS-1 shown above. Probes that can be used in the screening include: A pHCS-1-derived 308 base-pair DNA fragment, a pBRG4-derived ca. 1500 base pair DNA fragment, a pBRV2-derived ca. A 1500 base pair DNA fragment, a DNA fragment of an appropriate length and containing part (s) of one or more of these DNA fragments, and the aforementioned oligonucleotide probes [i.e. (IWQ), (A) and (IC)]. The case of using the pHCS-1 DNA fragment is described below.

This DNA fragment was radiolabelled with 32 P in accordance with the "nick translation method" [see Roop et al., Cell, IL>, 431 (1978)]. With the resultant

I DK 175336 B1 I

I 18 I

32P-labeled fragment used as a probe, subject I

In des human chromosomal gene library screening at I

In pest hybridization (see Benton and Davis, ibid.) To I

In obtaining well over ten clones. IN

After extracting DNA from the clones, I was prepared

In an enzyme restriction map by known methods I

In [Pritsch et al., Cell, 19, 959 (1980)]. IN

Using the same DNA probe, I was performed

In Southern blotting (see Southern, ibid.), And it showed I

In itself, a DNA fragment of ca. 4 kb cut out

I with EcoRI and Xhol, could possibly contain a region, I

In which encoded the human G-CSF polypeptide. DNA fragments- I

Therefore, the 4 kb tet was inserted into pBR327 by EcoRI-I

Instead, using an EcoRI linker for obtaining I

In 15 of pBRCE3 £. Using this plasmid as a base I

In six-sequence DNA, the nucleotide sequence I was determined

I of the section with approx. 3 kb of this DNA fragment with approx. 4 kb I

You know by the dideoxy method. As a result, I was found

In this DNA fragment to be a gene encoding it

20 human G-CSF polypeptide (Fig. 5). IN

In E_j_ coli strain X1776 containing pBRCE30 (i.e., I

In the plasmid pBR327 with this DNA fragment of ca. 4 kb I

Inserted into the EcoRI site) was deposited by Fermenta-I

I tion Research Institute, the Agency of Industrial Scien- I

I 25 CE and Technology (FERM BP-956). IN

Comparison of the pBRG4 cDNA insert shown in I

In FIG. 3 and the pBRV2 cDNA insert shown in FIG. 4 showed that I

In the DNA fragment discussed contained five exon parts, and I

In that it encoded the amino acid sequences derived from pBRG4 I

In 30 and pBRV2. IN

In FIG. 7 shows the restriction enzymes I-cut

In places by the gene obtained. IN

In This DNA fragment, the chromosomal gene contained I

I for human G-CSF, or a prior region capable of

I 35 is transcribed into human G-CSF mRNA, plus a nucleotide I

In sequence taking part in transcriptional regulation I

[Benoist and Chambon, Nature, 290, 304 (1981); and

Breathnack and Chambon, Ann, Rev. Biochem., 50, 349 (1981)].

(5) Construction of a recombinant vector for expression in E coli.

(A) + VSE linear recombinant vector.

From the pBRG4 plasmid obtained in (3) (Example 9), a cDNA fragment for the G-CSF polypeptide was excised with a restriction enzyme and a recombinant vector was constructed by one of the following methods: (i) Using of an "annealed" synthetic linker, the fragment was ligated with a fragment prepared from a tac promoter-containing pKK223-3 (Pharmacia Fine Chemicals) (Example 12 and Figure 8), (ii) three fragments prepared from PL promoter-containing pPL-λ (Pharmacia Fine Chemicals), was ligated with an annealed synthetic linker, and the ligation product and cDNA fragment were subjected to preparation procedures to construct a recombinant vector (Example 13, Figure 9). or (iii) using a "annealed" synthetic linker, the fragment was ligated with a fragment prepared from a trp promoter-containing pOYI plasmid (Example 14 and Figure 10).

(B) -VSE linear recombinant vector.

In the same manner as described above, three recombinant vectors were constructed using the plasmid pBRV2 (Example 10) as shown in Example 19 and FIG.

11, 12 and 13.

I DK 175336 B1 I

I 20 I

I (6) Preparation of E. coli transformants and culture I

I and expression thereof. IN

Using three recombinant vectors of I

In each of the + VSE and -VSE lines, coli I was transformed

In strain 5 DH1, N4830 or JM105 by calcium chloride or I

In the rubidium chloride method described in Molecular Cloning, I

In ibid, (Examples 12, 13, 14 and 19). Each of the obtained I

In the transformants were grown in ampicillin-containing Luria-I

In medium, then induction was performed as required for I

In 10 obtaining expression (Examples 15 and 20). IN

I (7) Extraction and purification of co-I G-CSF polypeptide

In li and amino acid analysis thereof. IN

I A culture solution of the transformants was one-

In trifugate to obtain a cell pill. They collected I

In 15 cells were treated with a lysozyme, and after lysis at I

In a cycle of freezing and thawing, the supernatant was dissolved

In total. Alternatively, the cells were treated with guanidi-I

In nium chloride and centrifuged and the supernatant was dissolved

In total. IN

In the supernatant, gel filtration was subjected to I

In an Ultrogel ACA54 column (LKB) and the active fractions I

I was concentrated by an ultrafiltration apparatus

In ratur. IN

Next, an aqueous solution of tri-I was added

25 fluoroacetic acid containing n-propanol to concentrate

After thawing and after standing in ice, the mixture was centrifuged

In right and adsorbed on a reverse phase C18 column. After I

In elution, the fractions were examined for their activity

In tet. The active fractions were collected and subjected to I

In the same purification procedures as described above. The pure I

In late fractions, the lyophilized was dried and the powder was dissolved

In loose and exposed to KPLC based on mo leky Istørre Ise. The I

In polypeptides obtained, SDS-polyacrylamide-I was submitted

In gel electrophoresis, and a single band for the desired G-I

35 CSF polypeptide was confirmed (Examples 16 and 20). The ten

In polypeptide thus obtained, human G-CSF activity I exhibited

21 DK 175336 B1 (Examples 17 and 20). The G-CSF polypeptide was analyzed by an amino acid analysis method with a Hitachi 835 automatic amino acid analyzer (Hitachi, Ltd.) · For analysis of the n-terminal amino acid, a gas phase sequencing apparatus (for Edman degradation), HPLC apparatus was used and Ultrasphere ODS column (Examples 18 and 21).

(8) Construction of animal cell recombinant vectors.

Recombinant vectors (obtained from PBV) for use with 0127 and NIH3T3 cells as host cells were constructed for each of the + VSE and -VSE line cDNA molecules and the chromosomal gene. Recombinant vectors (with dhfr) for use with CHO cells were also constructed for each of the + VSE and -VSE line cDNA molecules and 15 for the chromosomal gene. Recombinant vectors for use with COS cells were also constructed. Representative examples are described below, and for further details reference is made to the relevant exemplary embodiments.

(A) Construction of recombinant vectors of the + VSE line.

The cDNA - (+ VSE) fragment obtained in (3) was inserted into a vector, pdKCR, to produce plasmid 25 pHGA410 (Example 22 and Figure 14), which was partially digested with EcoRI and then treated with DNA polymerase. see I (Klenow fragment) to form ends without binding ability. A linker HindIII was attached to the DNA, which was then treated with HindIII and T4 DNA ligase. The treated DNA was used to transform coli strain DH1 by the rubidium chloride method (see Molecular Cloning, ibid.). The resulting plasmid was named pHGA410 (H) (Fig. 15).

The pHGA410 (H) 'was treated with SalI and after formation of ends without binding ability it was treated with HindIII again and a HindIII-SalI

I DK 175336 B1 I

I 22 I

In fragment was recovered. The plasmid pdBFV-1 with a trans-I

In propagated fragment of bovine papilloma virus was treated I

I with HindIII and PvuII, and the largest DNA fragment became I

You separated and bound together with the separately manufactured I

In 5 HindIII-SalI fragments. The linked fragments became I

I used to transform E. coli strain DH1 into op-I

In reaching the plasmid pTN-64, which had the pHGA410 off-I

In led CSF cDNA (Fig. 15 and Example 23). IN

Each of the plasmids, pHGA410 or pHGA410 (H) I

I 10 in combination with the plasmid pAdD26SVpA was used for I

In constructing pHGG4-dhfr, which was a recombinant tumor

I tor (+ VSE) for use with CHO cells (Figs. 16a and b I

and Example 25). IN

I A 2 kb DNA fragment and containing dhfr-I

The I gene was recovered from pAdD26SVpA by treatment with I

In EcoRI and BamHI, and the recovered fragment was inserted into I

In pHGA410 (H) at the HndIII site to produce I

In pG4DR1 and pG4DR2 (Fig. 16c and Example 25). IN

In 20 (B) Construction of -VSE-1 linear recombinant vectors. IN

In the cDNA - (- VSE) fragment obtained in (3), I was inserted

I in the vector pdKCR to generate the plasmid pHGV2 (Example I

column 28), which was partially digested with EcoRI and the like

I nearly treated with DNA polymerase I (Klenow fragment) I

to form ends without binding ability. A linen I

In fact, HindIII was attached to the DNA, which then became I

I treated with HindIII and T4 DNA ligase. It dealt with you

In DNA was used for transformation of E. coli strain I

In 30 DH1 by the rubidium chloride method (see Molecular Cloning, I

ibid.). The resulting plasmid was named pHGV2 (H) I

I (Fig. 18). IN

In pHGV2 (H) was treated with SalI, and after dan

In the making of ends without binding ability it was used

I traded with Hindlll once more, and a Hindlll-Salall

In fragments were collected. The plasmid pdBPV-1 with a trans-I

B1 propagated fragment of bovine papillomavirus was treated with HindIII and PvuII, and the major DNA fragment was separated and bound to the separately prepared HindIII-SalI fragment. The linked fragments were used to transform coli strain DH1 to obtain the plasmid pTN-V2, which had the pHGV2-derived CSF cDNA (Fig. 18 and Example 29).

In similar procedures, either plasmid pHGV2 or pHGV2 (H) in combination with plasmid 10 pAdD26SVpA was used to construct pHGV2-dhfr, which was a recombinant vector (-VSE) for use in CHO cells (Fig. 19a and b and Example 31).

A DNA fragment of ca. 2 kb containing the dhfr gene was recovered from pAdD26SVpA by treatment with 15 EcoRl and BamHI, and the recovered fragment was inserted into pHGV2 (H) at the HindIII site to construct pV2DR1 and pV2DR2 (Fig. 19c and Example 31).

(C) Construction of recombinant vectors containing the chromosomal gene.

The plasmid ρΒΚ0Ε3β obtained in (4) containing the chromosomal gene shown in Figs. 5, was treated with EcoRl.

The 25 pSVH + K + plasmid described by Banerji et al. in

Cell, 27, 299 (1981) was treated with KpnI to remove the globin gene. Furthermore, the plasmid was subjected to partial digestion with HindIII to remove part of the SV40's late gene. The fragments were again bound together to produce the expression vector pML-E +.

This vector was treated with the restriction enzyme EcoRl and dephosphorylated with an alkaline phosphatase (Takara Shuzo Co., Ltd.) to obtain a vector DNA which was bound to the aforementioned chromosomal DNA fragment by a T4 DNA ligase. (Takara Shuzo Co., Ltd.) to obtain pMLCE3a, which was a recombinant

I DK 175336 B1 I

I 24 I

In nant vector for COS cells (Example 34). As shown in FIG. IN

I 20 This plasmid contained the enhancer of the SV40 gene, I

At the origin of replication of SV40, replication I

At the pinning site of pBR322 and the pBR322-derived / 5-layer α-I

In the 5 gene (Ampr) and had the human G-CSF chromosomal I

gene bound after the amplifier for the $ V40 gene. IN

In an expression vector for C127 cells, con I

structured by the following methods. A DNA fragment I

I containing the chromosomal CSF gene with a pass I

In 10 sending restriction enzyme excised from pMLCE3a which was I

In an expression vector for COS cells. This fragment I

You were bound to a DNA-I by means of a T4 DNA ligase

In fragment containing the site of origin of bovine papilla- I

In lomavirus (BPV) and a DNA fragment containing SV40's I

In 15 early promoter. The resulting pTNCE3a was an ex

In the expression vector that had a chromosomal CSF gene bundle I

that after the SV40's early promoter, and which contained an I

In the 65¾1 part of BPV. IN

The expression vector for CHO cells had two DNA-I

In 20 fragments bound together by a T4 DNA ligase. IN

In one fragment, it contained the chromosomal CSF gene and I

In SV401's early promoter, as for the expression vector I

I for C127 cells, and the second fragment contained an I

In pAdD26SVpA-derived dhfr gene. The resulting pD26SVCE3a I

At 25 was an expression vector that had the chromosomal I

In the CSF gene after the SV40 promoter and the dhfr gene after the I

In main late adenovirus promoter. IN

(9) Expression in animal cells. IN

Two representative examples are described in I

In the following, while further details are seen by the relevant I

In embodiments. IN

B1 (A) Expression in mouse C127 cells.

Plasmid pTN-G4 or pTN-V2 was treated with BamHI. The treated plasmid was used for transformation of C127 cells (previously prepared by culture) by the calcium phosphate method. The transformed cells were cultured and high CSF formation rate clones were selected. Glycoproteins containing the expressed G-CSF were collected and purified from the culture solution of the transformed cells and found to have human G-CSF activity. The presence of the desired glycoprotein was also confirmed by amino acid analysis and analysis of the sugar content of the sample.

For analysis of sugar content, the CSF sample used in the amino acid analysis was subjected to determination of amino sugar by the Elson-Margan method, determination of neutral sugar by the orcinol sulfate method, or determination of sialic acid by the thiobarbiturate method. The procedures for each of the assays are shown in "Tohshitsu no 20 Kagaku Chemistry of Saccharides" (Part 2 of Two Parts) ", Chapter 13, Vol. 4 of" A Course in Biochemical Experiments "published by Tokyo Kagaku Dojin. Converting the measured values to weight percent showed that the sugar content of the G-CSF obtained was in the range of 1 to 20% by weight * depending on the type of host cells, expression vectors and the culture conditions.

(B) Expression in COS cells.

30 COS cells obtained from monkey CV-1 cells transformed with an SV40 on-site effector mutant to express the large T-antigen of SV40 [see Gluzman et al. Cell. 32, 175 (1981)], was transformed with the vector pMLCE3a obtained in 35 (5) (C) and containing the human chromosomal

G-CSF gene. The supernatant of the culture of COS cells expands

human G-CSF effect (Example 35). IN

The COS cells were collected and subjected to mRNA-I

assay showing the presence of two mRNA molecules that I

5 corresponded to the amino acid sequences depicted in I, respectively

In FIG. 3A and 4A. IN

In Examples I

Prior to the present invention, more are described

10 in detail with reference to embodiments are given

the following reference example for illumination of forward I

In the procedures for testing the CSF effect. IN

In Reference Example I

I 15 CSF effect testing. IN

The following methods were used for the treatment

tuning of the CSF effect (hereafter abbreviated CSA) in I

in connection with the present invention. IN

In CSA tests. IN

(A) With human bone marrow cells: I

Single layer soft agar culture was performed

In the method of Bradley, T.R. and Metcalf, D. I

I (Aust. J. Exp. Biol. Med. Sci., 44, 287-300, 1966). IN

More specifically, 0.2 ml of bovine fetal serum became 0.1 ml of I

25 of the sample, 0.1 ml of a suspension of human non-adherence

In pure bone marrow cells (1-2 x 10 5 cells with nucleus), 0.2 L

In ml modified McCoy's 5A culture solution and 0.4 ml mo-I

In modified McCoy's 5A culture solution containing 0.75¾ I

In agar mixed, poured into a plastic dish for growing I

In 30 (35 mm diameter), coagulated and grown at 37 ° C for 5¾ I

In CO2 / 95% air and at 100¾ humidity. Ten days later you became

In the number of colonies formed (one colony consists of I

(At least 50 cells) and CSA was determined with a unit such as I

In the activity required to form a colony. IN

27 DK 175336 B1 (b) With mouse bone marrow cells: 0.4 ml of horse serum, 0.1 ml of the sample, 0.1 ml of a suspension of female C3H / He mouse bone marrow cells (0.5-1 x 10 6 cells with nucleus) and 0.4 ml of modified 5 McCoy's 5A culture solution containing 0.75¾ agar was mixed, poured into a 35 mm diameter tissue culture dish, coagulated and cultured for 5 days at 37 ° C in 5¾002 / 95¾ air and at 100¾1s humidity. The number of colonies formed was counted (a colony consisted of at least 50-10 cells) and CSA was determined with a unit as the activity to form a colony.

The modified McCoy's 5A culture solution used in each of methods (a) and (b) and the suspension of human non-adherent bone marrow cells used in (a) were prepared by the following methods. Modified McCoy's 5A culture solution (dual concentration).

12 g of McCoy's 5A culture solution (Gibco), 2.55 g of MEM amino acid vitamin medium (Nissui Seiyaku Co., Ldt.), 20 2.18 g of sodium bicarbonate and 50,000 potassium penicillin G units were dissolved twice in 500 ml of distilled water. , and the solution was filtered aseptically through a Millipore filter (0.22 μιη).

Suspension of non-adherent human bone marrow cells.

A bone marrow fluid obtained from a healthy person at sternal puncture was diluted five times with a RPMI 1640 culture solution, grown on plates over a Ficoll-Paque solution (Fharmacia Fine Chemicals) and centrifuged at 400 x g for 30 minutes at 25 ° C. The cell layer at the interface (specific density <1.077) was collected. The cells were washed, adjusted to a concentration of 5 x 10 6 cells / ml with a RPMI 1640 culture solution containing 20¾ bovine fetal serum, poured into a 25 cm 2 tissue culture flask and incubated for 30 minutes in a CO 2 incubator. Non-adherent cells were collected in supernatant one, poured into a plastic flask (25 cm 2) and incubated for 2 hours. Non-adherent cells in the supernatant were collected and used for testing.

EXAMPLE 1 Providing CHO 2.

A tumor from a patient with oral cancer, in which a marked increase in the number of neutrophils was observed, was transplanted into nu / nu mice. Ten days after the transplant, the increase in tumor weight 10 and the number of neutrophils was pronounced. Twelve days after the transplant, the tumor was removed aseptically, cut into cubes of 1-2 mm3 and cultured as follows.

Ten to fifteen cubes of the tumor were placed in a 50 ml plastic centrifuge tube. After adding 5 ml of trypsin solution (containing 0.25% trypsin and 0.02% EDTA), the tube was shaken for 10 minutes in a 37 ° C hot bath and the supernatant removed. An additional 5 ml of the same trypsin solution was added and trypsin infusion was carried out with stirring for 15 minutes at 37 ° C.

The supernatant cell suspension was collected and stored in ice after the trypsin was inactivated by the addition of 1 ml of bovine fetal serum.

After repeating these procedures, the cell suspension was collected, poured with the previously obtained suspension and centrifuged at 15,000 rpm. per minute for 10 minutes to obtain a cell pill. The pill was washed twice with F-10, containing the 10% bovine fetal serum, and then loaded into a plastic culture flask (25 cm 2) to obtain a cell concentration of 5 x 10 6 cells / flask. After overnight incubation in a CO 2 incubator (5% CO 2 and 100% humidity) with an F-10 culture solution containing 10% bovine fetal serum, the supernatant was removed together with non-adherent cells. and the culture was continued in 35 with fresh culture solution. Six days after the start of cultivation, the bottle was full of cells and the culture solution was replaced with a fresh one. The next day, the culture solution was removed and 2 ml of anti-mouse erythrocyte antibody (Cappel) diluted 5 times with RPMI 1640 and 2 ml of guinea pig complement (Kyokuto Seiyaku Co., 5 Ltd.) diluted 2.5 times with RPMI 1640 was filled into the flask. After incubation for 20 min at 37 ° C, the culture was washed 2 times with F-10 containing 10¾ bovine fetal serum and the fibroblasts obtained from the nu / nu mice were removed. Next, an F-10 10 culture solution containing 10¾ bovine fetal serum was added and culture continued for an additional 2 days. Then, some of the cells were collected and subjected to cloning by the boundary dilution method.

The resulting 11 clones were tested for their CSF activity, and 1 clone (CHU-2) exhibited an activity that was approx. 10 times higher than the activity of the other clones.

Example 2 20

Isolation of CSF.

The cells provided in Example 1 were grown in a completely dense population in two culture flasks (150 25 cm 2). Cells were collected, suspended in 500 ml of a F-10 culture solution containing 10¾ bovine # feotal serum, transferred to a 1580 cm 2 glass roll bottle (Bel-co), and grown under five-speed rolling. minute (rpm). When cells were found to have grown in a completely dense population on the inside of the roller bottle, the culture solution was replaced with a serum-free RPMI 1640. After 4 days of culture, the culture supernatant was collected and culture continued with the addition of F-10 containing 10¾ bovine fetal serum. . After 35 days of culture, the culture solution was again replaced with serum-free RPMI 1640 and the supernatant of the culture was I DK 175336 B1 30

H collected 4 days later. By repeating these processes I

Duration, 500 ml of the serum-free supernatant of culture was obtained. bottle every week. In addition, this method allowed collection of the supernatant of the culture without preserving the cells for a substantially prolonged period.

A portion of 5000 ml of the obtained supernatant of the culture was mixed with 0.01% Tween 20 and concentrated ca. 1000 times by ultrafiltration with 10 hollow fiber DC-4 and Amicon PM-10 (Amicon). The concentrate was purified by the following steps.

(i) A 5 ml aliquot of the concentrated supernatant of the culture was subjected to gel filtration on a

Ultragel AcA54 column (4.6 cm diameter x 90 cm length; 15 LKB) at a flow rate of approx. 50 ml / hour with

0.01 M Tris-HCl buffer (pH 7.4) containing 0.15 M

NaCl and 0.01% Tween 20 (Nakai Kagaku Co., Ltd.). The column was calibrated with bovine serum albumin

H 67,000), ovoal albumin (molecular weight 45,000) and cytochrome C

20 (molecular weight 12,400). After completion of the gel filtration, 0.1 ml of each of the fractions was diluted 10 times H and screened for the active fractions by the above-described CSA test (b). The fractions for Ve = 400-700 ml were found to exhibit macrophage-dominant CSA, while the fractions for Ve-800-1200 exhibited granulocyte-dominant CSA. Therefore, the latter fractions were collected and concentrated to a volume of ca. 5 ml on an ultrafiltration apparatus with PM-10 (Amico).

In (il) To the concentrated fractions was added an aqueous

30 solution of 0.1% trifluoroacetic acid containing 30% I

n-propanol (to determine the amino acid sequence; available from Tokyo Kasei K.K.). After leaving the mixture in ice for approx. For 15 minutes, the precipitate was removed by centrifugation for 10 minutes at 15,000 rpm.

In the supernatant was adsorbed to a μ-Bondapak C18 column (8 mm x 30 cm for semi-preparat ion); 31 DK 175336 B1

Waters) equilibrated with an aqueous solution Containing n-propanol and trifluoroacetic acid. The column was eluted continuously with an aqueous solution of 0.1¾ trifluoroacetic acid containing n-propanol with a linear concentration concentration gradient from 30-60 °. An HPLC apparatus,

Hitachi Model 685-50 (Hatachi, Ltd.), and a detector,

Hitachi Model 638-41 (Hitachi, Ltd.) was used to simultaneously determine the absorbances at 220 nm and 280 nm. After elution, 10 μΐ of each of the fractions 10 was diluted 100-fold and screened for the active fractions by the above-described CSA test (b). The peaks, eluted with 40¾ n-propanol, were found to have CSA activity, which is why they were collected, again chromatographed under the same conditions, and tested for CSA by the same procedure. Again, CSA activity was observed in the peaks at 40¾ n-propanol. Therefore, these peaks were collected (4 fractions »4 ml) and lyophilized.

(iii) The freeze-dried powder was dissolved in 200 μΐ of an aqueous solution of 0.1¾ trifluoroacetic acid containing 40¾ n-propanol and subjected to HPLC on TSK-G 3000SW column (Tokyo Soda Manufacturing Co., Ltd.). ; 7.5 mm x 60 cm). The elution was carried out red the same aqueous solution at a low flow rate of 0.4 ml / min and the fractions were taken in 0.4 ml portions with a fraction collector, FRAC-100 (Pharmacia Pine Chemicals). Each of the collected fractions was examined for its CSA by the same procedure as described above and the activity was observed in the fractions with retention times of 37-38 minutes (corresponding to a molar weight of about 2 x 10 4). The active fractions were collected and purified on an analytical μ-Bondapak C18 column (4.6 mm x 30 cm). The main peaks were collected and lyophilized. The obtained sample was tested by the CSA test method (a). It was found to have human G-CSF-35 activity.

I DK 175336 B1 I

I 32 I

In Example 3 I

In Amino acid sequence determination. IN

I 5 (i) Determination of N-terminal amino acid sequence. IN

In the sample, Edman was subject to degradation by I

With the aid of a gas phase sequencing apparatus

I (Applied Biosystems), and the resulting PTH amino acid I

I 10 was analyzed by routine methods using an HPLC-I

In Apparatus (Beckman Instruments) and Ultrasphere-ODS Co-I

In Lonne (Beckman Instruments). Columns (5 mm; 4.6 mm dia- I)

In meters x 250 mm length) was equilibrated with a starting buffer

In fer aqueous solution containing 15 mM sodium acetate-I

In 15 buffer (pH 4.5) and 40 * acetonitrile] and the sample was collected

In the syringe (dissolved in 20 μΐ of the starting buffer). The separation I

You were performed after isocratic elution with the starting buffer. IN

H The flow rate was 1.4 ml / min and column temperature I

the trip was maintained at 40 ° C. The detection of the PTH amino acid I

20 was obtained by the absorptions in the UV range at I

At 269 nm and 320 nm. Standard samples of PTH amino acid (Sig-I

ma) in 2 nmol portions were separated on the same appa- I

rature for determining their retention times, which became I

compared to the retention times of the sample which should- I

25 le are tested. As a result, the sample was found to have I

In the following amino acid sequence for the 40 residues from N-I

terminuses: I

I h0N - Thr - Pro - Leu - Gly - Pro - Ala - Ser - Ser - I

I 2 (10). IN

30 Leu - Pro - Gin - Ser - Phe - Leu - Leu - Lys - Cys - I

(20)

Leu - Glu - Gin - Val - Arg - Lys - Ile - Gin - Gly - I

I (30)

Asp - Gly - Ala - Ala - Leu - Gin - Glu - Lys - Leu - I

(40)

I Cys - Ala - Thr - Tyr - Light - I

I 35 I

33 DK 175336 B1 (li) Decomposition with bromocyan.

The sample was dissolved in 70¾ formic acid. To the solution were added 200 equivalents of bromocyanine which had been purified by sublimation. The mixture was allowed to stand overnight at 37 ° C for reaction. The reaction product was freeze-dried and fractionated by HPLC on a TSK G3000SW column (Tokyo Soda Manufacturing Co., Ltd.) to obtain four peaks. The peaks were named CN-1, CN-2, CN-3 and CN-4 in order of decreasing molecular weight 10. The first two peaks (CN-1 and CN-2) had the greatest yields, and their amino acid sequences were analyzed by an automatic gas phase sequencing apparatus (Applied Biosystems} under the same conditions as used in (i).

As a result, CN-1 was found to be a peptide from the N-terminus of the G-CSF protein, and CN-2 had the following amino acid sequence:

Pro - Al $ · - Phe - Ala - Ser - Ala - Phe -Gin - Arg “Arg - Ala - Gly - Gly - Val -20 Leu _ vai - Ala - Ser - His - Leu - Gin - 1

Decomposition with trypsin.

The sample was dissolved in 0.1 M Tris-HCl buffer (pH

7.4 containing 8 M urea, and the solution was mixed with 0.1 M Tris-HCl buffer (pH 7.4) containing 0.1¾ 2-mercaptoethanol to give a 2-muturea concentration of T treated trypsin (Sigma) was added so that the sample enzyme ratio was 50: 1. The mixture was kept for 4 hours at 25 ° C and after addition 30 of an equal amount of TPCK treated trypsin was kept for an additional 16 hours at 25 ° C. Then, the reaction product was subjected to high-speed reverse phase column chromatography on C8 column (Yamamura Kagaku K.K.), eluting with 0.1 0 TFA containing 35 n-propanol with a linear density gradient of 5-60 °.

Since several peaks were obtained by measuring the absorbance at 280 nm, the main peak was analyzed for its amino acid sequence by an automatic gas phase sequencing apparatus (Applied Biosystems) under the same conditions as used in (in). As a result, the major peak turned out to be a peptide having the following sequence containing a portion of the CN-2 fragment shown in (ii): I Gin - Leu - Asp - Val - Ala - Asp - Pbe - Ala - Thr -

Thr - Ile - Trp - Gin - Gin - Met - Glu - Glu - Lea - I 1 ° Gly - Met - Ala - Pro - Ala - Leu - Gin - Pro - Thr - I Gin - Gly - Ala - Met - Pro - Ala - Phe - Ala - Ser - In Example 4 I 15

Preparation of DNA Probe.

(i) Probe Synthesis (IWQ).

Thirty successive nucleotides (see Fig. 1) were prepared based on the sequence of 10 mino acids (Ile-I Trp-Gln-Gln-Met-Glu-Glu-Leu-Gly-Met) contained in the amino acid sequence obtained in Example 3 (iii). It will be necessary to provide a comment on the write-up of the nucleotides shown in FIG. 1. The nucleotide 9 positions from the 5 'terminus are e.g. an equimolar mixture of dA and d6.

The starting nucleotides were mostly dimeric, but the mononucleotides were also used when required. 20 mg off.

In the starting nucleotide resin, Ap-d (G) (Yamasa Shoyu Co.,

Ltd.) was added to a column fitted with a glass filter. After repeated washing with methylene chloride, the 4.4 * dimethoxytrityl group was eliminated by treating with a solution of methylene chloride containing 3% trichloroacetic acid. Next, the column was washed several times with 1 ml of methylene chloride. After the column was washed with anhydrous pyridine to evaporate the solvent, 20 mg of a nucleotide dimer, (Nippon Zeon; NHR3 = triethylammonium; DMTr = dimethoxytrityl) and 0 mg were added. , 2 ml of pyridine, and the interior of the column were vacuum dried by means of a vacuum pump.

Next, 20 mg of 2,4,6-trimethylbenzenesulfonyl-5 3-nitrotriazolid (MSNT from Wako Pure Chemical Industries, Ltd.) and 0.2 ml of anhydrous pyridine were added and the contents of the column were driven out by nitrogen gas. The nucleotide resin was condensed with the dimer by reaction for 45 minutes at room temperature with occasional shaking. After completion of the reaction, the column was washed with pyridine and the unreacted OH groups were acetylated with a pyridine solution containing excess acetic anhydride and 4-dimethylaminopyridine. After washing the column with pyridine, the following dimers or monomers were condensed in the order indicated by repeating the procedures described above: (DMTr) lp (NHR3), (DMTr) GpGp (NHR3), {DMTr) lp (NHR3 ), an equimolar mixture of (DMTr) CpTp (NHR3) and (DMTr) TpTp- (NHR3), an equimolar mixture of (DMTr) ApAp (NHR3) and (DMTr) ApGp (NHR3), an equimolar mixture of (DMTr) ApGp- (NHR3) and (DMTr) GpGp (NHR3), (DMTr) GpAp (NHR3), (DMTr) -TpGp (NHR3), an equimolar mixture of (DMTr) ApAp (NHR3) and (DMTr) GpAp (NHR3), (DMTr) CpAp (NHR3), an equimolar mixture of (DMTr) ApAp (NHR3) and (DMTr) ApGp (NHR3), (DMTr) GpCp (NHR3), (DMTr) TpGp (NHR3), ( DMTr) lp (NHR3) and (DMTR) ApTp (NHR3), all of these nucleotides being available from Nippon Zeon, except (DMTr) lp (NHR3) available from Yamasa Shoyo Co., Ltd. After completion of the reaction in the final step, the resin was washed successively with pyridine, methylene chloride and ether without acetylation and then dried. The dried resin was suspended in 1.7 ml of a mixture of 0.5 ml of pyridine, 0.2 ml of water and 1 ml of dioxane containing 1 M tetramethylguanidine and 1 M o-picolinaldoxim. The suspension was allowed to stand overnight at room temperature and concentrated to 100 - 200 μΐ under vacuum. The concentrate was mixed with I DK 175336 B1 I 36

In a small amount (2-3 drops) of pyrldine and 2-3 ml of concentrated I

In the aqueous ammonia and the mixture was heated to 1

At 55 ° C for 6 hours. After extraction with ethyl acetate, I

the aqueous phase separated and concentrated under vacuum. IN

I The concentrate was dissolved in a solution of 50 mM tri-I

In ethyl ammonium acetate (pH 7.0) and the solution was sub-I

In cast chromatography on C-18 column (1.0 x 15 cm; Wa-I

While eluting with acetonitrile (linear I

In a density gradient of 10-30%) in a solution of 50 mM I

In triethylammonium acetate (pH 7.0). The peak fraction eluted I

I at an acetonitrile concentration of approx. 25% were concen- I

under vacuum. IN

To the concentrate was added 80% acetic acid and I

let the mixture stand for 30 minutes at room temperature. IN

H 15 After extraction with ethyl acetate, the aqueous fa

see separated and concentrated under vacuum. It resulted

The purified concentrate was further purified by HPLC on I

C-18 column (from Senshu Kagaku K.K .; SSC-0DS-272, 6 mm I

In diameter x 200 mm). The elution was performed with acetonitrile I

In 20 (10-20% linear density gradient) in a solution of 50 I

mM triethylammonium acetate (pH 7.0). Synthetic DNA obtain- I

You are in a yield of at least 10A26o ~ enhe <* are you

In Analysis by Maxam-Gilbert Sequence Determination

In the second [Meth. Enzym., 65, 499 (1980)] showed that

By 25 oligonucleotide reached had the nucleotide sequence shown in I

In FIG. 1. I

In (ii) Synthesis of Probe (A). IN

In fourteen successive nucleotides (see Fig. 1), I

obtained on the basis of the sequence of 5 amino acids (Met-Pro-I

In 30 Ala-Phe-Ala) contained in the amino acid sequence obtained in Eq

In Sample 3 (iii). IN

In the synthesis methods, similar to the methods used in I

In the preparation of probe (IWQ), and the following nucleotides I

I was condensed into the nucleotide resin, Ap-d (T) (Yama-I

35 sa Shoyu Co., Ltd.) in the order indicated: I

I (DMTr) CpAp (NHRg), (DMTr) GpGp (NHR3), an equimolar intermediate

In the thing of you

(DKR) CpAp (NHR3), (DMTr) GpGp (NHR3), an equimolar mixture of _ (DMTc) CpAp (NHRj), (DMTr) CpTp (NHR3), (DMTr) CpGp (NHRj) and (DMTr) CpCp (NHR3) / an equimolar mixture of (DMTr) ApGpiNHR ^), δ (DMTr) TpGp (NHR3), (DMTr) .GpGp (NHRj) and (DMTr) CpGp (NHR3), (DMTr) ApAp ( NHRj), an α-virolr mixture of "(DMTr) CpAp (NHR3) <50 (DMTr> CpGp (NHR3), and (DMTr) Gp (NHR3),".

since all the nucleotides could be obtained from Nippon Zeon. A synthetic DNA was obtained in a yield of ca. 10A26o "Enhe-there. Analysis by the Maxam-Gilbert sequence determination method showed that the oligonucleotide obtained had the nucleotide sequence shown in FIG. First

(iii) Synthesis of Probe (LC).

Automatic DNA synthesis was performed using a DNA synthesis apparatus, Model 380A from Applied Biosystems.

This technique, based on the principles described by Caruthers et al. [J. Am. Chem. Soc., 103. 3185 (1981)] is generally referred to as the phosphoramidite method.

A phosphoramidite form of (DMTr) -dT previously activated with tetrazole was condensed to dG-S (S: carrier), wherein blocking groups were removed from the 51-dimethoxytrityl group (DMTr). Then, the 25 unreacted hydroxyl groups were acetylated and oxidized with iodine in the presence of water to form a phosphoryl group. After removal of blocking groups from the DMTr group, condensation was repeated in the same manner until 24 nucleotides of the sequence shown in FIG. 1 was 30 synthesized. These nucleotides were cleaved from the support, blocking groups were removed and purified by reverse phase HPLC on C-18 column (Senshu Kagaku Co.,

Ltd .; SSC-ODS-272).

35 I DK 175336 B1

I 38 I

Example 5 I

In Cultivation of CHU-2 Cells and Production of mRNA. IN

51) Culture and collection of CHU-2 cells. IN

In CHU-2 cells provided were grown in a full I

constant tat population in two culture flasks (150 cm 2),

overall, suspended in 500 ml of a RPMI 1640 culture medium

solution containing 10¾ bovine, fetal serum, supernatant

10 led to a glass roll bottle of ~ 1580 cm 2 (Belco) and animal I

during rolling at 0.5 rpm. per minute for 4 I

For days. When the cells were found to have grown into a

constant tat population on the inside of the roller bottle, I

the culture solution was removed from the roller bottle, wherein I

15 were filled with 100 ml of a preheated (37 ° C) physiological I

saline solution containing 0.02¾ EDTA. After heating I

to 37 ° C for 2 minutes, the cells were separated from the inner wall

gene of the bottle by pipetting. The resulting cell I

suspension was centrifuged at 1500 rpm.

20 minutes for 10 minutes to obtain a cell pill. Cell I

The clays were resuspended in 5 ml of an EDTA-free physiol

gical saline solution. The suspension was centrifuged at 1

At 1500 rpm. per minute for 10 minutes to obtain I

I of a cell pill (wet weight about 0.8 g). They thus obtain- I

25 cells were stored, frozen at -80 ° C until they I

You were subjected to the procedures for extraction of RNA. I 1

2) Purification of mRNA. IN

I Isolation of mRNA from the CHU-2 cells obtained in I

In paragraph 1, 1) was carried out by methods which were in it

Essentially the same as those described in "Mole- I

In Bullet Cloning ", Maniatis et al., Cold Spring Harpor, I

On page 196, 1982. The frozen CHD-2 cells (wet weight 3.8 g) I

was suspended in 20 ml of a solution of 6 M guanyl

35 din [6 M guanidinium isothiocyanate, 5 mM sodium citrate I

I (pH 7.0), 0.1 M β-mercaptoethanol and 0.5¾ sodium sarco-I

And the suspension was well mixed by vortex mixing for 2-3 minutes. The mixture was subjected to 10 cycles of suction and syringe with a single syringe (capacity 20 ml) equipped with 18G cannula.

5 Approx. 6 ml of the viscous guanidinium solution containing disintegrated cells was placed in a layer of eh 6 ml of 5.7 M CsCl buffer in 0.1 M EDTA (pH 7.5) in a Beckman SW40-Ti polyallomeric centrifuge tube in such a way , that the tube was filled with the contents. Four centrifuge tubes 10 were prepared by the above method and centrifuged at 30,000 rpm. 15 minutes at 20 ° C. The resulting pills were washed three times with a small amount of 70% ethanol.

The pellets obtained from the respective tubes were combined, dissolved in 550 μΐ water and worked up to provide a NaCl concentration of 0.2 M. After treatment with a 1: 1 mixture of phenol and chloroform and with chloroform alone, 2 were added. , 5 volumes of ethanol to precipitate the total RNA (approximately 10.1 mg of total RNA 20 was obtained from 3.8 g of wet cells).

Poly (A +) RNA was purified from total RNA by the following affinity chromatography methods utilizing the advantage of binding the poly (A) chain to the 3 'terminus of the mRNA. Adsorption on oligo (dT) cellulose (type 7 25 from PL Biochemicals) was obtained by passing the total RNA through an oligo (dT) cellulose column in a loading buffer [containing 10 mM Tris-HCl (pH 7.5) , 0.5 M NaCl, 1 mM EDTA and 0.1¾ SDS solution], after the solution had been heated to 65 ° C for 5 minutes. The cowl was equilibrated with the same loading buffer. Elution of poly (A +) RNA was performed with a TE solution [containing 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA]. The unabsorbed effluent was again filled through the column and the eluate obtained by repeating the same procedures was mixed with the first eluate obtained. As a result, 400 µg of the poly (A +) RNA was obtained.

I DK 175336 B1 I 40

The mRNA thus prepared was fractionated by size by sucrose density gradient centrifugation following the procedure described in the laboratory manual of Schleif and Wensink, "Practical Methods in Molecular Biology", Springer-Verlag, New York, Heidelberg, Berlin (1981).

More specifically, a 5-25% 1s sucrose density gradient was created in a Beckman SW40 Ti centrifuge tube. Two sucrose solutions were prepared by dissolving 5% 10 and 25% RNase-free sucrose (Schwarz / Mann) in a solution containing 0.1 M NaCl, 10 mM Tris-HCl (pH 7.5), in 1 mM DTA and 0.5% SDS.

In 800 mg of the mRNA [poly (A +) - RNA] prepared by the method already described, 1,200-1500 μΐ of a TE solution was dissolved. The solution was heated to 65 ° C for 5 minutes and after being cooled it was placed on sucrose density gradient solutions which were centrifuged at 30,000 rpm. per minute for 20 hours. Fractions, each of 0.5 ml, were collected and their absorption at 260 nm measured. The sizes of the fractionated RNA molecules were determined based on the positions of standard RNA molecules (ribosomal RNA molecules 28S, 18S and 5S). At the same time, the G-CSF activity of each fraction was examined with oenocytes from Xenopus laevis by the following methods.

First, the RNA from each fraction was worked up to a 1 aqueous solution at a concentration of 1 μg / μl, oocytes were taken from Xenopus (about 1 year old) and the mRNA solution injected in such a way that 50-ng I 30 mRNA was injected into one oocyte, ten such oocytes were placed in each of 96 wells in a microtiter plate, the oocytes were cultured for 48 h at room temperature in 100 μΐ I of a Barth medium [88 mM NaCl; 1 mM KCl; 2.4 mM NaHCO3;

I 0.82 mM MgSO 4; 0.33 mM Ca (NO 3) 2; 0.41 mM CaCl 2; 7.5 mM

Tris-HCl (pH 7.6); penicillin, 10 mg / L; and streptomycin I sulfate, 10 mg / L], after which the supernatant of the culture was collected, concentrated and purified to a quality suitable for testing G-CSP activity.

The G-CSF activity was found to be present in the 15-17 S fractions.

5

Example 6

Synthesis of cDNA (construction of pBR-line cDNA library.

Od from the poly (A +) RNA obtained in Example 5, cDNA was synthesized by the method of Land et al.

[Nucleic Acids Res., 9, 2251 (1981)], modified by the method of Gubier and Hoffman [Gene, 25, 263 (1983)].

1) Synthesis of single-stranded cDNA.

In an Eppendorf tube (1.5 ml capacity), the following reagents were charged in the order listed: 80 μΐ of a reaction buffer (500 mM KCl, 50 mM MgCl 2, 250 mM Tris-HCl, pH 8.3); 20 μΐ 200 mM dithiothreitol, 32 μΐ 12.5 mM 20 dNTP (containing 12.5 mM of each of dATP, dGTP, dCTP and dTTP), 10 μΐ α-32-P-dCTP (PB 10205 from Amerscham), 32 μΐ oligo (dT) ^ 2-18 (from PL Biochemicals; 500 μg / ml), 20 μΐ poly (A +) RNA (2.1 μg / μl), and 206 μΐ distilled water. A total of 400 μΐ of the reaction solution was heated 25 to 65 ° C for 5 minutes and then heated to 42 ° C for 5 minutes. To the heated solution were added 120 units of reverse transcriptase (Takara Shuzo Co., Ltd.).

After reacting for an additional 2 hours at 42 ° C, 2 μΐ of an RNase inhibitor (Bethesda Research Laboratory 30), 20 μΐ of a TE solution, 16 μΐ of 100 mM na triumpy phosphate and 48 units (4 μΐ) were added. of a reverse transcriptase and the reaction was carried out at 46 ° C for 2 hours. The reaction was quenched by the addition of 0.5 M EDTA (8 μΐ) and 10% SDS (8 μΐ). Upon subsequent treatment with Young phenol / chloroform and ethanol precipitation (2 times), a single stranded cDNA was obtained.

In DK 175336 B1

I I

I 2) Attachment of the dC chain to the single stranded cDNA. IN

H The single-stranded cDNA obtained in 1) became I

Dissolve in distilled water. To the solution was added 60 μΐ I

of a dC chain-adding buffer [400 mM potassium cacody-I

In 5 lat, 50 mM Tris-HCl (pH 6.9), 4 mM dithiothreitol, 1 mM I

CoCl2 and 1 mM dCTP], and the mixture was heated to 1

37 ° C for 5 minutes. To the reaction solution was added 3 μΐ I

I of a terminal transferase (27 units / μΐ; P-L Biochemi- I

In cals) and the mixture was heated to 37 ° C for 2.5 minutes

10 ter. After treatment with phenol / chloroform (1 time) and I

In precipitation with ethanol (2 times), the cDNA was dc-1

tail dissolved in 40 μΐ TE solution containing 100 ml I

In NaCl. IN

3) Synthesis of double-stranded cDNA. IN

To 40 μΐ of the DNA solution prepared in point I

2), 4 µΐ oligo (dG) 12-i8 (200 µg / ml; P-L Bioche-I) was added.

micals) and the mixture was first heated to 65 ° C for 5 L

For minutes and then to 42 ° C for 30 minutes. While react- I

The solution was kept at 0 ° C, 80 μΐ of I was added

In a buffer [100 mM Tris-HCl (pH 7.5), 20 mM MgCl 2, 50 mM I

I (NH 4) 2 SO 4 and 500 mM KCl], 4 μΐ 4 mM dNTP (containing I

4 mM of each of dATP, dCTP, dGTP and dTTP), 60 μΐ 1 mM β-I

In NAD, 210 μΐ distilled water, 20 μΐ of E. coli DNA-I

25 polymerase I (Takara Shuzo Co., Ltd.), 15 μΐ of E. coli I

DNA ligase (Takara Shuzo Co., Ltd.) and 15 μΐ of E. coli I

In RNase H (Takara Shuzo Co., Ltd.) and the mixture was un- I

In discarded turnover at 12 ° C for 1 hour. After addition I

I of 4 mM dNTP (4 μΐ), the reaction was carried out at 25 ° C in I

For 30 hours. Upon subsequent treatment with ethanol-chloro- I

In form and precipitation with ethanol (once), approx. 8 I

In μg double-stranded cDNA. This double-stranded cDNA I

You were dissolved in a TE solution and subjected to electrophoto-I

In trip in 1.2% agarose gel. The fragments corresponding to an I

35 size of approx. 560 bp to 2 kbp were adsorbed on I

Whatman DE81, and approx. 0.2 µ? of the double-stranded cDNA I

43 DK 175336 B1 could be collected by elution.

4) dC chain attachment to the double stranded cDNA.

The double-stranded cDNA prepared in 3) was dissolved in 40 μΐ of a TE solution. After adding 8 μΐ of a dC tail-adding buffer of the type indicated in 2), the mixture was heated to 37 ° C for 2 minutes. After addition of 1 μΐ of a terminal transferase (27 units / μΐ), the mixture was subjected to reaction at 37 ° C for 3 minutes. Then, the reaction solution was immediately cooled to 0 ° C and quenched by the addition of 1 μΐ 0.5 M EDTA. After treatment with phenol / chloroform and precipitation with ethanol, the obtained precipitate was suspended in 10 μΐ of a TE solution.

5) Construction of pBR-line cDNA library.

Four microliters of a commercial pBR322 vector with oligo (dG) tail (Bethesda Research Laboratories; 10 ng / μΐ) and 2 μΐ of the double-stranded dc tail cDNA obtained in 4) were annealed in a TE solution containing 20 75 μΐ 0.1 M NaCl. The annealing consisted of three steps: heating to 65 ° C for 5 minutes, then heating to 40 ° C for 2 hours, and then cooling to room temperature.

In accordance with the method described in the laboratory manual of Maniatis et al. [Molecular Cloning, Cold Spring Harbor, p 249 ff. (1982)] (other routine methods could also be used here), competent cells were prepared from E. coli strain X1776 and transformed with the annealed plasmid to obtain 30 transformants.

Example 7

Synthesis of cDNA (construction of Aphag library) 35 l) Synthesis of single-stranded cDNA.

In accordance with the procedures described in Example 5, 3.8 g of frozen CHU-2 cells were purified.

twice on an oligo (dT) cellulose column and then I

I worked up to obtain 400 poly (A +) RNA. IN

A TE solution (10 μΐ) containing 12 pg of poly (A +) I

In the RNA dissolved, placed in a reaction tube inside

In 5 containing 10 μg actinomycin D (Sigma). Then you were filled

the following reagents in the order indicated in the tube: 20 I

In μΐ of a reverse transcription buffer 1250 mM Tris-HCl

I (pH 8.3); 40 mM MgCl 2; 250 mM KCl]; 20 μΐ 5 mM dNTP

I (containing 5 mM of each of dATP, dGTP, dCTP and dTTP); IN

I 10 20 μΐ oligo (dT) 12-i8 <0.2 μg / ml; P-L Biochemicals); in μΐ

I 1 M dithiothreitol; 2 μΐ RNasin (30 units / μΐ; Promega I

In Biotech); 10 μΐ of a reverse transcriptase (10 units / μΐ; I

In Seikagaku Kogyo Co., Ltd.); 1 μΐ of α-32P ~ dATP (10 μΟΙ; I

Amerscham) and 16 μΐ water. The reaction solution which I

15 in total had a volume of 100 μΐ, were kept at 42 ° C 1 2

and the reaction was quenched by the addition of 0.5 L

In M EDTA (5 μΐ) and 20% SDS (1 μΐ). Upon subsequent

action with phenol / chloroform (100 μΐ) and precipitation I

with ethanol (twice), approx. 4 pg single strand I

In 20 cDNA.

2) Synthesis of double-stranded cDNA.

The cDNA obtained in 1) was dissolved in 29 μΐ of a TE-I solution and a reaction solution prepared by adding the following reagents in the indicated sequence.

According to: 25 μΐ of a polymerase buffer [400 mM Hepes (pH

I 7.6); 16 mM MgCl2, 63 mM β-mercaptoethanol, and 270 mM

In KCl], 10 μΐ 5 mM dNTP; 1.0 μΐ 15 mM β-NAD; 1.0 μΐ α-32- I P-dATP (10 μα / μΐ); 0.2 μΐ E. coli DNA ligase (60 units / 30 μg; Takara Shuzo Co., Ltd.); 5.0 μΐ E. coli DNA- I polymerase 1 (New England Biolabs; 10 units / μΐ); 0.1 I μΐ RNase H (60 units / μΐ; Takara Shuzo Co., Ltd.) and 28.7 μΐ distilled water.

The reaction solution was incubated at 14 ° C for 1 hour for 35 hours, allowed to rise to room temperature, and incubated for 1 M further. Next, the reaction was quenched by the addition of 0.5 M EDTA (5 μΐ} and 20% SOS (1 μΐ), and phenol / chloroform treatment and ethanol precipitation were performed. The obtained DNA was dissolved in 20 μΐ 0.5 mM EDTA and a reaction solution were prepared by the addition of 3 μΐ of a Klenow buffer [500 mM Tris-HCl (pH 8.0) and 50 mM MgCl₂], 3 μΐ 5 mM dNTP and 4 μΐ water.

After addition of 1 μΐ DNA polymerase (Klenow fragment; Takara Shuzo Co., Ltd.), the reaction solution was incubated at 30 ° C for 15 minutes.

10 The incubated reaction solution was diluted with 70 μΐ TE solution and the reaction was quenched by the addition of 0.5 M EDTA (5 μΐ) and 20% SDS (1 μΐ). After subsequent treatment with phenol / chloroform and precipitation with ethanol, approx. 8 µg of a double-stranded cDNA.

3) Methylation of double-stranded cDNA.

30 μΐ aqueous solution of the double-stranded cDNA synthesized in 2) was mixed with 40 μΐ of a meth-20 methylation buffer [500 mM Tris-HCl (pH 8.0), 50 mM EDTA], 20 μΐ of a SAM solution [800 μΜ S-adenosyl-L-methyl-methionine (SAM), 50 mM / 3-mercaptoethanol] and 100 μΐ water. To the mixture was added 15 μΐ of an EcoRI methylase (New England Biolabs, 20 units / μΐ) to prepare 25 a reaction solution with a total volume of 200 μΐ.

After incubation at 37 ° C for 2 hours, treatment with phenol and ether and precipitation with ethanol were carried out to recover the DNA.

4) Adding EcoRI links.

For approx. 1.2 µg of the methylated double-stranded DNA was added 1.5 µΐ of a ligase buffer [250 mM Tris-HCl (pH 7.5) and 100 mM MgCl₂], 0.5 µΐ of a pre-phosphorylated EcoRI linker (Iomer, Takara Shuzo Co., 35 Ltd.), 1.5 μΐ 10 mM ATP, 1.5 μΐ 100 mM dithiothreitol, and 2 μΐ H2 O to prepare a reaction mixture with a volume of 15 μΐ in total. After the addition of 0.7 μΐ T4 DNA ligase (3.4 units / μΐ, Takara Shuzo Co., Ltd.), the reaction was carried out overnight at 4 ° C. Then, the ligase was inactivated by heating to 65 ° C for 10 minutes. The reaction solution was worked up to a total

volume of 50 μΐ by addition of 100 mM Tris-HCl (pH

H 7.5), 5 mM MgCl 2, 50 mM NaCl and 100 μg / ml gelatin. After the addition of EcoRI (3.5 μΐ, 10 units / μΐ), the reaction is carried out at 37 ° C for 2 hours. Next, 10 2.5 μΐ 0.5 M EDTA and 0.5 μΐ 20% SDS were added, followed by phenol / chloroform treatment and ethanol precipitation to recover the DNA. Subsequently, unreacted EcoRI links were removed by gel filtration on Ultrogel AcA34 (LKB) or agarose gel electrophoresis, to obtain ca.

15 0.5-0.7 µg of the linker-added double-stranded cDNA.

5) Binding of double-stranded cDNA to Xgt10 vector.

The linker-added double-stranded cDNA was mixed with 2.4 µg of previously EcoRI-treated 20 Xgt10 vector (Vector Cloning system), 1.4 µΐ of a ligation buffer (250 mM Tris-HCl and 100 mM MgCl2) and 6.5 μΐ H distilled water and the mixture was heated to 42 ° C for five minutes. Then, 1 μΐ 10 mM ATP, 1 μΐ I 0.1 M dithiothreitol and 0.5 μΐ T4 DNA ligase were added to obtain a total volume of 15 μΐ and the reaction was carried out overnight at 12 ° C. .

6) In vitro packaging.

H Approx. one third of the recombinant DNA molecules I produced in 5) were packed using an in vitro I packing kit (Promega Biotech) to obtain phage plate I ques.

DK 175336 B1 47

Example 8

Screening of pBR line library with Probe (IWQ).

5 Whatman 541 paper was placed on a colonial agar medium and allowed to stand at 37 ° C for 2 hours. The Pilter paper was then processed by the following procedure according to Taub and Thompson (Anal. Biochem., 126, 222 (1982)).

The colonies transferred to the 541 paper were further grown on an agar medium containing chloramphenicol (250 μg / μl) overnight at 37 ° C.

The 541 paper was taken out and left at room temperature for 3 minutes on another filter paper impregnated with 0.5 N NaOH solution. This procedure was repeated twice. Two similar procedures were carried out for 3 minutes using a solution of 0.5 M Tris-HCl (pH 8). At 4 ° C, the treatments were carried out with a solution of 0.05 M Tris-HCl (pH 8) for 13 minutes and with 1.5 mg / ml of a lysozyme solution (containing 0.05 M Tris-HCl (pH 8) and 25¾ sucrose) for 10 minutes, after which treatments were performed at 37 ° C with a solution of 1 x SSC (0.15 M NaCl and 0.015 M sodium citrate) for 2 minutes, and with a 1 x SSC solution containing 200 µg / ml proteinase K for 30 minutes, and finally, room temperature treatments were performed with a 1 x SSC solution for 2 minutes and with 95¾ ethanol solution for 2 minutes. The final step was repeated twice. Then, the 541 paper was dried. The dried 541 paper was immersed in a 25: 24: 1 mixture of phenol / chloroform / isoamyl alcohol (equilibrated with 100 mM Tris-HCl (pH 8.5), 100 mM NaCl and 10 mM EDTA) for 30 minutes at room temperature. Next, similar procedures were repeated 3 times with a 5 x SSC solution for 3 minutes, and then twice with a 35 95¾ ethanol solution for 3 minutes. Next, the filter paper was dried.

In DK 175336 B1

I 48 I

The probe (IWQ) was labeled with 32P 1 in accordance with I

with routine methods (see Molecular Cloning), and colo- I

nihydridization was carried out in accordance with method I

the procedure of Wallace et al. (Nucleic Acids Res., 9, I

I 5 879 (1981)). Prehybridization was performed at 65 ° C for 4 hours

In more in a hybridization buffer containing 6 x NET (0.9 I

M NaCl; 0.09 M Tris-HCl (pH 7.5) and 6 mM ETA), 5 x Den-I

In hard solution, 0.1% SDS and 0.1 mg / ml denatured DNA I

(Calvethymus). Then, hybridization was performed overnight

10 above at 56 ° C in a hybridization buffer (see its compilation I)

phrase above) containing 1 x 106 cpm / ml of the I

radiolabelled probe (IWQ). After completion of reaction I

For example, the 541 paper was washed twice with a 6 x SSC solution I

I (containing 0.1% SDS) for 30 minutes at room temperature I

For 15 and then at 56 ° C for 1.5 minutes. It washed 541-pa- I

pir was subjected to autoradiography. IN

The plasmid was separated from positive clones and un-I

discarded Southern blotting with the probe (IWQ). IN

Hybridization and autoradiography were performed under I

20 the same conditions as described above. IN

In the same way, Southern blotting was performed with I

the probe (A). Using a hybridization buffer I

with the composition shown above, hybridization I was performed

first at 49 ° C for 1 hour. After standing at 39 ° C done- I

Furthermore, hybridization at this temperature at 1 L

hour. Upon completion of the reaction, a nitrocellulose

In loose filter washed twice with 6 x SSC containing 0.1% I

SDS for 30 minutes at room temperature and then at 39 ° C

13 minutes. The washed paper was subjected to automatic

In 30 radiography. IN

As a result, a single clone was found to

Be positive. Nucleotide Sequencing by Dideoxyme- I

The dead showed that this clone had a DNA of 308 L

In base pairs and containing the portions of both the probe (IWQ) and I of the probe (A). The pBR322-derived plasmid containing

In this insert was named pHCS-i. IN

DK 175336 B1 49

Example 9

Screening of APhag line library with DNA probe obtained from pHCS-1.

5

Plaque hybridization was performed according to the method of Benton and Davis (Science, 196, 180 (1977)).

The pHCS-1 obtained in Example 8 was treated with Sau3A and EcoRI to obtain a DNA fragment of ca. 600 bp.

This DNA fragment was radiolabelled by nick translation by routine methods. A nitrocellulose filter (S&S) was placed on a phage plague growth agar medium to transfer phages to the filter. After denaturing the phage DNA with 0.5 M NaOH, the filter paper was treated by the following methods: Treatment with 0.1 M NaOH and 1.5 M NaCl for 20 seconds, two treatments with 0.5 M Tris-HCl ( pH 7.5) and 1.5 M NaCl for 20 seconds, and final treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH 2 PO 4 and 1 mM EDTA (pH 7.2) for 20 seconds.

The filter paper was then dried and heated to 80 ° C for 2 hours to immobilize the DNA. Pre-hybridization was performed overnight at 42 ° C in a pre-hybridization buffer containing 5 x SSC, 5 x Denhardt's solution, 50 mM phosphate buffer, 50% formate, 0.25 mg / ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Then, hybridization was performed at 42 ° C for 20 hours in a hybridization buffer containing 4 x 10 5 cpm / ml pHCS-1 probe radiolabelled by nick translation. The hybridization buffer was a mixture of 5 x SSC, 5 x Denhardt's solution, 20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate and 0.1 mg / ml denatured DNA (salmon sperm). DNA).

The hybridized nitrocellulose filter was washed for 20 minutes with 2 x SSC containing 0.1% SDS at room temperature, and then for 30 minutes with 0.1 x SSC containing 0.1% SDS at 44 ° C and finally for 10 minutes. 175336 B1 I 50 with 0.1 x SSC at room temperature. Next, detection was performed by autoradiography.

As a result, 5 positive donors (GI - G5) were obtained. The clone containing a full-length cDNA 5 was examined for DNA nucleotide sequence by the dideoxymethod, and the nucleotide sequence shown in FIG. 3 (A) was identified. This cDNA was excised from the Agt10 vector and bound to pBR327 (Soberon et al., Gene, 9, 287 (1980)) at the EcoRI site to generate a large scale plasmid. This plasmid is called I pBRG4.

Example 10 Screening of Xphag line library with DNA probe obtained from pBRG4 and probe (LC).

Plaque hybridization was performed according to the procedure of Benton and Davis (see Science, ibid.) Used in Example 9. A nitrocellulose filter (S&S) was applied to the phage plague growth agar medium for transferring the phages to the filter. After denaturing the phage I DNA with 0.5 M NaOH, the filter was treated with them

following methods: Treatment with 0.1 M NaOH and 1.5 M

25 NaCl for 20 seconds, then two 0.5 M treatments

Tris-HCl (pH 7.5) and 1.5 H NaCl for 20 seconds and finally

treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM

In KH2PO4 and 1 mM EDTA (pH 7.2) for 20 seconds. The filter was then dried and heated to 80 ° C for 2 hours to immobilize the DNA. Two pieces of the same filter I were prepared in the same manner as described above and I subjected to screening using the DNA probe obtained from pBRG4 and the probe (LC).

Screening with the DNA probe obtained from pBRG4 was performed by the following method. The pBRG4 plasmid was treated with EcoRI to obtain a DNA fragment of ca.

51 DK 175336 B1 1500 bp. This DNA fragment was radiolabelled by nick translation by routine methods. One of the two nitrocellulose filters was subjected to prehybridization overnight at 42 ° C in a prehybridization buffer containing 5 x 5 x SSC, 5 x Denhardt's solution, 50 mM phosphate buffer, 50% formamide, 0.25 mg / ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Then, the filter was subjected to hybridization at 42 ° C for 20 hours in a hybridization buffer containing the radiolabeled DNA probe (about 1 x 10® 10 cpm / ml) at ca. 1500 bp. This hybridization buffer was a mixture of 5 x SSC, 5 x Denhardt's solution, 20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate, and 0.1 mg / ml denatured DNA (salmon sperm). DNA). The hybridized nitrocellulose filter was washed 15 for 20 minutes with 2 x SSC containing 0.1% SDS at room temperature, then for 30 minutes with 0.1 x SSC containing 0.1% SDS at 44 ° C and finally for 10 minutes with 0 ° C. 1 x SSC at room temperature. Next, detection was performed by autoradiography.

Screening with the probe (LC) was then performed by the following method. The second filter was pre-treated with 3 x SSC containing 0.1% SDS at 65 ° C for 2 hours. Next, prehybridization was performed at 65 ° C for 2 hours in a solution containing 6 x NET, 1 x Den-25 hard solution and 100 Mg / ml denatured DNA (salmon sperm DNA). Hybridization was then carried out overnight at 63 ° C in a hybridization buffer containing the radiolabeled probe (LC) (2 x 10 6 cpm / ml). This hybridization buffer was also a mixture of 6 x NET, 1 x 30 Denhardt's solution and 100 Mg / ml denatured DNA (salmon sperm DNA). The hybridized nitrocellulose filter was washed three times (for a duration of 20 minutes each) with 6 x SSC containing 0.1% SDS at room temperature, and then with 6 x SSC containing 0.1% SDS at 63 ° C for 2 35 minutes.

The filter was dried and detection was performed by autoradiography.

I DK 175336 B1 I 52

In the screening described above, clone I was selected

You are positive for both probes and the clone is

In full-length cDNA was examined for I

its nucleotide sequence by the dideoxy method. It turned out you

In having the nucleotide sequence shown in FIG. 4 (A). This cDNA I

You were cut out of the Agt10 vector and bound to pBR327 I

I at the EcoRI site to generate the plasmid pBRV2. IN

Example 11 I

I 10 I

In Screening of human, chromosomal gene library. IN

I 1) Construction of human chromosomal gene library. IN

I The human chromosomal gene library that I was

provided by the hospitality of Dr. Maniatis from I

H Harvard University was manufactured by the following media

In tods: The entire chromosomal DNA was extracted from I

human, fetal liver with phenol or other appropriate I

In 20 chemicals, and digested partially with restriction enzyme I

In the mares, Haelll and Alul. The resulting DNA fragments I

was treated by sucrose density gradient centrifuge I

to concentrate the fragments with chain lengths I

I in approx. 18-25 kb, and the concentrated fragments became I

I linked to the arm DNA of E. coli phag-X-Charon 4A, I

wherein short-chain synthetic nucleotides with excess I

sites for the restriction enzyme EcoRI were inserted, I

for the preparation of infectious phage DNA recombinants. IN

For the purpose of providing increased infectivity, I

For 30, more purified phage-A particles were formed in package I

I {'' packaging ') · The human gene library thus produced

In theory, theoretically it is considered a collection of re- I

In combination, containing human DNA molecules with chain I

In lengths of 18-25 kb, which contained practically all I

35 human genes. IN

53) 175) Screening of the human chromosomal gene library with the DNA probe obtained from pHCS-1.

Plaque hybridization was performed according to the method of Benton and Davis (Science, 196, 180 (1977)).

The pHCS-1 obtained in Example 8 was treated with Sau3A and BcoRI to obtain a DNA fragment of ca. 600 bp.

This DNA fragment was radiolabelled by nick translation by routine methods. A nitrocellulose filter (S&S) was placed on a phage plaque growth agar medium for transfer of phages to the filter. After denaturing the phage DNA with 0.5 M NaOH, the filter paper was treated by the following methods: Treatment with 0.1 M NaOH and 1.5 M NaCl for 20 seconds, two treatments with 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCl for 20 seconds, and final treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH 2 PO 4 and 1 mM EDTA (pH 7.2) for 20 seconds.

The filter paper was then dried and heated to 80 ° C for 2 hours to immobilize the DNA. Pre-hybridization was performed overnight at 42 ° C in a pre-20 hybridization buffer containing 5 x SSC, 5 x

Denhardt's solution, 50 mM phosphate buffer, 50% forma mid, 0.25 mg / ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Then, hybridization was performed at 42 ° C for 20 hours in a hybridization buffer containing 4 x 10 5 cpm / ml 25 pHCS-1 probe radiolabelled by nick translation. The hybridization buffer was a mixture of 5 x SSC, 5 x Denhardt's solution, 20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate and 0.1 mg / ml denatured DNA (salmon sperm DNA ).

The hybridized nitrocellulose filter was washed for 20 minutes with 2 x SSC containing 0.1% SDS at room temperature, and then for 30 minutes with 0.1 x SSC containing 0.1% SDS at 44 ° C and finally for 10 minutes with 0.1 x SSC at room temperature. Next, detection was performed by autoradiography.

As a result, about 10 positive clones were obtained. Recombinant DNA molecules were prepared from these clones by the method of Maniatis (Cell / 15, 687 (1978)). The obtained DNA molecules were treated with restriction enzymes such as Eco RI, Bam HI and

BglII and analyzed by agarose gel electrophoresis, and their restriction enzyme maps were prepared by the method of Fritsch et al. (see Cell, ibid.).

Southern hybridization was performed using the radiolabeled DNA fragment obtained from pHCS-1 as a probe, which was the same as that used for the screening methods described above. A DNA fragment of ca. 8 kbp excised with EcoRI was selected from the clones that hybridized with the probe.

This fragment was subcloned to the EcoRI site of pBR327. The subcloned DNA was subjected to another restriction enzyme treatment and Southern hybridization was performed repeatedly. A DNA fragment of ca.

4 kbp excised with Eco RI and Xho I was found to contain a gene encoding the human G-CSF polypeptide. This DNA fragment was examined for sequence 20 for its ca. 3-kbp moiety by the dideoxy method, and the nucleotide sequence shown in FIG. 5 were identified. This DNA fragment had the restriction enzyme crossover sites shown in FIG. 7th

Screening of human chromosomal genes was also performed using the DNA obtained from pBRG4 and the DNA obtained from pBRV2 as probes. In both cases I, a 1500 bp DNA fragment that had been treated with Eco RI was directly radiolabelled by "nick translation" by the method described above, or alternatively a DNA fragment of ca. 700 bp, which you obtained by successive treatments with EcoRI and Dral, I radiolabelled by "nick translation". The probes thus prepared were used in plaque hybridization performed under the same conditions as described above. Selected clones were analyzed by Southern hybridization to obtain a DNA fragment with the current sequence of time shown in FIG. 5. The plasmid thus obtained is called pBRCE30.

Example 12 5

Construction of E. coli recombinant vector (+ VSE) and transformation (using Tac promoter-containing vector.

1) Recombinant vector construction.

10 (i) Vector Preparation.

Five micrograms of tac promoter-containing vector pKK223-3 (Pharmacia) was treated with 8 units of EcoRI (Takara Shuzo Co., Ltd.) for 2 hours at 37 ° C in 30 μΐ of a reaction solution (40 mM Tris-HCl, 7 mM MgCl2, 100 mM NaCl and 7 mM 2-mercaptoethanol.

Next, 3 μΐ of an alkaline phosphatase (Takara Shuzo Co., Ltd.) was added and the treatment was carried out at 60 ° C for 30 minutes. A DNA fragment was collected by three phenol treatments, one ether treatment, and ethanol precipitation by routine methods.

The recovered DNA fragment was dissolved in a 50 μΐ 25 mixture consisting of 50 mM Tris-HCl, 5 mM MgCl 2/10 mM DTT and 1 mM of each of dATP, dCTP, dGTP and dTTP. After adding 3 μΐ of an E. coli DNA polymerase I (Klenow fragment (Takara Shuzo Co.,

Ltd.)), the reaction was carried out at 14 ° C for 2 hours to form ends without binding ability.

(ii) Preparation of a synthetic linker.

Three micrograms of oligonucleotides with synthetic linker sequences, CGAATGACCCCCCTGGGCC and 35 CAGGGGGGTCATTCG, were phosphorylated by performing reaction in 40 μΐ of a reaction solution I DK 175336 B1 I 56

(consisting of 50 mM Tris-HCl, 10 mM MgCl 2, 10 mM

2-mercaptoethanol and 1 mM ATP) at 37 ° C for 60 minutes in the presence of 4 units of T4 polynucleotide kinase.

Each of the phosphorylated oligonucleotides (0.2 μg) was dissolved in 20 μΐ of a 100 mM NaCl containing

TE solution (10 mM Tris-HCl (pH 8.0) and 1 mM

In EDTA). After treatment at 65 ° C for 10 minutes, the oligonucleotides were annealed by slow cooling to room temperature.

(iii) Preparation of a G-CSF cDNA fragment.

H 60 micrograms of the pBRG4 plasmid produced in Example 9 containing the cDNA shown in FIG. 3 15 (A), was treated with 100 units of the restriction enzyme Apal (New England Biolabs) and 50 units of Oral (Takara Shuzo Co., Ltd.) at 37 ° C for 3 hours in 200 μΐ of a reaction solution.

consisting of 6 mM Tris-HCl, 6 mM MgCl 2, and 6 mM

2-mercaptoethanol. Ca. 2 µg of an Apal-Dral fragment (about 590 bp) was collected by 1.2% agarose gel electrophoresis.

(iv) Ligation of fragments.

I 25 Approx. 0.1 μg of each of the fragments prepared in (i) to (iii) was dissolved in 20 μΐ of a ligation solution (66 mM Tris-HCl, 6.6 mM MgCl2, 10 I mM DTT and 1 mM ATP) . After adding 175 I units of T4 DNA ligase, the solution was kept at 30 at 4 ° C overnight to obtain a recombinant vector (Fig. 8).

I 2) Transformation

Using 20 μΐ of a reaction solution containing the recombinant vector prepared in (iv)

In 35, E. coli β-strain JM105 was transformed by rubidium-I

In the chloride method (see T. Maniatis et al., Molecular Closing, p. 252 (1982)). The plasmid was separated from an ampicillin-resistant colony culture by the transformants and treated with the restriction enzymes BamHI, AccII and Apal to confirm that the transformants were the intended ones.

5

Example 13

Construction of E? -Coli recombinant vector (+ VSE) and transformation (using PL promoter-containing vector).

1) Recombinant vector construction.

(i) Vector making.

15 100 Mg of a PL promoter-containing vector, pPL-λ (Pharmacia) was treated overnight at 37 ° C with 50 units of the restriction enzyme BamHI in 100 μΐ of a reaction solution \ 10 mM Tris-HCl (pH 7.6), 7 mM MgCl 2, 100 mM NaCl and 10 mM DTT].

By subjecting the reaction solution to electrophoresis in 1% agarose gel, approx. 49 µg of a fragment of ca. 4 kb and approx. 11 µg of a fragment of ca. 1.2 kb.

The 4 kb fragment was dissolved in 100 μΐ of 25 a TE buffer (see its composition above) and dephosphorylated by reaction with an alkaline phosphatase (Takara Shuzo Co., Ltd.) at 60 ° C for 60 minutes.

The second fragment with a length of approx.

30 1.2 kb were dissolved in 20 μΐ of a buffer (10 mM

Tris-HCl, 10 mM MgCl2, 6 mM KCl and 1 mM DTT) and treated overnight with 20 units of the restriction enzyme MboII (New England Biolabs) at 37 ° C.

35 By electrophoresis in 4% polyacrylamide gel, approx. 0.9 Mg of a BamHI-MboII fragment in DK 175336 B1 I 58 B (about 200 bp) and ca. 19 µg of an MboII-BamHI fragment (about 310 bp).

(ii) Preparation of a synthetic linker.

B 5 Oligonucleotides with the sequences of synthesis I

B linkers, TAAGGAGAATTCATCGAT and

B TCGATGAATTCTCCTTAG, was phosphorylated and I

I annealed as in (ii) in Example 12 to prepare- I

In ling of a synthetic S / D linker. IN

I 10

B (iii) Preparation of an Expression Vector. IN

B One tenth m9 of the fragment with approx. 4 kb, I

0.05 µg of each of the BamHI-MboII-f fragment with I

The B ° LpL 'region and the MboII-BamHI fragment with tL ^ - I

B 15 region [the three fragments made in U)) and

B 0.1 Mg of the annealed synthetic S / D linker I

B prepared in (ii) was subjected to turnover I

B overnight at 12 ° C 1 40 μΐ of a reaction solution

B solution (66 mM Tris-HCl, 6.6 mM MgCl2 * 10 mM DTT I

B 20 and 1 mM ATP) in the presence of 175 units of I

B T4 DNA ligase (Takara Shuzo Co., Ltd.). 20 µΐ of I

The B reaction solution was used for transformation

B mation of coli strain N99Cl + (Pharmacia) at I

B the calcium chloride method (see Molecular Cloning, I

B 25 ibid.).

B The transformants were grown and the plasmid I

B was collected from the culture of their ampicillin-I

fl resistant colonies. Treatment of the plasmid with I

In the restriction enzymes EcoRI, BamHI and Smal, I showed

30 that it was the intended plasmid. IN

I 2 mg of this plasmid was reacted with a re I

strictly enzyme Clal (New England Biolabs) at I

37 ° C for 2 hours in 20 μΐ of a buffer (10 mM Tris-I

In HCl, 6 mM MgCl 2 and 50 mM NaCl). Then one- I

In 35 zymet inactivated by heating to 65 ° C in 10 L

In minutes. IN

59 µl 175336 B1 1 µΐ of the reaction solution was reacted overnight at 12 ° C with 175 units of T4 DNA ligase (Takara Shuzo Co., Ltd.) in a ligation solution of the composition described above. The reaction solution was then used to transform E coli strain N99cl + (Pharmacia). The plasmid was collected from the culture of ampicillin-resistant colonies of the transformants and treated with EcoRl and BamHI to confirm that this plasmid was the intended one.

(iv) Preparation of 6-CSF-expressing recombinant vector and transformants.

The expression plasmid produced in (iii) was treated with a restriction enzyme,

After formation of ends without binding ability, the plasmid was then treated as in Example 12 to produce a recombinant vector into which a G-CSF cDNA fragment was inserted.

This vector was used to transform E. coli strain N4830 (Pharmacia Fine Chemicals) by the calcium chloride method described in Molecular Cloning (ibid.). Identification of the desired transformants was obtained as in Example 12 (Fig. 9).

Example 14

Construction of col i recombinant tvector (+ VSE) and transformation (using trp promoter-containing vector).

1) Recombinant vector construction.

(I) Vector making.

The plasmid pOYl was prepared by insertion of tryptophan promoter-containing Hpall-Taql fragment I DK 175336 B1 I 60

H ment (about 330 bp) in pBR322 at the Clal site. 10 I

pg of this plasmid was treated with 7 units I

of the restriction enzyme Clal and 8 units of I

EVu.II at 37 ° C for 3 hours for 30 μΐ of a reaction I

5 solution of 10 mM Tris-HCl, 6 mM I

MgCl2 and 50 mM NaCl. IN

Next, 2 μΐ of an alkaline phosphate I was added

bag (Takara Shuzo Co., Ltd.), and turnover out

run at 60 ° C for 1 hour. IN

A DNA fragment (about 2.5 µg) of length I

For approx. 2.6 kb was collected from reaction mixture I

by electrophoresis in 1% agarose gel. IN

I (ii) Manufacture of Synthetic Links. IN

In oligonucleotides with the sequences of the syn

In 15 thetic linkers, CGCGAATGACCCCCCTGGGCC and I

In CAGGGGGGTCATTCG, phosphorylated and annealed I

as in (ii) in Example 12 to prepare an I

In synthetic links. IN

I (iii) Preparation of a recombinant vector. IN

In Approx. 1 µg of the vector fragment made in I

In (i), ca. 1 µg of the synthetic linker is manufactured

In easy in (ii) and approx. 1 µg of the G-CSF cDNA fragment I

prepared in (iii) in Example 12 was reacted with I

In 25 175 units of T4 DNA ligase overnight at 12 ° C

I in 20 µl of a ligation solution of composition I

In the invention described in Example 12, l) (iv), for the solution I

In reaching a recombinant vector (Fig. 10). IN

I 30 2) Transformation. IN

In 20 µl of the reaction solution prepared in (iii) I

I was used for transformation of coli DH1 by rubyl

In the dium chloride method described in Molecular Cloning, ibid

I As in Example 12, the plasmid was collected from I

In 35 ampicillin-resistant colonies of the transformants, and I

In the treatment of this plasmid with the restriction enzymes I

................ .-in·.-. - - / - / -'.- '' "i- ;," ivr ^ νΑ> ν ^ - · ΜΜΜ »ΙίΙ» «ΗΜ ^ Μ DK 175336 B1 61

Apal, Dral, Nrul and PstI showed that the desired transformants were obtained.

Example 15 Growth of transformants.

1) Cultivation of the transformants (with tac) obtained in Example 12.

The transformants were grown overnight at 37 ° C and 1 ml of culture was added to 100 ml of a Luria medium containing 25 µg / ml or 50 µg / ml ampicillin.

Cultivation. was carried out for 2-3 days at 37 ° C.

Culture was continued at 37 ° C for 2-4 hours after the addition of isopropyl-β-D-thiogalactoside to give a final concentration of 2 mM.

2} Cultivation of the transformants (med) obtained in Example 13.

20

The transformants were grown overnight at 28 ° C and 1 ml of culture was added to 100 ml of a Luria medium containing 25 or 50 µg / ml ampicillin. The cultivation was carried out for approx. 4 hours at 28 ° C.

Cultivation was continued for 2-4 hours at 42ec.

3) Cultivation of the transformants (with trp) obtained in Example 14. 1 2 3 4 5 6

The transformants were grown overnight at 2 37 ° C and 1 ml of culture was added to 100 ml of an M9 medium containing 0.5 inde glucose, 0.5¾ casamino acids 4 (Difco) and 25 or 50 µg / ml ampicillin. . Cultivation 5 was carried out for 4-6 hours at 37 ° C. After the addition of 50 µg / 6 ml of 3-5-indolacrylic acid (IAA), the culture was continued for 4-8 hours at 37 ° C.

I DK 175336 B1 I 62

Example 16

Recovery and purification of G-CSF polypeptide from E. coli.

51) Extraction.

The three kinds of transformants grown in Example 15 H were subjected to the following extraction procedures.

H 100 ml of the culture was centrifuged to obtain a cell pellet which was suspended in 5 ml of a mixture of 20 mM Trls-HCl (pH 7.5) and 30 mM NaCl.

Next, 0.2 M phenylmethylsulfonyl fluoride, 0.2 M EDTA and a lysozyme were added at concentrations of 1 HM, 10 mM and 0.2 mg / ml, respectively, and the suspension was left at 0 ° for 30 minutes. C.

The cells were lysed by three cycles of freezing / thawing, optionally followed by sonication. The lysate was centrifuged to obtain the supernatant. Alternatively, the lysate was treated with 8 M guanidine hydrochloride so that its final concentration was 6 M guanidine hydrochloride, and then centrifuged at 30,000 rpm. minute for 5 hours, after which the supernatant was collected.

I 25 2) Purification.

In (i) the supernatant obtained in 1) was subjected to gel filtration on a U1trogel AcA54 column (4.6 I cm in diameter x 90 cm in length; LKB) at

At 30 flow rates of approx. 50 ml / h with 0.01 M

In TrisHCl buffer (pH 7.4) containing 0.15 M NaCl I and 0.01% Tween 20 (Nakai Kagaku Co., Ltd.).

In the fractions exhibiting activity by analysis by the CSA test method (b) (described earlier in the present description) were selected and concentrated to a volume of ca. 5 ml with an ultrafiltration apparatus, pM-10 (Amicon).

(ii) To the concentrated fractions was added n-propanol (of a purity suitable for amino acid sequencing; Tokyo Kasei Co., Ltd.) and trifluoroacetic acid and the mixture worked up so that the final concentrations of n-propanol and trifluoroacetic acid was 30¾ and 0.1¾, respectively.

The worked mixture was allowed to stand in ice for approx. 15 minutes and centrifuged at 15,000 rpm. minute for 10 minutes to remove the precipitate. The supernatant was adsorbed on a μ-Bondapak C18 column (semi-preparative grade, Waters, 8 mm x 30 cm) equilibrated with an aqueous solution containing n-propanol (see above) and trifluoroacetic acid. The column was eluted continuously with an aqueous solution of 0.1¾ trifluoroacetic acid containing n-propanol 20 down a linear density gradient of 30-60¾. Using a Hitachi Model 685-50 (HPLC apparatus from Hitachi, Ltd.) and Hitachi Model 638-41 (detector from Hitachi, Ltd.), the adsorbents were measured at 220 nm and 280 nm simultaneously. After elution 25, a subset of 10 μΐ of each fraction was diluted 100-fold, and the diluted mixtures were screened for active fractions by the CSA test method (b). The activity was observed in the peaks eluted with 40¾ n-propanol. Oisse peaks 30 were combined and chromatographed again under the same conditions as used above, and the fractions were examined for their activity by method (b). Again, activity peaked at 40¾ n-propanol. These active peaks were collected (four fractions = 4 ml) and lyophilized.

In DK 175336 B1 I 64 (iii) The freeze-dried powder was dissolved in 200 μΐ of an aqueous 0.1% solution of trifluoroacetic acid containing 40% n-propanol and the solution I was subjected to HPLC on TSK-G3000SW column 5 (7.5 mm x 60 cm; Toyo Soda Manufacturing Co.,

Ltd.). Elution was performed at a flow rate of 0.4 ml / min. with an aqueous 0.1% solution of trifluoroacetic acid containing 40% propanol, and 0.4 ml of fractions were collected by means of H 10 a fraction collector FRAC-100 (Pharmacia Fine

Chemicals). The fractions were examined for their CSA as described above and the active fractions were collected. They were further purified on an analytical μ-Bondapak Cle column (4.6 mm x 30 cm) and the main peak collected and freeze dried.

H The protein thus obtained was treated with H 2-mercaptoethanol and subjected to SDS-polyacrylic amide gel electrophoresis (15.0%) (15 mV, 6 hours).

After staining and Coomassie blue, the desired G-CSF polypeptide could be identified as a single

On tape. IN

In Example 17 I 25

In Testing G-CSF Activity (+ VSE). IN

The CSF sample obtained in Example 16 was tested at I

In the CSF test method (a) described earlier in the presence- I

In the 30 description. The results are shown in Table 1. I

DK 175336 B1 65

Table 1

Human Neutrophil Column (Colonies / Bowl) 5 Purified Human G-CSF (20 na) _73_ CSF Sample Obtained in Example 15_ (50 nq) _68__

Blind_0_ Example 10

Amino acid analysis (+ VSE).

1) Analysis of amino acid composition.

The CSF sample purified in Example 16 was hydrolyzed by routine methods and amino acid composition of the protein portion of the hydrolyzate was analyzed by an amino acid analysis method by an automatic amino acid analyzer, Hitachi 835 (Hitachi Ltd.). The results are shown in Table 2 The hydrolysis was carried out under the following conditions: (i) 6 N HCl, i10 ° C, 24 hours in vacuo.

(li) 4 N methanesulfonic acid + 0.2¾ 3- (2-aminoethyl) -25 indole, 110 ° C, 24 hours, 48 hours, 72 hours in vacuo.

The sample was dissolved in 1.5 ml of a solution containing 40¾ n-propanol and 0.1¾ trifluoroacetic acid. Substances, each of 0.1 ml, were dried with a dry nitrogen gas and after addition of the reagents listed in (i) or (ii) the vessels were closed in vacuo and their contents hydrolyzed.

Each of the values shown in Table 2 averages four measurements, the 24 hour value for (i) and 24, 48 and 72 the 35 hour values for (ii), except that the contents of Thr, Ser, M Cys, Met, Val , Ile and Trp were calculated by the following procedures (see "Tampaku Kagaku (Protein I Chemistry) II, A Course in Biochemical Experiments, Tokyo Kagaku Dohjin):

Por Thr, Ser, H Cys, and Met, the time-dependent profile of the 24, 48 and 72 hour values of (il) was extrapolated at 0 hours.

For Val and Ile, the 72 hour value for I (li) was used.

For Trp, the average of 24, 48 and 72 was used for the 10 hour values for (ii).

67 DK 175336 B1

Table 2

Amino Acid Analysis Data

Amino Acids Mol% 5 Asp (Asp + Asn) 2.3

Thr 4.0

See 8.5

Glu (Glu + Gin) 15.2 Pro 7.3

Gly 7.9

Ala 10.7 1/2 Cys 2.8 15

Option 4,5

With 2.0

Ile 2,3 2o Leu I8> 3

Tyr 1.7

Phe 3,4

Lys 2.3 His 2.8 '

Trp 1.1

Arg 2,9 -—- 1 35 I DK 175336 B1 I 68 2) Analysis of N-terminal amino acids.

The sample was subjected to Edman degradation by a gas phase sequencing apparatus (Applied Biosystems) and the PTH amino acid obtained was analyzed by routine methods using an HPLC apparatus (Beckman

Instruments) and Ultrasphere ODS (Beckman In-

struments). After the column (5 μιη; 4.6 mm in diameter x I)

250 mm) was equilibrated with a starting buffer (an aqueous I

solution containing 15 mM sodium acetate buffer (pH I

10 4.5) and 40% acetonitrile), the sample (dissolved in 20 μΐ of I)

the starting buffer) and the separation was obtained

by isocratic elution with the starting buffer. Under these I

operations, the flow rate was kept at 1.4 L

H ml / min. and the column temperature of 40 ° C. Detection of I

The 15 PTH amino acid was performed using absorption in I

the ultraviolet range at 269 nm and 320 nm. Stan- I

dard samples (each containing 2 nmol) of PTH amino acid I

I (Sigma) was separated by the same procedure for determination I

comparison of their retention times, which were compared I

20 with the retention times of the sample for identification

fixation of the N-terminal amino acids. As a result I

of which PTH-methionine and PTH-threonine were detected. IN

In Example 19 I

I 25

Construction of E_j. coli recombinant tvector (-VSE) and I

transformation. IN

1) Using tac promoter-containing vector. IN

I 30 I

The procedure of Example 12 was repeated, I

except that the "pBRG4 plasmid made in Example 9I

I and containing the cDNA shown in FIG. 3 (a) "[see (iii) in I

In Example 12] was replaced by "pBRV2 prepared in Eq

In sample 10 and containing the cDNA shown in FIG. 4 (a) "

I As in Example 12, the transformants obtained were verified

As the desired transformants (Fig. 11). IN

69 DK 175336 B1 2) Using PL promoter-containing vector.

The procedure of Example 13 was repeated using cDNA (-VSE) and the obtained transformants were verified as the desired transformants (Fig. 12).

3) Using trp promoter-containing vector.

The procedure of Example 14 was repeated using cDNA (-VSE) and the transformants were verified as the desired transformants (Figs.

13).

Example 20

Testing G-CSF Activity (-VSE).

The three kinds of transformants obtained in Example 19 20 were grown by the method described in Example 15.

From the cultured Ig coli cells, G-CSF polypeptides were recovered and purified by the method described, in Example 16, with the result that human G-CSF polypeptide was obtained as a single band.

The CSF sample thus obtained was tested by the CSF activity test method (a) described previously. The results are shown in Table 3.

I DK 175336 B1 I 70

In Table 3 I

Human neutrophil colonies I

____ (colonies / bowl) _ I

I Purified Human G-CSF (20 nq) _73_ I

In CSF Sample obtained in I

Example 19_ (50 ng) _73_ I

I Blind _0_

Example 21 I

Amino acid analysis (-VSE). IN

1) Analysis of amino acid composition. IN

I 15

The amino acid composition of the CSF sample purified in I

Example 20 was analyzed by the method described in I

i. 1) in Example 18. The results are shown in Table 4. I

71 DK 175336 B1

Table 4

Amino Acid Analysis Data

Amino Acids Mol% 5 '----: -

Asp (Asp + Asn) 2.3

Thr 4.0

Ser 8.1

Glu (Glu + Gin) 15.0

Pro 7.5

Gly 8.1

Ala 11.0 15 1/2 Cys 2.9

Option 4.1

With 2.0

Ile 2.2 Leu 18.8

Tyr 1.7

Phe 3,4

Lys 2.3 25

His 2.7

Trp 1.1

Arg 2.8 30 2) Analysis of N-terminal amino acids.

The sample was subjected to analysis of the N-terminal amino acids by the method described in 2) of Example 18. As a result, PTH-methionine and PTH-35 threonine were detected. _ I DK 175336 B1

I 72 I

In Example 22 I

I Preparation of pHGA410 vector (for use in animal I

In cells, + VSE line). IN

I I

In the Eco RI fragment prepared in Example 9, as I

You had the cDNA shown in FIG. 3 (a), was treated with re- I

In the restriction enzyme Dral at 37 ° C for 2 hours and then I

In trade with the Klenow fragment of DNA polymerase I (Ta-I

In 10 kara Shuzo Co., Ltd.) to form ends without joining

In binding ability. 1 µg Bglll linker (8mer, Takara Shuzo I

In Co., Ltd.) was phosphorylated with ATP and bound to ca. IN

1 Mg of the separately obtained mixture of DNA fragments. IN

I The bound fragments were treated with restriction I

In the enzyme BglII and subjected to agarose gel electrophoresis. IN

Next, only the largest DNA fragment was collected. IN

In This DNA fragment corresponded to ca. 710 base pairs I

I containing a moiety encoding human G-CSF poly-I

peptide (see Fig. 6). The vector pdKCR [Fukunaga et al., I

In Proc. Natl. Acad. Sci., USA, 81, 5086 (1984)] were disclosed

You traded with the restriction enzyme BamHI and then de-I

In phosphorylated with an alkaline phosphatase (Takara Shuzo I

In Co., Ltd.). The vector DNA obtained was bound to cDNA-I

In the 710 bp fragment in the presence of T4 DNA ligase I

I see (Takara Shuzo Co., Ltd.) for the preparation of pHGA410 I

(Fig. 14). As shown in FIG. 14 contained this plasmid I

In the promoter of the early SV40 gene, replication assay

In the spawning site of SV40, part of the rabbit-island global gene, I

In the replication initiation region of pBR322 and β-lactam-I

In the gene (Ampr) obtained from pBR322, with the human I

In the G-CSF gene, downstream of the promoter of the time bound I

In straight SV40 gene. IN

73 DK 175336 B1

Example 23

Construction of recombinant vectors (+ VSE) for use in transformation of C127 cells.

1) Construction of pHGA410 (H).

20 µm of the plasmid pHGA410 (Fig. 14) prepared in Example 22 was dissolved in a reaction solution consisting of 50 mM Tris-HCl (pH 7.5), 7 mM MgCl 2, 100 mM NaCl, 7 mM 2-mercaptoethanol and 0 01% bovine serum albumin (BSA). EcoRI restriction enzyme (10-15 units,

Takara Shuzo Co., Ltd.) was added and the reaction solution was kept at 37 ° C for 30 minutes to induce partial digestion with EcoRI. Next, the DNA fragment was subjected to two treatments with a 1: 1 phenol / chloroform mixture, an ether treatment, and ethanol precipitation.

The DNA fragment obtained was dissolved in 50 μΐ of a solution consisting of 50 mM Tris-HCl, 5 mM MgCl 2, 1 ° mM DTT and 1 mM of each of dATP, dCTP, dGTP and dTTP.

After adding 5 μΐ of the Klenow-f fragment of E. coli DNA polymerase (Takara Shuzo Co., Ltd.), the solution was incubated at 14 ° C for 2 hours to form ends without binding ability.

Upon subsequent electrophoresis in 0.8% agarose gel, 6 Mg of a DNA fragment having a length of approx. 5.8 kbp.

30 Mg of the collected DNA fragment was dissolved in 50 µl! of a reaction mixture consisting of 50 mM Tris-HCl (pH 7.6), 10 mM MgCl 2, 10 mM DTT and 1 mM ATP. After adding 2 MSF of Hindi 11 links (Takara Shuzo Co.,

Ltd.) and 100 units of T4 DNA ligase (Takara Shuzo Co., Ltd.), the reaction was carried out overnight at 4 ° C.

Next, phenol and ether treatments and ethanol precipitation were performed. The precipitate was dissolved in 30 µl of 74 µΐ of a solution consisting of 10 mM Tris-HCl (pH 7.5), 7 mM MgCl 2 and 60 mM NaCl, and the solution was incubated at 37 ° C for 3 hours in the presence. of 10 units of

HindIII. After re-treatment with T4 DNA ligase, the resulting DNA was used to transform Ε_Ε coli strain OHI by the rubidium chloride method (see Molecular Cloning, ibid.). From ampicillin-resistant (Ampr) colonies of the transformants, cells containing a plasmid identical to pHGA410 were selected, except that 10 HindIII was inserted at the EcoRI site. The plasmid thus obtained was named pHGA410 (H) (Fig. 15).

I 2) Construction of expression recombinant vector pTN-G4.

15 µg of the pHGA410 (H) thus obtained was dissolved.

H dissolved in 50 μΐ of a reaction solution consisting of 10 mM I

In Tris-HCl (pH 7.5), 7 mM MgCl 2, 175 mM NaCl, 0.2 mM EDTA, 7 mM 2-mercaptoethanol and 0.01% bovine serum albumin.

After the addition of 20 units of Sall (Takara Shuzo I 20 Co., Ltd.), the reaction solution was incubated at 37 ° C.

For 5 hours. After treatment with phenol and precipitation with I

In ethanol, incubation was performed as il) for ca. 2 hours at I

In 14ftC in the presence of the Klenow fragment of DNA poly-I

In merase (Takara Shuzo Co., Ltd.) to form ends I

25 without binding ability. The reaction solution was I

Immediately, without being subjected to DNA collection

I by agarose gel electrophoresis, subjected to precipitation with I

ethanol. The resulting DNA fragment was processed

I with HindIII, and 5 g of HindIII-SalI fragment (about 2.7 kbp) I

30 was collected by electrophoresis in 1% agarose gel. It se- I

In a pair of steps, the plasmid pdBPV-1 containing I

You kept a bovine papilloma virus (BPV) [this plasmid up

was reached by the hospitality of Dr. Howley and are described I

In Sarver, N, Sbyrne, J. C. & Howley, P. M., Proc. Natl. IN

In 35 Acad. Sci., OSA, 79, 7147-7151 (1982)], with HindIII and I PvuXI, as described by Nagata et al. [Pukunaga, Sokawa 75 DK 175336 B1 and Nagata, Proc. Natl. Acad, Sci., USA, 81, 5086-5090 (1984)] to obtain a DNA fragment of 8.4 kb.

This 8.4 kb DNA fragment and the separately obtained HindIII-SalI DNA fragment (about 2.7 kb) were ligated by T4 DNA ligase.

The ligation product was used to transform coli strain DH1 by the rubidium chloride method described in Molecular Cloning, ibid. E coli colonies containing a plasmid with the G-CSF cDNA obtained from PH6A410 were selected. The plasmid was named pTN-G4 (Fig. 15).

Adenovirus type II [Tanpakushitsu, Kakusan, Koso (Proteins, Nucleic Acids, and Enzymes), 27, December, 1982, Kyoritsu Shuppan] was similarly treated to obtain the plasmid ApVA containing a SalI-HindIII fragment with ca. 1700 bp and containing VAI and VAII, and a fragment containing VAI and VAII were recovered from this plasmid. This fragment was inserted into pTNG4 at the HindIII site to obtain pTNG4VAa and 20 pTNG4VAO (Fig. 15). Due to the adenovirus VA gene, these plasmids were capable of increased expression of a transcriptome product from the SV40's early promoter.

Example 24 25

Transformation of C127 cells and G-CSF expression therein (+ VSE).

Before it was used to transform 30 mouse C127 cells, the pTN-G4 plasmid obtained in Example 23 was treated with the restriction enzyme BamHI. 20 µg of plasmid pTN-G4 was dissolved in 100 µΐ of a reaction solution [10 mM Tris-HCl (pH 8.0), 7 mM MgCl 2, 100 mM

NaCl, 2 mM 2-mercaptoethanol and 0.01¾ BSA] and treated with 20 units of BamHI (Takara Shuzo Co., Ltd.) followed by phenol and ether treatment and ethanol precipitation.

I DK 175336 B1 I

i 76 I

Mouse C127I cells were grown in a Dulbecco's I

In minimal essential medium containing 10% bovine, foal

In spoken serum (Gibco). The C127I cells that grew on plate I

there (5 cm diameter), was transformed with 10 Mg per IN

5 plate of the separately prepared DNA at calcium phosphate

phat method [see Haynes, J. & Weissmann, C., Nucleic I

In Acids Res., 11, 687-706 (1983)]. After treatment with I

In glycerol, the cells were incubated at 37 ° C for 12 hours. IN

In The incubated cells were transferred to 3 fresh plates I

10 (5 cm diameter) and the medium was changed twice per minute. IN

week. On the 16th, the center points were transferred to I

In fresh plates and subjected to serial cultivation on a Dulbec- I

co's minimal essential medium containing 10% bovine, I

I. fetal serum (Gibco), so as to select clones with I

15 high G-CSF production capability. These clones produced I

In G-CSF in an amount of approx. 1 mg / l. You provided additional cloning

cause of clones capable of producing I

In G-CSF in amounts of 10 mg / l or more. In addition to C127I- I

In the cells, NXH3T3 cells could also be used as host I

In 20 cells. IN

In Example 25 I

In Expression of G-CSF in CHO Cells (+ VSE). IN

I 25 I

I 1) Construction of pHGG4-dhfr. IN

In 20 Mg of the plasmid pHGA410 obtained in Example 22 I

was dissolved in 100 ml of a reaction solution containing I

In the 10 mM Tris-HCl (pH 7.5), 7 mM MgCl 2/175 mM NaCl, I

In 0.2 mM EDTA, 0.7 mM 2-mercaptoethanol and 0.01% BSA. IN

The reaction was carried out overnight at 37 ° C in the presence

In the purity of 20 units of the restriction enzyme Sall (Takara I

In Shuzo Co., Ltd.), followed by treatment with phenol and I

35 ether and precipitation with ethanol. IN

I The precipitated DNA was dissolved in 100 μΐ of a re I

I 'action solution consisting of 50 mM Tris-HCl, 5 mM I

77 DK 175336 B1

MgCl2 * 10 mM DTT and 1 mM of each of dATP, dCTP, dGTP and dTTP, and the reaction was performed at 14ftC for 2 hours in the presence of the Klenow fragment of coli DNA polymerase (10 μΐ; Takara Shuzo Co., Ltd.) and was followed by 5 treatments with phenol and ether and precipitation with ethanol.

An EcoRI linker was bound to the DNA in the precipitate by the following methods: The DNA was dissolved in 50 μΐ

of a reaction solution consisting of 50 mM Tris-HCl 10 (pH 7.4), 10 mM DTT, 0.5 mM spermidine, 2 mM ATP, 2 mM

hexamine-cobalt chloride and 20 μg / ml BSA. The reaction was carried out at 4 ° C for 12-16 hours in the presence of EcoRI linker (Takara Shuzo Co., Ltd.) and 200 units of Γ4 DNA ligase (Takara Shuzo Co., Ltd.). Following treatment with phenol, washing with ether, and precipitation with ethanol by routine methods, the DNA precipitate was subjected to partial digestion with EcoRI, and 3 µg of a DNA fragment with a length of ca. 2.7 kbp was collected by electrophoresis in 1% agarose gel.

The plasmid pAdD26SVpA [Kaufman, R. 6. & Sharp, P.

A., Mol. Cell Biol., 2, 1304-1319 (1982)] was treated with EcoRI and dephosphorylated by treatment with a bacterial alkaline phosphatase (BAP). More specifically, 20 µg of pAdD26SVpA and 20 units of EcoRI were added to a reaction solution [50 mM Tris-HCl (pH 7.5), 7 mM MgCl 2, 100 mM NaCl, 7 mM 2-mercaptoethanol and 0.01¾ BSA], and Reaction was carried out at 37 ° C for 10 hours. Next, 5 units of BAP were added to the reaction solution and the reaction was carried out at 68 ° C for 30 minutes. After treatment with phenol, the EcoRI fragment of pAdD26SVpA was collected by electrophoresis in a yield of ca. 5 µg

The fragment with a length of approx. 2.7 kbp and the pAdD26SVpA, each weighing 0.5 µg, were annealed.

The obtained plasmid was used to transform E ^ 35 coli strain DH1 by the rubidium chloride method and the colonies containing the plasmid of pHGG4-dhfr were selected.

I DK 175336 B1 I 78

In the plasmid obtained was named pHGG4-dhfr (Fig. I

I 16a). IN

The alternative approach was as follows:

H The plasmid pHGA410 was treated with SalI and exposed to I

5 partial digestion with EcoRI, without any EcoRI linker I

In the attached. A DNA fragment with a length of approx. 2.7 kbp I

I was collected and treated with the Klenow fragment of E ^ I

coli DNA polymerase to form ends without joining I

binding ability. An EcoRI fragment with ends without joining I

In 10 binding capacity was prepared from pAdD26SVpA as be I

In written above. This EcoRI fragment and the separate I

prepared fragments (about 2.7 kbp) were treated with I

In T4 DNA ligase to produce pHGG4-dhfr. IN

In pHG410 (H) prepared in Example 23 was treated

In light of the restriction enzymes HindIII and SalI, as described

H written in 2) in Example 23, and the HindIII-SalI fragment I

H was bound to the EcoRI fragment of pAdD26SVpA with ends I

without binding ability, described above. This forward

Procedure could also be used to prepare pHGG4-I

In 20 dhfr (Fig. 16b).

I 2) Construction of pG4DR1 and pG4DR2. IN

10 Mg of the plasmid pAdD26SVpA mentioned in 1) was dissolved

I dissolved in 50 ml of a reaction solution containing 50 mM I

In Tris-HCl (pH 7.5), 7 mM MgCl 2, 100 mM NaCl, 7 mM 2-mer

In carptoethanol and 0.01¾ BSA. After the addition of 10 units

In each of the restriction enzymes EcoRI and BamHI, I

reaction was carried out at 37 ° C for 10 hours and the successive I

For 30 hours of phenol treatment and ether washing. IN

In a DNA fragment of ca. 2 kb was collected by electro-I

Foresee through a 1% low melting agarose gel.

In the DNA fragment collected was treated with Klenow-I

the fragment of DNA polymerase by routine methods for

In making ends without binding ability. DNA fragments- I

In ends with non-bonding ends were subjected to phenol treatment, ether washing, and ethanol precipitation.

10 µg of the plasmid pPHGA410 (H) obtained in 1) of Example 23 was dissolved in 50 µl of a reaction solution 5 containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl2 and 60 mM NaCl. The reaction was carried out at 37 ° C for 6 hours in the presence of 10 units of HindIII. A DNA fragment was collected by electrophoresis through a 1% low melting agarose gel by routine methods. The collected DNA fragment was then treated with BAP, and ends without binding ability were formed by treatment with the Klenow fragment. After treatment with phenol and washing with ether, the DNA fragment was bound at ends with no binding ability to the previously obtained 15 DNA fragment with ca. 2 kb with a T4 DNA ligase by the following procedures: 1 μg of each DNA fragment was dissolved in 30 μΐ of a reaction solution containing 66 mM Tris-HCl (pH 7.5), 6.6 mM MgCl2, 5 mM DTT and 1 mM ATP, and the reaction was carried out at 6 ° C for 12 hours in the presence of 50 units of a T4 DNA ligase. The ligation product was used to transform E_j_co-1i strain DH1. As a result, pG4DR1 and pG4DR2 shown in FIG. 16c.

25 3) Transformation and Expression.

CHO cells (dhfr strain, kindly provided by Dr. L. Chasin of Columbia University) were grown in α-ml essential medium containing 10% calf serum 30 (o-MEN added adenosine, deoxyadenosine and thymidine) in plates (9 cm in diameter, Nunc). The cultured cells were transformed by the calcium phosphate method [Wigler et al.,

Cell, 14, 725 (1978)] by the following method.

A carrier DNA (calf thymus DNA) was added in a suitable amount to 1 g of the plasmid pHGG4-dhfr prepared in 1) and the mixture was dissolved in 375 μΐ of an I DK 175336 B1.

I 80 I

TE solution, after which 125 μΐ 1 M CaCl2 was added. IN

After cooling the solution in ice for 3-5 minutes, add-I

I added 500 µ x 2 x HBS (50 mM Hepes, 280 mM NaCl and 1.5 L)

mM phsophate buffer) to the solution. After re-cooling on I

5 ice, the solution was mixed with 1 ml of the culture of CHO-I

cells, transferred to plates and incubated for 9 hours in a 1

C02 incubator. The medium was removed from the plate and after I

washing with TBS (Tris-buffered saline), adding I

20¾ glycerol-containing TBS and washing again added a I

10 non-selective medium (the α-MEN medium described above, I

except that nucleotides were added). After two I

day incubation, a ten-fold dilution of I was transferred

the culture of a selective medium (not containing nucleotide I)

there). Cultivation was continued as the medium was replaced

15 with fresh, selective medium every other day, and they result

colonies were selected and transferred to fresh plates

where the cells grew in the presence of 0.02 μΜ I

methotrexate (MTX), after which cloning was performed at I

growth in the presence of 0.05 μΜ MTX, which concentration I

H 20 tration later was increased to 0.1 μΜ. IN

The transformation of CHO cells can also be carried out

by cotransformation with pH664 and pAdD26SVpA [see Scahill I

In et al., Proc. Natl. Acad. Sci., USA, 80, 4554-4658 I

(1983)]. IN

In 25 CHO 2 cells were also transformed by the I

the following procedure: pG4DR1 or pG4DR2 which was I

prepared in 2), were initially treated with I

In Sall and Kpnl, respectively, to obtain DNA fragments, I

and 10 µg of these fragments were used for transfer

30 mation of CHO cells as above. The transformed cell I

clay was subjected to continued cultivation in a series of series

In selective media by the method described above. Ca. 7 days I

Later, at least 100 separate colonies per plate. IN

In these colonies were transferred quantitatively to fresh I

In 35 plates and subjected to continued cultivation in a series of se- I

In selective media in the presence of 0.01 μΜ MTX, whereby I

81 DK 175336 B1 more than 10 colonies appeared. The same procedure was repeated, successively increasing the MTX concentration to 0.02 μΜ, 0.05 μΜ and 0.1 μΜ, and the surviving colonies were selected. Colony selection could be achieved in the same way, even when the well-obtained colonies were individually selected and subjected to culture at increasing MTX concentrations.

A recombinant vector containing a "polycistron" can also be used to transform CH0-10 cells. An example of this alternative method is as follows: pAdD26SVpA was treated with Pst1 and the collected two fragments were bound to a CSF cDNA fragment obtained from pBRG4 to construct a recombinant vector, wherein the adenovirus promoter, CSF cDNA, DHFR and The poly (A) site of SV40 was inserted in the order indicated. The recombinant vector was used to transform CHO cells.

Example 26 Testing G-CSF Activity (+ VSE).

The supernatants of cultures of C127 cells and CHO cells obtained in Examples 24 and 25, respectively, were adjusted to a pH of 4 with 1N acetic acid. After addition of an equal volume of n-propanol, the resulting precipitate was removed by centrifugation. The supernatant was passed through an open column (1 cm diameter x 2 cm length) filled with a C8 reverse phase support (Yamamura Kagaku K.K.) and elution was performed with 50¾ n-propanol. The eluate was diluted twice with water and subjected to reverse-phase HPLC on YMC-C8 column (Yamamura Kagaky K.K.), followed by elution with n-propanol (30-60¾1 linear density gradient) containing 0.1¾ TFA. The fractions eluted with n-propanol concentrations of ca. 40¾ was collected, lyophilized and dissolved in 0.1 M glycine buffer (pH 9). As a result of these procedures, the human G-CSF in the C127 and CHO cells was concentrated ca. 20 times.

In DK 175336 B1 B 82 B As control, cells were transformed with plasm B mites, free of human G-CSFcDNA, and the supernatants of B cultures of these were concentrated by the method of B described above. The human G-CSF activities of the samples were tested by the method (a) for testing B human G-CSF activity, described previously. If the expression B expression efficiency is sufficiently high, the supernatants of the cultures can be directly tested without being B concentrated. The results are summarized in Table 5, B 1 ° in which the numerical values are based on concentrated samples.

DK 175336 B1 83

Table 5

Testing of human G-CSF activity ~ 'Human neutrophil colonies δ__ colonies / dish_

Purified Human G-CSF (20 ng)

Culture of C127 cells transformed with pdBPV-100 (concentrated 20-fold) 10 -----

Bpv Culture of 3T3 cells transformed with pdBPV-100 (concentrated 20-fold)

Culture of C-i2 7 cells transformed with pTNG4 82 (concentrated 20-fold)

Culture of 3T3 cells transformed with pTNG4 85 (concentrated 20-fold)

Culture of CHO cells 20 transformed with pAdD26SVpA 0 (concentrated 20-fold)

Culture of CHO cells transformed with pHGG4-dhfr 110 dhfr (concentrated 20-fold)

Culture of CHO cells 25 transformed with pG4DR1 105 '(concentrated 20-fold)

Example 27 Amino acid and sugar analysis (+ VSE).

1) Analysis of amino acid composition.

The crude CSF sample prepared in Example 26 was purified by the procedure described in Example 2 (i i i).

The purified CSF sample was hydrolyzed by routine analysis and the protein portion of the hydrolyzate was tested for its amino acid composition by a special amino acid analysis method using a Hitachi 835 automatic amino acid analyzer (Hitachi, Ltd.). The results are shown in Table 6. The hydrolysis was carried out under the following conditions: (i) 6 N HCl, 110 ° C, 24 hours in vacuo.

(il) 4H methanesulfonic acid + 0.2¾ 3- (2-aminoethyl) indole, 110 ° C, 24 hours, 48 hours, 72 hours in vacuo.

The sample was dissolved in a solution (1.5 ml).

H containing 40¾ n-propanol and 0.1¾ trifluoroacetic acid. Part I

amounts each of 0.1 ml were dried with an I

dry nitrogen gas, and after adding the reagents,

15 in (i) or (ii), the containers were closed in vacuo, I

after which the contents were hydrolyzed. IN

Each of the values shown in Table 6 was an average

section of four measurements, the 24 hour value for (i) and 24,

48 and 72 hours for the values of (ii), except that I-

The teams of Thr, Ser, fc Cys, Met, Val Ile and Trp were employed

calculated by the following methods (see "Tampaku Kagaku I

(Protein Chemistry) II ", A Course in Biochemical Experiments

ments, Tokyo Kagaku Dohjin): I

For Thr, Ser, H Cys and Met, it became time-dependent

25 available profile for the 24, 48 and 72 hour values for (ii) I

extrapolated to 0 hours. IN

For Val and Ile, the 72 hour value was used for I

I (ii) ·

For Trp, the average of 24, 48 and 72 I was used

For the 30 hour values of (ii). IN

85 DK 175336 B1

Table 6

Amino acid analysis data 5 Amino acids Mol%.

Asp (Asp + Asn) 2.3

Thr 3.9

See 8.5 10

Glu (Glu + Gln) 15.3

Pro 7,4

Gly 7.8 j g Ala 10.8 1/2 Cys 2.8

Option 4,5

With 1.7 20 Ile 2.3

Leu 18,6

Tyr 1.7

Phe 3.4 25

Lys 2.3

His 2.8

Trp 1.1

Arg 2.8 30 ______] _ 35 I DK 175336 B1 I 86 Η 2) Analysis of sugar composition.

H An internal standard (25 nmol inositol) was added to 200 ng of the purified CSF sample used in the analysis of the amino acid composition 1). After addition of 5 a methanol solution (500 μΐ) containing 1.5 N HCl, the reaction was carried out at 90 ° C for 4 hours in a closed tube purified with N 2. After opening the tube, silver carbonate (Ag 2 CO 3) was added to neutralize the contents. Then 50 μΐ acetic anhydride was added and the tube was shaken for a sufficient time. Next, the tube was left to stand overnight in the dark at room temperature. The upper phase was put into a test tube and dried with nitrogen gas.

In Methanol was added to the precipitate and the mixture was washed and centrifuged lightly. The upper phase was put into the same test tube and dried. After addition of 50 μΐ TMS reagent (5: 1: 1 mixture of pyridine, hexamethyldisilazane and trimethylchlorosilane), the reaction was carried out at 40 ° C for 20 minutes and the reaction product was stored in a 1 freezer. A standard was prepared by mixing 20 25 nmol inositol with 50 nmol each of galactose (Gal), N-acetylgalactosamine (Gal NAc), sialic acid and any other suitable reagent.

The samples thus prepared were subjected to gas chromatographic analysis under the following conditions: 87 DK 175336 B1

Analvsebetlnaelser

Column: 2% OV - 17 VINport HP, 60-80 mesh.

3 m, glass

Temperature: increases from 110 to 250 ° C at 4 ° C / 5 min.

Carrier gas pressure first 1.2-1.6 kg / cm2 (N2 pressure): finally 2-2.5, kg / cm2 Sensitivity: 103 MQ range, 0.1-0.4 volts

Pressure: H2, 0.8 kg / cm2, air 0.8 kg / cm2 10 Supply sample: 2.5-3.0 µΐ.

As a result of the assay, galactose, N-acetylgatactosamine and sialic acid were identified in the CSF sample of the present invention.

15

Example 28

Preparation of pHGV2 vector (for use in animal cells, -VSE line).

20

The Eco RI fragment prepared in Example 10 containing the cDNA shown in FIG. 4 (A), was treated with the restriction enzyme Dral at 37 ° C for 2 hours and then with the Klenow fragment of DNA polymerase in (Takara Shuzo Co., 25 Ltd.) to form ends without binding ability. One microgram of BglII linker (8mer, Takara Shuzo Co., Ltd.) was phosphorylated with ATP and bound to ca. 1 µg of the separately obtained mixture of DNA fragments. The bound fragments were treated with the restriction enzyme 30 BglII and subjected to agarose gel electrophoresis. Next, only the largest DNA fragment was collected.

This DNA fragment corresponded to ca. 700 base pairs containing a portion encoding human G-CSF polypeptide (see Fig. 6). The vector pdKCR [Fukunaga et al., Proc. Natl. Acad. Sci., USA, 81, 5086 (1984)] was disclosed in DK 175336 B1

I 88 I

You traded with the restriction enzyme BamHI and then dephos- I

phorylated with an alkaline phosphatase (Takara Shuzo I

Co., Ltd.). The vector DNA obtained was bound to cDNA-I

the fragment by ca. 700 base pairs 1 presence of T4-I

5. DNA ligase (Takara Shuzo Co., Ltd.) for the preparation of I

In pHGV2 (Fig. 17). As shown in FIG. 17 contained this

plasmid promoter of the early SV40 gene, the repli I

cation-initiating region for SV40, part of rabbit β-I

the global gene, the replication-starting region of pBR322 I

10 and the β-lactamase gene (Ampr) obtained from pBR322, with I

the human G-CSF gene was bound by the promoter of I

In the early SV40 gene. IN

In Example 29 I

I 15 I

I Recombinant Vector Construction (-VSE) for Use I

I by transforming C127 cells. IN

I 1) Construction of pHGV2 (H). IN

I 20 I

In 20 Mg of the plasmid pHGV2 (Fig. 17) prepared in I

Example 28 was treated by the method described in I

I in 1) of Example 23 to produce a plasmid called I

In pHGV2 (H) (Fig. 18). IN

I 25 I

2) Construction of the expression recombinant vectors I

In pTN-V2, pTNVAa and pTNVAØ. IN

I Using 20 Mg of the pHGV2 (H) plasmid I

In 30, the procedure described in Example 23 was described in Example 23

In the selection for coli containing a plasmid I

I with G-CSF cDNA obtained from pHGV2. This plasmid became I

In named pTN-V2 (Fig. 18). IN

In Adenovirus, type II, [Tampakushitsu, Kakusan, I

I 35 Koso (Proteins, Nucleic Acids, and Enzymes), 27, Decern- I

In Ber, 1982, Kyoritsu Shuppan] was treated on the same

89 DK 175336 B1 method for obtaining a plasmid, ApVA, containing a SalIHindIII fragment of ca. 1700 bp containing VAI and VAII, and a fragment containing VAI and VAII were recovered from this plasmid. The fragment was inserted into 5 pTN'V2 at the HindIII site to obtain pTNVAa and pTNVAO (Fig. 18). Due to the VA gene of adenovirus, these plasmids were capable of increased expression of a transcriptome product from the early SV40 promoter.

10

Example 30

Transformation of C127 cells and G-CSF expression therein (-VSE).

The 15 pTN-V2 plasmid obtained in Example 29 was treated with the restriction enzyme BamHI before it was used to transform mouse C127 cells.

Mouse C127I cells were transformed with the DNA thus prepared to express G-CSF (see Example 24) and clones with high 6-CSF production capacity were selected. These clones formed G-CSF in an amount of ca. 1 mg / L.

Upon further cloning, clones capable of forming G-CSF in an amount of 10 mg / L could be selected. Similarly, C127 cells were transformed with pTNVAa and pTNVO, obtained in Example 29, and transformants with clones with high G-CSF production capacity were selected. For pTNVAa, clones capable of forming G-CSF in yields of 20 mg / L or more could be obtained, while clones with a lower productivity (few mg / L) were obtained by transformation with pTNVAo.

In addition to the C127I cells, NIH3T3 cells could also be used as host cells.

I DK 175336 B1 I

I 90 I

In Example 31 I

In Expression of G-CSF in CHO Cells (-VSE). IN

I 51) Construction of pHGV2-dhfr. IN

In A DNA fragment having a length of approx. 2.7 kbp became I

I prepared from 20 µg of the plasmid pHGV2 (Example I

I) in the method described in) in Example 25. I

I This fragment (0.5 μg) and the EcoRI fragment of I

In pAdD26SVpA (0.5 μg) was annealed. The resulting I

In plasmid was used for transformation of coli strain I

In me DH1 by the rubidium chloride method and the colonies contained I

In the holding plasmid of pHGV2-dhfr was selected. It does

In 15 plasmid reached, pHGV2-dhfr was named (Fig. 19a). IN

The alternative approach was as follows:

In the plasmid pHGV2 was treated with SalI and partially digested

In the stereo with EcoRI, no EcoRI links were attached. IN

In A DNA fragment having a length of approx. 2.7 kbp was recorded

I collected and treated with the Klenow fragment of coli I

In DNA polymerase to form ends without binding I

ability. An EcoRI fragment with ends without binding I

Ability was prepared from pAdD26SVpA as described in I

In the above. This EcoRI fragment and the separate preparation I

25 fragments (about 2.7 kbp) were treated with T4 DNA-11-I

In gases for the preparation of pHGV2-dhfr. IN

In the pHGV2 (H) plasmid prepared in Example 1

I 29 was treated with the restriction enzymes, KindIII and I

SalI, as described in 2) in Example 29, and HindIII-SalI

In the fragment was bound to the Eco I fragment with ends I

Without the binding ability of pAdD26SVpA, described above

I for. This method could also be used for adv

In the position of pHGG4-dhfr (Fig. 19b). IN

91 DK 175336 B1 2) Construction of pV2DR1 and pV2DR2.

10 Mg of plasmid pAdD26SVpA mentioned in 1) was dissolved in 50 ml of a reaction solution containing 50 mM Tris-HCl (pH 7.5), 7 mM MgCl2, 100 mM NaCl, 7 mM

2-mercaptoethanol and 0.01% BSA. The reaction was carried out at 37 ° C for 10 hours in the presence of 10 units of each of the restriction enzymes EcoRI and BamHI. Treatment with phenol and washing with ether were therefore carried out by routine methods. A DNA fragment of ca. 2 kb was collected by electrophoresis through a 1% low melting agarose gel. The collected DNA fragment was treated with the Klenow fragment of DNA polymerase by routine methods to form ends without binding ability. The DNA-15 fragment with unlinked ends was subjected to phenol treatment, ether washing, and ethanol precipitation.

10 µg of the plasmid pHGV2 (H) obtained in Example 29 was dissolved in 50 µl of a reaction solution containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl2 and 60 mM NaCl. The reaction was carried out at 37 ° C for 6 hours in the presence of 10 units of HindIII. A DNA fragment was collected by electrophoresis through a 1% low melting agarose gel by routine methods. The collected DNA-25 fragment was then treated with BAP, and ends without binding ability were formed by treatment with the Kle-now fragment. After treatment with phenol and washing with ether, the DNA fragment * was bound at the ends with no binding ability to the previously obtained DNA fragment by ca. 2 kb by T4 DNA ligase by the following procedure: 1 µg of each DNA fragment was dissolved in 30 μΐ of a reaction solution containing 66 mM Tris-HCl (pH 7.5), 6.6 mM MgCl 2. 5 mM DTT and 1 mM

ATP and the reaction was carried out at 6 ° C for 12 hours in the presence of 50 units of T4 DNA ligase. League

I DK 175336 B1 I

I 92 I

The ion product was used to transform I

In coli strain DH1. As a result, pV2DR1 I was obtained

I and pV2DR2 shown in FIG. 19c. IN

I 53) Transformation and Expression. IN

In CHO cells were transformed with the plasmid I

In pHGV2-dhfr for G-CSF expression by the method, I

Written 13) in Example 25. I

The transformation of CHO cells can also be carried out

I by cotransformation with pHGV2 and pAdD26SVpA. IN

In CHO cells were also transformed by the following

In progress: pV2DR1 or pV2DR2 which was obtained

In position 2), were initially treated with I

In 15 Sall and Kpnl, respectively, to obtain DNA fragments, and I

10 µg of these fragments were used for transforma- I

In tion of CHO cells as above. Transformed cells I

You were subjected to continued cultivation in a series of selections

In tive media by the method described above. Ca. 7 I

For 20 days, at least 100 separate colonies per IN

In plate. These colonies were quantitatively transferred to an I

In fresh plate and subjected to continued cultivation in a series I

I of selective media in the presence of 0.01 μΜ MTX, I

whereby about 10 colonies emerged. The same progress I

25 was repeated, the MTX concentration being successively I

was increased to 0.02 μΜ, 0.05 μΜ and 0.1 μΜ, and the colonies, I

Those who survived were selected. Colonial selection could up- I

You are reached in a similar way, even when the 10 colonies obtained I

You were selected individually and subjected to culture with I

In 30 increasing MTX concentrations. IN

I A recombinant vector containing a "poly-I

In the cistron "can also be used for transformation of CHO-I

In cells. An example of this alternative method I

You are as follows: pAdD26SVpA was treated with PstI, and I

In the two collected fragments, a CSF cDNA-I was bound

In fragment obtained from pBRV2 to construct a re- I

93 DK 175336 B1 combinator vector in which the adenovirus promoter, CSF cDNA, DHFR and the poly (A) site of SV40 were inserted in the order indicated. This recombinant vector was used to transform CHO cells.

5

Example 32

Testing G-CSF Activity {-VSE).

By the method described in Example 26, human G-CSF was obtained from supernatants of cultures of C127 cells and CHO cells obtained in Examples 30 and 31. The human G-CSF activity of each of the samples collected was tested as in Example 26. The results are shown in Table 7.

In DK 175336 B1

I 94 I

Table 7 I

In Testing Human G-CSF Activity I

Human neutrophils I

In 5 colonies I

colonies / bowl_ I

In Purified Human G-CSF (20 ng) _96_ I

In Culture of C127 Cells I

transformed with I

pdBPV-1 0 I

I 10 (concentrated 20 times) I

In Bpv Culture of 3T3 Cells I

You transformed with I

pdBPV-1 0 I

(concentrated 20 times) I

In Culture of Cd27 * Cells I

I 15 transformed with pTN-v2 ι07 I

I {concentrated 20 times) I

In Culture of 3T3 Cells I

transformed with pTN-v.2 103 I

(concentrated 20 times) I

In 2o Culture of CHO Cells I

I transformed with pAdD26SVpA 0 I

I (concentrated 20 times) _ I

In Culture of CHO Cells I

I transformed with pHGv2 ~ dhfr 111 I

dhfr (concentrated 20 times) I

I Culture of CHO Cells I

I transformed with pV2DR1 113 I

I (concentrated 20 times)

I 30 I

I 35 I

95 DK 175336 B1

Example 33

Amino Acid and Sugar Analysis (-VSE).

5 1) Analysis of amino acid composition.

The crude CSF sample prepared in Example 32 was purified by the procedure described in Example 2 (iii).

The purified CSF sample was subjected to analysis of amino acid composition by the procedure described in Example 27. The results are shown in Table 8.

I DK 175336 B1 I

I 96 I

In Table 8 I

In Amino Acid Analysis Data I

I 5 Amino Acids Mol% I

I Asp (Asp + Asn) 2r3 I

In Thr 4.0 I

I 10 Ser M I

I Glu (Glu + Gin) 15.1 I

I Pro 7.5 I

I Gly 8.0 I

I Ala 10.9 I

I 1/2 Cys 2.8 I

In Election 3.9 I

I With 1.7 I

I 20 Ile 2.3 I

In Leu 18.9 I

In Tyr 1.7 I

In Phe 3.5 I

I 25 I

In Light 2.3 I

I His 2.9 I

In Trp 1.2 I

I 30 Ar9 2 »9 I

I 35 I

97 DK 175336 B1 2) Analysis of sugar composition.

The purified CSF sample used in analyzing the amino acid composition 11) was also subjected to assay 5 for its sugar composition by the same procedure and under the same conditions as described in 2) in Example 27. As a result of this analysis, the presence of galactose was verified. N-acetylgalactosamide and sialic acid in the CSF sample of the present invention.

10

Example 34

Construction of recombinant vector containing chromosomal gene for expression in COS cells.

15

The plasmid pBRCE30 obtained in Example 11 containing the chromosomal gene shown in FIG. 5, was treated with EcoRI. The pSVH + K + plasmid described by Banerji et al. in Cell, 2/7, 299 (1981) was treated with 20 KpnI to remove the globin gene. In addition, the plasmid was subjected to partial digestion with HindIII to remove part of the late SV40 gene. The fragments were again bound to produce an expression vector pML-E +.

This vector was treated with the restriction zymet EcoRI and dephosphorylated with an alkaline phosphatase (Takara Shuzo Co., Ltd.) to obtain a vector DNA which was bound to the aforementioned chromosomal DNA by a T4 DNA ligase ( Takara Shuzo Co., Ltd.) to obtain pMLCE3a. As shown in FIG. 20, this plasmid contained the enhancer for the SV40 gene, the origin of replication of SV40, the origin of replication of pBR322, and the β-lactamase (Ampr) gene obtained from pBR322, and it had the chromosomal gene for human 35 G-CSF bound after the enhancer for the SV40 gene.

I DK 175336 B1 I

I 98 I

In Example 35 I

In Expression of chromosomal gene for human G-CSF in COS-I

cells. IN

I 5 I

In COS-1 Cells (provided by the accession of I

I Dr. Gluzman of Cold Spring Harbor Laboratory, U.S.A.), I

In which had been grown to a density of approx. 70¾ in Petri- I

In bowls (9 cm diameter, Nunc) using a DMEM-I

10 medium (Dulbecco's modified Eagle's medium capable of

available from Nissui Seiyaku K.K. under the trade mark "Nissui")

In containing 10¾ calf serum, either I was transformed

by the calcium phosphate method [Wigler et al., Cell, 1 ^ 4, I

In 725 (1978)] or the DEAE-dextran: chloroquine method [see I

In e.g. Gordon et al., Science, 228, 810 (1985)]. IN

Transformation by the calcium phosphate method became I

I performed as follows: 160 µg of the plasmid pMLCE3a prepared- I

Easy in Example 34 was dissolved in 320 μΐ TE solution and I

After addition of distilled water (3.2 ml), I was added

I 20 504 μΐ 2 M CaCl2. IN

To the resulting solution was added 4 ml of 2 x I

In HBS (50 mM Hepes, 280 mM NaCl, 1.5 mM phosphate buffer, I)

At pH 7.12) and the mixture was cooled on ice for 20-30 ml

In nuts. The cooled mixture was added dropwise to the mixture

25 diet in an amount of 1 ml per day. Petri dish where you had

In the growth of the COS-1 cells. After growing for 4 hours I

At 37 ° C in a CO 2 incubator, cells were washed with an I

In serum-free DMEM medium, after which they were allowed to stand in I

ca. 3 minutes at room temperature in 5 ml of a DMEM-I

In 30 medium containing 20¾ glycerol and washed again with an I

In serum-free DMEM medium. After removal of the serum-free I

In DMEM medium, 10 ml of a DMEM medium was added

In that 10¾ calf serum and cultivation was performed overnight I

I in a CO 2 incubator. After the medium was replaced with an I

In 35 fresh medium of the same type, cultivation was carried out in outer I

For like 3 days. IN

IN

99 DK 175336 B1

Transformation by DEAE-dextran: chloroquine method was carried out as follows: As with the calcium phosphate method, COS-1 cells were grown to a density of 70¾ and washed twice with serum-free DMEM medium. To the washed cells, a serum-free DMEM medium containing 250 µg / ml DEAE-dextran and 2 Mg / ml of the plasmid pMLCE3O prepared in Example 34 was added and the culture was carried out at 37 ° C for 12 hours. Next, the cells were washed twice with serum-free DMEM medium and subjected to further culture at 37 ° C for 2 hours in a DMEM medium containing 10% calf serum and 1 mM chloroquine. Then, the cells were washed twice with serum-free DMEM medium and grown at 37 ° C for an additional 3 days in a DMEM medium containing 10% calf serum.

The supernatant of the culture thus obtained of COS-1 cells was adjusted to a pH of 4 with 1N acetic acid. After adding an equal volume of n-propanol, the resulting precipitate was removed by centrifugation. The supernatant was passed through a 20 open column (1 cm diameter x 2 cm length) filled with a C8 reverse phase support (Yamamura Kagaku K.K.) and eluted with 50% n-propanol. The eluate was diluted twice with water and subjected to reverse-phase HPLC on YMC-C8 column (Yamamura Kagaku K.K.) followed by elution with n-propanol (30-60% linear density gradient) containing 0.1% TFA. The fractions eluted at n-propanol concentrations of ca. 40%, were collected, lyophilized and dissolved in 0.1 M glycidine buffer (pH 9).

As a result of these procedures, the human 30 G-CSF in the supernatant of the culture of COS-1 cells was concentrated ca. 20 times.

As a control, COS-1 cells were transformed with pML-E +, free of chromosomal gene for G-CSF, by the procedures described above, and the supernatant of the resulting culture was concentrated.

The human G-CSF activities of the obtained samples were tested by the method (a) for testing human I DK 175336 B1

I 100 I

G-CSF activity described previously. The results are I

summarized in Table 9. I

In Table 9 I

i

In Human neutrophil colonies I

_ (colonies / bowl) _ I

Purified human G-CSF (20 nol_18_ I

Culture of COS cells trans- I

10 propagated with pML-E + I

I (concentrated 20-quanqe) _ 0_ I

Culture of COS cells trans- I

propagated with pMLCE3a I

(concentrated 20-qq) _23_ I

H 15 Culture of COS cells trans- I

propagated with pMLCE3a I

(concentrated 10 times) _19_ I

Example 36 I

I 20 I

RNA Analysis of G-CSF (chromosomal gene). IN

COS Cells, grown to a cell concentration of 8 L

In x 10 6 cells / plate (9 cm diameter), was transformed with I

In 25 80 µg of plasmid pMLCE3a. After 48 hours, I was prepared

In the total RNA by the method of Chirgwin [Bio-I

In Chemistry, 18, 5294-5299 (1979)]. IN

In the plasmid pBRG4 obtained in Example 9, I was cut

You above using the restriction enzyme Ahalll and the re- I

Thirty suiting DNA fragments obtained from pBRG4 were radio-I

In the label of [γ-32P] ATP using T4 polynucleo-I

In time kinase to obtain a DNA fragment of ca. 2.8 kb I

In containing G-CSF cDNA. The fragment was collected and analyzed

turned like a DNA probe. After denaturation of DNA pro- I

In 35 legs (1.5 x 105 c.p.m., 2.8 x 106 c.p.m./pg DNA), it was I

I mixed with 20 μg of total RNA prepared from I

101 DK 175336 B1 COS cells. Hybridization was performed at 45 ° C for 15 hours. The mixture was subjected to digestion with 200 units / ml or 400 units / ml of S1 nuclease (PL Biochemicals) by the method of Weaver and Welssmann [Nucleic 5 Acid Res., 7, 1175-1193 (1979)] and then subjected to electrophoresis in 4% polyacrylamide gel in the presence of 8.3 M urea. Next, detection was performed by autoradiography.

As a result, a band corresponding to 722 bp was observed as a strongly radiolabelled band in COS cells in which a band corresponding to 487 bp was also detected.

Therefore, the RNA of COS cells was found to contain G-CSF mRNA molecules of both the + VSE and -VSE lineages.

15

Example 37

Amino acid and sugar analysis (chromosomal gene).

20 1) Analysis of amino acid composition.

The crude CSF sample prepared in Example 35 was purified by the procedure described in Example 2 (iii).

The purified CSF sample was subjected to analysis of amino acid composition by the method described in 1) 1 Example 27. The results are shown in Table 10.

I DK 175336 B1 I

I 102 I

In Table 10 I

In Amino Acid Analysis Data I

In Amino Acids Mol ·% I

5 ------- I

I Asp (Asp + Asn) 2.3 I

In The 4.9 I

I Ser 8.3 I

I 10 Glu {Glu + Gin) 15.3 I

I Pro 7.4 I

I Gly 7.9 I

I Ala 10, .8 I

15 I

I 1/2 Cys 2.8 I

In election 4.3 I

I With 1.7 I

I 2.3 I

In Leu 18.7 I

In Tyr 1.7 I

In Phe 3.4 I

I LyS 2.3 I

I Bis 2.9 I

In Trp 1.1 I

In Arg__2.9 I

I 30 2} Sugar Composition Analysis. IN

I The purified CSF sample used in the analysis of I

the amino acid composition of 1) was also subjected to ana- I

In view of its sugar composition by the same process I

Under the same conditions as described in 2) of Eq

As a result of this analysis, the presence of galactose, N-acetylgalactosamine and sialic acid in the CSF sample of the present invention was verified.

I DK 175336 B1 I

I 104 I

In Example 38 I

In Expression of the chromosomal gene for human G-CSF in I

In C127 cells. IN

I 5 I

In the plasmid pMLCEda obtained in Example 34 was used

You traded with EcoRI, and a fragment of approx. 4 kb was recorded

In summary, by the method described in Molecular Cloning, I

The collected fragment was used as a source I

In 10 for the chromosomal G-CSF gene. IN

The fragment was treated with the Klenow fragment I

I of DNA polymerase I to form ends without joining I

In binding ability (A). IN

In the SV40 promoter (EcoRI-EcoRI fragment with about I

In 0.4 kb) was excised from the plasmid pHGA410 (prepared I)

In light of Example 22) by the method described in Mole-I

In cular Cloning, ibid., And then treated with Klenow- I

In the γ fragment of DNA polymerase (B). IN

In a separate step, a plasmid, pdBPV-1, I

In 20 with a bovine papilloma virus (BPV) [this plasmid became I

In obtained by the hospitality of Dr. Howley and are described I

In Sarver, N., Sbyrne, J.C. & Howley, P.M., Proc. Natl. IN

In Acad. Sci., USA, 79, 7147-7151 (1982)] treated with I

In HindiII and PvuII to obtain a DNA fragment of ca. IN

I 8.4 kb. This fragment was treated with Klenow fragment

In the ment of DNA polymerase I and dephosphorylated with an I

In bacterial alkaline phosphatase (C). IN

In the DNA fragments (A), (B) and (C), each weighing I

In 0.1 µg, was dissolved in 20 μΐ of a reaction solution I

I (30 mM Tris-HCl (pH 7.6), 10 mM MgCl 2, 10 mM DTT, 1 mM I

In ATP) and the reaction was carried out overnight at 4 ° C

I in the presence of 180 units of a T4 DNA ligase. IN

The reaction solution was then treated at I

In the rubidium chloride method described in Molecular Cloning, I

In 35 ibid., To obtain the plasmid pTNCE3a (Fig. 21). IN

105 DK 175336 B1

The DNA fragment (A) used as the source of the chromosomal G-CSF gene can be replaced by a DNA fragment of approx. 1.78 kb obtained by the following procedure: 20 µg pMLCE3a is dissolved in 100 µ i of a mixture of 10 5 mM Tris-HCl (pH 8.0), 7 mM MgCl2 * 100 mM NaCl, 7 mM

2-mercaptoethanol and 0.01¾ BSA. The solution is incubated at 37 ° C for 5 hours in the presence of 20 units of Stul and subjected to electrophoresis through 1.2¾ agarose gel.

The plasmid thus obtained, pTNCE3a, was used to transform mouse C127 I cells as in Example 24, and clones expressing the chromosomal gene for human G-CSF and capable of generating a large amount of G-CSF , was selected.

15

Example 39

Expression of chromosomal gene for human G-CSF in CHO cells.

20

As in expression in C127 cells, the plasmid pMLCE3a was treated with Stul and a DNA fragment of ca.

1.78 kb was recovered. Alternatively, the same plasmid was treated with Eco RI and an Eco RI fragment of ca. 4 25 kb were recovered. Both fragments were suitable for use as the source of the chromosomal G-CSF gene.

The source fragment was treated with the Klenow fragment of DNA polymerase I (a).

As in Example 38, the promoter of SV40 30 (Eco RI-Eco RI fragment) was excised from pHGA410 to obtain a fragment of ca. 0.4 kb, which was similarly treated with the Klenow fragment of DNA polymerase (b).

In a separate step, the plasmid pAdD26 $ VpA [Kaufman, R.G. & Sharp, P.A., Mol. Cell. Biol., 2, 1304-1319 (1982)] treated with EcoRI and then with the Klenow fragment of DNA polymerase and finally dephosphorylated.

I DK 175336 B1 I

I 106 I

In phorylated by treatment with a bacterial alkaline I

In phosphatase (c). IN

In fragments (a), (b) and (c), each weighing I

0.1 μς, was dissolved in 20 μΐ of a reaction solution (50 l

5 mM Tris-HCl (pH 7.6), 10 mM MgCl 2, 10 mM DTT, 1 mM ATP), I

The reaction was carried out overnight at 4 ° C in the presence

In room of 180 units of a T4 DNA ligase. IN

The reaction solution was then treated at I

In the rubidium chloride method described in Molecular Cloning, I

In 10 ibid., For transformation of coli strain DH1. The re- I

In suiting Tetr colonies were screened for those in-

In the plasmid pD26SVCE3a shared. IN

I As shown in FIG. 22 had the plasmid pD26SVCE3a I

In the CSF gene bound to the early gene of SV40 and dhfr gene

15 networks bound after the adenovirus1's main late I

In the promoter. IN

In the plasmid pAdD26SVpA was treated with EcoRI and I

In BamHI as 12) in Example 25 to obtain a DNA-I

fragment (about 2 kb) containing the dhfr gene. This frag- I

20 were bound to fragment (a) and EcoRI-SalI fragment-I

of pHGA410 (H) to construct an Ampr expression I

In sion vector, pDRCE3a (Fig. 22). IN

CHO cells were transformed with the thus I

In plasmids pD26SVCE3a and pDRCE3a obtained, as in Example I

I 25 25. By repeated selection by growth in presence I

of MTX, clones of a G-CSF producing strain were obtained. IN

In Example 40 I

I Testing the G-CSF Activity of Transformants (There I

You express human chromosomal gene). IN

The supernatants of cultures of C127 cells and I CHO cells obtained in Example 38, respectively

In 35 and 39, was worked up as in Example 26 to obtain I

In human G-CSF, and its activity was tested. Results- I

ne is shown in Table 11.

DK 175336 B1 107

Table 11

Testing of human G-CSF activity

Human neutrophil 5 colonies _ (colonies / dish) _

Purified How to G-CSF_ (20 na) _85_

Culture of C127 cells transformed with pdBPV-100 BPV (concentrated 20-fold)

Culture of C127 cells transformed with pTNCE3a 83 _ (concentrated 20-fold) _

Culture of CHO cells 15 transformed with pAdD26SVpA 0 concentrated 20 times)

Culture of CHO cells dhfr transformed with pD26SVCE3a 85 (concentrated 20-fold) _ 20 Culture of CHO cells transformed with pDRCE3a 86 _ (concentrated 20-fold) _

Example 41 25

The molecular weight and isoelectric point of the transformants.

The purified CSF samples used in analyzing the amino acid compositions of Examples 16, 20, 27, 33 and 37 were subjected to measurements of their molecular weights and isoelectric points by the following methods.

- - - I _ ^

I DK 175336 B1 I

I 108 I

I 1) Molecular weight. IN

The molecular weight of the CSF was determined by sodium I

In dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). IN

I The electrophoresis equipment used was PROTEANTH (16 cm, I

product from Bio-Rad Corporation), which uses I

This is a gel made from a slice of polyacrylamide gel I

I (T = 15%, C = 2.6%) measuring 140 mm x 160 mm x 1.5 mm, I

I and a concentrating gel (T = 3%, C = 20%). A denatu- I

In 10 CSF test samples were prepared by the following procedure

way: CSF was boiled for 3 minutes in a solution containing I

In the 2% sodium dodecyl sulfate in 0.46 M 2-mercaptoetha- I

I nol. After performing electrophoresis with 4 Mg of sample I

In a friend with a constant current of 30 mA for 4 hours, I

In 15, the gel was removed and stained with 0.25% Coomassie Brilli-I

In ant blue R 250 (product of Sigma Chemical Co.) for tape I

In detection. The following substances were used as molecular I

H weight markers after the same treatments: Phosphorylase B I

Bovine serum albumin (BSA, molecular weight I)

67,000), ovalbumin (OVA, molecular weight 45,000), carbonic anhydride

See (mole weight 31,000), soybean trypsin inhibitor (mole I)

weight 21,500) and lysozyme (molecular weight 14,400). IN

As a result, a single band I was detected

At a molecular weight of 185,000 ± 1,000 for each of I

In the 25 CSF samples obtained in Example 16 [E. coli / cDNA (+ VSE)] I

In and Example 20 iE. coli / cDNA (-VSE)], and a single band I

Corresponding to a molecular weight of 19,000 ± 1,000 was applied

As shown by each of the CSF samples obtained in Example 27 I

In [C127, CHO / cDNA (+ VSE)], Example 33 [C127, CHO / cDNA I

In 30 (-VSE)] and Example 37 (COS / gDNA). IN

· Π-w ·, · - .. - - · * · .ι - «» · ηΓΛ · '»ί ·. jHWW ^ MB— DK 175336 B1 109 2) Isoelectric point.

The isoelectric point of the CSF of the present invention was determined by a flat-bed iso-electric electrophoresis apparatus, FBE-3000 (product of Pharmacia Fine Chemicals). After 2 hours of electrophoresis with a constant power of 30 watts (Vmax = 2,000 volts) on a polyacrylamide gel (T = 5515, C = 3%, 115 mm x 230 mm) containing Pharmalyte (pH * 10 4-6.5, Pharmacia Fine Chemicals) and 4M urea, the CSF was fixed with 30¾ methanol / 10¾ trifluoroacetic acid / 35 / sulfosalicylic acid and stained with Coomassie Brilliant blue R-250. A Low pi set (pH: 2.5-6.5, product of Pharmacia Fine Chemicals) was used as a marker of iso-electric point.

Analysis of band separation at a pH of 4 to 6.5 yielded a single band corresponding to pi = 6.1 for each of the CSF samples obtained in Examples 16 and 20 and three separate bands corresponding to pi = 5.5, 5 , 8 and 6.1 for each 20 of the CSF samples obtained in Examples 27, 33 and 37.

Example 42

Protective effect of human G-CSF against microbial infection.

Test method 1. Protection against infection by Pseudomonas aeruginosa.

30

Endoxan (trademark of Shionogi & Co., Ltd.) was administered intraperitoneally to 8-9 week old ICR mice (male, 35.3 ± 1.38 g body weight) at a dose of 200 mg / kg. The mice were then subdivided into three groups and two 35 groups received four subcutaneous injections (each with 0.1 dose of 110 ml) at 24 hour intervals of a solvent [1% propanol and 0.5% ( wt / vol) mouse serum albumin

in physiological saline] containing human G-CSF

(25,000 or 50,000 units / mouse), while the third group was administered the solvent only in the same program.

Three hours after the last injection, the mice in each group were infected with Pseudomonas aeruginosa GNB-139 by subcutaneous injection (3.9 x 10 5 CFU / mouse). 21 Hours after infection, the first two groups received a second subcutaneous

10 injection of the solvent containing human G-CSF

(25,000 or 50,000 units / mice) and the last group was administered only the solvent.

The protective effect of human G-CSF was investigated by counting the number of live mice 10 days after infection.

Preparation of cell suspension

Pseudomonas aeruginosa GNB-139 was grown overnight overnight shaking at 37 ° C in a Heart Infusion liquid medium (trademark of Difco). The culture was suspended in a physiological saline solution.

2) Protection against infections with Candida 25 In Endoxan (trademark of Shionogi & Co., Ltd.) was administered intraperitoneally to 8-week-old ICR mice (male, body weight of 40.5 ± 1.60 g) at a dose of 200 In mg / kg. The mice were then divided into two groups. One group received four subcutaneous injections (each with a 0.1 I ml dose) at 24 hour intervals of a solvent [1% propanol and 10% (w / v) ICR mouse serum in

physiological saline solution] containing human G-CSF

(50,000 units / mouse), while the other group was only given the solvent according to the same program. 4 Hours after the last injection, the mice in both groups were infected with Candida albicans 0-50-1 (strain isolated from urine from leukemia patients provided by Bacteriological Laboratory, Tohoku University, School of Medicine) by intravenous injection. (5.6 x 5 x 101 2 3 4 CFU / mouse). The protective effect of human G-CSF was examined by counting the number of live mice 10 days after infection.

Preparation of cell suspension.

10

Candida albicans 0-50-1 was grown overnight with shaking at 37 ° C in a yeast extract-containing Sabou raud liquid medium (2¾ dextrose from Junsei Pure Chemicals Co., Ltd .; 10¾ tryptocase peptone, trademark of 15 BBL, 5¾ yeast extract from Difco; pH 5.6). The culture was washed twice with physiological saline and suspended in physiological saline.

Protection against infections with intracellular, parasitic Listeria.

2

Endotoxan (trademark of Shionogi & Co., Ltd.) was administered intraperitoneally to 7 week old ICR mice (male, body weight 34.7 ± 1.24 g) at a dose of 200 mg / kg. The mice were then divided into two groups. The one group received four subcutaneous injections (each at 0.1 ml dose) at 24 hour intervals of a solvent [1¾ n-propanol and 10¾ (w / v) ICR mouse serum in physiological saline solution] containing human G-CSF (50,000 units / mice), while the other group was only given the solvent after the same program. 4 Hours after the last injection, mice in both groups in 4 were infected with Listeria monocytogenes 46 (provided thanks to Microbiological Laboratory, Tohoku University, I DK 175336 B1 I 122

In Preparation of Cell Suspension. IN

Listeria monocytogenes 46 was grown overnight I with shaking at 37 ° C in a Brain-Heart Infusion 11-

“5 quid medium (trademark of Difco). The culture was suspended

in physiological saline solution.

results

I) Tests 1, 2, and 3 were performed with E ^-coli-G-GSF

The (+ VSE) polypeptide obtained in Example 16. The results are shown in Tables 12, 13 and 14.

Table 12 I 15 I Effect against Pseudomonas aeruginosa I Group CSF concentration Live mice / units / mice / day treated mice

I Solvent 0 Q / lQ

20 ------ In CSF-containing solvent 25,000 6/10 In CSF-containing solvent 50,000 8/10 In Table 13 I 25

Effect against Candida albicans I Group CSF concentration Live mice / I units / intoxicants / day treated mice I Solvent 0 0/10 30 —I ------ In CSF-containing solvent 50,000 10/10 I 35 DK 175336 B1 113

Table 14

Effect against Listeria monocytogenes 5 Gruooe CSF concentration Live nose / PP _ units / mice / day imaged tos ·

Solvent _ 0/10/10 CSF-containing solvent 50,000 10/10 10 µl Test 1 was performed with the coII-G-CSF (-VSE) polypeptide obtained in Example 20. The results are shown in Table 15.

15

Table 15

Effect against Pseudomonas aeruginosa

Group CSF concentration Live mice / units / nus / day treated mice

Solvent 0 0/10 CSF-containing solvent 25,000 6/10 CSF-containing solvent 50,000 8/10 25 - iii) Test 1 was performed with a purified sample of human G-CSF (+ VSE) obtained from CHO cells, which sample was the same as that used in analyzing the amino acid composition of Example 27. The results are shown in Table 16.

I DK 175336 B1 I 114

In Table 16 I

Effect against Pseudomonas aeruginosa I

Group CSF concentration Live mice / I

5 units / nose / day treated mice I

Solvent 0 0/10 I

CSF-containing solvent 25 «000 9/10 I

In CSF-containing solvent 50,000 10/10 I

10 I

Substantially the same results were obtained when I

test 1 was performed with a sample of purified human G-CSF op-I

obtained from Ci27 cells, which sample was the same as I

that used in the analysis of amino acid composition- I

15 in Example 27. I

iv) Test 1 was performed with a sample of purified human I

In G-CSF (-VSE) obtained from CHO cells, which sample was I

the same as that used in the analysis of ami- I

the acid composition of Example 33. The results are I

20 shown in Table 17. I

In Table 17

Effect against Pseudomonas aeruginosa

Λ C * I

° Group CSF concentration Live mice / units / mice / day treated mice I Solvent q 0/10 CSF-containing solvent 25,000 9/10 30 CSF-containing solvent 50,000 10/10 Essentially the same results were obtained,

In when test 1 was performed with a sample of purified human G-CSF

I obtained from C127 cells, which sample was the same I 35 as used in the analysis of the amino acid composition of Example 33.

Claims (24)

115 DK 175336 B1 1. DNA sequence, characterized in that it encodes a polypeptide acting as a human granulocyte colony-stimulating factor and encodes all or part of the polypeptide sequence shown below: 5 Met Ala Gly Pro Ala Thr Gin Ser Pro Met Lys Leu Met Ala Leu Gin Leu Leu Leu Trp His Ser Ala Leu Trp Thr Val Gin Glu Ala Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gin Ser Phe Leu 10 Leu Lys Cys Leu Glu Glit Val Arg Lys Ile Gin Gly Asp Gly Ala Ala Leu Gin Glu Lys Leu (Val Ser Glu) mCys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Gly Until Ser Leu Gly In Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser 15 Gin Ala Leu Gin Leu Ala Gly Cys Leu Ser Gin Leu His Ser Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly Ile Ser Pro Glu Leu. Gly Pro Thr Leu Asp Thr Leu Gin Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gin Gin Met 20 Glu Glu Leu Gly With Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala With Pro Ala Phe Ala Ser Ala Phe Gin Arg Arg Ala, _ Gly Gly Val Leu Val Ala Ser His Leu Gin Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gin Pro 25 (wherein m is 0 or 1). DNA sequence according to claim 1, characterized in that it encodes all or part of the polypeptide sequence shown below: I DK 175336 B1 I 116 I Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gin Ser Phe Leu Leu Lys Cys Leu Glu Gin val Arg Lys Ile Gin Gly Asp Gly Ala Ala Leu Gin Glu I Lys Leu (Val Ser GluJ ^ Cys Al * Thr Tyr Lys Leu I 5 Cys His Pro Glu Glu Leu Val Leu Leu Gly His I Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser! I Cys Pro Ser Gin Ala Leu Gin Leu Ala Gly Cys I Leu Ser Gin Leu His Ser Gly Leu Phe Leu Tyr H Gin Gly Leu Lein Gin Ala Leu Glu Gly Ile Ser 10 pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gin 1 Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp I Gin Gin With Glu Glu Leu Gly With Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala With Pro Ala Phe I Ala Ser Ala Phe Gin Arg Arg Ala Gly Gly Val 15 Leu Val Ala Ser His Leu Gin Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gin I Pro (wherein m is 0 or 1). 3. DNA sequence according to claim 1, characterized in that it has all or part of the nucleotide sequence shown below: - - - - assE3 · - -2 - ·. , Uv.j-- ·. · '.' Τ: DK 175336 B1 117 ATG GCT GGA CCT, GCC ACC CAG AGC CCC ATG AAG CTG ATG GCC CTG CAG CTG CTG CTG TGG CAC AGT GCA CTC TGG ACA GTG CAG GAA GCC ACC CCC CTG I GGC CCT GCC AGC TCC CTQ- CCC CAG AGC TTC CTG 5 CTC AAG TGC TTA GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG CTC CAG GAG AAG CTG (GTG I AGT GAG) fflTGT GCC ACC TAC AAG CTG TGC CAC CCC 'GAG GAG CTG GTG CTG CTC GGA CAC TCT CTG GG CCC TGG GCT CCC CTG AGC AGC TGC CCC AGC. 10. CAG GCC CTG CAG CTG 'GCA GGC TGC TTG AGC CAA' CTC CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC, CTG CAG GCC CTG GAA GGG ATC TCC CCC GAG TTG! GGT CCC ACC TTG GAC ACA CTG CAG CTG GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG 15 GAA GAA CTG GGA ATG GCC CCT GCC CTG CAG CCC. ACC CAG GGT GCC ATG CCG GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT GCC TCC CAT ‘CTG’ CAG AGC TTC CTG GAG GTG TCG TAC CGC GTT CTA CGC CAC. CTT GCC CAG CCC 20 (wherein m is 0 or 1). DNA sequence according to claim 1, characterized in that it has all or part of the nucleotide sequence shown below: 25 1 35 I DK 175336 B1 I 118 I ACC CCC CTG GGC CCT GCC AGC TCC C TG CCC C AG I AG C TTC CTG CTC AAG TG C TTA GAG C AA G TG AGG IA AG ATC C AG GGC GAT GGC GCA G CG CTC CAG GAG I AAG CTG (GTG AGT GAGJJTGT GCC ACC TAC AAG CTG S m TGC CAC CCC GAG GAG CTG GTG CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GCT CCC CTG AGC AGC I TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG AGC C AA CTC CAT AGC GGC CTT TTC CTC TAC I CAG GGG CTC CTG CAG GCC CTG G AA GGG ATC TCC 10 CCC GAG TTG GGT CCC ACC TTG GAC ACA CTG CAG CTG GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG A TG G AA G AA CTG GGA A TG GCC CCT GCC H CTG CAG CCC ACC CAG GGT GCC ATG CCG GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TOG TAC CGC GTT CTA CGC CAC CTT GCC CAG I CCC (where m is 0 or 1). sequence, characterized in that it encodes a polypeptide having effect as human granulocyte colony stimulating factor and having all or part of the nucleotide sequence shown in FIG. 3 (A). 6. DNA sequence, characterized in that it encodes a polypeptide acting as a human granulocyte colony-stimulating factor and that it has all or part of the nucleotide sequence shown in FIG. 4 (A). 7. DNA sequence, characterized in that it encodes a polypeptide acting as a human granulocyte colony-stimulating factor and has all or part of the nucleotide sequence shown in FIG. 5th DNA sequence according to any one of claims I 1-7, characterized in that it is bound to an I replicon obtained from a microorganism or virus. - ^ = 3-II -J_I_2- · - ^ gTO '^ Wgl: · - · DK 175336 B1 119 A recombinant vector, characterized in that it contains a DNA sequence encoding a polypeptide acting as a human granulocyte colony stimulating factor and the DNA sequence is a sequence according to any one of claims 1-7. A recombinant vector according to claim 9, characterized in that it is to be used with EL co-li. The recombinant vector of claim 9, characterized in that it is to be used with animal cells. The coli recombinant vector according to claim 9, characterized in that the DNA sequence encodes all or part of the polypeptide shown below: I DK 175336 B1 I 120 I Het Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro I Gin Ser Phe Leu Leu Lys Cys Leu Glu Gin Val I Arg Lys Ile Gin Gly Asp Gly Ala Ala Leu Gin I Glu Lys Leu (Val Ser Glu ^ Cys Ala Thr Tyr Lys 5 Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gin Ala Leu Gin Leu Ala Gly I Cys Leu Ser Gin Leu His Ser Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly Ile H 10 ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gin Leu Asp Val Ala Asp Phe Ala Thr Thr Ile H Trp Gin Gin The Glu Glu Leu Gly With Ala Pro H Ala Leu Gin Pro Thr Gin Gly Ala Hot Pro Ala Phe Ala Ser Ala Phe Gin Arg Arg Ala Gly Gly 15 val Leu Val Ala Ser His Leu Gin Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg Bis Leu Ala Pro H 20 (where m is 0 or 1) . Transformant, characterized in that it contains a recombinant vector containing a DNA sequence encoding a polypeptide acting as a human granulocyte colony-stimulating factor, and that the DNA sequence is a DNA sequence according to any of claims 1 to 1. 7th An el coli transformant according to claim 13, characterized in that it is obtained by transformation I with an EL coli recombinant vector. Isolated animal cell transformant according to claim 13, characterized in that it is obtained by transformation with a recombinant vector for use with animal cells. The coll-transformant according to claim 13, characterized in that it is obtained by transformation with the coll-recombinant vector according to claim 12. A method of producing a polypeptide or glycoprotein having the effect of human granulocyte colony stimulating factor, characterized in that it comprises: a) obtaining a DNA sequence according to any one of claims 1-7 encoding for a polypeptide having human granulocyte colony-stimulating activity, b) producing a recombinant vector into which this DNA sequence is inserted, c) transforming host cells with this vector, d) culturing the transformants, and e) recovering the desired polypeptide or glycoprotein from cultures. The method according to claim 17, characterized in that the vector is an E coli recombinant vector according to claim 12. The method of claim 17, characterized in that the polypeptide is represented by all or part of the amino acid sequence shown in claim 12. The method of claim 17, characterized in that the glycoprotein comprises a sugar chain portion and a polypeptide represented by all or part of the amino acid sequence shown in claim 2.