HRP920628A2 - Human granulocyte colony stimulating factor - Google Patents

Description

The field of technology

The invention is from the field of molecular biology.

Technical problem

This invention relates to human granulocyte colony stimulating factor.

More specifically, the present invention relates to a gene encoding a polypeptide possessing colony stimulating factor activity (hereinafter referred to as CSF) which is a specific stimulating factor required in principle for the formation of colonies of human granulocytic cells. This invention also relates to a recombinant vector present in said gene, a transformant containing said vector, a polypeptide or glycoprotein having CSF activity when obtained from said transformant, and a method for obtaining a polypeptide or glycoprotein having CSF activity.

State of the art

When bone marrow cells as target cells and kidney cells or embryo cells are cultured by the two-layer soft agar culture method, with bone marrow cells in the upper layer and kidney or embryo cells in the lower layer, some of the cells in the upper layer grow and differentiate to form colonies neutrophil granulocytes (further simply referred to as granulocytes) or monocyte macrophages. This observation suggests the presence of an in vivo factor that facilitates colony formation /Pluznik and Sach, J. Cell. Comp. Physiol., 66, 319(1965); and Bradley and Metcalf, Aust. J. Exp. Biol. Honey. Sco., 44, 287(1966)/.

It is known that these factors, collectively designated as CSF, can be produced by cells such as T-cells, monocyte macrophages, fibroblasts and endothelial cells that are normally widely distributed in vivo. CSF includes the following subclasses: granulocyte-monocyte macrophage-CSF (designated as GM-CSF) which acts on the granulocyte or monocyte macrophage cell system in such a way as to stimulate the growth of such stem cells and induce their differentiation to form colonies of granulocytes or monocyte macrophages; monocytic macrophage CSF (designated as M-CSF) which is in principle capable of forming monocytic macrophage colonies; multipotent CSF (denoted as multi-CSF) acting on poorly differentiated multipotent stem cells; and granulocyte CSF (designated as G-CSF) of the type contemplated by the present invention which is in principle capable of forming granulocyte colonies. It has recently been pointed out that the differentiation states of target cells differ from one subclass to another /Asano, Taisha-Metabolism and Disease, 22, 249(1985); and Yunis et al., "Growth and Maturation Factors", published by Guroff, John Wiley and Sons, NY, vol 1, 209(1983)/.

Therefore, the explanation of individual CSF subclasses and the study of their chemical and biological properties is very important for the study of hematopoietic mechanisms and the analysis of pathomorphological aspects of various hematological diseases. The biological actions of G-CSF are attracting increased attention from researchers due to its ability to induce the differentiation of leukemic bone marrow cells and enhance the functions of mature granulocytes, and potentially provide the possibility of successful clinical application in the areas of leukemia treatment and prevention.

So far, attempts have been made to isolate and purify G-CSF based on a cell culture procedure where G-CSF is isolated from the culture cell supernatant, but homogeneous G-CSF has not yet been produced in large quantities because G-CSF can only be obtained in small concentrations. and complex purification procedures yield only traces of G-CSF from a large volume of culture fluid. That is why it is desirable to adopt the process of recombinant DNA technology for mass production of G-CSF.

Description of the solution to the technical problem with implementation examples

The object of this invention is to obtain a coding gene for a polypeptide that has human G-CSF activity.

The next goal of this invention is to obtain a recombinant vector incorporated in the mentioned gene.

A further aim of this invention is to obtain a transformant which is obtained by transforming the host with the said recombinant vector, and polypeptides and glycoproteins which are obtained by means of said transformant.

The aim of this invention is to set up a procedure for obtaining a polypeptide or glycoprotein that has human G-CSF activity.

Figure 1 shows arrays of three different probes IWQ, A and LC;

Figure 2 shows the nucleotide sequence of the pHCS-1 portion;

Figure 3(A) shows the nucleotide sequence of the cDNA portion in pBRG4;

Figure 3(B) shows the amino acid sequence of human mature G-CSF derived from pBRG4 cDNA;

Figure 4(A) shows the nucleotide sequence of the cDNA portion in pBRV2;

Figure 4(B) I shows the amino acid sequence of the human G-CSF precursor derived from pBRV2 cDNA;

Figure 4(B) II shows the amino acid sequence of human mature G-CSF derived from pBRV2 cDNA;

Figure 5 shows the nucleotide sequence of the human chromosomal coding gene for human G-CSF;

Figure 6 shows the restriction enzyme cleavage site of pBRG4- or pBRV2-derived human G-CSF cDNA.

Figure 7 shows the restriction enzyme cleavage site of the human chromosomal gene coding for human G-CSF.

Figure 8 is a partial representation of a procedure for obtaining a tac promoter containing vector (+VSE line);

Figure 9 is a representation of the procedure for obtaining a PL promoter containing a vector (+VSE line);

Figure 10 is a representation of the procedure for obtaining a trp promoter containing vector (+VSE line);

Figure 11 is a partial representation of a procedure for obtaining a tac promoter containing vector (-VSE line);

Figure 12 is a representation of the procedure for obtaining a PL promoter containing a vector (-VSE line);

Figure 13 is a representation of the procedure for obtaining a trp promoter containing vector (-VSE line);

Figure 14 shows the schematic structure of pHGA410;

Figure 15 is a representation of the procedure for the construct expression of the recombinant vectors, pTN-G4, pTN-G4VA and pTN-α G4VAβ;

Figures 16a and 16b show two procedures for the formation of pHGG4-dhfr;

Figure 16c shows the procedures for generating PG4DR1 and pG4DR2;

Figure 17 shows the schematic structure of pHGV2;

Figure 18 is a representation of the procedure for the construct expression of the recombinant vectors, pTN-V2, pTN-VAα and pTN-VAβ;

Figures 19a and 19b show two procedures for constitutive expression of the pHGV2-dhfr recombinant vector.

Figure 19c shows the procedures for obtaining pV2DR1 and pV2DR2;

Figure 20 shows the schematic structure of pMLCE3α;

Figure 21 schematically shows the structure of pTNCE3α;

Figure 22 schematically shows the structures of pD26SVCE3α and pDRCE3α.

The gene encoding a polypeptide having human G-CSF activity according to the present invention is a DNA (cDNA) that is complementary to a messenger RNA (mRNA) obtained as a 15-17 fraction of a centrifugal density gradient of sucrose and which encodes a polypeptide having human G-CSF activity.

These inventors obtained two cDNA lines.

The cDNA of one line has all or part of the gene coding for polypeptide I or II in Figure 3(B). Specifically, this cDNA has a nucleotide sequence delineated with ATG at 32-34 nucleotide positions from the 5'-terminus (see Figure 3(A)/ and CCC at 650-652 nucleotide positions or with ACC at 122-124 positions and CCC at 650- 652 positions. Alternatively, the cDNA has the nucleotide sequence shown in Figure 3(A) or a portion thereof. The cDNA of this line is designated below as cDNA (+VSE).

The cDNA of the second strand has all or part of the gene coding for polypeptide I or II shown in Figure 4(B). More specifically, this has a nucleotide sequence characterized by ATG at 31-33 nucleotide positions from the 5'-terminus /see Figure 4(A)/ and with CCC at 640-642 nucleotide positions, or with ACC at 121-123 positions and with CCC at 640-642 positions. Alternatively, this cDNA may have the nucleotide sequence shown in Figure 4(A) or a portion thereof. The cDNA of this line is denoted below as cDNA (-VSE).

The gene described above can be obtained by the following procedure: mRNA encoding G-CSF is first obtained from mammalian animal cells or other host cells having G-CSF activity; The mRNA was then translated into double-stranded cDNA by known methods; a set of recombinants containing this cDNA (the set is further referred to as a cDNA library) is then subjected to screening by known methods.

The gene of the present invention also includes a human chromosomal gene encoding a polypeptide having human G-CSF activity. This human chromosomal gene contains a nucleotide sequence that participates in transcriptional control and also contains all or part of the nucleotide sequence shown in Figure 5.

The chromosomal gene can then be obtained by preparing from human cells recombinants containing the human chromosomal gene (the set is hereinafter referred to as a human chromosomal gene library) and then subjecting said gene to testing using known methods.

A human chromosomal gene can be obtained from any type of human cell such as cells extracted from the liver or kidney or cultured cells such as tumor cells. A human chromosomal gene library can be obtained from human cells by any known method / see Maniatis et al., Cell, 15, 687 (1978); and Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, p. 269 (1982)/, which are illustrated below: extract human chromosomal DNA from such a source as human embryonic liver with phenol or other appropriate chemicals; destruction of the extracted DNA partially or completely with a suitable restriction enzyme to obtain a DNA fragment of the appropriate length; inserting the DNA portion into the λ-phage vector DNA fragment with T4 ligase or other suitable ligases, with a linker containing a restriction site for a suitable enzyme such as EcoRI which is optionally attached; then, obtaining λ-phage particles by an in vitro packaging process and transforming host cells such as E. coli with the obtained λ-phage particles.

Examples of λ-phages applicable as a vector in the above methods include Charon 4A and EMBL-3 and EMBL-4.

A mammalian cell that can be used as a source of mRNA supply is a human Ca oral cavity derived cell, CHU-2 (deposited in the Collection Nationale de Cultures de Mikroorganismes, or C.N.C.M., under number I-483). however, it should be pointed out that instead of these tumor cells, any other cells of the species isolated from mammals can be used. Obtaining mRNA can be performed using any of the known methods for gene cloning of other physiologically active proteins; for example, whole RNA is first obtained by treatment with surfactant and phenol in the presence of a ribonuclide inhibitor such as vanadylribonucleoside complex (see Berger and BirkenMeier, Biochemistry, 18, 5143(1979)) or by CsCl density gradient centrifugation followed by treatment with guanidine thiocyanate /see Chirgwm et al., Biochemistry, 18, 5294(1979)/, poly(A+)RNA (mRNA) is then obtained by subjecting the entire RNA to stepwise adsorption or column chromatography on oligo(dT)-cellulose or poly-sucrose 2B used as a carrier. Poly(A+) can be further fractionated by some suitable procedure.

The ability of the thus obtained mRNA to code for a polypeptide having G-CSF activity can be confirmed by several methods; for example; mRNA is translated into protein and its physiological activities are examined; alternatively, the identity of this protein was determined using an anti-G-CSF antibody. More specifically, mRNA is introduced into Xenopus laevis eyes for translation (see Gurdon et al., Nature, 233, 117(1972)), or translation can be performed with rabbit reticulocytes or wheat germ (Schelif and Wensink, "Practical Methods in Molecular Biology", Springer-Verlag, NY (1981)/. G-CSF activity can be assayed using the soft agar culture method using bone marrow cells, and procedures for performing this method, as described /Metcalf, "Hemopoietic Colonies", Springer-Verlag Berlin, Heidelberg, NY (1977)/.

A single-stranded cDNA synthesized with the thus obtained mRNA is used as a template; single-stranded cDNA is synthesized from this single-stranded cDNA; and the single-stranded cDNA is introduced into the appropriate DNA vector to generate a recombinant plasmid. This recombinant plasmid can be used to transform a suitable host, for example Escherichia coli, so that a group of DNAs in transformants (cDNA library) is obtained.

Double-stranded cDNA can be obtained from mRNA by one of the following two procedures: the mRNA is treated with reverse transcriptase with an oligo (dT) that is complementary to the poly(A)-strand at the 3'-terminus taken as an example; or an oligonucleotide corresponding to the part of the amino acid sequence of G-CSF that is synthesized, and a cDNA that is complementary to the mRNA is synthesized by treatment with reverse transcriptase with the synthesized oligonucleotide used as an initiator. Double-stranded cDNA can also be obtained by the following procedures: mRNA is degraded and removed by base treatment and the obtained single-stranded cDNA is treated first with reverse transcriptase or DNA polymerase I (eg Klenow fragment), then with S1 nuclease; alternatively, mRNA can be directly treated with RNAse H and DNA polymerase (eg, E. coli polymerase I). For more information see Maniatis et al., "Molecular Cloning", Cold Spring Harbor Laboratory (1982); and Guber and Hoffman, Gene, 25, 263(1983).

The double cDNA thus obtained is introduced into a suitable vector such as, for example, one of the EK-type plasmid vectors designated as pSC101, pDF41, Co1E1, pMB9, pBR322, pBR327 and pACYC1 or one of the phage vectors designated as λgt, λc, λgt10 and λgtWES , and then the recombinant vector is used to transform the E. coli strain (eg, X1776, HB101, DH1 or C600) to obtain a cDNA library (see, for example, "Molecular Cloning", also).

The double-stranded cDNA can be attached to the vector by the following procedures: the terminus of the cDNA is provided with an attachable end by attaching the appropriate chemically synthesized DNA fragment; vector DNA cleaved with a restriction enzyme is joined to said cDNA by treatment with T4 phage DNA ligase in the presence of ATP. Alternatively, the dG-strands (or dT, dA-strands) are ligated, respectively, to a double-stranded cDNA and vector DNA that has been cut with a restriction enzyme and quenched in a solution containing both DNAs (see "Molecular Cloning", ibid.).

The host cell can be transduced with the thus obtained recombinant DNA using any of the known methods. If the host cell is E. coli, the procedure described by Hanahan (J. Mol. Biol. 166, 557(1983)/) can be applied by adding the recombinant DNA to the appropriate cell obtained in the presence of CaCl 2 , MgCl 2 or RbCl.

Testing for cells expressing the desired genes can be performed using a number of methods including: the plus-minus method applicable in cloning interferon cDNA /Taniguchi et al., Proc. Jpn. Acad., 55, Ser. B, 464(1979)/, the hybridization-translation test method /Nagata et al., Nature, 284, 316 (1980)/ and the colony or hybridization infection method using an oligonucleotide template synthesized chemically on the basis of the amino acid sequence of a protein having a human G- CSF activity /Wallace et al., Nucleic Acids, Res., 9, 879(1981)/; and Benton & Davis, Science, 196, 180(1970)/.

The fragment growing the gene encoding the polypeptide thus cloned has human G-CSF activity can be reintroduced into a suitable DNA vector for the purpose of translation in other prokaryotic or eukaryotic host cells. By introducing the appropriate promoter and associated expression sequence into the vector, the gene can be expressed in an individual host cell.

Illustrative prokaryotic host cells include Escherichia coli, Bacillus subtillis, and Bacillus thermophilus. The gene of interest can be expressed in these host cells by transforming them with a replicon (eg, a plasmid vector that grows the primer and a sequence regulator) derived from a host-compatible species. A preferred vector is one that has a sequence capable of transforming a cell with selectivity for an expressed personality (phenotype).

For example, E. coli can be transformed with pBR322 which is a vector capable of replicating E. coli (see Bolivar, Gene 2, 95(1975)). This vector contains both ampicillin- and tetracycline-resistance genes whose properties can be used to identify the transformed cell.

Examples of promoters that are essential for gene expression in prokaryotic hosts include the δ-lactose gene promoter /Chang et al., Nature, 275, 615(1978)/, lactose promoter /see Goeddel et al, Nature, 281, 544(1979)/ and the tryptophan promoter /see Goeddel et al, Nucleic Acid Res., 8, 4057(1980)7 et seq. Any of these promoters can be used in the production of polypeptides having human G-CSF activity according to the present invention.

A eukaryotic microorganism such as Saccharomyces cerevisiae can be used as a host cell and transformed with a vector such as the YRp7 plasmid (see Stinchcomb et al., Nature, 282, 39(1979)). This plasmid has the TRP1 gene as a selection marker for yeast species capable of producing tryptophan, so transformants can be selected by growth in the absence of tryptophan. Examples of promoters that can be used for gene expression include the acid phosphatase gene promoter /Miyanohara et al., Proc. Natl. Acad. Sci., USA, 80, 1(1983)/ and alcohol dehydrogenase gene promoter /Valenzuela et al., Nature, 298, 347(1982)/.

The host cell can also be derived from mammalian cells such as COS cells, Chinese Hamster Ovary (CHO) cells, C-127 cells and Hela cells. An illustrative vector that can be used to transform these cells is pSV2-gpr /see Mulligan and Berg; Proc. Natl. Acad. Sci., USA, 78, 2072(1981)/. The vectors used to transform these cells contain a primer, a selectable marker, a promoter preceding the position where the gene will be expressed, a TNA joining site, a polyadenylation signal, etc.

Illustrative promoters that can be used for gene expression in mammalian cells include retrovirus promoters, polyoma virus, adenovirus, simian virus 40 (SV40), etc. If the SV40 promoter is used, the desired gene expression can be easily achieved according to the method of Mulligan et al. described in Nature, 277, 108(1979).

Illustrative primers that may be used include those derived from SV40, polyoma virus, adenovirus, bovine papilloma virus (BVP), etc. Illustrative selectable markers that may be used include the phosphotransferase APH (3') II or I (neo) gene, thymidine kinase (TK) gene, E. coli xanthine guanine phosphoribosyltransferase (Ecogpt) gene, dihydrofolate reductase (DHFR) gene, etc.

In order to obtain a polypeptide having human G-CSF activity from the host-vector systems mentioned above, the following procedures can be used: the coding gene for a peptide having human G-CSF activity is inserted into a suitable place in one of the vectors mentioned above; the host cell is transformed to obtain recombinant DNA; and the obtained transformants are cultivated. The desired polypeptide can be isolated and purified from the cell or culture solution by any of the known techniques.

Eukaryotic genes are generally considered to exhibit polymorphism as is known for the case of the human interferon gene (see Nichi et al., J. Biochem., 97, 153(1985)). And this phenomenon can cause the substitution of one or more amino acids in the nucleotide sequence, but not a change in the entire amino acid sequence.

G-CSF activity may also be possessed by a polypeptide that is missing one or more amino acids in the amino acid sequence of Figures 3(B) or 4(B) or that has such amino acids added, or a polypeptide that has one or more of these acids replaced by one or more amino acids. It is also known that the polypeptide obtained by translating each of the cysteine codons in the human interleukin-2 (IL-2) gene to a serine codon has interleukin-2 activity /Wang et al., Science, 224, 1431(1984)/. Therefore, as long as the polypeptides, whether natural or chemically synthesized, have human G-CSF activity, all genes encoding these polypeptides, recombinant vectors containing these genes, transformants obtained using such recombinant vectors, and polypeptides or glycoproteins obtained by culturing such transformants falls within the scope of this invention.

Below are the procedures for obtaining the gene of this invention coding for a polypeptide having human G-CSF activity, a recombinant vector having said gene and a transformant having this recombinant vector, and a polypeptide or glycoprotein having human G-CSF activity expressed in this transformant.

(1) Preparation of rehearsal

Homogeneous human CSF protein was purified from the culture supernatant of the tumor cell line CHU-2 and its amino acid sequence from the N terminus was determined. The fragments were obtained by digestion with cyanide bromide and treatment with trypsin, and the amino acid sequences of these fragments were determined (example 3(i), (ii) and (iii)/.

From the specified amino acid sequences, three nucleotide probes, (A), (LC) and (IWQ), having the sequences shown in Figure (1) (Example 4), were synthesized. Sample (A) was of the type mixture composed of 14 successive nucleotides. The probe (IWQ) was composed of 30 successive nucleotides with deoxynosine and was a probe of the type used in the cloning of the human cholecystokinin gene /Takahashi et al., Proc. Natl. Acad. Sci, USA 82, 1931(1985)/. The probe (LC) was a 24-nucleotide probe that was synthesized from nucleotides at positions 32-39 from the N terminus of the amino acid sequence shown in Example 3(i) based on the nucleotide sequence shown in Figure 3.

Chemical syntheses of nucleotides can be performed using the improved fpsfortriester method in the solid phase described by Narang /Tetrahedron, 39, 3-22 (1983)/.

Probes based on amino acid sequences at positions other than those in the above probes can also be used.

(2) Creation of cDNA library

CHU-2 cells were homogenized after addition of guanidine thiocyanate solution and total RNA obtained by CsCl density gradient centrifugation.

Poly(A+) RNA was isolated from total RNA by chromatography on an oligo (dT)-cellulose column. A single-stranded cDNA was then synthesized with reverse transcriptase, and both RNAse H and E. coli DNA polymerase I were added to form a double-stranded cDNA. The dC chain was joined to the thus obtained double cDNA, which was inserted into the vector, pBR322, and the dG chain was joined to the Pst I splice site. The obtained recombinant DNA was used to transform the E. coli strain, XI776, and the pBR322 cDNA library line was created (examples 5 and 6).

In a similar manner, the double-stranded cDNA was ligated to the λgt10 vector with an EcoRI linker and a λ-phage cDNA library line was generated (Example 7).

(3) Testing

Recombinants derived from the pBR322-line cDNA library were fixed on Whatman 541 filter paper and a single clone could be isolated by colony hybridization with a 32P-labeled probe (IWQ). Further study with the Southern blotting method /Southern, J. Mol. Biol, 98, 503(1975)/ shows that this clone also hydrolyzed with probe (A). The nucleotide sequence of this clone was determined using the dideoxy method /Sanger, Science, 214, 1205(1981)/.

The nucleotide sequence of the resulting cDNA fragment is shown in Figure 2, from which it can be seen that this fragment contains 308 base pairs including probes (IWQ) and (A), and has an open reading frame coding for 83 amino acids containing the amino acid sequence shown in the example 3(iii). The pBR322 derived plasmid containing 308 base pairs is designated below as pHCS-1 (Example 8).

A DNA fragment containing 308 base pairs obtained from pHCS-1 was radiolabeled using the translational nick method (see Molecular Cloning, ibid) and this fragment was used as a probe, a λgt10-derived cDNA library was screened by infectious hybridization /Benton and Davis, Science , 196, 180(1977)/ so that 5 clones are obtained. The nucleotide sequence of the clone believed to contain cDNA was determined using the same method as described above /(Figure 3(A)/).

As shown in Figure 3(A), this cDNA portion has a single wide open reading frame.

The amino acid sequence encoded by this cDNA can be shown as in Figure 3(A).

Comparison with the N-terminal amino acid sequence of the G-CSF protein shown in Example 3(i) shows that this cDNA contains a nucleotide sequence corresponding to a signal peptide encoded by 90 base pairs with an ATG sequence at 32-34 nucleotide positions from the 5'-terminus and ending with a GCC sequence at positions 119-121, and a mature G-CSF polypeptide encoded by a 531 base pair primer with an ACC sequence at positions 122-124 and ending with a CCC sequence at positions 650-652. Therefore, the polypeptide of amino acid sequence I shown in Figure 3(B) is composed of 207 amino acids and has a calculated molecular weight of 22292.67 daltons. Amino acid sequence II polypeptide is composed of 177 amino acids and has a calculated molecular weight of 18986.74 daltons (Example 9).

It should be noted that ATG at positions 32-34 or at positions 68-70 can also be considered as the starting site of the protein. Escherichia coli strain X1776 growing pBR322 having a cDNA + (VSE) at the EcoRI cleavage site is deposited in the "Fermentation Research Institute, Agency of Industrial Science and Technology" (FERM BP.954).

Figure 6 shows the restriction enzyme cleavage sites of the gene.

This cDNA was ligated to pBR327 /Sorberon et al., Gene, 9, 287(1980)/ at the EcoRI site and the resulting plasmid is designated below as pBRG4.

pBRG4 thus obtained was treated with the restriction enzyme, EcoRI, so that a DNA fragment containing a cDNA of about 1500 base pairs is obtained. This fragment was radiolabeled using the translational incision method (see Molecular Cloning, also) and, with this radiolabeled DNA fragment used as a probe, the λgt10-derived library was tested again by infection hybridization (see also Benton and Darvis). In this infection hybridization, two strips of nitrocellulose paper were prepared on which λ-phage DNA was fixed; one of these strips was used for the above-mentioned infection hybridization, and the other was subjected to infection hybridization with the already described probe (LC). Phages that were positive for both tests were selected. A clone having the "full length" cDNA was selected and the nucleotide sequence of the portion of the cDNA determined by the dideoxy method is shown in Figure 4(A).

This cDNA has a single wide open reading frame and the amino acid sequence to be encoded by this cDNA is derived as shown in Figure 4(A).

Comparison with the N-terminal amino acid sequence of the G-CSF protein shown in Example 3(i) shows that this cDNA contains a nucleotide sequence corresponding to a signal peptide encoded by 90 base pairs beginning with an ATG sequence at 31-32 nucleotide positions from the 5'- terminal and ending with the GCC sequence at positions 118-120 and the mature G-CSF peptide encoded by 522 base pairs starting with the ACC sequence at positions 121-123 and ending with the CCC sequence at positions 640-642. Therefore, the polypeptide of amino acid sequence I shown in Figure 4(B) is composed of 204 amino acids and its molecular weight is calculated as 21977.35 daltons. The polypeptide of amino acid sequence II is composed of 174 amino acids and its molecular mass is calculated to be 18671.42 daltons (Example 10).

It should be noted that ATG at positions 58-60 or at positions 67-69 can also be considered as a protein start site.

Escherichia coli strain X1776 growing pBR322 having this cDNA (-VSE) at the EcoRI cleavage site is deposited in the "Fermentation Research Insdtute, Agency of Industrial Science and Technology" (FERM BP.955).

Figure 6 shows the restriction enzyme cleavage sites of the gene. This cDNA was ligated into pBR327 at the EcoRI site to generate a plasmid designated below as pBRV2.

(4) Human chromosomal gene library testing

The human chromosomal gene library obtained according to the procedures described by Maniatis et al. (Molecular Cloning, too) was tested with pHCS-1 shown above. Probes that can be used for testing include: pHCS-1-derived 308-bp DNA fragment, pBRG4-derived 1500-bp DNA fragment, pBRV2-derived 1500-bp DNA fragment, DNA fragment of appropriate length containing part of one or more DNA fragments , as well as the above-mentioned nucleotide probes / e.g. (IWQ), (A) and (IC)/. A case of using the pHCS -1 DNA fragment is described below.

This DNA fragment was radioisotope labeled with 32P according to the translational cleavage method /see Roop et al., Cell, 15, 431(1978)/. With the resulting 32 P-labeled fragment used as a probe, the human chromosomal gene library was screened by infection hybridization (see also Benton and Davis), yielding ten-second clones.

After extracting the DNA from the clones, an enzyme map was prepared using known procedures /Fritsch et al., Cell, 19, 959 (1980)/.

Southeron blotting was performed with the same probe (see also Southeron) and a DNA fragment of about 4 kb was found to be excised with AcoRI and Khol potentially containing the coding region of the human G-CSF polypeptide. Therefore, a 4-kb DNA fragment was inserted into pBR327 at the EcoRI site using the EcoRI linker to give pBRCE3β. With this plasmid used as the DNA base sequence, the nucleotide sequence of the 3-kb part of the 4-kb DNA fragment was determined using the dideoxy method. The said fragment was found to be the gene coding for the human G-CSF polypeptide (Figure 5).

E. coli strain X1776 growing pBRCE3β (ie, plasmid pBR327 having the aforementioned 4-kb DNA fragment inserted into the EcoRI site) is deposited in the "Fermentation Research Institute, Agency of Industrial Science and Technology" (FERM BP.956).

A comparison between the pBRG4 cDNA part shown in Figure 3 and the pBRV2 cDNA part shown in Figure 4 shows that the discussed DNA part contains five exon parts, therefore it encodes only the amino acid sequences derived from pBRG4 and pBRV2.

Figure 7 shows the restriction enzyme cleavage site of the resulting gene. This DNA fragment contains the chromosomal gene for human G-CSF, or the region preceding it that is transcribed into human G-CSF mRNA, plus a nucleotide sequence that participates in transcriptional control /Benoist and Chambon, Nature, 290, 304(1981); and Breathnack and Chambon, Ann. Rev. Biochem., 50, 349(1981)/.

(5) Construction of a recombinant vector for expression in E. coli

(A) -VSE line recombinant vector

From the pBRG4 plasmid obtained in (3) (Example 9), the cDNA fragment of the G-CSF peptide was cut with a restriction enzyme and the recombinant vector was made by one of the following methods:

(i) using a quenched synthetic linker, the fragment was ligated to a fragment derived from the tac promoter containing pKK223-3 (Pharmacia Fine Chemicals) (Example 12 and Figure 18);

(ii) three fragments obtained from the PL promoter containing PPL-lambda ((Pharmacia Fine Chemicals)) are ligated with a hardened synthetic linker and the ligation product and the fragment are subjected to a reassembly procedure to form a recombinant vector (Example 13, Figure 9); or

(iii) using a hardened synthetic linker, the fragment is ligated to a fragment derived from the trp promoter containing the pOYI plasmid (Example 14 and Figure 10).

(B) -VSE clinical recombinant vector

In the same manner as described above, three recombinant vectors were made using plasmid pBRV2 (Example 10) as shown in Example 19 and Figures 11, 12 and 13.

(6) Obtaining the E. coli transformant and its cultivation and expression

Using three recombinant vectors each of +VSE and -VSE lines, E. coli strains DH1, N4830 or JM105 were transformed with calcium chloride or rubidium chloride by the procedure described in Molecular Cloning, also (Examples 12, 13, 14 and 19). Each of the resulting transformants was cultured in Luria medium containing ampicillin, with induction performed as required for the desired expression (Examples 15 and 20).

(7) Separation and purification of G-CSF polypeptide from E. coli and analysis of its amino acids

The transformant culture solution was centrifuged to obtain a pellet of cells. The collected cells were treated with lysozyme and then the supernatant was obtained by cyclic freezing and thawing. Alternatively, the cells were treated with guanidine chloride, centrifuged and the supernatant was collected.

The supernatant was subjected to gel filtration on an Ultrogel ACA54 column (LKB) and the active fractions were concentrated with an ultrafiltration apparatus.

Then, an aqueous solution of trifluoroacetic acid containing n-propanol was added to the concentrate and it was placed in ice. The mixture was centrifuged and adsorbed on a reverse-phase C18 column. After elution, the activity of the fractions was tested. Active fractions were collected and subjected to the same purification procedure described above. The purified fractions were freeze-dried and the powder was thawed and subjected to molecular size-based HP liquid chromatography. The resulting polypeptides were subjected to SDS polyacrylamide gel electrophoresis and distinct bands for the desired G-CSF polypeptide were found (Examples 16 and 20). The resulting polypeptide shows human G-CSF activity (examples 17 and 20). G-CSF polypeptide was analyzed by the amino acid analysis procedure with a Hitachi 835 Automatic Acid Analyzer (Hitachi, Ltd.). For the analysis of N-terminal amino acids, a gas-phase array tester (for Edman decomposition), a high-pressure liquid chromatography apparatus and an Ultrasphere-ODS column (examples 18 and 21) were used.

(8) Creation of recombinant vectors for animal cells

Recombinant vectors (derived from BPV) for use with C127 and NiH3T3 host cells are available for each of the +VSE and -VSE cDNA lines and for each chromosomal gene. Recombinant vectors (with dhfr) for use with CHO cells were also made for each +VSE and -VSE cDNA line and for the chromosomal gene. Recombinant vectors for use with COS cells have also been constructed. Representative examples are described below in more detail and with an indication of working examples.

(A) Generation of recombinant vectors of +VSE and -VSE lines

The cDNA fragment obtained in (3) was inserted into the pdKCR vector so that plasmid pHGA 410 (example 22 and figure 14) was created, which was partially digested with EcoRI and then treated with polymerase I (Klenow fragment) so that open ends were formed. The HindIII binder is bound to the DNA, which is then treated with HindIII and T4DNA ligase. The treated DNA was used to transform E. coli strain DH1 by the rubidium chloride method (see also Molecular Cloning). The resulting plasmid was named pHGA410(H) (Figure 15).

pHGA410(H) was treated with SalI and, after which open ends were formed, it was then treated again with HindIII and the HindIII-SalI fragment was isolated. Plasmid pdBPV-1 having a transformed fragment of bovine papillomavirus was treated with HindIII and PvuII and the large DNA fragment was cleaved and ligated to a separately prepared HindIII-SalI fragment. Fragment ligation was used to transform E. coli strain DH1 to yield plasmid PTN-G4, which has a pHGA410-derived G-CSF-cDNA (Figure 15 and Example 23).

Plasmid pHGA410 or pHGA410(H), combined with plasmid pAdD26SVpA was used to generate pHGG4-dhfr which was a recombinant vector (+VSE) for use with CHO cells (Figures 16a and b, and Example 25).

A 2-kb fragment containing the dhfr gene was excised from pAdD26SVpA by treatment with EcoRI and BamHI and the excised fragment was inserted into pHGA410(H) in situ to generate pG4DR1 and pG4DR2 (Figure 16c and Example 25).

(B) Generation of the -VSE line of recombinant vectors

The cDNA (-VSE) fragment obtained in (3) was inserted into the pdKCR vector to form the pHGV2 plasmid (example 28), which was partially digested with EcoRI and then treated with DNA polymerase I (Klenow fragment) to create open ends. The HindIII binder was attached to the DNA, which was then treated with HindIII and T4DNA ligase. The treated DNA was used to transform E. coli strain DH1 by the rubidium chloride method (see also Molecular Cloning). The resulting plasmid was named pHGV2(H) (Figure 18).

pHGV2(H) was treated with SalI and, after that, open ends were created, and the HindIII-SalI fragment was isolated by retreatment with HindIII. Plasmid pdBPV-1 having a transformed fragment of bovine papillomavirus was treated with HindIII and PvuII and the large DNA fragment was isolated and ligated to a separately prepared Hind-III-SalI fragment. The attached fragments were used to transform E. coli strain DH1 to yield a plasmid, pTN-V2, having a pHGV2-derived CSF-cDNA (Figure 18 and Example 29).

By similar procedures the pHGV2 or pHGV2(H) plasmid, in combination with the plasmid pAdD26SVpA was used to obtain pHGV2-dhfr which was a recombinant vector (-VSE) for use with CHO cells (Figures 19a and b, and Example 31).

A DNA fragment of about 2kb containing the dhfr gene was isolated from pAdD26SCpA by treatment with EcoRI and BamHI and the isolated fragment was inserted into pHGV2(H) at the HindIII site so that pV2DR1 and pV2DR2 were created (Figure 19 c and example 31).

(C) Creation of recombinant vectors containing the chromosomal gene

Plasmid pBRCE3 obtained in (4) and containing the chromosomal gene shown in Figure 5 was treated with EcoRI.

The pSVH+K+ plasmid described by Banerji et al., Cell, 27, 299(1981) was treated with KpnI to remove the globin gene.

The plasmid was further subjected to partial digestion with HindIII to remove part of the residual SV40 gene. The fragments were rejoined to form the pML-E+ expression vector.

This vector was treated with restriction enzyme EcoRI, and dephosphorylated with alkaline phosphate (Takara Shuzo Co., Ltd.). Thus, a DNA vector was obtained, which was linked to the above-mentioned chromosomal DNA fragment by T4DNA ligase (Takara Shuzo Co., Ltd.) to obtain pMLCE3, which was a recombinant vector for COS cells (Example 34). As shown in Figure 20, this plasmid contains the SV40 gene enhancer, the SV40 origin replicator, the pBR322 origin replicator and the pBR322-derived β-lactamase gene (Ampr) and has the human G-CSF chromosomal gene fused downstream of the SV40 gene enhancer.

An expression vector for C127 cells was made by the following procedure. The DNA fragment containing the chromosomal CSF gene was pulled out with the appropriate enzyme from pMLCE3α having an expression vector for COS cells. This fragment was ligated, with T4DNA ligase, to a DNA fragment containing the beginning of bovine papillomavirus (BPV) and a DNA fragment containing the SV40 promoter. The resulting pTNCE3α was an expression vector having the chromosomal CSF gene linked under the SV40 promoter containing 65% of the BPV portion.

The expression vector for CHO cells has two DNA fragments linked together with T4DNA ligase; one fragment containing the chromosomal CSF gene and the earlier SV40 promoter in case of an expression vector for C177 cells, and the other fragment containing the pAdD26SVpA-derived dhfr gene. The resulting pD26SVCE3α was an expression vector that has the chromosomal CSF gene under the SV40 promoter, the dhfr gene under the last adenovirus promoter.

(9) Expression in animal cells

Two representative examples are described below, and for more details see the corresponding working examples.

(A) Expression in mouse C127 cells

Plasmid pTN-G4 or pTN-V2 was treated with BamHI. The treated plasmid was used to transform C127 cells (previously grown by culturing) by the calcium-phosphate method. The transformed cells were cultured and clones were selected that had a high rate of CSF production. Glycoproteins containing expressed G-CSF were isolated and purified from the culture solution of transformed cells and found to possess human G-CSF activity. The presence of the desired glycoprotein was also confirmed by analyzing the amino acids and sugars in the sample.

For the analysis of sugar content, the CSF sample used for amino acid analysis was subjected to the determination of amino sugars using the Elson-Margan method, the determination of neutral sugars using the orcinol-sulfate method, or the determination of sialic acid using the thiobarbiturate method. All determination procedures are described in 'Tohshitsu no Kagaku "Chemistry of Saccharides" (part 2 of the second part), Chapter 13, vol. 4 A of "A Course in Biochemical Experiments", published by Tokyo Kagaku Dojin. Translating the measured values into mass percentages showed that the obtained sugar content was in the range of 1-20% depending on the type of host cells, expression vector and cultivation conditions.

(B) Expression in COS cells

COS cells, which were derived from monkey CV-L cells and which were transformed with an SV40-start deficient mutant to express the SV40 large T antigen (see Gluzman et al, Cell, 32, 175 (1981)) were transformed with the pMLCE3α vector which obtained in (5) (C) and containing the human chromosomal G-CSF gene. COS cell culture supernatant exhibits human G-CSF activity (Example 35).

COS cells were isolated and subjected to mRNA analysis, which showed the presence of two mRNAs corresponding to the amino acid sequences shown in Figures 3(A) and 4(A).

Examples

This invention is described in detail above with regard to working examples. The following reference example is given in order to illustrate the procedures for testing CSF activity.

Reference example: Examination of CSF activity

The following examples were used to determine the CSF activity (referred to below as CSA) in the present invention.

CSA tests

(a) with human bone marrow cells

A single layer of soft agar was used for cultivation according to the method of Bradley, T.R. and Metcalf, D. (Aust. J. Exp. Biol. Med. ScL, 44, 287-300(1966). More specifically, 0.2 ml bovine embryo serum, 0.1 ml sample, 0.1 ml suspension of human sta bone marrow (1-2x105 cell nuclei), 0.2 ml of modified MsCoy's 5A culture solution containing 0.75% agar, was poured into a plastic tissue culture dish (diameter 55 mm), coagulated and cultured on 37°C in 5% CO2/95% air and 100% humidity.Ten days later, the number of colonies formed (one colony consists of at least 50 cells) was determined and the CSA was determined so that one unit of activity was required to form one colonies.

(b) with mouse bone marrow cells

Horse serum (0.4 ml), 0.1 ml sample, 0.1 ml suspension of female mouse C3H/He bone marrow cells (0.5-1x105 cell nuclei), and 0.4 ml modified McCoy's 5A culture solution containing 0.75% agar was poured into a plastic dish for tissue culture (diameter 55 mm), coagulated and cultured at 37°C in 5% CO2/95% air and 100% humidity.

Ten days later, the number of formed colonies was determined (one colony consists of at least 50 cells) and the CSA was determined so that one unit of activity was required to form one colony.

The modified McCoy 5A culture solution used in each of methods (a) and (b) and the human bone marrow cell suspension used in (a) were obtained by the following procedures.

Modified McCoy's 5A culture solution (double concentrated)

12 grams of opopin McCoy's 5A culture (Gibco), 2.55 g of MEM amino acid-vitamin medium (Nissui Seiyaku Co., Ltd.), 2.18 g of sodium bicarbonate, and 50,000 units of potassium penicillin G were dissolved twice in 500 ml of distilled of water and the solution was aseptically filtered through a Millipore filter (0.22 µm).

Suspension of human bone marrow cells

Bone marrow fluid obtained from a healthy person by sterile puncture was diluted 5 times with RPMI 1640 culture solution and placed over Ficol-infection solution (Pharmacia Fine Chemicals) and centrifuged at 400 g for 30 minutes at 25°C. A layer of interfacial cells with a density of less than 1.077 was isolated. Cells were washed, and the concentration was adjusted to 5x106 cells/ml with RPMI 1640 culture solution containing 20% fetal bovine serum, poured into a 25 cm3 plastic tissue culture flask and incubated for 30 minutes in a CO2 incubator. Non-adherent cells were separated in the supernatant, poured into a 25 cm3 plastic bottle and incubated for 2.5 hours. Non-adherent cells in the supernatant were collected and used in the study.

Example 1:

Establishment of CHU-2

The tumor of a patient with oral Ca, where a pronounced increase was observed in the number of neutrophils, was transplanted into a nu/nu mouse. About 10 days after transplantation, there was a marked increase in tumor mass and the number of neutrophils. 12 days after surgery, the tumor was aseptically extracted, cut into 1-2 mm3 cubes and cultured as follows.

10 to 15 cubes were placed in a 50 ml plastic centrifuge tube. After adding 5 ml of trypsin solution (containing 0.25% trypsin and 0.02% EDTA), the tube was shaken for 10 minutes in a warm bath at 37°C and the supernatant was discarded. Another 5 ml of the same trypsin solution was added and cleavage by trypsin was performed with stirring for 15 minutes at 37°C. The supernatant cell suspension was separated and placed in ice, since the trypsin was deactivated by the addition of 1 ml of bovine embryo serum.

After repeating these procedures once more, the cell suspension was separated, combined with the previously obtained suspension and centrifuged at 15,000 rpm for 10 minutes to obtain a cell pellet. The tablet was washed twice with F-10 containing 10% fetal bovine serum and then transferred to a 25 cm3 plastic bottle so that the cell concentration was 5x106 cells/bottle. After overnight incubation in a CO2 incubator (5% CO2 and 100% humidity) with F-10 culture solution containing 10% fetal bovine serum, the supernatant was removed along with non-adherent cells, and culturing was continued with freshly added culture solution. Six days after the start of culturing, the bottle becomes filled with cells and the culture solution is replaced with fresh. The next day, the culture solution was discarded and the bottle was supplemented with 2 ml of anti-mouse erythrocyte antibody (Cappel) diluted 5-fold with RPMI 1640 and 2 ml of guinea pig complement (Kyokuto Seyasku Co., Ltd.) diluted 2.5 times with RPMI 1640. After incubation for 20 minutes at 37°C, the culture was washed twice with F-10 containing 10% fetal bovine serum and the derived nu/nu mouse fibroblasts were removed. F-10 culture solution containing 10% bovine embryo serum was then added and cultivation was continued for another two days. After this, the same cells were isolated and subjected to cloning using the limiting dilution method.

The obtained 11 clones were tested for CSF activity and one clone (CHU-2) showed an activity about 10 times higher than that of the other clones.

Example 2:

Isolation of CSF

Cells based on example 1 were grown in a fairly dense population in two culture flasks (150 cm 3 ). Cells were isolated, suspended in 500 ml of F-10 culture solution containing 10% fetal bovine serum, transferred to a 1580 cm 3 glass rotary flask (Delco), and cultured by rotation at 0.5 rpm. When the cells were found to have grown in a fairly dense population on the inner wall of the rotating flask, the culture solution was replaced with serum-free RPMI 1640. After 4 days of cultivation, the culture supernatant was removed and cultivation was continued with F-10 containing 10% fetal bovine serum added. After the 3rd day of cultivation, the culture solution was replaced again with serum-free RPMI 1640 and the culture supernatant was removed 4 days later. By repeating this procedure, 500 ml of serum-free supernatant was obtained every week. Furthermore, this method enables extraction of the culture supernatant, with cells maintained over a significantly extended period.

A batch containing 5000 ml of culture supernatant was obtained by mixing with 0.1% Tween 20 and concentrated about 1000 times by ultrafiltration with Hollow Fiber DC-4 and Amicon PM-10 (Amicon). The concentrate is purified in the following stages:

(i) A portion (5 ml) of the concentrated culture supernatant was subjected to gel filtration on an Ultrogen AcA54 column (diameter 4.6 cm and length 90 cm; LKB) at a flow rate of about 50 ml/hr with 0.01 M Tris-HCl buffer ( pH 7.4) containing 0.15 M NaCl and 0.01% Tween 20 (Nakai Kagaku Co., Ltd.). The column was calibrated with bovine serum albumin (M 67000), ovalbumin (M 45000) and cytochrome C (M 12400). After completion of filtration, 0.1 ml of each fraction was diluted 10-fold and tested for activity using the CSA assay method described above (b). Fractions 400-700 ml were found to show macrophage-dominant CSA while fractions 800-1200 ml showed granulocyte-dominant CSA. Therefore, the last fractions were collected and concentrated to a volume of about 5 ml on an ultrafiltration apparatus with PM-10 (Amico).

(ii) An aqueous solution of 0.1% trifluoroacetic acid containing 30% n-propanol (for amino acid sequence determination; obtained from Tokyo Kasei K.K.) was added to the concentrated fractions. The mixture was then allowed to stand in ice for about 15 minutes, the precipitate was removed by centrifugation for 10 minutes at 15000 rpm. The supernatant was adsorbed on a µ-Bondpak C18 column (8 mmx30 cm for semipreparative use; Waters (equilibrated with an aqueous solution containing n-propanol and trifluoroacetic acid; the column was continuously eluted with an aqueous solution of 0.1% trifluoroacetic acid containing n-propanol which has a linear concentration gradient of 30-60%. High pressure liquid chromatography apparatus, Hitachi Model 685-50 (Hitachi, Ltd.) and detector, Hitachi Model 638-41 (Hitachi, Ltd.) were used to determine adsorption on 220 nm and 280 nm, simultaneously. After elution, 10 µl of each fraction was diluted 100 times and tested for active fractions by the CSA assay method described above (b). Peaks eluted with 40% n-propanol were found to have CSA activity, so they were collected and rechromatographed under the same conditions, and assayed for CSA by the same method. Again, CSA activity was observed in peaks at 40% n-propanol. Therefore, these peaks were pooled (4 fractions = 4 ml) and dried with to freeze.

(iii) The freeze-dried powder was dissolved in 200 µl of an aqueous solution of 0.1% trifluoroacetic acid containing 40% n-propanol and the solution was subjected to high pressure liquid chromatography on a TSK-G 3000SW column (Toya Soda Manufacturing Co., Ltd. ; 7.5 mmx60 cm). Elution was performed with the same aqueous solution at a flow rate of 0.4 ml/min and fractions were taken in portions of 0.4 ml with a fraction collector, FRAC-100 (Pharmacia Fine Chemicals). Each fraction was assayed for CSA by the same method as described above and activity was observed in fractions for retention times of 37-38 minutes (corresponding to a molecular weight of 2x10 4 ). Active fractions were separated and purified on an analytical µ-Bond-pak C18 column (4.6 mmx30 cm). The main peaks were separated and freeze-dried. The obtained sample was tested using the CSA test method (a); was found to have human G-CSF activity.

Example 3:

Determination of amino acid sequence

(i) Determination of the N-terminal amino acid sequence

The sample was subjected to Edman digestion with a plinko-phase sequencer (App. Biosystems) and the obtained PTH amino acid was analyzed by a routine procedure with a high-pressure liquid chromatography apparatus (Beckman Instruments) and an Ultrasphere-ODS column (Beckman Instruments). The column (5 µm; 4.6 mmx250 mm) was equilibrated with starting buffer (aqueous solution containing 15 mM sodium acetate buffer (pH 4.5 and 40% acetonitrile)) and loaded with sample (dissolved in 20 µl of starting buffer). The separation was performed by elution once with the starting buffer. The flow rate was 1.4 ml/min and the column was maintained at a temperature of 40°C. Detection of PTH amino acid was performed using absorption in the UV region at 260 nm and 320 nm. Standard samples of PTH amino acid (Sigma) in 2-nmol aliquots were separated on the same line to determine its retention time, which was compared with that of the sample under investigation.The sample was found to have the following N-terminal 40-residue amino acid sequence:

[image]

(ii) Decomposition with cyanide bromine

The sample was dissolved in 70% formic acid. 200 equivalent amounts of cyanide bromine, which had been purified by sublimation, were added to the solution. The mixture was left overnight at 37°C for reaction. The reaction product was freeze-dried and fractionated by HPLC on a TSK G3000SW column (Toyo Soda Manufacturing Co., Ltd.) to give 4 peaks. The peaks are named CN-1, CN-2, CN-3 and CN-4 with decreasing molecular masses. The first two peaks (CN-1 and CN-2) have better yields and their amino acid sequences were analyzed with an automatic sequencer (App. Biosystems) under the same conditions as in (i).

CN-1 was found to be a peptide composed of the N-terminal of the G-CSF protein, and CN-2 was the following amino acid sequence:

[image]

(iii) Digestion with trypsin

The sample was dissolved in 0.1 M Tris-HCl buffer (pH 7.4) containing 8 M urea and the solution was mixed with 0.1 M Tris-HCl buffer (pH 7.4) containing 0.1% 2-mercaptoethanol. to give a final urea concentration of 2 M. TPCK-treated trypsin (Sigma) was added so that the sample:enzyme ratio was 50:1. The mixture was kept at 25°C for 4 hours and after the addition of the same amount of TPCK-treated trypsin, the mixture was additionally kept at 25°C for 16 hours. Next, the reaction product was subjected to reverse-phase flash column chromatography (Yamamura Kagaku K.K.), with elution performed with 0.1% THA containing n-propanol having a linear density gradient from 5 to 60%.

Although multiple peaks were obtained by measuring absorbance at 280 nm, the main peak was analyzed for its amino acid sequence with an automatic gas-phase sequencer (App. Biosystems) under the same conditions as in (i). The major peak was found to be a peptide having the following sequence containing part of the CN-2 fragment shown in (ii):

[image]

Example 4:

Preparation of DNA test

(i) Probe synthesis

30 successive nucleotides (see Figure 1) were obtained based on a sequence of 10 amino acids (Ile-Trp-Gln-Met-Glu-Glu-Gly-Met) included in the amino acid sequence obtained in example 3(iii). It will be necessary to make one comment about the labeling of the nucleotides shown in Figure 1; for example, the nucleotide at the 9-position of the 5'-terminus is an equimolar mixture of dA and dG. Starting nucleotides are mostly dimers, but monomers were also used if requested. A glass filter column was loaded with 20 mg of starting nucleotide resin, Ap-d(G) (Yamasa Shoyu Co., Ltd). After repeated washing with methylene chloride, the 4,4'-dimethyloxytrityl group was eliminated by treatment with a methylene chloride solution containing 3% trichloroacetic acid. Then the column was washed several times with 1 ml of methylene chloride. The column was then washed with anhydrous pyridine to expel the solvent, 20 mg of nucleotide dimer (DMTr)ApTp(NH3), (Nippon Zeon; NH3=triethylammonium; DMTr=dimethoxytrityl) and 0.2 ml of pyridine was added, and the inside of the column was vacuum dried. with a vacuum pump. Then, 20 mg of 2,4,6-trimethylbenzenesulfonyl-3-nitrothiazolide (MSNT Wako Pure Chemical Industries, Ltd.) and 0.2 ml of anhydrous pyridine were added, and the inside of the column was flushed with nitrogen gas. The nucleotide resin was condensed with the dimer reaction for 45 minutes at room temperature, with occasional shaking. At the end of the reaction, the column was washed with pyridine and the unreacted OH groups were acetylated with a pyridine solution containing an excess of acetic anhydride and 4-dimethylamino pyridine. After washing the column with pyridine, the following dimers or monomers were condensed, according to the written order, by repeating the procedures described above; (DMTr)Ip(NH3), (DMTr)GpGp(NH3), (DMTr)Ip(NH3), equimolar mixture of (DMTr)CpTp(NH3) and (DMTr)TpTp(NH3), equimolar mixture of (DMTr) ApAp(NH3 ) and (DMTr)ApGp(NH3), (DMTr)GpAp(NH3), (DMTr)TpGp(NH3), an equimolar mixture of (DMTr) ApAp(NH3) and (DMTr)GpAp(NH3), (DMTr)CpAp(NH3 ), an equimolar mixture of (DMTr)ApAp(NH3), (DMTr)ApGp(NH3), (DMTr)GpCp(NH3), (DMTr)TpGp(NH3), (DMTr)Ip(NH3) and (DMTr)ApTp(NH3 ), with all these nucleotides available from Nippon Zeon, except for (DMTr)Ip(NH3), which was available from Yamasa Shoyu Co., Ltd. At the end of the reaction in the last step, the resin was washed with pyridine, then with methylene chloride and finally with ether without acetylation, and then dried. The dried resin was suspended in 1.7 ml of a mixture of pyridine (0.5 ml), water (0.2 ml) and dioxane (1 ml), containing 1 M tetramethylguanidine and 1 M α-picolinaldoxime. The suspension was allowed to stand overnight at room temperature, and then concentrated to 100-200 µl under vacuum. The concentrate was mixed with a small amount (2-3 drops) of pyridine and 2-3 ml of concentrated dissolved ammonia, and the mixture was heated at 55°C for 6 hours. Using extraction with ethyl acetate, the aqueous layer was separated and concentrated under vacuum. The concentrate was dissolved in a solution of 50 mM triethyl ammonium acetate (pH 7) and the solution was subjected to chromatography on a C-18 column (1.0x15 cm; Waters), eluting with acetonitrile (10-30% linear density gradient) in solution of 50 mM triethylammonium acetate (pH 7.0). The eluted peak fraction at an acetonitrile concentration of about 25% was concentrated under vacuum.

80% acetic acid was added to the concentrate and the mixture was left to stand for 30 minutes at room temperature. Using extraction with ethyl acetate, the aqueous layer was separated and concentrated under vacuum. The resulting concentrate was further purified by HPLC on a C-18 column (from Senshu Kagaku K.K.; SSC-ODS-272; 6mmx200mm). Elution was performed with acetonitrile (10-20% linear velocity gradient) in a solution of 50 mM triethyl ammonium acetate (pH 7.0). Synthetic DNA was obtained in a yield of no less than 10A260 units.

Maxim-Gilbert analysis using the sequential method /Math. Enzym., 65, 499(1980)/ shows that the resulting oligonucleotide has the nucleotide sequence shown in Figure 1.

(ii) Synthesis of test (A)

15 successive nucleotides (see Figure 1) were obtained on the basis of a sequence of 5 amino acids (Met-Pro-Ala-Phe-Ala) included in the amino acid sequence obtained in example 3(m).

The synthesis is similar to that used for sample preparation (IWQ) and the following nucleotides are condensed on a nucleotide resin, Ap-d(T) (Yamasa Shoyu Co., Ltd.) in the following order:

(DMTr)CpAp(NH3), (DMTr)GpAp(NH3), an equimolar mixture of (DMTr)CpAp(NH3), (DMTr)CpTp(NH3), (DMTr)CpGp(NH3), and (DMTr)CpCp(NH3) , equimolar mixture of (DMTr)ApGp(NH3), (DMTr)TpGp(NH3), (DMTr)GpGp(NH3), (DMTr)CpGp(NH3), (DMTr)ApAp(NH3), equimolar mixture of (DMTr)CpAp( NH3), and (DMTr)CpGp(NH3), and (DMTr)Gp(NH3), with all nucleotides obtained from Nippon Zeon. Synthetic DNA was thus obtained in a yield of about 10A260 units. Analysis using the Maxim-Gilbert sequencing method shows that the resulting oligonucleotide has the nucleotide sequence shown in Figure 1.

(iii) Trial Synthesis (LC)

Automatic DNA synthesis was performed with a DNA synthesizer, model 380A Applied Biosystems. This technique is based on the principles given by Caratherus et al., /J. Am. Chem. Soc., 103, 3185(1981)/, and is generally referred to as the phosphoramidite process.

Phosphoramidite from (DMTr)-dT previously activated with tetrazole is condensed to dG-S (S:support) where the 5'-dimethoxynitrile group (DMTr) is deblocked. Then the unreacted hydroxyl groups are acylated and oxidized with iodine in the presence of water so that a phosphoryl group is formed. After unblocking the DMTr group, the condensation was repeated in the same way, and 24 nucleotides with the sequence shown in Figure 1 were not synthesized. These nucleotides were separated from the support, deblocked and purified by reverse-phase HPLC on a C-18 column (Senshu Kagaku Co., Ltd. ; SSC-ODS-272).

Example 5:

Cultivation and isolation of CHU-2 cells

1)

Established CHU-2 cells were grown to full density in two culture flasks (150 cm3), separated, suspended in 500 ml RPMI 1640 culture solution containing 10% fetal bovine serum, transferred to a 1580 cm3 glass rotary flask (Belco ) and cultivated with stirring for 4 days at 0.5 rpm. When it was determined that the grown cells on the inner walls of the flask had quite a dense population, the culture solution was removed from the rotating flask, which was supplemented with 100 ml of physiological saline solution heated to 37°C containing 0.02% EDTA. After heating for 2 minutes at 37°C, the cells were separated from the inner wall of the flask by pipetting. The resulting cell suspension was centrifuged at 1500 rpm for 10 minutes to obtain a cell pellet. The cells were resuspended in 5 ml of EDTA-free physiological saline. The suspension was centrifuged at 1500 rpm for 10 minutes to obtain a pellet of cells (weight about 0.8 g). The cells thus obtained were left frozen at -80°C until they were subjected to the RNA extraction procedure.

2) Purification of mRNA

Isolations of mRNA from CHU-2 cells obtained in 1) were based on procedures that were essentially the same as those described in "Molecular Cloning", Maniatis et al., Cold Spring Harbor, p. 196, 1982. Frozen CHU-2 cells (wet weight, 3.8 g) were suspended in 20 ml of a solution of 6M guanidine/(M guanidinium isocyanate, 5 mM sodium citrate (pH 7.0), 0.1 M β- mercaptoethanol and 0.5 sodium sarcosyl sulfate/ and the suspension was mixed well for 2-3 minutes. The mixture was withdrawn and injected 10 times with a syringe (capacity 20 ml) with an 18G needle. About 6 ml of the viscous guanidinium solution containing the disrupted cells was spread on 6 ml medium of 5.7 M CsCl in 0.1 M EDTA (pH 7.5) in a Beckman SW40 Ti polyallomer centrifuge tube so that the tube is completely full. 4 tubes were prepared by the procedures described above and centrifuged at 30000 rpm for 15 hours at 20° C. The resulting tablets were washed three times with water and a small amount of 70% ethanol.

Tablets obtained from special test tubes were combined, dissolved in 560 µl of water and processed to reach a NaCl concentration of 0.2 M. After treatment with a 1:1 mixture of phenol and chloroform and with chloroform itself, 2.5 volumes of ethanol were added so that total RNA is precipitated (about 10.1 mg of total RNA was obtained from 3.8 g of mock cells).

Poly(A+)RNA was purified from total RNA using the following affinity chromatography procedures that take advantage of binding of the poly(A) strand at the 3' terminus of the mRNA. Adsorption on oligo(dT)-cellulose (Type 7 P-L Biochem.) was achieved by passing total RNA through an oligo(dT)-cellulose column in carrier buffer (containing 10 mM Tris-Hd (pH 7.5), 0.5 M NaCl, 1 mM EDTA and 0.1% SDS solution) as the solution was heated for 5 minutes at 65°C.

The column is equilibrated with the same carrier buffer. Elution of poly(A+)RNA was performed with TE solution (containing 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA). The non-adsorbed effluent is again passed through the column and the eluate obtained by repeating the same procedures is mixed with the eluate obtained in the first elution. In this way, 400 µg of poly(A+)RNA was obtained.

The thus obtained mRNA was fractionated by particle size using a centrifugal sucrose density gradient according to the procedures described in the laboratory manual Schleif and Wensink "Practical Methods in Molecular Biology", Springer-Verlag, New York, Heidelberg, Berlin (1981).

Specifically, a 5-25% sucrose density gradient was created in a Beckman SV40 Ti centrifuge tube. Two sucrose solutions were made by dissolving 5% and 25% RNase-free sucrose solutions (Schwarz/Mann) in a solution containing 0.1 M NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, and 0. 5% SDS.

800 µg m RNA /poly (A+)-RNA/ obtained according to the already described method, was dissolved in 200-500 µl of TE solution. The solution was heated for 5 minutes at 65°C, after which it was suddenly cooled and placed in a density gradient of sucrose solutions, which were centrifuged at 30,000 rpm for 20 hours. Fractions of 0.5 ml were collected and their adsorption was measured at 260 nm. Sizes of fractionated RNA were determined based on the position of RNA standards (ribose RNAs 28S, 18S, and 5S). At the same time, the G-CSF activity of each fraction was tested with Xenopus laevis oocytes by the following procedures. First, the mRNA of each fraction was translated into an aqueous solution, which has a concentration of 1 µg/µl; oocytes were taken from Xenopus (about 1 year old) and the mRNA solution was injected in such a way that 50 ng of mRNA was injected into one oocyte; ten such oocytes were placed in each of the 96 wells of the microtiter plate; oocytes were cultured for 48 hours at room temperature in 100 µl of Barth medium (88 mM NaCl; 1 mM KCl; 2.4 mM NaHCO3 0.82 mM MgSO4 0.33 mM Ca(NO3)2; 0.41 mM CaCl2; 7, 5 mM Tris-HCl (pH 7.6); 10 mg/1 penicillin and 10 mg/1 streptomycin sulfate); the culture supernatant was separated, concentrated and purified to a level suitable for testing G-CSF activity.

G-SCF activity was found to be present in the 17S fraction.

Example 6:

Synthesis of cDNA (creation of pBR-line cDNA library)

From the poly(A+) RNA obtained in example 6, cDNA was synthesized by the procedure of Land et al. /Nucleic Acids Res., 9, 2251 (1981)/ modified by Gubler and Hoffman /Gene, 25, 263 (1983)/.

(1) Synthesis of single-stranded cDNA

An Eppendorf tube (capacity 1.5 ml) was filled with reagents in the following order: 80 µl reaction buffer (500 mM KCl, 50 mM MgCl2 250 mM Tris-HCl, pH 8.3); 20 µl 200 mM dithiotrietiol, 32 µl 12.5 mM dNTP (containing 12.5 mM each of dATP, dGTP, dCTP and dTTP), 10 µl 32P-dCTP (PB 10205 Amersham), 32 µl oligo(dT)12-18 (from P-L Biochem.; 500 µg/ml), 20 µl poly(A+) RNA (2.1 µg/µl) and 206 µl of distilled water. A total of 400 µl of the reaction solution was heated for 5 minutes at 65°C and then for 5 minutes at 42°C. To the warm solution, 120 units of reverse transcriptase (Takara Shuzo Co., Ltd.) were added. Following the reaction for another two hours at 42°C, 2 µl of RNase inhibitor (Bethesda Research Laboratories), 20 µl of TE solution, 16 µl of 100 mM sodium pyrophosphate, and 48 units (4 µl) of reverse transcriptase were added, and the reaction continued performed for 2 hours at 46°C. The reaction was stopped abruptly by the addition of 0.5 M EDTA (8 µl) and 10% SDS (8 µl). By further treatment with phenol/chloroform and precipitation with ethanol (twice), a single-stranded cDNA was obtained.

(2) Attachment of dC-strand to single-stranded cDNA

The single-stranded cDNA obtained in (1) was dissolved in distilled water. 60 µ1 dC-chain was added to the solution by adding a buffer (400 mM potassium cacodylate, 50 mM Tris-HCl (pH 6.9), 4 mM dithiotrietol, 1 mM CoCl2 1 mM dCTP) and the mixture was heated at 37°C for 5 minutes. . 3 µl of terminal transferase (27 units/µl; P-1 Biochem.) was added to the reaction solution and the mixture was heated at 37°C for 2.5 minutes. After further treatment with phenol/chloroform (once) and precipitation with ethanol (twice), the dC-terminated cDNA was dissolved in 40 µl TE solution containing 100 mM NaCl

(3) Synthesis of double-stranded cDNA

In 40 µl of the DNA solution obtained in 2), 4 µl of oligo(dG)12-18 (200 µg/ml; P-L Biochem.) was added and the mixture was first heated for 5 minutes at 65°C and then at 42°C for 30 minutes. . While the reaction solution was maintained at 0°C, 80 µl buffer (100 mM Tris-HCl (pH 7.5), 20 mM MgCl2, 50 mM (NH4)2SO4, and 500 mM KCl/, 4 µl 4MM dNTP (which containing 4 mM dATP, dCTP, dGTP and dTTP each), 60 µl 1 mM β-NAD, 210 µl distilled water, 20 µl E. coli DNA polymerase I (Takara Shuzo Co., Ltd.), 15 µl E. coli DNA ligase (Takara Shuzo Co., Ltd.) and 15 µl of E. coli RNase H (Takara Shuzo Co., Ltd.) and the mixture was subjected to reaction at 1°C for 1 hour.After the addition of 4 mM dNTP (4 µl), the reaction was carried out for 1 hour at 25° C. Further, treatment with phenol/chloroform and precipitation with ethanol (once) yielded about 8 µg of double-stranded cDNA. This double-stranded cDNA was dissolved in TE solution and subjected to 1,2 agarose gel electrophoresis. Fragments corresponding to a size of about 560 bp to about 2 kbp were adsorbed on Whatman DE81 from which about 0.2 µg of double-stranded cDNA was obtained by elution.

(4) Attachment of the dC-strand to the double-stranded cDNA

The double cDNA obtained in 3) was dissolved in 40 µl of TE solution. Then 8 µl of dC-terminating buffer of the type specified in 2) was added and the mixture was heated at 37°C for 2 minutes. After the addition of 1 µl of terminal transferase (27 units/µl), the mixture was subjected to a reaction at 37°C for 3 minutes. After this, the reaction solution was immediately cooled to 0°C and the reaction was stopped by the addition of 1 µl of 0.5M EDTA. Further, after treatment with phenol/chloroform and precipitation with ethanol, the obtained precipitate was suspended in 10 µl of TE solution.

(5) Creation of pBR-line cDNA library

4 microliters of commercial oligo(dG)-terminated pBR322 vector (Bethesda Research Laboratories; 10 µg/µl) and 2 µl of dC-terminated duplex cDNA obtained in 4) were quenched in TE solution containing 75 µg of 0.1 m NaCl. Tempering includes three stages: heating to 65°C for 5 minutes; then heating to 40°C for 2 hours and cooling to room temperature.

According to the method described in the laboratory manual of Maniatis et al. /Molecular Cloning, Cold Spring Harbor, p. 249 ff. (1982)/ (other routine techniques may also be used), appropriate cells obtained from E. coli strain X1776, and transformed with the hardened plasmid to obtain transformants.

Example 7:

Synthesis of cDNA (Creation of λ phage library)

1) Synthesis of single-stranded cDNA

According to the procedures described in example 5, 3.8 g of frozen CHU-2 cells purified twice on an oligo (dT)-cellulose column were processed to obtain 400 µg of poly(A+)RNA.

The TE solution (10 µl), which has 12 µg of poly(A+)RNA dissolved in it, was placed in a reaction tube containing 10 µg of actinomycin D (Sigma). Then the test tube was supplemented with reagents in the following order: 20 µl reverse transcriptase buffer / 250 mM Tris-HCl (pH 8.3); 40 mM MgCl2 250 mM KCl/; 20 µl of 5 mM dNTP (containing 5 mM each of dATP, dGTP, dCTP and dTTP); 20 µl oligo (dT)12-18 (0.2 µg/ml; P-L Biochemicals); 1 µl 1 M dithiotrietiol; 2 µl of RNasin (30 units/µl; Promega Biotech); 10 µl reverse transcriptase (10 units/µl; Seikagaku Kogyo Co.,Ltd.): 1 µl α-32P-dATP (10 µCi; Amerscham); and 16 µl of water.

The reaction solution was a total of 100 µl and was kept for 2 hours at 42°C, then the reaction was stopped by adding 0.5 M EDTA (5 µl) and 20% SDS (1 µl). By treatment with phenolchloroform (100 µl) and precipitation with ethanol (twice), about 4 µg of single-stranded cDNA was obtained.

2) Synthesis of double cDNA

The cDNA obtained in 1 was dissolved in 29 µl TE solution and the reaction solution was obtained by adding the following reagents in the order indicated: 25 µl polymerase buffer (400 mM Hepes (pH 7.6); 16 mM MgCl2, 63 mM p-mercaptoethanol, and 270 mM KCl/; 10 µl 5 mM dNTP; 1.0 µl 15 mM β-NAD; 1.0 µl α-32P-dATP (10 µCi/µl); 0.2 µl E. coli DNA polymerase I (New England Biolabs ; 10 units/µ1); 0.1 µl RNase H (60 units/µl; Takara Shuzo Co., Ltd.); 28.7 µl distilled water.

The reaction solution was incubated at 14°C for 1 hour, and then left at room temperature for another hour. Then the reaction was stopped by the addition of 0.5 M EDTA (5 µl) and 20% SDS (1 µl) and then treated with phenol/chloroform and precipitated with ethanol. The obtained RNA was dissolved in 20 µl of 0.5 M EDTA and the reaction solution was prepared by adding 3 µl of Klenow buffer /500 mM Trias-HCl (pH 8.0) and 50 mM MgCl2/, 3 µl of 5 mM dNTP, and 4 µl of water. . After adding 1 µl of DNA polymerase (Klenow fragment; Takar Shuzo Co., Ltd.), the reaction solution was incubated for 15 minutes at 30°C.

The incubated reaction solution was diluted with 70 µl of TE solution and the reaction was stopped by adding 0.5 M EDTA (5 µl) and 20% SDS (1 µl). then by treatment with phenol/chloroform and precipitation with ethanol, about 8 µl of double-stranded cDNA was obtained.

3) Methylation of double cDNA

An aqueous solution (30 µl) of the double cDNA synthesized in 2) was mixed with 40 µl of methylation buffer/500 mM Tris-HCl (pH 8.0); 50 mM EDTA/, 20 µl SAM solution /800 nm S-adenosyl-L-methylmethionine (SAM); 50 mM β-mercaptoethanol/, and 100 µl water. 15 µl of EcoRI methylase (New England Biolabs; 20 units/µl) was added to the mixture, so that a reaction solution with a total volume of 200 µl was obtained. After incubation at 37°C for 2 hours, treatment with phenol and ether, and precipitation with ethanol, DNA was isolated.

4) Addition of EcoRI binder

In about 1.2 µg of methylated duplex cDNA, 1.5 µl of lyase buffer /250 mM Tris-HCl (pH 7.5) and 100 mM MgCl2/, 0.5 µl of pre-phosphorylated EcoRI binder (10 mer; Takara Shuzo Co. ,Ltd.), 1.5 µl of 10 mM ATP, 1.5 l of 100 mM dithiotriethylol, and 2 µl of water were added so that the total volume of the solution was 15 µl. After addition of 0.7 µl of T4DNA ligase (3.4 units/µl; Takara Shuzo Co.,Ltd.), the reaction proceeded overnight at 4°C. The ligase was then deactivated by heating at 65°C for 10 minutes. The reaction solution was brought to a total volume of 50 µl by the addition of 100 mM Tris-HCl (pH 7.5) and 5 mM MgCl2, 50 mM Nad and 100 µg/ml gelatin. After addition of EcoRI (3.5 µl; 10 units/µl), the reaction was performed for 2 hours at 37°C. Then 2.5 µl of 0.5 M EDTA and 0.5 µl of 20% SDS were added and the solution was treated with phenol/chloroform and precipitated with ethanol, so that the DNA was isolated. Unreacted EcoRI was then removed by gel filtration on Ultragel AcA34 (LKB) or agarose-gel electrophoresis, so that about 0.5-0.7 µg of double-stranded cDNA was isolated, to which the binder was added.

5) Ligation of the double cDNA to the λgt10 vector

Double-stranded cDNA to which the binder was added was mixed with 2.4 λg of previously EcoRI-treated λgt10 vector (Vektor Cloning System), 1.4 λl of ligase buffer (250 mM Tris-HCl and 100 mM MgCl2) and 6.5 λl of distilled water. , and the mixture was heated to 42°C for 15 minutes. Then, 1 λ1 of 10 mM ATP, 1 λl of 0.1 M dithiotrietiol and 0.5 dithiotriedol and 0.5 λl of T4DNA ligase were added so that 15 λl of the total volume of the reaction solution was created, which was left at 12°C overnight.

6) In vitro packaging

About thirty recombinant DNAs obtained in 5) were packaged with an in vitro packaging kit (Promega Biotech) so that phage infection was obtained.

Example 8:

Testing the pBR-line library with probe (IWQ)

Whatman 541 paper was placed on a colony growth agar medium and allowed to stand for 2 hours at 37°C. The filter paper was then treated as follows, Taub and Thomson /Anal. Biochem., 126, 222(1982)/.

Colonies transferred to 541 paper were further grown on agar medium containing chloramphenicil (250 µg/µl) overnight at 37°C.

541 paper was taken out and left at room temperature for 3 minutes on another sheet of filter paper that was impregnated with 0.5 N NaOH solution. This procedure was repeated twice. A similar procedure was repeated twice for 3 minutes each using 0.5 M Tris-HCl (pH 8). At 4°C, treatments were performed with a 0.05 M Tris-HCl (pH 8) solution for 3 minutes, and with a 1.5 mg/ml lysozyme solution/containing 0.05 M Tris-HCl (pH 8) and 25% sucrose/ during 10 minutes; then at 37°C treatments were performed with 1xSSC solution (0.15 M NaCl and 0.015 M sodium citrate) for 2 minutes and with 1xSSC solution containing 200 µg/ml proteinase K for 30 minutes; finally, at room temperature, treatments were performed with 1xSSC solution for 2 minutes, and with 95% ethanol solution for 2 minutes. The last step was repeated twice. Then the 541 paper was dried. The dried 541 paper was immersed in a 25:24:1 mixture of phenol/chloroform/isoamyl alcohol /equilibrated with 100 mM Tris-HCl (pH 8.5), 100 mM NaCl and 10 mM EDTA/ for 30 minutes at room temperature. Then, similar procedures were repeated three times with 95% ethanol solution for 3 minutes. Then the filter paper is dried.

Probe (IWQ) labeled with 32P according to the routine procedure (see Molecular Cloning) and colony hybridization were performed according to the method of Wallace et al. /Nucleic Acids Res., 9, 879(1981)/.

Prehybridization was performed for 4 hours at 65°C in a hybridization buffer containing 6xNET /0.9 M NaCl; 0.09 M Tris-Hd (pH 7.5); and 6 mM EDTA/, 5xDenhardt's solution, 0.1% SDS and 0.1 mg/ml denatured DNA (calf thymus). Then, hybridization was performed overnight at 56°C in hybridization buffer (for its preparation see ahead) containing 1x106 cpm/ml radiolabeled probe (IWQ). Upon completion of the reaction, the 541 paper was washed twice with 6xSSC solution (containing 0.1% SDS) for 30 minutes at room temperature, and washed at 56°C for 1.5 minutes. The washed 541 paper was then subjected to autoradiography.

Plasmid was isolated from positive clones and subjected to Southern blotting with probe (IWQ). Hybridization and autoradiography were performed under the same conditions as described above.

Similarly, Southern blotting was performed with sample (A). Using hybridization buffer prepared as above, hybridization was performed first at 49°C for 1 hour. After standing at 39°C, the hybridization was further continued at this temperature for 1 hour. Upon completion of the reaction, the nitrocellulose filter was washed twice with 0.1% SDS containing 6xSSC for 30 minutes at room temperature, then washed at 39°C for 3 minutes. The washed paper was subjected to autoradiography.

It was found that one positive clone was observed. Nucleotide sequence analysis by the dideoxy method shows that this clone has DNA composed of 308 base pairs spanning parts of probes (IWQ) and (A). pBR322 derived plasmid containing this part not called pHCS-1.

Example 9:

Testing the λphage line library with a pHCS-1 derived DNA probe

Infection hybridization was performed according to the method of Benton and Davis /Science, 196, 180 (1977)/. pHCS-1 obtained in example 8 was treated with Sau3A and EcoRI so that a DNA fragment of about 600 bp was obtained. This DNA fragment was radiolabeled by translational cleavage according to routine procedures. A nitrocellulose filter (S&S) was placed on a phage agar medium for culturing the infection to transfer phage to the filter. After denaturing the phage with 0.5 M NaOH, the filter paper was treated as follows: treatment with 0.1 M NaOH and 1.5 M NaCl for 20 seconds; two treatments with 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCl for 20 seconds; finally treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH2PO4 and 1 mM EDTA (pH 7.3) for 20 seconds.

The filter was then dried and heated for 2 hours at 80°C to immobilize the DNA. Prehybridization was performed overnight at 42°C in prehybridization buffer containing 5xSSC, 5xDenhardt's solution, 50 mM phosphate buffer, 50% formamide, 0.25 mg/ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Next, hybridization was performed at 42°C for 20 hours in hybridization buffer containing 4x105 cpm/ml pHCS-1 probe that was radiolabeled using translational cleavage. This hybridization buffer was a mixture of 5xDenhardt's solution, 20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate, and 0.1 mg/ml denatured DNA (salmon sperm DNA).

The hybridized nitrocellulose filter was washed for 20 minutes with 2xSSC containing 0.1% SDS at room temperature, then for 30 minutes with 0.1xSSC containing 0.1% SDS at 44°C and finally for 10 minutes with 0.1xSSC at room temperature. . Autoradiographic detection was then performed.

5 positive clones (G1-G5) were obtained. The clone containing the full length cDNA sequence was tested for DNA nucleotide sequence determination by the dideoxy method and the nucleotide sequence shown in Figure 3(A) was identified. After cutting the λgt10 vector, this cDNA was joined to pBR327 /Sorberon et al, Gene, 9, 287(1980)/ at the EcoRI site, so that a plasmid is produced that can be obtained in large quantities. This plasmid was named pBRG4.

Example 10:

Screening of the λphage line library with the pBRG4-derived probe and the (LC) probe

Infection hybridization was performed according to the method of Benton and Davis (see also Science) used in Example 9. A nitrocellulose filter (S&S) was placed on phage agar infection culture medium to transfer phage to the filter. After denaturing phage DNA with 0.5 M NaOH, the filter was treated with the following procedures: treatment with 0.1 M NaOH and 1.5 M NaCl for 20 seconds; then two treatments with 0.5 M Tris-Hd (pH 7.5) and 1.5 M NaCl for 20 seconds; finally treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH2PO4 and 1 mM EDTA (pH 7.2) for 20 seconds. The filter was then dried and heated for 2 hours at 80°C to immobilize the DNA. Two sheets of the same filter were prepared as described above and tested with the pBRG4-derived DNA probe and the probe (LC).

Testing with the pBRG4-derived DNA probe was performed as follows. pBRG4 was treated with EcoRI to obtain a DNA fragment with about 1500 bp. This fragment was radiolabeled by translational cleavage according to routine procedures. One of the two nitrocellulose filters was subjected to prehybridization overnight at 42°C in prehybridization buffer containing 5xSSC, 5xDenhardt's solution, 50 mM phosphate buffer, 50% formamide, 0.25 mg/ml denatured DNA (salmon sperm DNA) and 0.1 % SDS. Then, the filter was subjected to hybridization at 42°C for 20 hours in a hybridization buffer containing a radiolabeled DNA probe (about 1x106 cpm/ml) of about 1500 bp. This hybridization buffer is a mixture of 5xSSC, 5xDenhard's solution, 20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate, and 0.1 mg/ml denatured DNA (sperm DNA salmon). I hybridize with nitrocellulose, the filter was washed for 20 minutes with 2xSSC containing 0.1% SDS at room temperature, and then for 30 minutes with 0.1xSSC containing 0.1% SDS at 44°C, and finally, for 10 minutes with 0.1 % SSC at room temperature. Detection was performed using autoradiography.

Trial testing (LC) was performed using the following procedures. The second filter was pretreated with 5xSSC containing 0.1% SDS for 2 hours at 65°C. Then prehybridization was performed for 2 hours at 65°C in a solution containing 6xNET, 1xDenhardt's solution and 100 µg/ml denatured DNA (salmon sperm DNA). Hybridization was then performed overnight at 63°C in hybridization buffer containing radiolabeled probe (LC) (2x106 cpm/ml). This hybridization buffer is also a mixture of 6xNET, 1xDenhardt's solution and 100 µg/ml denatured DNA (salmon sperm DNA). The hybridized nitrocellulose filter was washed three times (20 minutes each time) with 3xSSC containing 0.1% SDS at room temperature, then washed for 2 minutes at 63°C with 6xSSC containing 0.1% SDS.

The filter was dried and detected by autoradiography.

In the assay described above, clones that were positive in both assays were separated and the clone that had the full-length cDNA chain was tested by the dideoxy method to determine the nucleotide sequence. It was found to have the nucleotide sequence shown in Figure 4(A). This DNA was excised from the λt10 vector and ligated into pBR327 at the EcoRI site to generate plasmid pBRV2.

Example 11:

Human chromosomal gene library testing

1) Creating a human chromosomal gene library

Human chromosomal gene library obtained thanks to the kindness of Dr. Maniatis from Harvard University was prepared by the following procedures: Whole chromosome DNA was extracted from human embryo liver with phenol or other appropriate chemicals and partially digested with restriction enzymes, HaeIII and AluI; the obtained DNA fragments were treated using a centrifugal sucrose density gradient so that a concentrate of fragments with chains of about 18-25 kb in length; the concentrated fragments were attached to the arm DNA of E. coli phage λ Charon 4A, with synthetic nucleotides of short chains that were inserted at the cleavage sites of the restriction enzyme EcoRI, so that infectious phage DNA recombinants were created; in order to reduce infectivity, purer λ phage particles were obtained by packaging. The thus obtained human gene library was theoretically considered as a set of recombinants containing human DNA with chains of 18-25 kb in length that contain practically all human genes.

2) Testing of the human chromosomal gene library with pHCS-1 derived DNA probe

Infection hybridization was performed according to the method of Benton and Davis /Science, 196, 180(1977)/. pHCS-1 obtained in Example 8 was treated with Sau3A and EcoRI to obtain a fragment of about 600 bp. This DNA fragment was radiolabeled using translational cleavage according to routine procedures. A nitrocellulose filter (S&S) was placed on the phage agar medium for culturing the infection to transfer phage to the filter. After denaturing the phage DNA with 0.5 M NaOH, the filter paper was treated with the following procedures; treatment with 1.5 M NaCl for 20 seconds; two treatments with 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCl for 20 seconds; finally, treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH2PO4 and 1 mM EDTA (pH 7.2) for 20 seconds.

The filter was then dried and heated at 80°C for 2 hours to immobilize the DNA. Prehybridization was performed overnight at 42°C in prehybridization buffer containing 5xSSC, 5xDenhardt's solution, 50 mM phosphate buffer, 50% formamide, 0.25 mg/ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Then hybridization was performed for 20 hours at 42°C in a hybridization buffer containing 4x105 cpm/ml pHCS-1 probe that was radiolabeled by translational cleavage. This hybridization buffer was a mixture of 5xSSC, 5xDenhard's solution, 20 mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate, and 0.1 mg/ml denatured DNA (salmon sperm DNA ).

The hybridized nitrocellulose filter was washed for 20 minutes with 2xSSC containing 0.1% SDS at room temperature, and then for 30 minutes with 0.1xSSC containing 0.1% SDS at 44°C and finally for 10 minutes with 0.1xSSC at room temperature. . Detection was further performed autoradiographically.

10 split positive clones were obtained. Recombinant DNA was obtained from these clones by the Maniatis method /Cell, 15, 687 (1978)/. The obtained DNAs were treated with restriction enzymes such as EcoRI, BemHI and BglII, analyzed by agarose gel electrophoresis and a map of their restriction enzyme was obtained according to the method of Fritsh et al. (see also Cell).

Southern hybridization was performed with a probe radiolabeled with a pHCS-1 derived DNA fragment identical to that used in the above assay. A DNA fragment of about 8 kbp cut with EcoRI was selected from clones that hybridized with the probe. The fragment was subcloned into the EcoRI site of pBR327. The subcloned DNA was subjected to a second treatment with restriction enzymes and Southern hybridization was performed several times. A DNA fragment of about 4 kbp cut with EcoRI and XhoI was found to contain the gene encoding the human G-CSF polypeptide. This DNA fragment was tested to determine the sequence of its 3-kbp dideoxy method and the nucleotide sequence shown in Figure 5 was identified. This fragment has a restriction enzyme cleavage site shown in Figure 7.

Human chromosomal gene testing was also performed using pBRG4-derived DNA and pBRV2-derived DNA as probes. In both cases, a DNA fragment of 1500 bp treated with EcoRI was directly radiolabeled by translatome cleavage in the manner described above, or alternatively, a DNA fragment of about 700 bp obtained by alternating treatments with EcoRI and DraI was radiolabeled with translational cleavage. The sample thus obtained was used in the infection hybridization, which was carried out under the same conditions as described above. The selected clones were analyzed by Southern hybridization to obtain a DNA fragment with the nucleotide sequence shown in Figure 5. The resulting plasmid was named pBRCE3.

Example 12:

Creation of E.coli recombinant vector (+VSE) and transformation (using tac promoter containing vector)

1) Creation of recombinant vector

(i) Preparation of vectors

5 micrograms of tac promoter containing vector pKK223-3 (Pharmacia) was treated with 8 units of EcoRI (Takara Shuzo Co., Ltd.) for 2 hours at 37°C in 30 (µl reaction solution (40 mM Tris-HCl, 7 mM MgCl2, 100 mM NaCl, and 7 mM 2-mercaptoethanol).

Then, 3 µl of alkaline phosphatase (Takara Shuzo Co., Ltd.) was added and the treatment was carried out at 60°C for 30 minutes. The DNA fragment was isolated by triple treatment with phenol and single treatment with ether and precipitated with ethanol, everything was done according to routine procedures.

The isolated DNA fragment was dissolved in 50 microliters of a mixture composed of 50 mM Tris-HCl, 5 mM MgCl2, 10 mM DTT and 1 mM each of sATP, dCTP, dGTP and dTTP. After adding 3 µl of E. coli DNA polymerase I -Klenow fragment (Takara Shuzo Co., Ltd.), the reaction was performed at 14°C for 2 hours to create open ends.

(ii) Obtaining a synthetic binder

Three micrograms of oligonucleotide having the sequences of synthetic linkers, CGAATGACCCCCCTGGGCC and CAGGGGGGTCATTGG, was phosphorylated by carrying out the reaction in 40 µl reaction solution (composed of 50 mM Tris-HCl, 10 mM MgCl2, 10 mM 2-mercaptoethanol and 1 mM ATP) at 37°C for 60 minutes in the presence of 4 units of T4 polynucleotide kinase. Each of the phosphorylated oligonucleotides (0.2 µg) was dissolved in 20 µl of 100 mM NaCl-containing TE solution (10 mM Tris-Hd (pH 8.0) and 1 mM EDTA). After treatment at 65°C for 10 minutes, the oligonucleotides were quenched by slow cooling to room temperature.

(iii) Obtaining the G-CSF cDNA fragment

60 micrograms of pBRG4 obtained in Example 9 containing the cDNA shown in Figure 3(A) was treated with 100 units of restriction enzyme ApaI (New England Biolabs) and 50 units of Dral (Takara Shuzo Co., Ltd.) at 37°C for 3 hours. in 200 µl reaction solution composed of 6 mM Tris-HCl, 6 mM MgCl2 and 6 mM 2-mercaptoethanol. About 2 µg of the Apal-Dral fragment (about 590 bp) was separated by 1.2% agarose gel electrophoresis.

(iv) Binding of fragments

About 0.1 microgram of each of the fragments obtained in (i) to (iii) was dissolved in 20 µl of binding solution (66 mM Tris-HCl, 6.6 mM MgCl2, 10 mM DTT and 1 mM ATP). After the addition of 175 units of T4 ligase, the solution was kept overnight at 4°C so that the recombinant vector was obtained (Figure 8).

2) Transforming

Using 20 µl of the reaction solution containing the recombinant vector obtained in (iv), E. coli strain JMI05 was transformed by the rubidium chloride procedure (see Maniatis et al., Molecular Cloning, p. 252 (1982)). The plasmid was separated from amplicillin -resistant colonies of the transformant culture and treated with the restriction enzymes, BamHI, AccII and ApaI to confirm that the transformants are the desired ones.

Example 13:

Creation of an E. coli recombinant vector (+VSE) and transformation (using the PL promoter containing the vector)

1) Creation of recombinant vector

(i) Obtaining a vector

100 micrograms of the PL promoter containing the vector pPL-lambda (Pharmacia) was treated overnight at 37°C with 50 units of the restriction enzyme BamHI in 100 µl reaction solution /10 mM Tris-HCl (pH 7.6), 7 mM MgCl2 100 mM NaCl and 10 mM DTT/.

By subjecting the reaction solution to 1% agarose gel electrophoresis, about 49 µg of the approximately 4-kb fragment and about 11 µg of the approximately 1.2-kb fragment were isolated.

The 4-kb fragment was dissolved in 100 µl of TE buffer (see ahead for its composition) and dephosphorylated by reaction with alkaline phosphatase (Takara Shuzo Co., Ltd.) at 60°C for 60 minutes.

The second fragment of about 1.2 kb in length was dissolved in 20 µl of buffer (10 mM Tris-HCl, 10 mM MgCl2 and 1 mM DTT) and treated overnight with 20 units of restriction enzyme MboII (New England Biolabs) at 37°C.

About 0.9 µg of MboII-BamHI fragments were isolated by 4% polyacrylamide gel electrophoresis.

(ii) Obtaining a synthetic binder

Oligonucleotides having the synthetic linker sequences TAAGGAGAATTCATCGAT and TCGATGAATTCTCCTTAG are phosphorylated and annealed as in (ii) in Example 12, so that a synthetic S/D linker is obtained.

(iii) Obtaining expression vectors

0.1 µg of about 4-kb fragment, 0.05 µg each of BamHI fragment having OLPL region and MbOII-BamHI fragment having tL1 region /three fragments obtained in (i)/ and 0.1 liquefied synthetic S/D binder obtained in (ii) was subjected to overnight reaction at 12°C in 40 µl reaction solution (66 mM Tris-HCl, 6.6 mM MgCl2, 10 mM DTT and 1 mM ATP) in the presence of 175 units of T4DNA ligase (Takara Shuzo Co. , Ltd.). 20 µl of the reaction solution was used to transform E. coli strain N99CI+ (Pharmacia) by the calcium chloride method (see also Molecular Cloning).

The transformants were cultured and the plasmid was isolated from the culture of their ampicillin-resistant colonies. Treatment of the plasmid with the restriction enzymes EcoRI, BamHI and SmaI showed that it was the desired plasmid.

Two micrograms of this plasmid was reacted with the restriction enzyme ClaI (New England Biolabs) at 37°C for 2 hours in 20 µl buffer (10 mM Tris-HCl, 6 mM MgCl2 and 50 mM NaCl). The enzyme was then deactivated by heating for 10 minutes at 65°C.

One microliter of the reaction solution was reacted overnight at 120C with 175 units of T4DNA ligase (Takara Shuzo Co., Ltd.) in a binding solution having the composition described above.

The reaction solution was then used to transform E. coli strain N99cI+ (Pharmacia). The plasmid was isolated from the culture of ampicillin-resistant transformant colonies and treated with EcoRI and BamHI, so as to confirm that the mentioned plasmid is the desired one.

(iv) Obtaining G-CSF expressing recombinant vector and transformants

The expression plasmid obtained in (iii) was treated with the restriction enzyme ClaI. After creating the open ends, the plasmid was processed as in example 12, so that a recombinant vector of the inserted cDNA fragment of G-CSF was obtained. This vector was used to transform E. coli strain N4830 (Pharmacia Fine Chemicals) by the calcium chloride procedure described in Molecular Cloning, (ibid.). The desired transformants were identified as in example 12 (Figure 9).

Example 14:

Generation of E. coli recombinant vector (+VSE) and transformation (using the trp promoter that the vector has)

1) Construction of recombinant vector

(i) Preparation of vectors

Plasmid pOY1 was obtained by inserting the tryptophan promoter containing the HpaII-TagI fragment (about 330 bp) into pBR322 at the ClaI site. Ten micrograms of this plasmid were treated with 7 units of restriction enzyme ClaI and 8 units of PvuII at 37°C for 3 hours in 30 µl reaction solution composed of 10 mM Tris-HCl, 6 mM MgCl2 and 50 mM NaCl.

Then, 2 µl of alkaline phosphatase (Takara Shuzo Co., Ltd.) was added and the reaction was performed at 60°C for 1 hour.

A DNA fragment (about 2.5 µg) of about 2.6 kb in length was separated from the reaction solution by 1% agarose gel electrophoresis.

(ii) Obtaining a synthetic binder

Oligonucleotides having the synthetic linker sequences CGCGAATGACCCCCCTGGGCC and CAGGGGGGTCATTCG were phosphorylated and annealed as described in (ii) in Example 12, so that a synthetic linker was obtained.

(iii) Obtaining a recombinant vector

About 1 µg of the vector fragment obtained in (i), about 1 µg of the synthetic linker obtained in (ii) and about 1 µg of the G-CSF fragment obtained in (iii) in Example 12 were reacted with 175 units of T4DNA ligase overnight at 12° C in 20 µl of the ligation solution, which has the composition described in example 12, 1) (iv), so that the recombinant vector is obtained (Figure 10).

2) Transforming

Twenty microliters of the reaction solution obtained in (iii) was used to transform E. coli DH1 by the rubidium chloride procedure described in Molecular Cloning, ibid.

As in Example 12, the plasmid was isolated from ampicillin-resistant transformant colonies, and treatment of this plasmid with the reaction enzymes ApaI, Dral, Nrul and PstI showed that the desired transformants were obtained.

Example 15:

Cultivation of transformants

1) Cultivation of transformants (with tac) obtained in example 12

Transformants were cultured overnight at 37°C and 1 ml of culture was added to 100 ml of Luria medium, containing 25 µg/ml or 50 µg/ml ampicillin. Cultivation was carried out for 2-3 hours at 37°C.

Cultivation was continued at 37°C for 2-4 hours after the addition of isopropyl-β-D-thiogalactose, so as to reach a final concentration of 2 mM.

2) Cultivation of transformants (with PL) obtained in example 13

Transformants were cultured overnight at 28°C, and 1 ml of culture was added to 100 ml of Luria medium containing 25 or 50 µg/ml ampicillin. Cultivation was carried out for about 4 hours at 28°C.

Cultivation was continued for 2-4 hours at 42°C.

3) Cultivation of transformants (with trP) obtained in application 14

Transformants were cultured overnight at 37°C, and 1 ml of culture was added to 100 ml of M9 medium, containing 0.5% glucose, 0.5% Casamino acid (Difco), and 25 or 50 µg/ml ampicillin. Cultivation was carried out for 4-6 hours at 37°C. After the addition of 50 µg/ml 3-β-indolacrylic acid (IAA), cultivation was continued for 4-8 hours at 37°C.

Example 16:

Isolation and purification of G-CSF polypeptide from E. coli

1) Extraction

Three types of transformants cultured in Example 15 were subjected to the following isolation procedures.

The culture (100 ml) was centrifuged to obtain a pellet of cells, which was then suspended in 5 ml of a mixture of 20 mM Tris-HCl (pH 7.5) and 30 mM NaCl.

Then 0.2 M phenylmethylsulfonyl fluoride, 0.2 M EDTA and lysozyme were added in the respective concentrations of 1 mM, 10 mM and 0.2 mg/ml and the suspension was placed for 30 minutes at 0°C.

Cells were lysed using three freeze/thaw cycles. The lysate was centrifuged, so that the supernatant was obtained. Alternatively, the lysate was treated with 8 M guanidine hydrochloride, so that its final concentration was 6 M guanidine hydrochloride, and then centrifuged at 30,000 rpm for 5 hours, and then the supernatant was collected.

2) Purification

(i) The supernatant obtained in 1) was subjected to gel filtration on an Ultrogel AcA54 column (4.6 cm diameter x 90 cm length) at a flow rate of about 50 ml/hour with 0.01 M Tris-HCl buffer (pH 7.4), which containing 0.15 M NaCl and 0.01% Tween 20 (Nakai Kagaku Co., Ltd.).

Fractions showing activity when analyzed by CSA assay method (b) (described earlier in this specification) were selected and concentrated to a volume of about 5 ml with an ultrafiltration apparatus pM-10 (Amicon).

(ii) n-propanol (purity suitable for amino acid sequence testing; Tokyo Kasei C, Ltd.) and trifluoroacetic acid were added to the concentrated fractions, and the mixture was worked up so that the final concentrations of n-propanol and trifluoroacetic acid were 30% and 0.1 %, respectively. The treated mixture was left in ice for about 15 minutes and centrifuged at 15,000 rev/mm for 10 minutes to separate the precipitate. The supernatant was adsorbed onto a µ-Bondapak C18 column (semi-prep grade; Waters; 8 mmx30 cm), which was equilibrated with an aqueous solution containing n-propanol (see above) and trifluoroacetic acid. The column was continuously eluted with an aqueous solution of 0.1% trifluoroacetic acid, containing n-propanol, with a linear density gradient of 30-60%. With the Hitachi Model 685-50 (HPLC apparatus Hitachi, Ltd.) and Hitachi Model 638-41 (detector Hitachi, Ltd.), which were used, the adsorption at 220 nm and 280 nm was measured simultaneously. After elution, a 10 µl aliquot of each fraction was diluted 100 times and the solutions were tested for active fractions by the CSA test method (b). Activity was observed in peaks eluted with 40% n-propanol. These peaks were combined and rechromatographed under the same conditions as above and the fractions were assayed for activity by method (b). Again, activity was found in peaks for 40% n-propanol. These active peaks were collected (four fractions=4ml) and freeze-dried.

(iii) The freeze-dried powder was dissolved in 200 µl of an aqueous solution of 0.1% trifluoroacetic acid containing 40% n-propanol, and the solution was subjected to HPLC on a TSK-G3000SW column (7.5 mmx60 cm; Toyo Soda Manufacturing Co., Ltd.). Elution was performed at a flow rate of 0.4 ml/mm with an aqueous solution of 0.1% trifluoroacetic acid containing 40% n-propanol, and fractions of 0.4 ml were collected with a fraction collector, RRAC-100 (Pharmacia Fine Chemicals ). Fractions were assayed for CSA as described above and active fractions were separated. They were further purified on a µ-Bondapak C18 column (4.6 mmx30 cm), the main peak was separated and freeze-dried.

The thus obtained protein was treated with 2-mercaptoethanol and subjected to SDS-polyacrylamide gel (15.0%) electrophoresis (15 mV, 6 hours). After staining with Coomassie Blue, the desired G-CSF polypeptide can be identified as a single band.

Example 17:

Test of G-CSF activity (+VSE)

The CSF sample obtained in Example 16 was tested according to the CSF test method (a) described earlier in this specification. These results are shown in Table 1.

Table 1

[image]

Example 18:

Amino acid analysis (+VSE)

1) Analysis of amino acid composition

The CSF purified in Example 16 was hydrolyzed by routine procedures. The amino acid composition of the protein part of the hydrolyzate was analyzed using the amino acid analysis method with an automatic amino acid analyzer, Hitachi 835 (Hitachi Ltd.). The results are shown in table 2. Hydrolysis was performed under the following conditions:

(i) 6 N HCl, 110°C, 24 hours in vacuo

(ii) 4 N methanesulfonic acid + 0.2% 3-(2-aminoethyl)indole, 110°C, 24 hours, 48 hours, 72 hours, in vacuum.

The sample was dissolved in a solution (1.5 ml) containing 40% n-propanol and 0.1% trifluoroacetic acid. Aliquots, each with a mass of 0.1 ml, were dried with dry nitrogen gas and after the addition of the reagents specified in (i) or (ii), the vessels were sealed in a vacuum, and then hydrolysis was performed.

Each of the values shown in Table 2 is the mean of 4 measurements, 24 hour values (i) and 24, 48 and 72 hour values (ii), except that the contents of Thr, Ser, 1/2Cys, Met, Val, Ile and Trp calculated by the following methods (see "Tampaku Kagaku (Protein Chemistry) II" Course m Biochemical Experiments, Tokyo Kagaku Dohjin);

For Thr, Ser, 1/2Cys and Met, the time dependence of the profile of the 24, 48 and 72 hour values for (ii) was extrapolated to 0 hours.

For Val and Ile, the 72 hour value for (ii) was used. For Trp, the mean of the 24, 48 and 72 hourly values for (ii) was used.

Table 2

Amino acid analysis data

[image]

2) Analysis of N-terminal amino acids

The sample was subjected to Edman decomposition with a gas-phase array analyzer (Applied Biosystems) and the obtained PTH amino acid was analyzed by routine procedures with an HPLC apparatus (Beckman Instruments) and an Ultrasphere-ODS column (Beckman Instruments).

The column (5 µm; diameter 4.6 mm and length 250 mm) is equilibrated with the starting buffer /aqueous solution containing 15 mM sodium acetate buffer (pH 4.5) and 40% acetonitrile/, the sample (dissolved in 20 µl of the starting buffer ) was inserted and a single elution was performed with the starting buffer. During this operation, the flow rate was maintained at 1.4 ml/min and the column temperature at 40°C.

Detection of PTH amino acid was performed using absorption in the ultraviolet region at 269 nm and 320 nm. Standard samples (2 nmol each) of PTH amino acid (Sigma) were separated on the same line to determine their retention times, which were compared with those of the sample in order to identify the N-terminal amino acids. PTH-methionine and PTH-threonine were detected in this way.

Example 19:

Creation of E. coli recombinant vector (-VSE) and transformation

1) Using the tac promoter containing vector

The procedures of Example 12 were repeated except that "pBRG4 obtained in Example 9 containing the cDNA shown in Figure 3(A)" /see (iii) in Example 12/ was replaced with "pBRV2 obtained in Example 10 containing the cDNA shown in Figure 4 (AND)". As in Example 12, the obtained transformants were confirmed as desirable (Figure 11).

2) Using a PL promoter containing vector

The procedures of Example 13 were repeated using cDNA (-VSE) and the resulting transformants were confirmed as desirable (Figure 12).

3) Using the trp promoter containing vector

The procedures of Example 14 were repeated using cDNA (-VSE) and the transformants were confirmed as desirable (Figure 13).

Example 20:

G-CSF activity test (-VSE)

Three types of transformants obtained in example 19 were cultivated by the method described in example 15. From cultured E. coli, G-CSF polypeptides were isolated and purified by the method described in example 16, so that human G-CSF polypeptide was obtained as a single band.

The G-CSF sample thus obtained was tested by the CSF activity test method (a) described earlier in this specification. The results are shown in Table 3.

Table 3

[image]

Example 21:

Amino acid analysis (-VSE)

1) Analysis of amino acid composition

The amino acid composition of the CSF sample purified in Example 20 was analyzed by the method described in 1) in Example 18. The results are shown in Table 4.

Table 4

Amino acid analysis data

[image]

2) Analysis of N-terminal amino acids

The sample was subjected to N-terminal amino acid analysis according to the method described in 2) example 18. In this way, PTH-methionine and PTH-threonine were detected.

Example 22:

Obtaining the pHGA410 vector (for use with animal cells +VSE lines)

The EcoRI fragment obtained in Example 9 whose DNA is shown in Figure 3(A) was treated with the restriction enzyme Dral at 37°C for 2 hours, and then it was treated with the Klenow fragment of DNA polymerase 1 (Takara Shuzo Co., Ltd.) as follows to create open ends. One microgram of BglII binder (8 mer, Takara Shuzo Co., Ltd.) was phosphorylated with ATP and attached to 1 µg of a specially prepared mixture of DNA fragments. The joined fragments were treated with the restriction enzyme, BglII, and subjected to agarose gel electrophoresis. Then only the largest DNA fragment was isolated.

This DNA fragment was equivalent to about 170 base pairs containing the human G-CSF polypeptide coding portion (see Figure 6). Vector pDKCR /Fukunga et al., Proc. Natl. Acad. Sci., USA, 81, 5086(1984)/ was treated with restriction enzyme BamHI and then dephosphorylated with alkaline phosphatase (Takara Shuzo Co., Ltd.). Vector DNA was obtained by ligating the 710 bp cDNA fragment in the presence of T4 DNA ligase (Takara Shuzo Co., Ltd.), thus obtaining pHGA410 (Figure 14). As shown in Figure 14, this plasmid contains the SV40 early gene promoter, replication of the SV40 origin replicator, part of the rabbit β-globin gene, replication of the pBR322 injection region, and the pBR322-derived β-lactamase gene (Amp1), with the human gene inserted below the promoter SV40 of the earlier gene.

Example 23:

Generation of a recombinant vector (+VSE) for use in transforming C127 cells

1) Creation of pHGA410 (H)

Twenty micrograms of plasmid pHGA410 (Figure 14) obtained in example 22 was dissolved in a reaction solution composed of 50 mM Tris-HCl (pH 7.5); 7 mM MgCl2, 100 mM NaCl, 7 mM 2-mercaptoethanol and 0.01% calf serum albumin (BSA).

The restriction enzyme, EcoRI (10-15 units; Takara Shuzo Co., Ltd.) was added to the reaction solution and kept at 37°C for about 30 minutes for partial digestion with EcoRI. The DNA fragment was then subjected to two treatments with a 1:1 mixture of phenol/chloroform, one treatment with ether and precipitation with ethanol.

The obtained DNA fragment was dissolved in 50 µl of a solution composed of 50 mM Tris-Hd, 5 mM MgCl2, 10 mM DTT, and one mM each of dATP, dCTP, dGTP and DTTP. Then 5 µl of Klenow fragment was added and the solution was incubated at 14°C for 2 hours to form open ends.

Then, using 0.8% agarose gel electrophoresis, 6 µg of a DNA fragment of about 5.8 kb in length was isolated.

Five micrograms of the isolated DNA fragment were dissolved in 50 µl of reaction solution composed of 50 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 10 mM DTT and 1 mM ATP. After adding 2 µg of HindIII binder (Takara Shuzo Co., Ltd.), the reaction was carried out overnight at 40C.

Further, treatments with phenol and ether and precipitation with ethanol were carried out. The pellet was dissolved in 30 µl of a solution composed of 10 mM Tris-HCl (pH 7.5), 7 mM MgCl 2 and 60 mM NaCl, and the solution was incubated for 3 hours at 37°C in the presence of 10 units of HindIII. After retreatment with T4 ligase, the obtained DNA was used to transform E. coli strain DH1 by the rubidium chloride method (see also Molecular Cloning). A colony of transformant cells was selected from ampicillin-resistant (Ampr) cells growing a plasmid identical to pHGA410 except that HindIII was inserted into the EcoRI site. The resulting plasmid was named pHGA410 (H) (Figure 15).

2) Creation of recombinant pTN-G4 expression vector

Twenty micrograms of pHGA410 (H) thus obtained was dissolved in 50 µl of a reaction solution composed of 10 mM Tris-HCl (pH 7.5) and 7 mM MgCl2, 175 mM NaCl, 0.2 mM EDTA, 7 mM 2-mercaptoethanol. and 0.01% bovine serum albumin. After addition of 20 units of SalI (Takara Shuzo Co., Ltd.), the reaction solution was incubated at 37°C for 5 hours. After treatment with phenol and precipitation with ethanol, incubation was performed as in 1) for 2 hours at 14°C in the presence of Klenow fragment of DNA polymerase (Takara Shuzo Co., Ltd), so that open ends are built. Without prior separation of DNA using agarose gel electrophoresis, the reaction solution was immediately subjected to ethanol precipitation. The resulting DNA fragment was treated with HindIII and 5 µg of the HindIII-SalI fragment (about 2.7 kbp) was separated by 1% agarose gel electrophoresis. In particular, plasmid pdBPV-1, which has bovine papilloma virus (BPV) (this plasmid was obtained through the kindness of Dr. Howley and is described in Sarver, N., Sbyrne, J.C. & Howley, P.M. Proc. Natl. Acad. Sci ., USA, 79, 7147-7151(1982)/ was treated with HindIII and PvuII, as described by Nagata et al., /Fukunga, Sokawa and Nagata, Proc. Natl. Acad. Sci., USA, 81, 5086 -5090(1984), so that an 8.4 kb DNA fragment is obtained. This 8.4 kb DNA fragment and a separate HindIII-SalI DNA fragment obtained (about 2.7 kbp) are ligated with T4DNA ligase. The ligation product is co- was prepared to transform E. coli strain DH1 using the rubidium chloride procedure described in Molecular Cloning. E. coli colonies growing a plasmid having a pHGA410-derived G-CSF cDNA were isolated. This plasmid was named pTN-G4 (Figure 15).

Adenovirus type II /Tanpakushitsu, Kakusan, Koso (Proteini, Nucleic Acids i Enzymes), 27, December, 1982, Kyoritsu Shuppan/ was similarly treated to obtain a plasmid. pVA containing about 1700-bp SalI-HindIII fragments VAI and VAII and a fragment containing VAI and VAII were isolated from this plasmid. This fragment was inserted into pTNG4 at the HindIII site, resulting in pTNG4VAα and pTNG4VAγ (Figure 15). Because of this, the VA gene of adenoviruses of these plasmids is able to highlight the expression of the transcription product from the early promoter of SV40.

Example 24:

Transforming C127 cells and G-CSF expression (+VSE)

Before being used to transform mouse C127 cells, pTN-G4 obtained in Example 23 was treated with the restriction enzyme BamHI. Twenty micrograms of plasmid pTN-G4 was dissolved in 100 µl of reaction solution /10 mM Tris-HCl (pH 8.0), 7 mM MgCl2, 100 mM NaCl, 2 mM 2-mercaptoethanol and 0.01% BSA/ and treated with 20 unit of BamHI (Takara Shuzo Co., Ltd.), and then treated with phenol and ether and precipitated with ethanol.

Mouse C127 cells grown in Dulbecco's minimal essential medium, containing 10% fetal bovine serum (Gibco). C127 cells grown in 5 cm diameter plates were transformed with 10 µg, per plate, of DNA specifically obtained by the calcium phosphate method / see Haynes, J. & Weissmann, C., Nucleic Acids Res., 11, 687-706 (1983) /. After treatment with glycerol, the cells were incubated at 37°C for 12 hours.

Incubated cells were transformed into three fresh 5 cm diameter plates and the medium was changed twice a week. At 1 day, seals were transferred to fresh plates and serially cultured on Dulbecco's minimal essential medium, containing 10% fetal bovine serum (Gibco), to isolate clones having a high rate of G-CSF production. These clones produced G-CSF of about 1 mg/ml. Further cloning gives rise to clones capable of producing G-CSF at a level of 10 mg/ml or more. In addition to C127I cells, NIH3T3 can also be used host cells.

Example 25:

Expression of G-CSF in CHO cells (+VSE)

1) Creation of pHGG4-dhfr

Twenty micrograms of plasmid pHGA410 obtained in example 22 was dissolved in 100 µl of reaction solution containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl2, 175 mM NaCl, 0.2 mM EDTA, 0.7 mM 2-mercaptoethanol. and 0.01% BSA. The reaction was carried out overnight at 37°C in the presence of 20 units of restriction enzyme SalI (Takara Shuzo Co., Ltd.), followed by treatment with phenol and ether and precipitation with ethanol.

The DNA precipitate was dissolved in 100 µl of the reaction solution, which contains 50 mM Tris-HCl, 5 mM MgCl2, 10 mM DTT and 1 mM each of dATP, dCTP, dGTP and dTTP and the reaction was carried out at 14°C for 2 hours in the presence of the Klenow fragment E. coli and DNA polymerase (10 µl; Takara Shuzo Co., Ltd.), followed by treatment with phenol and ether and precipitation with ethanol.

The EcoRI binder was attached to the DNA in the precipitate by the following procedures:

DNA dissolved in 50 µl reaction solution containing 50 mM Tris-HCl (pH 7.4), 10 mM DTT, 0.05 mM spermide, 2 mM ATP, 2 mM hexamine-cobalt chloride and 20 µg/ml BSA. The reaction was performed at 4°C for 12-16 hours in the presence of EcoRI binder (Takara Shuzo Co., Ltd.) and 200 units of T4DNA ligase (Takara Shuzo Co., Ltd.). After treatment with phenol, washing with ether and precipitation with ethanol, everything was done according to routine procedures. The DNA pellet was partially digested with EcoRI and 3 µg fragments of about 2.7 kbp in length were separated by 1% agar gel electrophoresis.

Plasmid pAdD26SVpA /Kaufman, R.G. & Sharp, P.A., Mol. Cell Biol., 2, 1304-1319(1982)/ was treated with E. coli and dephosphorylated by treatment with bacterial alkaline phosphatase (BAP). More specifically, 20 µg of pAdD26SVpA and 20 units of EcoRI were added to the reaction solution (50 mM Tris-HCl (pH 7.5), 7 mM MgCl2, 100 mM NaCl, 7 mM 2-mercaptoethanol and 0.01% BSA) and the reaction was carried out. at 37°C for 10 hours. Then 5 units of BAP were added to the reaction solution and the reaction was performed at 68°C for 30 minutes. After treatment with phenol, the EcoRI fragment of pAdD26SVpA was isolated by electrophoresis in a yield of about 5 µg.

A fragment of about 2.7 kbp in length and pAdD26SVpA, each weighing 0.5 µg, was annealed. The resulting plasmid was used to transform E. coli strain DH1, using the rubidium chloride method, and colonies of the pHGG4-dhfr plasmid grower were separated. The resulting plasmid was named pHGG4-dhfr (Figure 16a).

An alternative procedure is as follows: Plasmid pHGA410 was treated with SalI and partially digested with RcoRI, without addition of EcoRI binder. A DNA fragment of about 2.7 kbp in length was isolated and treated with the Klenow fragment of E. coli DNA polymerase to create open ends. An open-ended EcoRI fragment was obtained from pAdD26SVpA, as described above. This EcoRI fragment and a specially prepared fragment (about 2.7 kbp) were treated with T4DNA ligase, so that pHGG4-dhfr was obtained.

pHGA410 (H) obtained in Example 23 was treated with restriction enzymes HindIII and SalI, as described in 2) in Example 23 and the HindIII-SalI fragment was ligated to the open end of the EcoRI fragment of pAdD26SVpA, described above. This method can also be used to obtain pHGG4-dhfr (Figure 16b).

2) Creation of pG4DR1 and pG4DR2

Ten micrograms of plasmid pAdD26SVpA, mentioned in 1) was dissolved in 50 ml of reaction solution containing 50 mM Tris-HCl (pH 7.5), 7 mM MgCl2, 100 mM NaCl, 7 mM 2-mercaptoethanol and 0.01% BSA. After adding 10 units of each of the restriction enzymes EcoRI and BamHI, the reaction was carried out at 37°C for 10 hours, and then the treatment was continued with phenol and washing with ether. A DNA fragment of about 2 kb was separated by electrophoresis through a 1% low melting point agarose gel. The separated DNA fragment was treated with Klenow fragment DNA polymerase by routine procedures, so that open ends are built. The open-ended DNA fragment was treated with phenol, washed with ether and precipitated with ethanol.

Ten micrograms of plasmid pHGA410, obtained in 1) of example 23 were dissolved in 50 µl of reaction solution containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl2, 60 mM NaCl. The reaction was carried out for 6 hours at 37°C, in the presence of 10 units of HindIII. The DNA fragment was separated by electrophoresis from a 1% low-melting point agarose gel, performed by routine procedures. The isolated DNA fragment was then treated with BAP and open ends were created by treatment with the Klenow fragment. Then, by treating with phenol and washing with ether, the DNA fragment was attached to the open ends of the previously obtained 2-kb DNA fragment with T4DNA ligase according to the following procedures: 1 µg of each DNA fragment was dissolved in 30 µl of a reaction solution containing 66 mM Tris-HCl ( pH 7.5), 6.6 mM MgCl2, 5 mM DTT and 1 mM ATP and the reaction was performed at 6°C for 12 hours, in the presence of 50 units of T4DNA ligase. The ligation product was used to transform E. coli strain DH1. In this way, pG4DR1 and pG4DR2 were obtained, shown in Figure 16c.

3) Transforming and expressing

CHO cells (dhfr-type; courtesy of Dr. L. Chasin, Columbia University) were cultured for growth in alpha-minimal essential medium, containing 10% basic bovine serum (α-MEN supplemented with adenosine, deoxyadenosine, and thymidine). in a plate with a diameter of 9 cm (Nune). Cultured cells were transformed by the calcium-phosphate method (Wigler et al., Cell, 14, 725(1978)) as follows:

Carrier DNA (calf thymus DNA) was added in an appropriate amount to 1 µg of plasmid pHGG4-dhfr, obtained in 1), and the mixture was dissolved in 375 µl of TE solution, which was further followed by the addition of 125 µl of 1M CaCl2. The solution was cooled on ice for 3-5 min, and 500 µl of 2xHBS (50 mM Hepes, 280 mM NaCl, and 1.5 mM phosphate buffer) was added to the solution. After re-cooling on ice, the solution was mixed with 1 ml of CHO cell culture, transferred to plates and incubated for 9 hours in a CO2 incubator. The medium was removed from the plate and washed with TBS (Tris-buffered saline), 20% glycerol containing TBS was added, and the medium was washed again, after which non-selective medium (α-MEN medium, described above, except is supplemented with nucleotides). After the second day of incubation, the 10-fold diluted culture was transferred to selective medium (not supplemented with nucleotides). Cultivation was continued by replacing the selective medium with fresh medium every 2 days and the resulting colonies were picked and transferred to fresh plates, where the cells were grown in the presence of 0.02 µM methotrexate (MTX), followed by cloning through growth in the presence of 0, 05 µM MTX, which was further increased to 0.1 µM MTX.

Transformation of CHO cells can also be performed by counter-transformation with pHGG4 and pAdD26SVpA /see Shaill et al., Proc. Natl. Acad. ScL, USA, 80, 4654-4658(1983)/.

CHO cells were also transformed by the following procedures:

pG4DR1 or pG4DR2, which were obtained in 2) were pretreated with SalI and KpnI, to obtain DNA fragments and 10 µg of these fragments were used to transform CHO cells, as above; transformed cells were subjected to continuous cultivation in a series of selective media in the manner described above; about 7 days later no less than 100 separated colonies appear in each plate; these colonies were transferred en masse to a fresh plate and subjected to continued cultivation in a series of selective media, in the presence of 0.01 mM MTX, until ten odd colonies appeared; the same procedures were repeated with MTX concentrations of 0.02, 0.05, and 2.01 µM, and the colonies that survived were selected; colony selection can be performed in a similar manner, even when the resulting 10 odd colonies are subjected to cultivation with increasing concentrations of MTX.

A recombinant vector harboring the "polycitron gene" can also be used to transform CHO cells. An example of this alternative method is as follows:

pAdD26SVpA was treated with PstI and the separated two fragments were joined to the pBRG4-derived CSF cDNA fragment, so that a recombinant vector was built, where the adenovirus promoter, CSF cDNA, DHFR and poly(A), SV40 site were inserted in the written order. This recombinant vector was used to transform CHO cells.

Example 26:

Test of G-CSF activity (+VSE)

Culture supernatants of C127 cells and CHO cells obtained in examples 24 and 25, respectively, were subjected to an adjusted pH of 4 with 1N acetic acid.

After the addition of an equal volume of n-propanol, the resulting precipitate was removed by centrifugation. The supernatant was passed through an open column (diameter 1 cm and length 2 cm) filled with C8 reverse-phase carrier (Vamamura Kagaku K.K.) and eluted with 50% n-propanol.

The eluate was diluted twice with water and subjected to reverse-phase HPLC on a YMC-C8 column (Yamamura Kagaku K.K.), then eluting with n-propanol (30-60% linear density gradient) containing 0.1% TFA . Fractions eluted with n-propanol concentration of about 40% were separated, freeze-dried and dissolved in 0.1 M glycine buffer (pH 9). Due to these procedures, human G-CSF in C127 and CHO cells is concentrated about 20 times.

As a control, cells were transformed with human G-CSF cDNA-free plasmids and their culture supernatants were concentrated according to the procedures described above. The activities of the human G-CSF samples were tested by the method for testing the activity of human G-CSF (a) described earlier in this specification. If the expression efficiency is high enough, culture supernatants can be directly assayed without prior concentration. The results are given in Table 5, where the data are based on concentrated samples.

Table 5

Assay of the activity of human G-CSF

[image]

Example 27:

Amino acid analysis and sugar analysis (+VSE)

1) Analysis of amino acid composition

The crude CSF sample obtained in Example 26 was purified according to the procedures described in Example (iii). The purified CSF sample was hydrolyzed by routine procedures, the protein part of the hydrolyzate was examined for amino acid composition using a special method of amino acid analysis with a Hitachi 835 automatic amino acid analyzer (Hitachi, Ltd.). The results are shown in table 6. Hydrolysis was performed under the following conditions:

(i) 6 N HCl, 110°C, 24 hours, in vacuo

(ii) 4 N methanesulfonic acid +0.2% 3-(2-aminoethyl)indole, 110°C, 24 hours, 48 hours, 72 hours, in vacuo.

The sample was dissolved in a solution (1.5 ml) containing 40% n-propanol and 0.1% trifluoroacetic acid. Aliquots of the solution, each of 0.1 ml, were dried with dry nitrogen gas, after the addition of the reagents specified in (i) or (ii), the vessels with the solution were sealed in vacuum, which was further followed by hydrolysis of the contents.

Each of the values shown in table 6 is the mean value of 4 measurements, 24 values for (i) and 24, 48 and 72 hour values for (ii), except for the content of Thr, Ser, 1/2Cys, Met, Val, Ile and Trp were calculated by the following methods (see "Tampaku Kagaku (Protein Chemistry) II" A Course in Biochemical Experiments. Tokyo Ka-gaku Dohjin):

For thr, Ser, 1/2Cys and Met, the time dependence of the profile of 24, 48 and 72 hour values for (ii) was extrapolated to 0 hours.

For Val and Ile, the 72 hour value for (ii) was used. For Trp, the mean of the 24, 48 and 72 hourly values for (ii) was used.

Table 6

Amino acid analysis data

[image]

2) Analysis of sugar content

An internal standard (25 nmol of inositol) was added to 200 ng of the purified CSF sample used for amino acid composition analysis 1). After the addition of a methanol solution (µ1) containing 1.5 N HCl, the reaction was carried out at 90°C for 4 hours in purified N2 in a closed test tube. The tube was then opened and silver carbonate (Ag2CO3) was added to neutralize the contents. Then 50 µl of acetic hydride was added and the test tube was shaken for some time. The tube was left overnight in the dark at room temperature. The upper layer was placed in a sample tube and dried with nitrogen gas. Methanol was added to the precipitate and the mixture was washed and centrifuged in the light. The top layer was placed in the same sample tube and dried. After adding 50 µl of TMS reagent (5:1:1 mixture of pyridine:hexamethyldisilazane and trimethylchloro-silane), the reaction was carried out at 40°C for 20 minutes and the reaction product was placed in a freezer for deep freezing. The standard was obtained by combining 25 nmol of inositol with 50 nmol each of galactose (Gal), N-acetyl galactosamine (Gal NAc), sialic acid and some other appropriate reagent.

The samples thus obtained were subjected to gas chromatographic analysis under the following conditions:

Analysis conditions

Column: 2% OV-17 VINport HP, 0.25-0.18 mm, 3 m, glass

Temperature: increased from 110 to 250°C at 4°C/min.

Carrier gas pressure (N2): initial 0.12-0.16 Pa

ultimate 0.2-0.25 Pa

Sensitivity: 103 M range, 0.1-0.4 volts

Pressure: H2, 0.08 Pa

air, 0.08 Pa

Sample 2.5-3.0 µl

In this way galctosome N-acetyl galctosamine and sialic acid were identified in the CSF sample of the present invention.

Example 28:

Obtaining the pHGV2 vector (for use with animal cells, -VSE lines)

The EcoRI fragment obtained in Example 10 having the cDNA shown in Figure 4(A) was treated with the restriction enzyme DraI for 2 hours at a temperature of 37°C, and then with the Klenow fragment of DNA polymerase I (Takara Shuzo Co., Ltd.) so that open ends are formed. One microgram of BglII binder (8 mer, Takara Shuzo Co., Ltd.) was phosphorylated with ATP and attached to about 1 µg of a specially obtained mixture of DNA fragments. The joined fragments were treated with the restriction enzyme, BglII, and subjected to agarose gel electrophoresis. Then only the largest DNA fragment was isolated.

This DNA fragment is equivalent to about 700 bp containing the coding part of human G-CSF. Vector pdKCR /fukunaga et al., Proc. Natl. Acad. Sci., USA 81, 5086(1984)/ was treated with the restriction enzyme, MaMHI, and then dephosphorylated with alkaline phosphatase (Takara Shuzo Co., Ltd.). The obtained vector DNA was joined to about 700 cDNA fragment in the presence of T4 DNA ligase (Takara Shuzo Co., Ltd.), so that pHGV2 was obtained (Figure 17). As shown in Figure 17, this plasmid contains the SV40 early gene promoter, replication of the SC40 start region of the rabbit γ-globin portion, replication of the start region of pBR322 and the pBR322-derived β-lactamase gene (Ampr), with the human G-CSF gene fused below promoter for SV40 early gene.

Example 29:

Generation of a recombinant vector (-VSE) for use in transforming C127 cells

1) Creation of pHGV2(H)

Twenty micrograms of plasmid pHGV2 (Figure 17) obtained in Example 28 was treated with the procedures described in 1) in Example 23, so that a plasmid named pHGV2(H) (Figure 18) was formed.

2) Creation of recombinant expression vectors pTN-V2, pTNVAα and pTNVAβ

Using 20 µg of pHGV2(H), the procedures described in 2) in Example 2 were repeated to select an E. coli cultured plasmid having a pHGV2-derived G-CSF cDNA. This plasmid was named pTN-V2 (Figure 18).

Adenovirus type II /Tampakushitsu, Kakusan Koso (Proteins, Nucleic Acids and Enzymes), 27, December, 1982, Kyoritsu Shuppan/ were similarly treated to obtain plasmid ∆pVA, which contains about 1700 bp SaII-HindIII portion that grows VAI and VAII and a fragment containing VAI and VAII was isolated from this plasmid. This fragment was inserted into PTN-2 at the HindIII site to obtain pTNVAα and pTNVAβ (Figure 18). Due to the VA gene of adenovirus, this plasmid is able to enhance the transcriptional expression of the product from the earlier SV40 promoter.

Example 30:

Transformation of C127 cells and G-CSF expression in (-VSE)

pTN-V2 obtained in Example 29 was treated with the restriction enzyme BamHI before being used to transform mouse C127 cells.

Mouse C127 cells were transformed with the DNA thus obtained to express G-CSF (see Example 24) and clones possessing a high G-CSF production rate were selected. These clones produce G-CSF of about 1 mg/l.

By further cloning, clones capable of producing G-CSF of about 10 mg/1 can be isolated. Similarly, C127 cells were transformed with pTNVAα and pTNVAβ obtained in Example 29, and transformants were selected for clones having high G-CSF production capacity. Thus, clones with pTNVAα that are capable of producing G-CSF in a yield of 20 mg/1 or more can be obtained, while clones with lower productivity (several mg/1) are obtained with pTNVAβ.

In addition to C127 cells, NIH3T3 cells can also be used.

Example 31:

Expression of G-CSF in CHO cells (-VSE)

1) Construction of pHGV2-dhfr

A DNA fragment of about 2.7 kbp in length was obtained from 20 µg of plasmid pHGV2 (Example 28) by the procedures described in 1) in Example 25. This fragment (0.5 µg) and the EcoRI fragment of pAdD26SVpA (0.5 µg) were annealed. The resulting plasmid was used to transform E. coli DH1 by the rubidium chloride method and colonies growing the pHGV2-dhfr plasmid were selected. The resulting plasmid was named pHGV2-dhfr (Figure 19a).

An alternative procedure is as follows: plasmid pHGV2 was treated with Sa1L and partially digested with EcoRI without attaching any EcoRI linker. A DNA fragment of about 2.7 kbp in length was isolated and treated with the Klenow fragment of E. coli DNA polymerase, so that open ends are created. The exposed ends of the EcoRI fragment were obtained from pAdD26SVpA, as described above. This EcoRI fragment and a separately prepared fragment (about 2.7 kbp) were treated with T4DNA ligase to generate pHGV2-dhfr.

pHGV2 (H) obtained in 1) of Example 29 was treated with the restriction enzyme HindIII and SandII, as described in 2) of Example 29, and the HindIII-SandII fragment was ligated to the open ends of the EcoRI fragment of pAdD26SVpA, described above. This method can also be applied to prepare pHGG4-dhfr (Figure 19b).

2) Formation of pV2DR1 and pV2DR2

Ten micrograms of plasmid pAdD26SVpA, mentioned in 1) was dissolved in 50 ml of reaction solution containing 50 mM Tris-HCl (pH 7.5), 7 mM MgCl2, 100 mM NaCl, 7 mM 2-mercapto-ethanol and 0.01% BSA. The reaction was performed at 37°C for 10 hours in the presence of 10 units of each of the following enzymes, EcoRI and BamHI. Then treatment with phenol and washing with ether was carried out, routine procedures. A DNA fragment of about 2 kb was separated by electrophoresis, through a 1% agarose gel of low (melting point, routine procedures).

The separated DNA fragment was treated with the Klenow fragment of DNA polymerase by routine procedures, so that open ends are built. The open-ended DNA fragment was treated with phenol, washed with ether and precipitated with ethanol.

Ten micrograms of plasmid pHGV2(H) obtained in 1) of example 29 were dissolved in 50 µl of reaction solution, which contains 10 mM Tris-HCl (pH 7.5), 7 mM MgCl 2 , and 60 mM NaCl. The reaction was performed at 37°C for 6 hours in the presence of 10 units of HindIII. The DNA fragment was separated by electrophoresis through a 1% low melting point agarose gel, using routine procedures. The isolated fragment was then treated with BAP and open ends were obtained by treatment with the Klenow fragment. Using phenol treatment and washing with ether, the DNA fragment was ligated to the open ends of the previously obtained 2-kb DNA fragment with T4DNA ligase, using the following procedures: 1 µg of each fragment was dissolved in 30 µl of a reaction solution containing 66 mM Tris-HCl (pH 7 ,5), 6.6 mM MgCl2, 5 mM DTT and 1 mM ATP, and the reaction was performed at 6°C for 12 hours in the presence of 50 units of T4DNA ligase. The ligation product was used to transform E. coli strain DH1. In this way, pV2DR1 and pV2DR2 were obtained, shown in Figure 19c.

3) Transformation and expression

CHO cells were transformed with plasmid pHGV2-dhfr for G-CSF expression according to the procedures described in 3) in example 25.

Transformation of CHO cells can also be performed by co-transformation with pHGV2 and pAdD26SVpA.

CHO cells were transformed by the following procedures: pV2DR1 or pV2DR2 obtained in 2) were previously treated with SalII and KpmI to obtain DNA fragments and 10 µg of these fragments were used to transform CHO cells as before; the transformed cells were subjected to prolonged cultivation in series of selective media as described above, about 7 days later, not less than 100 separate colonies appeared per plate; these colonies were transferred en masse to a fresh plate and subjected to extended cultivation in batches of selective media in the presence of 0.01 µm. MTX, until ten odd colonies appear; the same procedures were repeated with MTX concentrations that were serially increased to 0.02 µM, 0.05 µM and 0.1 µM and the surviving colonies were separated; colony selection can be performed in the same way even when 10 non-prime colonies are obtained by individual selection and subjected to cultivation with increasing MTX concentrations.

A recombinant vector carrying a "polycistronic gene" can also be used to transform CHO cells. An example of an alternative method is as follows:

pAdD26SVpA was treated with PstI and the separated two fragments were ligated to the pBRV2-derived CSF cDNA fragment to create a recombinant vector where the virus promoter, CSF cDNA, DHFR and poly(A) site of SV40 were inserted in the order written. This recombinant vector was used to transform CHO cells.

Example 32:

G-CSF activity test (-VSE)

By the procedures described in example 26, human G-CSF obtained from culture supernatants of C127 cells and CHO cells obtained in examples 30 and 31. Human G-CSF activity of each of the isolated samples was tested as in example 26. The results are shown in table 7 .

Table 7.

Assay of human G-CSF activity

[image]

Example 33:

Amino acid analysis and sugar analysis (-VSE)

1) Analysis of amino acid composition

The crude CSF sample obtained in Example 32 was purified according to the procedures described in Example 2(iii). The purified CSF sample was subjected to amino acid composition analysis by the procedures described in 1) in Example 27. The results are shown in Table 8.

Table 8

Amino acid analysis data

[image]

2) Analysis of sugar composition

The purified CSF sample used in the analysis of the amino acid composition in 1) was also subjected to the analysis of the sugar composition using the same procedures and under the same conditions as described in 2) in example 27. In this way, the presence of galactose, N-acetyl galactosamine and sialic acid in CSF sample of this invention.

Example 34:

Construction of a recombinant vector containing a chromosomal gene for expression in COS cells

Plasmid pBRCE3β, which was obtained in Example 11 and which contains the chromosomal gene shown in Figure 5, was treated with EcoRI. The pSVH+K+ plasmid, described in Banerija et al., Cell, 27, 299(1981), was treated with KpnI to remove the globin gene. The plasmid was further subjected to partial digestion with HindIII, in order to remove part of the residual SV40 gene. The fragments were rejoined, resulting in the pML-E+ expression vector.

This vector was treated with a restriction enzyme, EcoRI, and dephosphorylated with alkaline phosphatase (Takara Shuzo Co., Ltd.) to obtain vector DNA, which was linked to the above-mentioned chromosomal DNA by T4DNA ligase (Takara Shuzo Co., Ltd. ), so that pMLCE3 is obtained. As shown in Figure 20, this plasmid contains the SV40 gene enhancer, the SV40 origin replicon, the pBR322 origin replicon and the pBR322-derived β-lactamase gene (AMpr), and the human G-CSF chromosomal gene fused below the SV40 gene enhancer.

Example 35:

Expression of the human G-CSF chromosomal gene in COS cells

COS-1 cells (obtained courtesy of Dr. Gluzman from Cold Spring Harbor Laboratory, USA), grown to a density of about 70% in Petri dishes (9 cm diameter, Nunc), using DMEM medium (Dulbecco's modification Eagle's medium, obtained from Nissui Sieyaku K.K., under the trade name "Nissui") containing 10% calf serum, was transformed by the calcium-phosphate method /Wigler et al., Cell, 14, 725 (1978)/ or DEAE- by the dextran:chloroquine method /see, for example, Gordon et al., Science, 228, 810(1985)/.

Transformation with the calcium-phosphate method was performed as follows: 160 µg of plasmid pMLCE3, obtained in example 34, was dissolved in 320 µl of TE solution and after the addition of distilled water (3.2Ml), 504 µl of 2M CaCl2 was added.

4 ml of 2xHBS (50 mM Hepes, 280 mM NaCl, 1.5 mM phosphate buffer, pH 7.12) was added to the resulting solution and the mixture was cooled on ice for 20-30 minutes. The cooled mixture was added dropwise to the medium in an amount of 1 ml per Petri dish, where COS-1 cells were grown. After culturing for 4 hours at 37°C in a CO2 incubator, the cells were washed with DMEM medium without serum, and left to stand for about 3 minutes at room temperature in 5 ml of DMEM medium containing 20% glycerol, and washed again with DMEM medium without serum . After removing the DMEM medium that does not contain serum, 10 ml of DMEM medium containing 10% calf serum was added and the cultivation was performed overnight in a CO2 incubator. The medium was then replaced with fresh medium of the same type and cultivation was carried out for an additional 3 days.

Transformation by the DEAE-dextran: chlorquine method was performed as follows: As in the calcium-phosphate procedure, COS-1 cells were grown to 70% density and washed twice with serum-free DMEM medium; DMEM medium containing serum and containing 250 µg/ml DEAE-dextran and 2 µg/ml plasmid pMLCE3, obtained in example 34, was added to the washed cells and the cultivation was carried out at 37°C for 12 hours; then the cells were washed twice with serum-free DMEM medium and subjected to further cultivation at 37°C for 2 hours in DMEM medium containing 10% calf serum and 1 mM chloroquine; then the cells were washed twice with DMEM medium containing no serum and cultured at 37°C for another three days in DMEM medium containing 10% calf serum.

The supernatant of the COS-1 cell culture thus obtained was adjusted to pH 4 with 1 N acetic acid. After the addition of the same volume of n-propanol, the resulting precipitate was removed by centrifugation. The supernatant was passed through an open column of diameter 1 and length 2 cm, filled with C8 reverse-phase support (Yamamura Kagaku K.K.) and elution was performed with 50% n-propanol. The eluate was diluted twice with water and subjected to reverse-phase HPLC on a YMC-C8 column (Yamamura Kagaku K.K.), eluting with n-propanol (30-60% linear density gradient) containing 0.1% TFA. Fractions eluted with n-propanol concentration of about 40% were separated, freeze-dried and dissolved in 0.1 M glycidic buffer (pH 9). As a result of these procedures, human G-CSF in the culture supernatant of COS-1 cells is concentrated about 20-fold.

As a control, COS-1 cells were transformed with G-CSF chromosomal gene free pML-E+ by the procedures described above and the culture supernatant was concentrated.

The human G-CSF activity of the obtained samples was assayed using the "Method of Human G-CSF Activity Assay(s)" described earlier in this specification. The results are given in table 9.

Table 9.

[image]

Example 36:

RNA analysis of G-CSF (chromosomal gene)

COS cells cultured to a cell concentration of 8x106 cells/plate (diameter 9 cm) were transformed with 80 µg of plasmid pMLCE3α. After 48 hours, total RNA was obtained according to the procedure of Chirgwin /Biochemistry, 18, 5294-5299 (1979)/.

Plasmid pBRG4 obtained in Example 9 was cut with the restriction enzyme AhaIII and the resulting pBRG4-derived DNA fragment was radiolabeled with /γ32-P/ATP using T polynucleotide kinase to obtain an approximately 2.8 kb DNA fragment containing G-CSF cDNA. The fragment was isolated and used as a DNA probe.

After denaturing the DNA sample (1.5x105 s.p.m., 2.8x106 s.p.m./µg DNA), it was mixed with 20 µg of total RNA obtained from CMOS cells. After hybridization at 45°C for 15 hours, the mixture was digested with 200 units/ml or 400 units/ml S1 nuclease (p.L. Bichemicals) according to the procedure of Weaver and Weissmann /Nucleic Acid Res., 7, 1175-1193(1979), which is followed by 4% polyacrylamide gel electrophoresis in the presence of 8.3 M urea. Then the detection was carried out using autoradiography.

A band corresponding to 722 bp was observed as a strong radiolabeled band in COS cells, and a corresponding band for 487 bp was also detected.

Therefore, COS cell RNA was found to contain G-CSF of the +VSE and -VSE lines.

Example 37:

Amino acid analysis and sugar analysis (chromosomal gene)

1) Analysis of amino acid composition

The crude CSF sample obtained in Example 35 was purified according to the procedures described in Example 2(iii). The purified CSF sample was subjected to amino acid composition analysis by the procedures described in 1) example 27. The results are shown in table 10.

Table 10

Amino acid analysis data

[image]

2) Analysis of sugar composition

The purified CSF sample used in the analysis of amino acid composition in 1) was also subjected to analysis of sugar composition by the same procedures as described in 2) in example 27. As a result of this analysis, the presence of galactose, N-acetyl galactosamine and sialic acid in the CSF sample of this was confirmed invention.

Example 38:

Expression of the human G-CSF chromosomal gene in C127 cells

Plasmid pMLCEα, obtained in example 34, was treated with EcoRI and a fragment of about 4 kb was isolated by the procedures described in Molecular Cloning. The isolated fragment was used as the source of the chromosomal G-CSF gene.

The fragment is treated with Klenow fragment of DNA polymerase I, so that open ends are built (A).

The SV40 promoter (about 0.4 kb EcoRI-EcoRI fragment) was excised from plasmid pHGA410 (obtained in Example 22) by the procedures described in Molecular Cloning, and then treated with the Klenow fragment of DNA polymerase (B).

In a separate step, plasmid pdBPV-1 harboring bovine papilloma virus (BPV)/this plasmid was obtained through the courtesy of Dr. Howley and is described in Sarver, N., Sbyrne, J.C. & Howley, P.M. Proc. Natl. Acad. Sci., USA, 79, 7147-7151 (1982)/ was treated with HindIII and PvuII, so that a DNA fragment of about 8.4 kb was obtained. This fragment was treated with Klenow fragment of DNA polymerase 1 and dephosphorylated with bacterial alkaline phosphatase (C).

DNA fragments (A), (B) and (C), each weighing 0.1 µg were dissolved in 20 µl reaction solution /50 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 10 mM DTT and 1 mM ATP/ and the reaction was performed overnight at 4°C in the presence of 180 units of T4DNA ligase.

The reaction solution was then treated with rubidium chloride, according to the procedure described in Molecular Cloning, so that the plasmid pTNCE3α was obtained (Figure 21).

DNA fragments (A), used as the source of the chromosomal G-CSF gene can be replaced by a DNA fragment of about 1.87 kb, which was obtained by the following procedures:

20 µg of pMLCE3α was dissolved with 100 µl of a mixture of 10 mM Tris-HCl (pH 8.0), 7 mM MgCl2 and 100 mM NaCl, 7 mM 2-mercaptoethanol and 0.01% BSA; the solution was incubated at 37°C for 5 hours in the presence of 20 units of StuI and electrophoresed through a 1.2% agarose gel.

The thus obtained plasmid pTNCE3α was used to transform C127 mouse cells, as in example 24, and clones expressing the human G-CSF chromosomal gene and those with a high capacity for G-CSF production were isolated.

Example 39:

Expression of the human G-CSF chromosomal gene in CHO cells

As in the case of expression in C127 cells, plasmid pMLCE3α was treated with StuI and a DNA fragment of about 1.78 kb was isolated; alternatively, the same plasmid was treated with EcoRI and an EcoRI fragment of about 4 kb was isolated. Both fragments are suitable for use as sources of the chromosomal G-CSF gene.

The source of the fragment was treated with Klenow fragment of DNA polymerase 1 (a).

As in example 38, the SV40 promoter (EcoRI-EcoRI fragment) was excised from pHGA410, so that a fragment of about 0.4 kb was obtained, which was similarly treated with the Klenow fragment of DNA polymerase (b).

In a separate step, the plasmid pAdD26SVpA plasmid /Kaufman, R.G. & Sharp, P.A., Mol. Cell. Biol., 2, 1304-1319(1982)/ was treated with EcoRI, and then with the Klenow fragment of DNA polymerase, and finally dephosphorylated by treatment with bacterial alkaline phosphatase (c).

Fragments (a), (b) and (c), each weighing 0.1 µg, were dissolved in 20 µl reaction solution /50 mM Tris-HCl (pH 7.6), 10 mM MgCl2, 10 mM DTT and 1 mM The ATP/i reaction was performed overnight at 4°C in the presence of 180 units of T4DNA ligase.

The reaction solution was then treated with rubidium chloride by the procedure also described in Molecular Cloning, so that E. coli species Dhl were transformed. The resulting Tetr colonies were tested for PD26SVCE3 content.

As shown in Figure 22, plasmid pD26SVCE3α has the CSF gene linked to the SV40 early gene, and the dhfr gene linked below the principally last adenovirus promoter.

Plasmid pAdD26SVpA was treated with EcoRI and BamHi as in 2) of example 25, so that a DNA fragment (about 2 kb) containing the dhfr gene was obtained. This fragment was ligated to fragment (a) and the EcoRI-SaII fragment of pHGA410 (H), thus creating the Ampr expression vector pDRCE3α (Figure 22).

CHO cells were transformed with the thus obtained plasmids, pD26SVC3α and pDRCE3α, as in example 25. By repeated cross-growth selection in the presence of MTX clones of G-CSF, a production species was obtained.

Example 40:

Examination of G-CSF activity of transformants (expressing a human chromosomal gene)

Culture supernatants of C127 cells and CHO cells obtained in Examples 38 and 39 were processed as in Example 26 to obtain human G-CSF and its activity was tested. The results are shown in table 11.

Table 11

Assay of human G-CSF activity

[image]

Example 41:

Molecular mass and isoelectric point of transformants

The purified CSF samples used in the amino acid composition analyzes in Examples 16, 20, 27, 33 and 37 were subjected to molecular mass and isoelectric point measurements following the following procedures>

1) Molecular mass

The mass of CSF molecules was determined by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDE-PAGE). The electrophoresis equipment was PROTEANTM (16 cm, a product of BioRad Corporation) using a gel made from a polyacrylamide plate gel (T=15%, C=2.6%) measuring 140 mmx160 mmx1.5 mm and a gel concentrate (T=3%, C=20). A denatured CSF sample was obtained following the following procedure: CSF was boiled for 3 minutes in a solution containing 2% sodium dodecyl sulfate in 0.46 M 2-mercaptoethanol. After electrophoresis with 4 µg of sample at a constant current of 30 mA for 4 hours, the gel was separated and stained with 0.24% Coomassie Brilliant Blue R 250 (product of Sigma Chemical Co.) for band detection. The following substances were used as molecular mass markers after similar treatments: phosphophorylase B (mol. mass 92500), bovine serum albumin (BSA, mol. m. 67000), ovalbumin (OVA, mol. m. 45000), carbonic anhydrase (mol. m. m. 31000), soy trypsin inhibitor (mol. m. 21500) and lysozyme (mol. m. 14400).

In this way, a single band corresponding to a molecular weight of 185000±1000 was identified for each of the CSF samples obtained in Example 18 /E. coli/cDNA (+VSE)/ and example 20 /E. coli/cDNA (-VSE)/, and a single band corresponding to a molecular weight of 19000±1000 was identified for each CSF sample obtained in Example 27 /C127,CHO/cDNA (+VSE)/, Example 33 /C127,CHO/cDNA (-VSE)/ and example 37 /COS/gDNA/.

2) Isoelectric point

The isoelectric point of the CSF of this invention was determined using a flat stand, isoelectric apparatus, FBE-3000 (Product of Pharmacia Fine Chemicals). After 2 hours of electrophoresis with a constant power of 30 watts (Vmax=2000 volts) on a polyacrylamide gel (T=5%, C=3%, 115 mmx230 mm) containing Framelit (pH= 4-6.5, Pharmacia Fine Chemicals) and 4M urea, CSF was fixed with 30% methanol/10% trichloroacetic acid/35% sulfoalylic acid, and stained with Coomassie Brilliant Blue R 250. Low pI kit (pH=2.5-6.5, product of Pharmacia Fine Chemi- cals) was used as an isoelectric point marker.

Band separation analysis at pH 4-6.5 gives a single band corresponding to pI=6.1 for each of the CSF samples obtained in Examples 16 and 20, and further three separated bands, corresponding to pI=5.5, 5, 8 and 6.5 for each of the samples obtained in examples 27, 33 and 37.

Example 42:

Protective effect of human G-CSF against microbiological infections

Test method

1. Protection against infection with Pseudomonas aeruginosa

Endoxan (trade name Shionogi & Co., Ltd.) was administered intraperitoneally to 8-9-week-old mice (males; 35.3±1.38 g body weight) at a dose of 200 mg/kg.

Mice were then divided into three groups / two groups received subcutaneously 4 injections (deze 0.1 ml) every 24 hours of solvent /1% propanol and 0.5% (m/v) mouse serum albumin in saline) containing human G-CSF (25,000 or 50,000 units per mouse), while the other group was given solvent alone according to the same schedule. Three hours after the last injection, mice in each group were infected with Pseudomonas aeruginosa GNB-139 by subcutaneous injection (3.9x105 CFU/mouse). Twenty-one hours after infection, the mice of the first group were given a second subcutaneous injection of a solvent containing human G-CSF (25,000 or 50,000 units/mouse) and the second group was given only solvent.

The protective effect of human G-CSF was tested by counting mice that remained alive 10 days after infection.

Preparation of cell suspension

Pseudomonas aeruginosa. GNB-139 was cultured overnight with shaking at 37°C in cardiac infusion liquid medium (trade name Difco). The culture was suspended in physiological saline solution.

2. Protection against Candida infection

Endoxan (trade name Shinogi & Co., Ltd.) was administered intraperitoneally to 8-week-old ICR rats (male; 40.5±1.60 g body weight) at a dose of 200 mg/kg. The mice were divided into two groups; one group was given 4 subcutaneous injections, (doses 0.1 ml) every 24 hours, of a solvent (1% propanol and 10% m/v) of ICR mouse serum in saline/ containing human G-CSF (50,000 units per mouse ), while the other group was given only the solvent according to the same schedule. Four hours after the last injection, mice in each group were infected with Candida albicans U-50-1 (species isolated from urine or leukemic patients; courtesy of the Laboratory of Bacteriology, Tohoku University, School of Medicine) by intravenous injection (5.6x105 CFU/mouse ). The protective effect of human G-CSF was examined by counting mice that remained alive ten days after infection.

Preparation of cell suspension

Candida albicans U-50-1 was cultured overnight with shaking at 37°C in yeast extract containing Sabouraud-liquid medium (2% dextrose from Junsei Pure Chemicals Co., Ltd.; tryptocase peptone, trade name BBL; 5% extract yeast from Difco; pH 5.6). The culture was washed twice with saline and suspended in saline.

3. Protection against infection with intracellular parasitic Listeria

Endotoxan (trade name Shionogi & Co., Ltd.) was administered intraperitoneally to 7-week-old ICR mice; 34.7±1.24 g of body weight) in a dose of 200 mg/kg. The mice were divided into two groups; one group was given 4 subcutaneous injections, (0.1 ml dose) every 24 hours, solvent /1% propanol and 10% (m/v) ICR mouse serum in saline/ containing human G-CSF (50000 units/ mouse) while the other group was given only solvent according to the same schedule. Four hours after the last injection, mice of each group were infected with Listeria monocytogenes 46 (courtesy of the Microbiology Laboratory, Tohoku University, School of Medicine) by intravenous injections of 1.0x107 CFU/mouse. The protective effect of human G-CSF was examined by counting mice that remained alive 12 days after infection.

Preparation of cell suspension

Listeria monocytes 46 were cultured overnight with shaking at 37°C in brain-cardiac infusion liquid medium (trade name Difco). The culture is suspended in physiological solution.

The results:

i) Tests 1, 2 and 3 were performed with the E. coli G-CSF (+VSE) polypeptide obtained in Example 16. The results are shown in Tables 12, 13 and 14.

Table 12

Effect against Pseudomonas aeruginosa

[image]

Table 13

Effect against Candida albicans

[image]

Table 14

Effect against Listeria monocytogenes

[image]

ii) Test 1 was performed with the E. coli G-CSF (-VSE) polypeptide obtained in Example 20. The results are shown in Table 15.

Table 15

Effect against Pseudomonas aeruginosa

[image]

iii) Testing against Pseudomonas aeruginosa

[image] Substantially the same results were obtained when assay 1 was performed with a C127 cell-derived, purified G-CSF sample of the same one used in the amino acid composition analysis in Example 27.

iv) Test 1 was performed with CHO derived cells, a purified human G-CSF sample (+VSE) which is the same as that used in the amino acid composition analysis in Example 33.

The results are shown in table 17.

Table 17.

Effect against Pseudomonas aeruginosa

[image]

Essentially the same results were obtained when assay 1 was performed with C127 cell-derived, purified human G-CSF sample that was the same as that used for the amino acid composition analysis in Example 33.

Claims (10)

1. A human chromosomal gene coding for a polypeptide characterized by the activity of human granulocyte colony-stimulating factor containing all or only part of the nucleotide sequence shown in Figure 5. 2. Human chromosomal gene according to claim 1, characterized in that said chromosomal gene contains a nucleotide sequence that participates in transcription control. 3. Human chromosomal gene according to claim 1, characterized in that it is associated with a replicon derived from a microorganism or a virus. 4. Recombinant vector, characterized in that it contains a human chromosomal gene according to claim 1. 5. Recombinant vector according to claim 4, characterized in that said human chromosomal gene contains a nucleotide sequence that participates in transcription control. 6. Recombinant vector according to claim 4 or 5, characterized in that said human chromosomal gene is associated with a replicon of a microorganism or a replicon derived from a virus. 7. Transformant, characterized in that it contains a recombinant vector according to any one of claims 4 to 6. 8. A process for the production of a glycoprotein that has human granulocyte colony-stimulating factor activity, indicated by the fact that it includes: a) cultivation of transformant culture according to claim 7 in media culture i b) recovery of the glycoprotein culture that has human granulocyte colony-stimulating factor activity. 9. The method according to claim 8, characterized in that said glycoprotein has a carbohydrate chain part and a polypeptide that is represented in whole or in part by the following amino acid sequence: [image] and where m is 0 or 1 10. Strain E coli X 1776, characterized by the fact that it contains approx. A 4 kb DNA fragment coding for human G-CSF was inserted into the EcoRI site of plasmid pBR327 (FERM BP-956).