SI21397A - Human granulocyte colony stimulating factor. - Google Patents

Abstract

The invention concerned provides a gene which is coding a polypeptide with an activity stimulating factor for a human granulocyte colony (human G-CSF), a recombinant vector of the said built-in gene, a transformed compound which the said vector contains, a polypeptide or glycoprotein having a human G-CSF activity and is manufactured by means of the said transformed compound, and the procedure for recovery of polypeptide or glycoprotein with the human G-CSF activity. The gene from the invention concerned comprises two lines of cDNA, complementary to a messenger RNA (mRNA) coding the polypeptide with the human G-CSF activity and contains also a human chromosome gene coding a polypeptide with the human G-CSF activity

Description

A FACTOR STIMULATING THE HUMAN COLONY OF GRANULOCYTES

The field of technology

The present invention falls within the field of molecular biology.

A technical problem

The present invention relates to a factor that stimulates a human granulocyte colony. The present invention more specifically relates to a coding gene for a polypeptide that possesses the activity of a colony stimulating factor (hereinafter referred to as CSF), which is a specific stimulating factor required mainly for the construction of colonies of human granulocyte cells.

The present invention also relates to a recombinant vector present in said gene, a transformant containing said gene, a polypeptide or glycoprotein having CSF activity, if obtained from said transformant, and a method for producing polypeptides and glycoproteins having CSF activity.

The state of the art

When bone marrow cells, like mint cells and kidney cells or embryonic cells, are cultured with bilayer soft agar with bone marrow cells in the upper layer and kidney or embryonic cells in the lower layer, a portion of the upper layer cells grows and differentiates to build neutrophil granulocyte colonies (further easily granulocyte) or monocytic macrophages. This observation suggests the presence of in vivo factors that aid colony building / Pluznik and Sach, J. Celi. Comp. Physioi., 66, 319 (1965); and Bradley and Metcalf, Aust. J.Exp. Biol.Med.Sci., 44, 287 (1966) /.

It is known that these factors, collectively referred to as CSFs, can be produced by cells such as T cells, monocytic macrophages, fibroblasts, and endothelial cells, which are normally highly in vivo. CSF includes the following subclasses: granulocyte-monocytic macrophage CSF (designated GM-CSF), which acts on STEM cells of granulocytes and monocytes in such a way as to stimulate the growth of such STEM cells and induce their differentiation by building colonies of granulocytes and monocytic macrophages of CSF (designated G-CSF) acting on poorly differentiated multipotent STEM cells; and a CSF granulocyte (designated G-CSF) of the type described by the present invention, which is in principle capable of constructing granulocyte colonies. Recently, it has been mentioned that differentiation of mint cells varies from one subclass to another / Asano, Taisha-Metabolism and disease, 22, 249 (1985); and Yunis et al., Growth and maturation factors, published by Guroff, John Willey and Sons,

NY, vol.l, 209 (1983).

For this reason, explaining the individual CSF subclasses and conducting studies of their chemical and biological properties is very important for studying the hematopoiesis mechanisms and for analyzing the pathomorphological aspects of various hematological disorders. The biological facts of G-CSF are attracting increased attention from researchers because of their ability to differentiate bone marrow leukemia cells and enhance the function of mature granulocytes, and potentially offer the potential for successful clinical use in the treatment and prevention of leukemia.

To date, experiments have been carried out to isolate and purify G-CSF based on a cell culture process where G-CSF is isolated from cell culture supernatants but homogeneous G-CSF has not yet been produced in large quantities since G-CSF can be it is obtained only at low concentrations, and only 2-step purification processes from a large volume of culture fluid yield only traces of G-CSF. Therefore, it is desirable to obtain a process of recombinant DNA technology for mass production of G-CSF.

Description of the solution to a technical problem with implementation examples

It is an object of the present invention to provide a coding gene for a polypeptide having human G-CSF activity.

Another object of the present invention is to provide a recombinant vector incorporated into said gene.

A further object of this is to obtain a transformant obtained by transforming the host with said recombinant vector and a polypeptide or glycoprotein obtained by said transformant.

A further object of the present invention is to provide a process for the production of a polypeptide or glycoprotein having human G-CSF activity.

Figure 1 shows the sets of three different IWQ, A and LC probes;

Figure 2 shows the nucleotide sequence of the pHCS-1 moiety;

Figure 3 (A) shows the nucleotide sequence of the cDNA moiety in pBRG4;

Figure 3 (B) (I) shows the amino acid sequence of a human G-CSF precursor derived from pBGR4 cDNA;

Figure 3 (B) (Il) shows the amino acid sequence of human mature G-CSF derived from pBRG4 cDNA;

Figure 4 (A) shows the nucleotide sequence of the cDNA moiety in pBRV2;

Figure 4 (B) I shows the amino acid ni2 of the human G-CSF precursor derived from pBRV2 cDNA;

Figure 4 (B) II shows the amino acid sequence of human mature G-CSF derived from pBRV2 cDNA;

Figure 5 shows a nucleic acid sequence of a human chromosomal coding gene for human G-CSF;

Figure 6 shows the restriction enzyme of the pBRG4- [alpha] and pBRV2-derived human G-CSF cDNA cut-off site;

Figure 7 shows the restriction enzyme of the human chromosomal gene cut-off site, which is the coding gene for human G-CSF.

Figure 8 is a partial representation of a process for obtaining a tac promoter containing a vector (+ ALL line);

Figure 9 is a representation of a process for obtaining a P _L promoter containing a vector (+ ALL line);

Figure 10 is a representation of a method for obtaining a trp promoter containing a vector (+ ALL line;)

Figure 11 is a partial view of the process for obtaining a tac promoter containing a vector (-ALL line;)

Figure 12 is a representation of a process for obtaining a P _L promoter containing a vector (-ALL line);

13 is a representation of a method for obtaining a trp promoter containing a vector (-ALL line);

Figure 14 shows a schematic structure of pHGA410;

Figure 15 is a representation of a procedure for the construct expression of recombinant vectors pTN-G4, pTN-G4VA and pTN-ot, G4VAp;

Figures 16a and 16b show two processes for constructing pHGG4-dhfr;

Figure 16c shows the procedures for constructing pG4DR1 and pG4DR2;

Figure 17 schematically shows the structure of pHGV2;

Figure 18 is a representation of the procedure for the construct expression of recombinant vectors, pTN-V2, pTN-VAa and ρΤΝ-νΑβ;

Figures 19a and 19b show two methods for constructively expressing the recombinant pHGV2-dhfr vector.

Figure 19c shows the procedures for constructing pV2DR1 and pV2DR2;

Figure 20 schematically shows the structure of pMLCE;

Figure 21 schematically shows the structure of pTNCE3ct;

Figure 22 schematically shows the structures of pD2 6SVCE3ot and pDRCE3a.

The coding gene for a polypeptide having human G-CSF activity is according to this invention a DNA (cDNA) that is complementary to transfer RNA (mRNA) obtained as a 15 to 17 sucrose density centrifuged fraction and encoding a poiipeptide with human G-CSF activity.

These inventors got two cDNA lines.

The single-strand cDNA has all or part of the coding gene for poiipeptide I or II shown in Figure 3 (B). Specifically, this cDNA has a nucleotide array drawn with ATG at 32-34 nucleotide positions with 5 ¹ -terminus (see Figure 3 (A) / and CCC at 650-652 nucleotide positions or with ACC at 122-124 positions and CCC at 650-652 Alternatively, the cDNA has the nucleotide sequence shown in Figure 3 (A), or a portion thereof, The cDNA of this line is designated here lower than the cDNA (+ ALL).

The second-line cDNA has all or part of the coding gene for the poiipeptide I or II shown in Figure 4 (B). Specifically, this nucleotide array formed by ATG at 31-33 nucleotide positions with 5 * terminus / see Figure 4 (A) / and 2 CCC at 640-642 nucleotide positions, or by ACC at 121-123 positions and CCC at 640 -642 positions. Alternatively, this cDNA may have the nucleotide sequence shown in Figure 4 (A) or a portion thereof. The cDNA of this line is lower labeled than the cDNA (-ALL).

The gene described above can be obtained by following the following procedure:

mRNA encoded by G-CSF is first obtained from animal mammalian cells or other host cells capable of producing polypeptides having G-CSF activity; mRNA is then translated into double-stranded cDNA by one of the known methods; a set of recombinants containing this cDNA (hereinafter referred to as the cDNA library) is then screened by known methods.

The gene described in the present invention includes a human chromosomal coding gene for a polypeptide having human G-CSF activity. This human chromosomal gene contains a nucleotide gene that has MDSO in transcriptional control and also contains all or part of the nucleotide sequence shown in Figure 5.

The chromosomal gene can be obtained primarily by preparation from human cells of a set of recombinants containing the human chromosomal gene (the set will hereinafter be referred to as the library of the human chromosomal gene), and by further testing said gene by known methods.

The human chromosomal gene can be obtained from any type of human cell, such as cells extracted from the liver or kidney, or cultured cells such as tumor cells. The human chromosomal gene library can be obtained from cells by any known method / see Maniatis et al., Celi, 15,

-7687 (1987); and Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, p, 269 ff. (1982), which are illustrated below:

Extract of human chromosomal DNA from a source such as human liver of an embryo with phenol aii or other suitable chemicals; complete or partial degradation of the extracted DNA by an appropriate restriction enzyme so as to obtain DNA of the appropriate length? inserting the DNA portion into a λ-phage vector of a DNA fragment with a T4 ligase or other suitable ligase with a binder containing a restriction site for a suitable enzyme such as EcoRI, which is optionally attached; thereafter, the λ-phage particle is obtained by the in vitro packing process, transforming the host cells, such as E. Coii, by obtaining λ-phage particles.

Examples of λ-phages useful as a vector in the above procedures include Charon 4A, EMBL-3, and EMBL-4.

The mammalian cell that can be used as the source of mRNA supply is a human cancer cell of the CHU-2 type taken from the oral cavity (stored in the Collection Nationale de Cultures de Microorganisms or CNCM, numbered 1-483). However, it should be noted that any other type of cell taken from mammalian organisms may be used in place of these tumor cells. The mRNA production can be performed by any known method for cloning the gene of other physiologically active proteins: for example, whole RNA is initially obtained by treatment with a surfactant and phenol in the presence of a ribonucleoside inhibitor such as the vanadyl ribonucleoside complex / see Berger and Birkenmeier, Biochemistry , 18, 5143 (1979) / or CsCl with a density gradient of centrifugation accompanied by guanidine thiocyanate treatment / see Chirgwin et al., Biochemistry, 18, 5294 (1979) /, thus producing poly (A ⁺ ) RNA ( mRNA) by treating whole RNA by stepwise adsorption or the influence of column chromatography on oligo (dT) -cellulose or poly-II-sucrose 2B used as a carrier. Poly (A ⁺ ) can be further fractionated by a suitable process. The ability of the mRNA thus obtained to encode a polypeptide having G-CSF activity can be confirmed by a number of methods; for example, the mRNA is translated into a protein whose physiological activity is then verified; alternatively, the identity of this protein is determined by an anti-G-CSF antibody. Specifically, mRNA is introduced into Xenophs Laevis oocytes for translation purposes / see Gurdon et al. _f Nature, 233, 177 (1972) /, or translation by rabbit reticulocytes or wheat germ / Schleif and Wensink, Practical Methods and Molecular Biology, SpringerVerlag, NY (1981). G-CSF activity can be tested using a soft agar culture method using bone marrow cells, which has been described (Metcalf, Hemopoietic Colonies, SpringerVerlag, Berlin, Heidelberg, NZ (1977)).

A single cDNA synthesized by the mRNA thus obtained is used as salons; double cDNA is synthesized from that single cDNA; and the double cDNA is introduced into the corresponding DNA vector by constructing the recombinant vector. This recombinant plasmid can be used to transform a suitable host such as Esherichia Coli to produce a DNA group in transformants (cDNA library).

Double cDNA can be obtained from mRNA in one of the following ways: mRNA is treated with oligo (dT) reverse transcriptase, which is complementary to the poly (A) chain at the 3'-terminus taken as an example; or with an oligonucleotide corresponding to the portion of the G-CSF amino acid sequence to be synthesized, and the cDNA complementary to the mRNA is synthesized by reverse transcriptase treatment with the synthesized oligonucleotide used as the initiator. Double cDNA can also be obtained as follows: mRNA is degraded and removed by base treatment, and the single cDNA obtained is first treated with reverse transcriptase or DNA polymerase I (e.g., Klenow fragment) and then with the Sl nucleus; alternatively, the mRNA can be treated directly with RNAase H and DNA polymerase (e.g., E. Coli polymerase 1). See Manitatis et al., Molecular Cioning, Cold Spring Harbor Laboratory (1982) for further information; and Gubler and Hoffman, Gene, 25, 263 (1983).

The double cDNA thus obtained is then introduced into a response vector such as, for example, one of the Ek-type plasmid vectors designated as pSClOl, pDF41, ColEl, pMB9, pBR322, pBR327, and pACVCl, or one of the phage vectors designated as Xgt, Xc, Xgt and XgtWES, and then the recombinant vector is used to transform E. coli species (e.g., 761776, HB101, DH1, or C600) to obtain a cDNA library (see, e.g., Molecular Cioning, same).

The host cell can be translated with the DNA recombinant thus obtained by any known method. If the host cell is E. coli, the procedure described by Hanahan (J. Mol. Biol. 166, 557 (1983) / can be used by adding recombinant DNA to the corresponding cell obtained in the presence of CaCl ₂ , MgCl. ₂ or RbCl.

Testing of cells harboring desired genes can be carried out using several methods, including: a plus-minus method useful in cDNA cloning interferon / Taniguchi et al., Et al. Jpn. Acad., 55, Ser.B., 464 (1979) /, a method for verifying translation hybridization / Nagata et al., Nature, 284, 316 (1980) /, and a colony or hybridization infection method using an oligonucleotide pattern chemically synthesized based on amino acid a set of proteins that have human G-CSF

-1010 activity / Wallace et al · Nucleic Acids Res. 9, 879 (1981); and Benton and Davis, Science, 196, 180 (1970) /.

A fragment containing such a cloned coding gene for a polypeptide having human G-CSF activity can be re-inserted into the corresponding DNA vector for translation of other prokaryotic or eukaryotic host cells. 2 by introducing a suitable promoter and expressing a string linked to a vector, the gene can be expressed in an individual host cell.

Illustrative host prokaryotic cells include Esherichia coli, Bacillus subtillis, Bacillus thermophilus. The gene can be expressed in these host cells by transformation by means of a replicon (eg, a plasmid vector having a start and a ni2a regulator), which is derived from species compatible with the host. A desired vector is one that has a string capable of transforming a cell with selectivity for the expressed trait (phenotype).

For example, E. coli can be translated by pBR322, which is a vector capable of copying into E. coli (see Bolivar, Gene 2, 95 (1975)). This vector contains both ampicillin- and tetracycline-resistant genes whose properties can be exploited to identify transformed cells. Examples of promoters essential for genetic expression in prokaryotic hosts include the β-lactase gene promoter (Chang et al., Nature, 275, 615 ¢ 1978) /, the lactose promoter / see Goeddel et al., Nature, 281, 544 ( 1979) and the tryptophan promoter / see Goeddel et al., Nucleic Acid Res., 8, 4057 (1980) / and so on. According to the present invention, any of these promoters can be used to produce polypeptides with human G-CSF activity.

-11Eukaryotic microorganism such as Saccharomyces cerevisiae can be used as a host cell and transformed with a vector such as plasmid Yrp7 / see Stinchcomb et al. Nature, 282, 39 (1979). This plasmid has the TRPI gene as a selective marker for yeast species capable of producing tryptophan, so that transformants can be selected by cultivation in the absence of tryptophan. Promoter primers that can be used to screen for a gene include the acid phosphatase gene promoter / Miyanohara et al., Et al. Natl. Acad. Sci., USA, 80, 1 (1983) / and the alcohol dehydrogenase gene promoter / Valezuela et al., Naturae, 298, 347 (1982) /.

The host cell can also be obtained from mammalian cells such as COS cells, Chinese hamster ovary (CHO) cells, C-127 cells and Hela cells. An illustrative vector that can be used to transform these cells is pSV2-gpt / see Mulligan and Berg; Away. Natl. Acad. Sci., USA, 78, 2072 (1981). The vectors used to transform these cells include a starter, a selection marker, a promoter that is a precursor to the position where the gene will be expressed, RNA that splices, polyadenylation signal, etc.

Illustrative promoters that can be used for gene expression in mammalian cells include promoters of retrovirus, polynomial virus, adenovirus, simian virus 40 (SV40), etc. When the SV40 promoter is used, the desired gene expression can be achieved by the method of Mulligan et al., Described in Nature, 277, 108 (1979).

Illustrative beginnings that may be used include those derived from SV40, polynomial virus, adenovirus, bovine papillomavirus (BVP), etc. An illustrative selection marker that may be used includes the phosphotransferase APH (3 ') II or I (neo) gene,

-1212 thymidine kinase (TK) gene, E. coli xantinguanine phosphoribosyltransferase (Ecogpt) gene, dihydro folate reductase (DHFR) gene, etc.

The following procedures may be used to obtain a polypeptide having human G-CSF activity from the above host-vector systems: the coding gene for a polypeptide having human GCSF activity is set to the correct location in one of the aforementioned vectors; the host cell is transformed to produce DNA recombinant; the transformants thus obtained are then cultured. The desired polypeptide can be isolated and purified from the cell or culture solutions by any known technique.

Eukaryotic genes are generally thought to exhibit polymorphism, as is known in the case of the human interferon gene (see Nishi et al., J. Biochem., 97, 153 (1985)), and this phenomenon may cause substitution of one or more amino acids in the nucleotide but not changes throughout the amino acid sequence.

G-CSF activity may also possess a polypeptide lacking one or more amino acids in the set of amino acids in Figures 3 (B) or 4 (B) or one having such amino acids added, or a polypeptide having one or more such amino acids acids substituted with one or more amino acids. It is also known that the polypeptide obtained by translating each of the cysteine codons into the human interleukin-2 (IL-2) gene into a serine codon has the activity of interleukin-2 (Wang et al., Science 224, 1431 (1984)). Because of this, they are as long as they have both natural and synthetic polypeptide! human G-CSF activity, all genes encoding these polypeptides, recombinant vectors with these genes, and polypeptides or glycoproteins obtained by culturing such transformants fall within the scope of the present invention.

-1313

The data below for obtaining the genes of the present invention encoding a polypeptide with human G-CSF activity, a recombinant vector with said gene, and a transformant containing this recombinant gene and a polypeptide or glycoprotein with human G-CSF activity expressed in this transformant.

(1) Probe preparation

The homogeneous human CSF protein was purified from the supernatant of the tumor cell culture line, CHU-2, after which its amino acid sequence was determined from the N terminus. The fragments are obtained by decomposition using bromocyanine and trypsin treatment, after which the amino acid sequences of these fragments are determined (Example 3 (1), (ii) and (iii) /.

Three nucleotide probes, (A), (LC) and (IWQ), are synthesized from certain amino acid arrays, having the arrays shown in Figure 1 (Example 4). Probe (A) consisted of 14 successive nucleotides from the mixture. The probe (IWQ) consists of 30 successive nucleotides with deoxynosine and was of the same type as the probe used in cloning the human chalcistokinin gene / Takahashi et al. Natl. Acad. Sci., USA 82, 1931 (1985). The probe (LC) was a 24-nucleotide probe synthesized from nucleotides at 32-39 positions from the N terminus of the amino acid sequence shown in Example 3 (1) based on the nucleotide sequence shown in Figure 3.

Chemical synthesis of nucleotides can be carried out using the improved solid phase phosphodiester method described by Narang (Tetrahedron, 39, 3-22 (1983)).

Probes based on amino acid arrays at positions other than those in the probes mentioned above may also be utilized.

-1414 (2) Construction of a cDNA library

CHU-2 cells were homogenized after the addition of a guanidine thiocyanate solution and total RNA obtained using a CsCl density gradient centrifuge.

Poly (A ⁺ ) RNA is isolated from total RNA by chromatography on an oligo (dT) -cellulose column. Subsequently, single-stranded cDNA is synthesized using reverse transcriptase and then double-stranded cDNA is synthesized by adding RNAase H and E. coli DNA polymerase I. The dC strand is attached to the resulting cDNA strand, which is then fused to the vector pBR322, on which the dG strand is attached to the Pst I junction site. The resulting recombinant DNA is used to transform E. coli species, Χ1776, and thus the pBR322-type cDNA is upgraded (Examples 5 and b).

Similarly, a double strand of cDNA with a binding strand is attached to the XgtlO vector from E.coli and the λ-phag cDNA line is rewarded (Example 7).

(3) Testing

Recombinants derived from the pBR322-line cDNA library are fixed on Whattman 541 filter paper, and a single clone can be performed by colony hybridization with a 32P-labeled probe (IWQ). Further study by the Southern Absorbent Method / Southern, J. Mol.Biol., 98, 503 (1975) / shows that this clone is also hydrolyzed by probe (A). The nucleotide sequence of this clone is determined by the dideoxy method (Sanger, Science, 214, 1205 (1981)).

The nucleotide sequence of the resulting cDNA moiety is shown in Figure 2, which shows that this moiety consists of 308 base pairs including probes (IWQ) and (A) and has an open reading frame that

-1515 codes for 83 amino acids containing the amino acid sequence shown in Example 3 (iii). The pBR322 derived plasmid containing these 308 base pairs is lower labeled than pHCS-1 (Example 8).

A DNA fragment containing 308 base pairs obtained from pHCS-1 is radiolabeled using the translaceration method (see Molecular Cloning, ibid) and used as a probe, and the λ gtlO-derived cDNA library is screened using slit hybridization / Benton and Davis, Science, 196, 180 (1977) / so as to obtain 5 clones. The nucleotide sequence of clones suspected to contain cDNA is ordered by the same method as described above (Figure 3 (A)).

As shown in Figure 3 (A), this cDNA has a single wide-open reading frame.

The amino acid sequence encoded by this cDNA can be displayed as in Figure 3 (A).

Comparison with the N-terminal amino acid sequence of the G-CSF protein shown in Example 3 (1) shows that this cDNA contains a nucleotide strand corresponding to a signal peptide encoded by 90 basic ATG ni2om pair pairs at 32-34 nucleotide positions with 5 'terminus and terminated with a GCC string at 119-121 positions and a mature G-CSF polypeptide encoded by 531 base output pairs with an ACC string at 122-124 positions and ending with a CCC string at 650-652 positions. As a result, the amino acid sequence I polypeptide shown in Figure 3 (B) is composed of 207 amino acids and has a molecular weight of 22292.67 daltons. The amino acid sequence II polypeptide consists of 177 amino acids and has a calculated molecular weight of 18986,74 Daltons (Example 9).

-1616

It should be noted that ATG at positions 32-34 or at positions 68-70 can also be treated as a protein starting point. Escherichia coli species Χ1776 harboring pBR322 having cDNA + (ALL) at the EcoRI cut-off site is stored at the Fermentation Research Institute, Agency of Industrial Science and Technology, (FERM BP.954).

Figure 6 shows the site of the restriction enzyme of the gene.

This cDNA is spliced to pBR327 / Sorberon et al., Gene, 9, 287 (1980) / at the EcoRI position, and the resulting plasmid will be further designated as pBRG4. The pBRG4 thus obtained is treated with a restriction enzyme, EcoRI, to obtain a DNA fragment containing from about 1500 base pairs. This fragment is labeled with radioactive isotopes using the tanslation etching method (see Molecular Cloning, ibid.). With the DNA fragment so labeled as a probe, the Xgt10-derived cDNA library is tested again by hybridization of the infection (see Benton and Davis, ibid.). In this hybridization of infection, two strips of nitrocellulose paper are prepared on which the λ-phage DNA is fixed; one of the two straps is used for the above-mentioned hybridization of infection and the other undergoes hybridization of infection with the probe (LC) mentioned above. Phages that were positive for both probes were selected. A clone having a full length cDNA is selected and the nucleotide sequence of a portion of the cDNA ordered by the dioxy method is shown in Figure 4 (A).

This cDNA has a single wide-open reading frame and the amino acid sequence to be encoded by this cDNA is performed as shown in Figure 4 (A).

Comparison with the N-terminated amino acid set of G-CSF protein shown in Example 3 (1) shows that this cDNA contains

-1717 nucleotide array, which also corresponds to a signal peptide encoded by 90 base pairs and starts with an ATG array at 31-32 nucleotide positions at the 5'-end and knocks with a GCC array at 118120 positions and a mature g-CSF peptide encoded by 522 base pairs starting with the ACC string at 121-123 positions and ending with the CCC string at 640-642 poology. Therefore, the amino acid sequence I polypeptide of Figure 4 (B) is composed of 204 amino acids whose calculated molecular weight is 21977.35 Daltons. The amino acid sequence II polypeptide consists of 174 amino acids and its calculated molecular weight is 18671,42 Daltons (Example 10).

It should be noted that ATG at positions 58-60 or at positions 67-69 can also be understood as a protein start site.

Escherichia coli species Χ1776 that harbors pBR322 harboring this cDNA at the EcoRI termination site is stored at the Fermentation Research Institute, The Agency of Industrial Science and Technology ”(FERM BP-955).

Figure 6 shows the site of the restriction enzyme of the gene. This cDNA is anchored to pBR327 at the EcoRI site by constructing a plasmid that will be pre-designated as pBRV2.

(4) Human chromosomal gene library testing

The human chromosomal gene library provided by the methods described by Maniatis et al. (molecular Cloning, same) is subjected to testing with pHCS-1 as shown below. Probes that can be used for testing include: pHCS-1 derived 308-bp DNA fragment, pBRG4-derived 1500-bp fragment, pBRV2 derived 1500 bp DNA fragment, DNA fragment of appropriate length

-1818 contains part of one or more DNA fragments as well as the nucleotide probes mentioned above / e.g. (IWQ), (A) and (IC) /. An example of using a pHCS-1 DNA fragment is described below.

The TA DNA fragment was labeled ³² p by tanslation notching / see Roop et al., Celi, 15, 431 (1987) /. Using the resulting 32p-tagged fragment used as a probe, the library of the human chromosomal gene is subjected to hybridization notch testing (see Benton and Davis, same) to obtain ten parallel clones.

After separation of the DNA from the clones, a scheme of enzymes is prepared by known methods (Fritsch et al., Celi, 19, 959 (1980)).

Southeron uptake was performed with the same DNA probe (see Southeron, same), revealing that a DNA fragment about 4 kb long was excised from AcoRI and Khol, potentially containing a region for encoding a human G-CSF polypeptide.

As a result, a 4-kb fragment is inserted into pBR327 at the EcoRI site using the EcoRI binder to obtain pBRCE3p. With this plasmid used as a DNA base set, a 3-kb nucleotide sequence of a portion of a 4-kb DNA fragment is determined by the dioxy method.

Said phage was found to be a coding gene for the human G-CSF polypeptide (Figure 5).

E. coli of strain 761776, which harbors pBRCE3p (i.e., the plasraid pBR327, which implements said 4-kb DNA fragment at the EcoRI site), is stored in the Fermentation Research Institute, FERM BP-956.

The comparison between the pBRG-4 cDNA portion shown in Figure 3 and the pBRV cDNA portion shown in Figure 4 indicates that the discontinuous portion

-1919

DNA contains five parts of exons, which encodes amino acid strands derived from pBRG4 and pBRV2,

Figure 7 shows the restriction enzyme breakpoint of the resulting enzyme.

This DNA fragment contains the chromosomal gene of human G-CSF, or the region preceding it is transcribed into human G-CSF mRNA, plus a nucleotide sequence involved in transcriptional control / Benoist and Chambon, Ann. Rev. Biochem., 50, 349 (1981).

5) construction of recombinant expression vector for E. coli (A) + ALL line recombinant vector

From the pBRG4 plasmid obtained in (3) (Example 9), the cDNA fragment of the G-CSF peptide is excised by the restriction enzyme, and the recombinant vector is produced in one of the following ways:

(i) using a hardened synthetic binder, the fragment binds to a fragment obtained from a tac promoter containing pKK223-3 (Pharmacia Fine Chemicals) (Example 12 and Figure 8);

(ii) three fragments obtained from the P _L promoter containing pPL-lambda (Pharmacia Fine Chemicals) are linked to the hardened synthetic binder, and the binding product and cDNA fragment are further subjected to a recapitulation process by constructing a recombinant vector (Example 13) , Figure 9); or (iii) using a hardened synthetic binder, the fragment binds to a fragment derived from a trp promoter containing a pOYI plasmid (Example 14, Figure 10).

(B) -All line recombinant vector

-2020

In the same manner as described above, three recombinant vectors (Example 10) are produced using the pBRV2 plasmid as shown in Example 19 and Figures 11, 12, 13.

(6) Obtaining E. coli transformant, and cultivating and expressing it

Using three recombinant vectors, each + ALL and-ALL E. coli lines of DH1, N4830 or JM105 species are transformed with calcium chloride or rubidium chloride in the same procedure described in Molecular Cloning (Examples 12, 13, 14 and 19). Each of the transformants obtained was cultured in Luria ampicillin containing medium by performing induction as required by the desired expression (Examples 15 and 20).

(7) Separation and purification of G-CSF poiipeptide from E. coli and analysis of its amino acids

The transformant culture solution was centrifuged to give a tablet of cells. The collected cells were treated with lysozyme and then cycled freeze-thaw and then the supernatant separated.

The supernatant was then treated by gel filtration on an Ultrogel ACA54, and the clones (LKB) and the active fractions were concentrated by ultrafiltration.

Then, an aqueous solution of trifluoro lactic acid containing npropanoi was added to the concentrate and then placed in ice. The mixture was then centrifuged and adsorbed on a reversed-phase C18 column. After elution, the activity of the fractions is examined. The active fractions are collected and subjected to the same purification process,

-2121 which is described below. The purified fractions were then freeze-dried and the powder was dissolved and subjected to HP molecular size accurate chromatography. The resulting polypeptides were then electrophoresed on an SDS polyacrylamide gel, finding specific bands for the desired G-CSF polypeptide (Examples 16 and 20). The polypeptides thus obtained exhibit human G-CSF activity (Examples 17 and 20). The G-CSF poiipeptide is analyzed by a procedure for amino acid analysis with the Hittachi 835 Automatic Amine Acid Analyzer (Hittachi, Ltd.). For N-terminal amino acid analyzes, gas-phase array analyzers (for Edman decay), high-pressure precision chromatography apparatus and an Ultrasphere-ODS column (Examples 18 and 21) are used.

(8) Construction of recontoinant vectors for animal cells

Recombinant vectors (derived from BPV) for use with C127 and NiH3T3 host cells are constructed for each of + ALL and-ALL cDNA lines and chromosomal gene. Recombinant vectors (with dhfr) for use with CHO cells are also produced for each + ALL and-ALL cDNA lines and for the chromosomal gene. Recombinant vectors for use with COS cells are also fabricated. Below are detailed examples of examples of working cases.

(A) Construction of the recombinant vectors + ALL and-ALL lines of the cDNA fragment obtained in (3) is placed in the pdKCR vector by constructing a pHGA 410 plasmid (Example 22 and Figure 14) that is partially digested with EcoRI and then treated with polymerase I (Kienow fragment) so that open ends are built. HindIII binding is DNA bound, which is then treated with HindIII and T4DNA ligase. The treated DNA is used to transform E. coli type DH1 in a process using rubidium chloride (See Molecular

-2222

Cloning, ditto). The resulting plasmid is called pHGA410 (H) (Figure 15).

The pHGA410 (H) is treated with a scarf after which open ends are made and then further treated with a HindIII to separate the HindIII fragment. The plasmid pdBPV-1 containing the transformed bovine papillomavirus fragment is treated with HindIII and PvuII to separate large DNA fragments and attach to a specially prepared HindIII-Sall fragment. The attachment of the fragment is prepared to transform E.coli DHl species to yield a plasmid pTN-G4 having a pHGA410-derived CSF-cDNA (Figure 15 and Example 23).

Plasmid pHGA410 (H) is treated with Shawl to form open ends and then treated again with HindIII to separate the HindIII-Sall fragment. The plasmid pdBPV-1, which has a transformed bovine papillomavirus fragment, is treated with HindIII and PvuII, thereby separating the large DNA fragment and attaching it separately to a specially prepared HindIII-Sall fragment. The attachment of the fragment is done to transform E.coli of the DHl species to produce a plasmid pTn-G4 having a pHGA410i2-derived CSF-cDNA (Figure 15 and Example 23).

Plasmid pHGA410 or pHGA410 (H), in combination with plasmid pAdD26SVpA, was used to superimpose pHGG4-dhfr, which was a recombinant vector (+ ALL) for use with CHO cells (Figures 16a and b and Example 25).

A 2-kb DNA fragment containing the dhfr gene was eliminated from pAdD26SVpA by treatment with EcoRI and BamHI, and the resulting fragment was placed in a pHGA410 (H) at the HindIII site by constructing pG4DRI and pGDR2 (Fig. 16c and Example 25).

(B) Construction of - ALL lines of recombinant vectors

The -2323 cDNA (-ALL) line fragment obtained in (3) is placed in the pdKCR vector by constructing a pHGV2 plasmid (Example 28) partially degraded by EcoRI and then treated with DNA polymerase 1 (Klenow fragment), thus to build open ends. The HindIII ligand is attached to DNA, which is then treated with HindIII and T4DNA ligase. The treated DNA is used to transform E.coli DH1 in a process involving rubidium chloride (see Molecular Cloning, ibid.). The resulting plasmid is called pHGV2 (H) (Figure 18).

pHGV2 (H) is treated with Scarf, for which open ends are built, and Hindlll-Sall fragment is separated by repeated treatment with HindIII. Plasmid pdBPV-1, which has a transformed bovine papillomavirus fragment, is treated with HindIII and PvuII and a large DNA fragment is anchored to the specially prepared Hind-III-Sall fragment. The prepared fragment is used to transform E.coli DH1 species to produce a plasmid, pTNV2, which has a pHGV2-derived CSF-cDNA (Figure 18 and Example 29).

Using similar procedures, pHGV2 or p HGV2 (H) in combination with the pAdD26SVpA plasmid was used to construct pHGV2-dhfr, which was a recombinant vector (-VSE) for use with CHO cells (Figures 19a and b and Example 31).

A DNA fragment about 2kb in length containing the dhfr gene was separated from pAdD26SCpA using EcoRI and BamHI, and the resulting fragment was placed in pHGV2 (H) at the HindIII site by constructing pV2DR1 and pV2DR2 (Figure 19c and Example 31).

(C) Construction of recombinant vectors containing the chromosomal gene

The plasmid pBRCE3 obtained in (4) containing the chromosomal gene shown in Figure 5 is treated with EcoRI.

The -2424 pSVH ⁺ K ⁺ plasmid described by Banerji et al., Celi, 27, 299 (1981) is treated with KpnI by removing the globin gene. The plasmid is further partially degraded by HindIII, removing part of the residual SV40 gene. The fragments are then reconnected to construct the pML-E ⁺ expression vector.

This vector is treated with the EcoRI restriction enzyme and dephosphorylated with alkaline phosphatase (Takara Shuzo Co., Ltd.) to obtain a DNA vector that is linked to the above-mentioned chromosomal DNA fragment by T4DNA ligase (Takara Shuzo Co., Ltd.). by obtaining pMLCE3, which was the recombinant vector for COS cells (Example 34). As shown in Figure 20, this plasmid contains an SV40 gene enhancer, an SV40 initiator replicator, a pBR322 initiator replicator, and a pBR322 derived X-lactimase gene (Amp ^r ) and has a human G-CSF chromosomal gene fused downstream of the SV40 gene enhancer.

The expression vector for C127 cells is constructed by the following procedure. A DNA fragment containing the chromosomal CSF gene is extracted with the corresponding enzyme from pMLCE3a, which has an expression vector for COS cells. This fragment is anchored by T4DNa ligase to a DNA fragment containing a promoter for SV40. The obtained pTNCE3a was an expression vector having a chromosomal CSF gene bound under the SV40 promoter containing 65% of the BPV portion.

The expression vector of CHO cells has two DNA fragments linked together by T4DNA ligase; one fragment contains the chromosomal CSF gene and an early SV40 promoter in the case of zs expressing a vector for C177 cells, and the other fragment containing the pAdD26SVpA-derived dhfr gene. The resulting pD26SVCE3a was an expression vector having a chromosomal CSF gene under the SV40 promoter, a dhfr gene under the last adenovirus promoter.

-2525 (9) Expression in anlmal cells

The two representative examples are shown below, and for further details see the relevant working examples.

(A) Expression in CL27 mice cells

Plasmid pTN-G4 or pTN-V2 was treated with BamHI. The treated palasmid is used to transform C127 cells (previously cultured) by a process involving calcium phosphate. Transformed cells are cultured, and clones with high production rate of CSFs are selected. Glycoproteins containing expressed G-CSF are separated and purified from the culture solution of transformed cells. These were found to possess human G-CSF activity. The presence of the desired glycoprotein is also confirmed by analysis of the amino acids and sugars in the sample.

For the analysis of the sugar content, the CSF sample used for amino acid analysis is subjected to the determination of amino acids by the Elson-Margan method, the neutralization of sugars by the orcinol sulfate process, or the sialic acid determination by the thiobarbituarate process. All determination procedures are shown in Tohshitsu no Kagu ”Chemistry of Saccharides (Part 2 of Part Two), Chapter 13, vol.4 of a Course in Biochemical Experiments, published in Tokyo Kagaku Dojin. Translating the measured values by weight showed that the sugar content obtained was in the range of 1-20%, depending on the type of host cells, expression vector and culture conditions.

(B) Expression in COS cells

-2626

COS cells derived from CV-L monkey cells transformed with the SV40-initiation of the defective mutant by eliciting the large T antigen of SV40-a / see Glutzman et al., Celi, 32, in (5) (C) and containing the human chromosomal G-CSF gene.

The COS cell culture supernatant showed human G-CSF activity (Example 35).

Some COS cells were secreted and subjected to mRNA analysis, which showed the presence of two mRNAs, corresponding to the amino acid arrays shown in Figures 3 (A) and 4 (A).

Examples

The present invention will be further described with reference to the working examples, where the following exemplary example is provided to illustrate the process of exploring CSF activity.

Sample example: Exploring CSF activities

The following methods are used to determine CSF activity (hereinafter referred to as CSA) in the present invention.

CSA Research (a) Human bone marrow cells

A single layer of soft agar was used for cultivation according to the method of Bradley, TR and Metcalf, D.Aust.J.Exp. Biol.Med. Sci., 44, 287-300,1966). Specifically, 0.2 ml of bovine embryo serum, 0.1 ml of sample, 0.1 ml of human bone marrow suspension (1-2 10 ⁵ nukie cells) and 0.2 ml of modified MsCoy 5A culture solution are poured into a culture bottle (55 mm diameter). containing 0.75% agar. The solution was coagulated and cultured at 37 ° C in 5% CO ² /95% air and 100% humidity. Ten days later, the number of formed ones is determined

-2727 colonies (one colony consists of at least 50 cells), and the CSA is determined by the fact that one unit of activity is required to build one colony.

(b) with mouse bone marrow cells

Mix horse serum (0.4 ml), 0.1 ml of a sample of C3H / He bone marrow female bone marrow cell suspension (0.5-110 ⁵ cell nuclei and 0.4 ml of modified McCoy's 5A culture solution containing 0.75% agar. The mixture is then poured to a tissue culture plastic container (35 mm radius), coagulated and cultured for 5 days at 37 ° C in 5% CO ₂ /95% air at 100% humidity, then determined the number of superimposed colonies (one colony containing at least 50 cells), The CSA, however, is found to be that the unit of activity corresponds to the construction of one colony.

The McCoy modified 5A culture solution used in both cases (a) and (b) and the human bone marrow cell suspension used in (a) are obtained by the following procedures.

Modified McC0y's 5A culture solution (double concentrated) grams of McCoy culture solution (Gibco), 2, 55g MEM amino acid vitamin environment (Nissui Seiyaku Co., Ltd.),

2.18 g of sodium bicarbonate and 50,000 units of potassium penicillin G are dissolved twice in 500 ml of distilled water and the solution is then aseptically filtered through Millipore filters (0.22pm).

Suspension of human bone marrow cells

Bone marrow fluid obtained from a healthy specimen with sterile puncture is diluted 5 times with RPMI 1640 culture solution and placed over Ficol infection

-2828 (Pharmacia Fine Chemicals) and then centrifuged at 400 g for 30 minutes at 25 ° C. A layer of interfacial cells with a density of less than 1,077 is eliminated. The cells are washed, and the concentration is increased to 5 10 ⁶ cells / ml with RPMI 1640 culture solution containing 20% bovine embryo serum filled into a 25 cm ³ large tissue culture flask and incubated for 30 minutes in a C0 ₂ incubator . The non-adherent cells were excreted in the supernatant and then transferred to a 25 cm ³ plastic bottle, where they were incubated for 2.5 hours. These cells in the supernatant are collected and used for examination.

Example 1: Design of CHU-2

The tumor of a cancer patient in the oral cavity, where the growth observed in neutrophil counts is accentuated is transplanted into nu / nu mice. After 12 days after transplantation, the tumor is aseptically extracted, sliced 1-2 mm ^3, and cultured as follows. Place 10 to 15 tumor cubes in a 50 ml plastic centrifuge tube. After the addition of 5 ml of trypsin solution (containing 0.25% trypsin and 0.02% EDTA), shake the tube for 10 minutes in a warm bath at 37 ° C and discard the supernatant. Then another 5 ml of the same trypsin solution was added and digestion with trypsin was carried out with stirring at 37 ° C for 15 minutes. Remove the supernatant cell suspension and leave it in ice after trypsin is deactivated with 1 ml of bovine embryo serum. After repeating this process, the cell suspension was eliminated, which was then combined with the previously obtained cell suspension and centrifuged at 15,000 rpm for 10 minutes to give a cell tablet. The tablet is washed twice with F-10 containing 10% bovine embryo serum and then placed in a 25 cm ³ plastic bottle so that the cell concentration is 5x10 ⁶ cells / bottle. After incubation all night in a CO ² incubator (5% CO ² at 100% humidity) with F-10

-2929 A culture solution containing 10% bovine embryo serum is removed by supernatant together with cells, with non-adherent cells, and cultivation is continued with freshly added culture solution. 6 days after the start of cultivation, the bottle is filled with cells and the culture solution is replaced with fresh one.

The next day, the culture solution was discarded and the bottle was filled with 2 ml anti-mouse erythrocyte antibody (Cappel) diluted 5 times with RPMI 1640 and 2 ml guinea pig complement (Kyokuto Seiyaku Co., Ltd.) diluted with 2.5 RPMI 1640. After incubation for 20 minutes at 37 ° C, the culture was washed twice with an F-10 solution containing 10% serum of bovine embryos and nu / nu mice to remove the derived fibroblasts. Then an F-10 culture solution containing 10% bovine embryo serum was added, and cultivation continued for two days. After that, the same cells are eliminated, which then undergo cloning using the boundary dilution method.

The obtained 11 clones were screened for CSF activity and one clone (CHU-2) showed activity that was about 10 times greater than those in other clones *

Example 2: CSF Isolation

The cells based on Example 1 were grown in a very dense population in two cultivation bottles (150 cm ³ ). Cells were extracted, suspended in 500 ml of F-10 culture solution containing 10% bovine embryo serum, transferred to a 1580 cm ² glass rotary bottle (Belco; Bi.

Op. and rotated cultured at 0.5 rpm. When the cells were found to have grown in a very dense population on the inner wall of the rotating bottle, the culture solution was replaced with serum-free RPMI 1640. After 4 days of cultivation, the culture supernatant was eliminated and the cultivation was continued with F-10 containing 10% serum of the embryo of bovine animals added. After 3 days of cultivation, it was

-3030 culture solution replaced with serum-free RPMI 1640. The culture supernatant was removed after 4 days. By repeating this process, 500 ml of serum-free supernatant were obtained weekly. Further, this process allows the culture supernatant to be separated, with cells maintained over a significantly extended period.

A batch containing 5,000 ml of culture supernatant was obtained by mixing with 0.01% Tween 20 and concentrated about 1000 times by ultrafiltration with Hollow Fiber DC-4 and Amicon PM10 (Amicon). The concentrate was purified in the following steps.

(i) A portion (5 ml) of the concentrated supernatant was gel filtered on an Ultrogel AcA54 column (4.6 cm in diameter and 90 cm in length; LKB) at a flow rate of 50 ml / h with 0.01M Tris-HCl buffer (pH 7.4) containing 0.15M NaCl and 0.01% Tween 20 (Nakai kagaku Co., Ltd.). The column was calibrated with bovine albumin serum (M; 67000), ovalbumin (M 45000} and cytochrome C (M 12400). After braking filtration, 0.1 ml of each fraction was diluted 10 times, after which activity was tested according to the above CSA assay methods ( b) .The fractions of 400-700 ml were found to show macrophage-dominant CSA, while the fractions of 800-1200 ml showed granulocyte-dominant CSA, which made the latter fractions collected and concentrated on an ultrafiltration device PM- 10 (Amico) to a volume of 5 ml.

(ii) An aqueous solution of 0.1% trifluoroacetic acid containing 30% n-propanol was added to the concentrated fractions (for determination of amino acid series; obtained from Tokyo Kasei K.K.). The mixture was then allowed to stand in ice for about 15 minutes and the liners were removed by centrifugation for 10 minutes at 15,000 rpm. The supernatant was then adsorbed on a u-Bondpak C18 column (8 mm x 30 cm for semi-preparative use; Waters) and

-3131 equilibrated with an aqueous solution containing n-propanoic acid and trifluoroacetic acid; the column was continuously eluted with an aqueous solution of 0.1% trifluoroacetic acid containing npropanol having a linear concentration gradient of 3060%. High-pressure liquid chromatography apparatus, Hitachi model 685-50 (Hitachi, Ltd.) and detector, Hitachi model 638-41 (Hitachi, Ltd.) were used for absorption at 220 nm and 280 nm simultaneously. After elution, 10 μΐ of each fraction was diluted 100 times, which were then tested for active fractions using the abovementioned CSA exploration procedures (b). The peaks eluted with 40% n-propanol were found to have OSA activity, 2 which were then collected and re-chromatographed under the same conditions and tested for CSA using the same methods. CSA activity was again observed with peaks on 40% n-propanol. As a result, these peaks were collected (4 fractions = 4 ml) and freeze-dried.

(iii) The dry frozen powder was dissolved in a 200 μΐ aqueous solution of 0.1% trifluoroacetic acid containing 40% n-propanol. The solution is subjected to high pressure liquid chromatography on a TSK-G 3000SW column (Toyo Soda Manufacturing Co., Ltd .; 7.5mm x 60 cm). Elution was carried out with the same aqueous solution at a flow rate of 0.4 ml / min, and fractions were collected in 0.4 ml portions using a FRAC-100 (Pharmacia Fine Chemicals) fraction collector. Each fraction was tested for CSA using the same methods as described below, and the activity was observed in fractions with a retention time of 37-38 minutes (corresponding to a molecular weight of 2 10 ⁴ ). The active fractions were separated and purified on an analytical u-Bondpak C18 column (4.6 mm x 30 cm). The main peaks were separated and freeze-dried. The sample obtained is examined by the CSA method of examination (a); this was found to have human G-CSF activity.

-3232

Example 3: Determination of the amino acid sequence (I) Determination of the N-terminal of the amino acid sequence

The v2 sample is subjected to Edman decomposition by a gas-phase sequencer (Fit Biosiostemi), and the obtained PTH amino xylin is analyzed by routine using a high-pressure liquid chromatography apparatus (Beckman Instruments). The column (5 pm; 4.6 mm x 250 mm) was equilibrated with the initial buffer (aqueous solution containing 15mM sodium acetate buffer fpH 4.5 and 40% acetonitrile) and the introduced sample (dissolved in 20 pl initial buffer). Separation is carried out using single elution with initial buffer. The flow rate was 1.4 mi / min and the column was heated to 40 ° C. PTH amino acid detection was performed using UV light adsorption in the 269 nm and 320 nm range. Standard PTH amino acid (Sigma) samples in 2-nmol portions are separated on the same line to regulate its retention time, which is comparable to that for the sample tested. The sample was found to have the following amino acid sequence consisting of 40 residues from the N-terminus:

H ₂ N-Thr-Pro-Leu-Gly-Pro-Ala-Ser-Ser (10)

Leu-Pro-Gln-Ser-Phe-Leu-Leu-Lys-Cys ”(20)

Leu-Glu-Gln-Val-Arg-Lys-Ile-Gln-Gly (30)

Asp-Gly-Ala-Ala-Leu-Gln-Glu-Lys-Leu (40)

Cys-Ala-Thr-Tyr-Lys (ii) Degradation by bromcyan utilization

-3333

The sample is dissolved in 70% formic acid. To the solution is added 200 equivalent amounts of bromcyan which has been purified by sublimation. The mixture was allowed to stand at 37 ° C overnight for reaction. The reaction product was freeze-dried and fractionated by HPLC on a TSK G3000SW column (Make; Toyo Soda Manufacturing Co., Ltd.) to give 4 peaks. The peaks were named CN-1, CN-2, CN-3, CN-4, according to the falling molecular weights. The first two peaks (CN-1 and CN-2) have better yields, and their amino acid arrays were analyzed using an automatic gas-phase sequencer (Biosystems used) under the same conditions as in (I).

CN-1 was found to be a peptide from the N-terminal of G-CSF protein, and CN-2 is the following amino acid sequence:

Pro-Ala-Phe-Ala-Ser-Ala-PheGln-Arg-Arg-Ala-Gly-Gly-ValLeu-Val-Ala-Ser-His-Leu-Gln (iii) Trypsin degradation

The sample was dissolved in 0.1 M tris-HCl buffer (pH 7.4) containing 8 M urea. The solution was mixed with 0.1 M Tris-HCl buffer (pH 7.4) containing 0.1% 2-mercaptoethanol to allow a final urea concentration of 2M. TPCK-treated trypsin (Sigma) is added such that the ratio of ed to the samples and the butyas enzyme is 50: 1. The mixture was allowed to stand at 25 ° C for 4 hours. After addition of the same amount of TPCKtreated trypsin, it is additionally allowed to stand at the same temperature for 16 hours. To this end, the reaction product is subjected to reverse phase flash chromatography on column C (Yamamura Kagaku K.K.), eluting with 0.1% TFA containing n-propanol having a linear density gradient of 5 to 60%. Although by measurement

-3434 adsorption at 280 nm yields multiple peaks, the principal peak being analyzed for its amino acid sequence using an automatic gas phase sequencer (Applied Biosystems) under the same conditions as in (I). It has been found that.the main peak is a peptide containing the following set containing part of the CN-2 fragment shown in (ii):

Gln-Leu-Asp-Val-Ala-Asp-Phe-Ala-ThrThr-Ile-Trp-Gln-Gln-Met-Glu-Glu-LeuGly-Met-Ala-Pro-Ala-Leu-Gln-Pro-ThrGln- Gly-Ala-Met-Pro-Ala-Phe-Ala-SerPrimer 4: Preparation of DNA Probe:

(I) Probe synthesis (IWQ) of successive nucleotides (see Figure 1) is obtained based on 10 amino acids (Ile “Trp“ Gln-Met-Glu-Glu-LeU ”Gly-Met) included in the amino xylin sequence obtained in the example 3 (iii). It will be necessary to comment on the labeling of the nucleotides shown in Figure 1; for example, the nucleotide at the 9-position from the 5'-terminal is an equimolar mixture of dA n dG. Initial nucleotides are usually dimers, but monomers are also used if required. The secured glass fi lter column is filled with 20 ng of initial nucleotide resin, Ap-d (G) (Yamas Shoyu Co ,, Ltd.). After washing again with methylene chloride, the 4,4'-dimethioxytrityl group is eliminated by methylation with a methylene chloride solution containing 3% trichloroacetic acid. After that, the column is repeatedly washed with 1 ml of methylene chloride. The column was then washed with anhydrous pyridine to extract solvent, 10 mg of nucleotide dimer (DMTr) ApTp (NHR ₃ ), (Nippon Zeon; NHR3-triethylammonium; DMTr = dimethoxytrityl) then 0.2 ml of pyridine was added and the inside of the column was vacuum dried. use of a vacuum pump). After that, 20 mg of 2,4,6-3535 trimethylbenzosulfonyl-3-nitrotriazolide (MSNT Wako Pure Chemical Industries, Ltd.) and 0.2 ml of anhydrous pyridine are added and the inside of the column is flushed with gaseous nitrogen. The nucleotide resin is condensed by dimer reaction for 45 minutes at room temperature with occasional stirring. After completion of the reaction, the column is washed with pyridine and the unreacted OH groups are acetylated with a pyridine solution containing excess acetanhydride and 4-dimethylamino pyridine. After washing the pyridine column, the following dimers or monomers are condensed in the order they are written. This is done by repeating the above procedures; (DMTr) Ip (NHR ₃ ), (DMTr) GpGp (NHR ₃ ), (DMTr) Ip (NHR ₃ ), equimolar mixture (DMTr) CpTp (NHR ₃ ), and (DMTr) TpTp (NHR ₃ ), equimolar mixture ( DMTr) ApAp (NHR ₃ ), (DMTr) ApGp (NHR ₃ ), {DMTr) GpAp (NHR ₃ ), (DMTr) TpGp (NHR ₃ ), equimolar mixture (DMTr) ApAp (NHR ₃ ), and (DMTr) GpAp (NHR ₃ ), (DMTr) CpAp (NHR ₃ ), equimolar mixture of (DMTr) ApAP (NHR ₃ ), and (DMTr) ApGp (NHR ₃ ), (DMTr) GpCp (NHR ₃ ), (DMTr) TpGp (NHR ₃₎ ), (DMTr) Ip (NHR ₃ ) and (DMTr) ApTp (NHR ₃ ), with all mixtures of the listed nucleotides available at Nippon Zeon, except for (DMTr) Ip (NHR ₃ ) available at Yamasa Shoyu Co., Ltd.

At the end of the reaction in the last step, the resin i is washed with the aid of pyridine, then with methylene chloride and finally with ether without acetylation. This is followed by a drying process. The dried resin was suspended in 1.7 ml of a mixture of pyridine (0.5 ml) water (0.2 ml) and dioxane (1 ml) containing IM tetramethylguanidine and IM vrholinaldoxime. The suspension was allowed to stand overnight at room temperature and then concentrated to 100-200 μΐ under vacuum. The concentrate is mixed with a small amount (2-3 drops) of pyridine and with 2-3 ml of concentrated aqueous ammonia. This mixture was heated to 55 ° C for 6 hours. Using ethyl acetate extraction, the aqueous layer was separated and concentrated in vacuo. The concentrate was dissolved in a solution of 50 mM triethyl ammonium acetate (pH 7) and the solution was then chromatographed on column C-18 (1.0 x 15 cm;

-3636

Waters), eluting with acetonitrile (a linear density gradient of 10-30%} in a solution of 50mM triethyl ammonium acetate (pH 7) .The eluted peak fraction at a concentration of acetonitrile at about 25% is concentrated under vacuum.

80% acetic acid was added to the concentrate and the mixture was allowed to stand at room temperature for 30 minutes. Using extraction with ethyl acetate, the aqueous layer was separated and concentrated under vacuum. The resulting concentrate was further purified by HPLC on column C-18 (from Senshu Kagaku KK; SSC-ODS-272; 6 mm x 200 mm). The elution was carried out with acetonitrile (10.20% linear gradient of jittiness) in a solution of 50mM triethyl ammonium acetate (pH 7). Synthetic DNA is obtained in a yield of not less than 1OA ₂ 6o units.

Analysis by Maxim-Gilbert Sequence Method / Meth. Enzym ,, 65, 499 (1980) / indicates that the resulting oligonucleotide has the nucleotide sequence shown in Figure 1.

(ii) Synthesis of probe (A) of successive nucleotides (see Figure 1) is obtained based on the set of 5 amino acids (Met-Pro-Ala-Phe-Ala) included in the amino acid sequence obtained in Example 3 (iii).

The synthesis is similar to that used for probe preparation (IWQ). The following nucleotides condense on the nucleotide resin,

Ap-d (T) (Yamasa Shoyu Co., Ltd.) in the following order:

(DMTr) CpAp (NHR ₃ ), (DMTr) GpGp (NHR ₃ ), equimolar mixture, (DMTr) CpAp (NHR ₃ ), (DMTr) CpTp (NHR ₃ ), (DMTr) CpGp (NHR ₃ ), and (DMTr ) CpCp (NHR ₃ ), equimolar mixture, (DMTr) ApGp (NHR ₃ ), (DMTr) CpGp (NHR ₃ ), (DMTr) GpGp (NHR ₃ ), and (DMTr) CpGp (NHR ₃ ).

-3737 (DMTr) ApAp (NHR ₃ ), equimolar mixture, (DMT-r) CpAp (NHR ₃ ) and (DMTr) CpGp (NHR ₃ ) and (DMTr) Gp (NHR ₃ ) with all nucleotides obtained from Nippon Zeon ( dealer-manufacturer). Synthetic DNA is thus obtained in yields around IOA260 units. Analysis using the Maxim-Gilbert sequence method shows that the resulting oligonucleotide has the nucleotide sequence shown in Figure 1.

(iii) Probe synthesis (LC)

Automatic DNA synthesis with DNA synthesizer Model 380A Applied Biosystems is performed. This technique is based on the principles set by Caratherus et al., / J. Am. Chem. Soc., 103, 3185 (1981) /. Generally, this technique is referred to as the phosphoramamide process.

Phosphoramidite from (DMTr) -dT, previously activated with tetrazole, condenses into dG-S (S: carrier), where the 5'-dimethoxynitrile group (DMTr) is unblocked. Subsequently, the unreacted hydroxyl groups are acylated and oxidized with iodine in the presence of water to form a phosphoryl group. After unblocking the DMTr group, condensation is carried out in the same way as no 24 nucleotides have been synthesized having their sequence shown in Figure 1. These nucleotides are separated, unblocked and purified by reverse phase HPLC on column C-18 (Shenshu Kagaku Co.). , Ltd.; SSC-ODS-272).

Example 5: Cultivation and separation of CHU-2 cells

The designed CHU-2 cells were grown in a fully dense population in two culture bottles (150 cm ² ), after which the sauce was isolated and suspended in 500 ml RPMI 1640 culture solution, I containing 10% bovine embryo serum. They were then transferred to a 1580 cm ² large glass bottle (Belco) and cultured under stirring for 4 days at 0.5 rpm. When the grown cells on the inner wall of the bottle were found to have a completely dense population, the solution was

-3838 cultures were removed from the bottle and 100 ml of physiological saline solution heated to 37 ° C containing 0.02% EDTA was added to the bottle. After heating for 2 minutes at 37 ° C, the cells were separated from the inner wall of the bottle by pipetting. The resulting cell suspension was centrifuged at 1500 rpm for 10 minutes to give a cell tablet. The cells were then resuspended in 5 ml of saline containing no EDTA. The suspension was centrifuged at 1500 rpm for 10 minutes to give a tablet of cells (weighing about 0.8 g). The cells thus obtained are left frozen at -80 ° C until subjected to the RNA extraction process.

2) MRNA purification

Isolated mRNAs from CHU-2 cells obtained in 1) were designed by procedures substantially identical to those described in Molecular Cloning ”Maniatis et al., Cold Spring Harbor, p. 196, 1982. Frozen CHU-2 cells (wet weight 3.8 g) were suspended in 20 ml of a solution of 6M guanidine / (M guanidinium isothiocyanant, 5mM sodium citrate (pH 7), 0.1M β mercaptoethanol and 0.5% sodium sarcosyl sulfate / suspension Stir well for 2-3 minutes The mixture is subjected to 10x withdrawal and injection (20 ml capacity) with a needle of 18G About 6 ml of viscous guanidinium solution containing dissolved cells is expanded to a 6 ml 5.7M CsCl pad in 0.1M EDTA (pH 7.5) in Beckman CW40 Ti polyalloomer centrifuge tubes so that the tube is completely filled in. The procedures described below will prepare 4 tubes that are centrifuged at 30000 rpm for 15 hours at 20 ° C. The tablets obtained are washed three times in the introduction with a small amount of 70% ethanol.

Tablets obtained from special tubes are combined, dissolved in 550 μΐ of water and treated to allow 0.2M NaCl concentration. After treatment with a 1: 1 mixture of phenol and

-3939 chloroform, and with chloroform alone, 2.5 volumes of ethanol are added so that STAL0ŽIs the total RNA (about 10.1 mg total RNA is obtained from 3.8 g wet cells).

Poly (A ⁺ ) RNA is purified from total RNA by the following affinity chromatography procedures, which take advantage of the binding of the poly (A) strand at the 3 'mRNA terminal. Adsorption on oligo (dT) -cellulose (Type 7 PL Biochemicals) is achieved by passing total RNA in carrier buffer (containing lOmM TrisHCl (pH 7.5), 0.5M NaCl, lmM EDTA and 0.1% SDS solution) through the oligo (dT) -cellulose column after heating the solution to 65 ° C for 5 minutes. The column is equilibrated with the same carrier buffer. The elution of poly (A ⁺ ) RNA is done with TE solution (containing 10mM Tris-HCl (pH 7.5) and 1mM EDTA). The unabsorbed effluent is again passed through a column and the eluate obtained by repeating the same procedures is mixed with the eluate obtained in the first elution. In this way 400μς poly (A ⁺ ) RNA was obtained. The mRNA thus obtained is fractionated by particle size using a sucrose centrifugation gradient according to the procedures described in the laboratory manual (Practical Methods in Molecular Biology, Springer-Veriag, New York, heidelberg, Berlin (1981).

Specifically, a density gradient of 5-25% sucrose is formed in a Beckman SW40 Ti centrifugal tube. Two sucrose solutions were prepared by dissolving 5% and 25% sucrose solutions containing no RNase (Schwarz / Mann) into a solution containing 0.1M NaCl, 10MM Tris-HCl (pH 7.5), 1mM EDTA and 0.5% SDS.

800 pg of mRNA / poly (A ⁺ ) -RNA / obtained according to the method already described is dissolved in 200-500 ml of Ul TE solution. The solution was heated to 65 ° C for 5 minutes, then cooled rapidly and placed in a gradient of sucrose density solution, centrifuged at 30000

-4040 rpm 20 hours. Collect 0.5 ml of the fraction and measure the adsorption at 260 nm. The sizes of fractionated RNA are determined based on the positions of the RNA standards (ribos RNAs 28S, 18S and 5S).

At the same time, the G-CSF activity of each fraction was examined by Xenophus laevis oocytes by the following procedures. First, the RNA of each fraction is translated into an aqueous solution having a concentration of 1μς / μ1; The oocytes are taken from Wenophus (about 1 year old) and the mRNA solution is placed in such a way that 50 ng of mRNA is placed in one oocyte; ten such oocytes are inserted into each of the 96 wells of the microtiter tray; oocytes were cultured for 48 hours at room temperature in 100μ1 Barth medium (88 ml NaCl, 1 mM Kcl,

2.4 mM NaHCOa, 0.82 mM MgSO ₄ , 0.33 mM Ca (NO ₃ ) ₂ , 0.41 mM CaCl ₂ ,

7.5 mM Tris Hcl (pH 7.6), 10 mg / l penicillin and 10 mg / l streptimycin sulfate); the culture supernatant is separated, which is concentrated and purified to an appropriate level to study the level of G-CSF activity.

G-CSF activity was present in the 17S fractions.

Example 6: cDNA Synthesis (Construction of a pBR Line cDNA Library)

From the poly (A ⁺ ) RNA obtained in Example 6, cDNA was synthesized by the procedure of Land et al. / Nucleic Acids res., 9, 2551 (1981) /, modified by Gubler and Hoffman (Gene, 25, 263 (1983)).

(1) Single cDNA synthesis

The Eppendorf tube (1.5 ml capacity) is filled with reagents in the following order: 80 μΐ fraction buffer (500 mM Kcl, 50 mM MgCl ₂ , 250 mM Tris-HCl with pH = 8.3 (; 20μ1 200 mM dithiotriethioia, 32µ1 12.5 mM dNPT (containing 12.5 mM of dATP, dGTP, dCTP and dTTP), 10μ1 a- ³² P-dCTP (PB 10205 Amerscha) μΐ oligo (dT) 12 * 18 (from PL Biochemicals; 500 pg / ml), 20 μς poly (A ⁺ ) RNA (2.1 μς / μΐ) and 206 μΐ of distilled water

-4141 A total of 400 μΐ of the reaction solution is heated at 65 ° C for 5 minutes and then at 42 ° C for 5 minutes. 120 Reverse Transcriptase Units (Takara Shuzo Co., Ltd) were added to the warm solution. By monitoring the reaction for another 2 hours at 42 ° C, 2µ1 TE solution, Ϊ6 μΐ lOOmM sodium pyrophosphate and 48 units (4 μΐ) of reverse transcriptase were added, and the reaction was continued for another two hours at 46 ° C. the reaction was stopped abruptly by the addition of 0.5M EDTA (8μ1) and 10% SDS (8μ1). Subsequently, enol / chloroform treatment and ethanol precipitation (twice) yielded a single cDNA strand.

(2) Coupling of the dC strand to a single cDNA

The single cDNA obtained in (1) is dissolved in distilled water. 60 μΐ dC-chain was added to the solution by addition of buffer / 400 mM potassium lacodylate, 50mM Tris-HCl (pH 6.9), 4mM dithiothrietol, 1mM CoCl ₂ and 1mM dCTP / and the mixture was heated to 37 ° C for 5 minutes. A further 3µ1 terminal transferase (27 units / μΙ; Pl. Biochemicals) was added to the reaction mixture and the mixture was then heated to 37 ° C for 2.5 minutes. By further treatment with phenol / chloroform (once) and by precipitation with ethanol (twice), the dC-terminal portion of the cDNA was dissolved in 40 μΐ TE solution containing 100 mM NaCI.

3) Double cDNA synthesis

To 40 μΐ of the solution obtained in 2), 4 μΐ oligo (dG) ₁₂ -i ₈ (200 pg / ml; PL Biochemicals) was added, then the mixture was warmed to 65 ° C for 5 minutes and then to 42 ° C for 30 minutes. While maintaining the reaction solution at 0 ° C, 80 μΐ of buffer (100 mM TrisHCl (pH 7.5), 20 mM MgCl ₂ , 50 mM (NH ₄ ) ₂ SO ₄ and 500 mM Kcl /, 4 μΐ are added 4mM dNTP (containing 4 mM dATP, dCTP, dGTP and dTTP each), 60 μΐ lmM β-NAD, 210 μΐ distilled water, 20 μΐ E.coli Polymerase I bottoms (Takara Shuzo Co., Ltd.), 15μ1 E. coli DNA ligase (Takara Shuzo

-4242

Co., Ltd.). The mixture was then reacted to 1 ° C for 1 hour. After the addition of 4 mM dNTP (4 gl), the reaction was allowed to proceed for another 1 hour at 25 ° C. Further, treatment with pheno / chloroform and precipitation with ethanol (once) yielded about 8gg of double cDNA. This double cDNA was then dissolved in TE solution and then subjected to 1.2% agarose gel electrophoresis. Fragments of approximately 569 bp to 2 kbp are adsorbed onto Whatman DE81, yielding about 0.2 gg of double cDNA by elution.

4) Attachment of the dC strand and double cDNA

The double cDNA obtained in 3) was dissolved in 40 gl of TE solution.

Then 8 μΐ dC-end buffer of the type mentioned in 2) is added and the mixture is heated to 37 ° C for 3 minutes. After that, the reaction mixture was immediately cooled to 0 ° C and quenched by the addition of 1 μΐ 0.5 M EDTA. After treatment with phenol / chloroform and precipitation with ethanol, the resulting TALOG is suspended in 10 μΐ TE solution.

5) Construction of a pBR-line cDNA library of a microliter of commercial oligo (dG) -specific pBR322 vector (Bethesda Research Laboratories; 10 ng / μΙ) and 2 μΐ dC-terminal double cDNA obtained in 4) was germinated in TE solution containing 75 gg 0.1 M NaCl. Tempering involves three stages: heating to 65 ° C for 5 minutes; then warming to 40 ° C for 2 hours and cooling to room temperature.

According to the method described in the laboratory manual of Manitatis et al · Molecular Clonigng Cold Spring Harbor, p. 249 ff.

(1982) / (other routine techniques may be used), the corresponding cells are obtained from E. coli Χ1776. These are transferred with a hardened plasmid to obtain transformants.

-4343

Example 7: cDNA Synthesis (X £ age Library Construction)

1) Single cDNA synthesis

Following the procedures described in Example 5, 3.8 g of frozen CHU-2 cells were purified twice per oligo (dT) cellulose column to give 400 pg of poly (A ⁺ ) RNA.

A TE solution of {10 pl) containing 12 pg of poly (A ⁺ ) RNA dissolved therein was placed in a reaction tube containing 10 pg of actinomycin D (Sigma). After this, the tube is supplemented with reagents in the following order: 20 µl reverse transcriptase buffer / 250 mM Tris-HCl (pH 8.3); 40 mM MgCl ₂ ; 250 mM Kcl /; 20 pl 5 mM dNTP (containing 5 mM dATP, dGTP, dCTP and dTTP each); 20 pl oligo (dT) 12-IU (0.2 pg / ml; PL Biochemicals); 1 pl IM of dithiothriethiol; 2 pl of RNasin (30 units / pl; Promega Biotech); 10 pl reverse transcriptase (10 units / pl; Seikagaku Kogyo Co., Ltd.): 1 pl a- ³² P-ATP (10 pCi; Amerscham); and 16 pl of water. The total volume of the reaction mixture was 100 µl. The mixture was heated to 42 ° C for 2 hours and then quenched by the addition of 0.5 M EDTA (5 pl) and 20% SDS (1pi). Treatment with phenol / chlorine (100 pl) and ethanol precipitation (twice) yielded about 4 pg of single cDNA.

2) Double-strand cDNA synthesis obtained in 1) was dissolved in 29 pl TE solution and the reaction solution was obtained by adding the following reagents in the following order: 25 pl polymerase buffer 1 400 mM Hepes (pH 7.6); 16 mM MgCl ₂ , 63 mM 5-mercaptoethanol and 270 mM Kcl; 10 μΐ 5mM dNTP; 1.0 μΐ 15 mM β-NAD; 1.0 μΐ alpha ³² P-dATP (10 pCi in 0.2 pl E. coli DNA polymerase I) New England Biolabs;

-4444 units / μΐ); 0.1 μΐ Rnase Η (60 units / μΙ; Takara Shuzo Co., Ltd.,); and 28.7 μΐ of distilled water.

The reaction mixture was incubated for 1 hour at 14 ° C and then left at room temperature for another hour, then quenched by the addition of 0.5 M EDTA (5μ1) and 20% SDS (Ιμΐ) and then treated with phenol / chloroform. and deposition was performed with ethanol. The resulting DNA was dissolved in 20 μΐ 0.5 M EDTA, with the addition of 3 μΐ Klenow buffer / 500 mM Trias-HCl (pH 8.0) and 50 mM Μ9θ1 ₂ / 3μ1 5mM dNTP and 4 μΐ water, and the reaction solution was prepared . Then 1 μΐ of DNA polymerase (Klenow fragments of Takar Suhozo Co., Ltd) was added and the reaction solution was incubated at 30 ° C for 15 minutes.

The incubated reaction solution was diluted with 70 μΐ TE solution and quenched by the addition of 0.5 M EDTA (5 μΐ) and 20% SDS (1 μΐ). After treatment with phenol chloroform and ethanol deposition, about 8 μς of double cDNA was obtained.

3) Double cDNA methylation

Aqueous solution (30 μΐ) of double cDNA synthesized in 2) was mixed with 40 μΐ methylation buffer / 500 mM Tris-HCl (pH 8.0); 50 mM EDTA /, 20 μΐ S-adenosyl-L ~ methylmethionine solution (hereinafter referred to as SAM solution) / 800 μΜ SAM solution; 50 mM β-mercaptoetol and 100 μΐ water. 15 μΐ of EcoRI methylase (manufactured by New England Biolabs; 20 units / μΙ) was added to the mixture to obtain a reaction solution with a total volume of 200 μΐ. After two hours of incubation at 37 ° C, treatment with phenol and ether and ethanol precipitation, DNA was extracted.

4) Addition of EcoRI binder

In about 1.2 μ9 methylated double cDNA, 1.5 μΐ of ligase buffer / 250 mM Tris-HCl (pH 7.5) and 100 mM MgCl ₂ /, 0.5 μΐ

-4545 pre-phosphorylated EcoRI binder (10 mer; Takara Shuzo Co., Ltd.), 1.5 pl 10 mM ATP, 1.5 μΐ 100 mM dithiothriethiol and 2 pl water added to a total solution volume of 15 pl. After the addition of 0.7 pl T ₄ DNA ligase (3.4 units / μΐ; Takara Shuzo Co., Ltd.), the reaction was allowed to proceed overnight at 4 ° C. The ligase is subsequently deactivated by heating to 65 ° C for 10 minutes. The reaction solution is brought to a total volume of 50 μΐ by the addition of 100 mM Tris-HCl (pH 7.5), 5 mM MgCl ₂ , 50 mM NaCI and 100 μg / ml gelatin. After the addition of EcoRI (3.5 pl; 10 units / μΐ), the reaction was carried out for 2 hours at 37 ° C. After this, 2.5 μΐ 0.5 M EDTA and 0.5 μΐ 20% SDS are added, after which the solution is treated with phenol / chloroform and precipitated with ethanol to remove DNA. Thereafter, unreacted EcoRI is removed by gel filtration on ULTRAGEL AcA34 (LKB) or by agarose gel electrophoresis, eliminating about 0.5-0.7 pg of double cDNA that has been added bindably.

5) Coupling of double cDNA to Xgtl0 vector

The double cDNA to which the binder was added is mixed with 2.4 pg of pre-EcoRI treated vector XgtlO vector (Vector Zioning System), 1.4 pg of ligase buffer (250 mM Tris-HCl and 100 mM MgCl ₂ ) and 6.5 pl of distilled water, then It is heated to 42 ° C for 15 minutes. then Ιμΐ mM ATP, 1 μΐ 0.1 M dithiothriethiol and 0.5 μΐ T ₄ DNA ligase were then added to build 15 pl of the total volume of the reaction mixture which was left overnight at 12 ° C.

6) In vitro packaging

About 30 recombinant DNAs obtained in 5) are packed in vitro with a packing kit (manufactured by Promega Biotech) to obtain phage infection.

-4646

Example 8: Testing a PBR Line Probe Library (IWQ)

The Whatman 541 paper was placed on an agar pad for colony growth, where it was left for 2 hours at 37 ° C. After that, we treated the filter paper as follows, Taub and Thomson / Anal. Biochem., 126, 222 (1982) /.

Colonies transferred to 541 paper were further grown on an agar medium containing chloramphenicyl (250 μ μ / 1 μΐ) overnight at 37 ° C.

Paper 541 was taken out and left at room temperature for 3 minutes on another sheet of filter paper impregnated with 0.5 N NaOH solution. This process was repeated twice. A similar procedure was performed twice every 3 minutes using 0.5 M Tris.HCI (pH 8) for 3 minutes, with a 1.5 mg / ml lysozyme solution containing 0.05 M Tris-HCl (pH 8) and 25% sucrose, in for 10 minutes; then the paper was treated at 37 ° C with a solution of 1 x SSCD (0.15 M NaCl and 0.015 M sodium citrate) for 2 minutes and with 1 x SSC solution containing 200 pg / ml proteinase K for 30 minutes; finally, treatments were performed at room temperature using 1 x SSC solution for 2 minutes and 95% ethanol solution for 2 minutes. The last stage was repeated twice. After that, paper 541 was dried. The dried paper 541 was immersed in a 25: 24: 1 phenol / chloroform / isoamylalcohol mixture balanced with 100 mM Tris-HCl (pH 8.5), 100 mM NaCl and 10 mM EDTA / for 30 minutes at room temperature. Then, similar procedures were repeated three times with 5 x SSC solution for 3 minutes and twice with 95% ethanol solution for 3 minutes. After that, the filter paper was dried.

The probe (IWQ) was labeled with ³² P following a routine procedure (see Molecular Cloning), and colony hybridization was performed according to the method of Wallace et al. / Nucleic Acid Res., 9, 879 (1981) /.

-4747

The hybridization was performed for 4 hours at 65 ° C in hybridization buffer containing 6 χ NET /0.9 M NaCl; 0.09 M Tris-HCl (pH 7.5); and 6 mM EDTA /, 5 x Denhardt's solution, 0.1% SDS, and 0.1 mg / ml denatured DNA (thymus calf), then the hybridization was performed at zero at 56 ° C in hybridization buffer (preparation of this is described below). containing 1 x 10 ⁶ cpm / ml radiolabeled probe (IWQ). After completion of the reaction, paper 541 was washed twice with 6 x SSC solution (containing 0.1% SDS) for 30 minutes at room temperature and for 1.5 minutes at 56 ° C. The paper so washed was then autoradiographed.

The plasmid was separated from clones and subjected to Southern probe uptake (IWQ). Hybridization and autoradiography were performed under the same conditions as described below.

Similarly, Southern soaking was also performed with probe (A). Using hybridization buffer, which was prepared as described below, hybridization was first performed at 49 ° C for 1 hour. At 39 ° C, hybridization continued at this temperature for another 1 hour. After completion of the reaction, the nitrocellulose paper was washed twice with 0.1% SDS containing 6 x SSC for 30 minutes at room temperature and then washed at 39 ° C for 3 minutes. The washed paper was sent for autoradiography.

One positive clone was found. Examination of the nucleotide array by the dideoxy method revealed that this DNA clone consisted of 308 base pairs comprising parts of probes (IWQ) and (A). The pBR322 derived plasmid containing this moiety was named pHCS-1.

Example 9: Testing a Kfagov Library Line with a pHCS-1 Derived DNA Probe

Hybridization of the infection was performed according to the method of Benton and Davis (Science, 196, 180 (1977)). pHCS-1 obtained in Example 8

-4848 was treated with Sau3A and EcoRI to obtain a DNA fragment of about 600 bp in length. This DNA fragment was radiolabeled with translational notch according to routine methods. A nitrocellulose filter (S&S) was placed on a phage agar pad to raise infection due to the transfer of the phage to the filter. After denaturing the phage with 0.5 M NaOH, the filter paper was treated as follows: treatment with 0.5 M NaOH and 1.5 M NaCl for 20 seconds; twice treatment with 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCI for 20 seconds; final treatment with 120 mM NaCI, 15 mM sodium citrate, 13 mM KH ₂ PO ₄ and 1 mM EDTA (pH 7.2) for 20 seconds. The filter is then dried and heated to 80 ° C for 2 hours to immobilize DNA. The re-hybridization was performed overnight at 42 ° C in pre-hybridization buffer containing 5 x SSC, 5 x Denhardt solution, 50 mM phosphate buffer, 50% formamide, 0.35 mg / ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Hybridization was then performed at 42 ° C for 20 h in hybridization buffer containing 4 x 10 ^{with a} cpm / ml pHCS-1 probe, which was radiolabeled using translational notch. This hybridization buffer was a mixture of 5 x Dehnhardt solution, 20 mM phosphate buffer (pH 6), 50% formamide, 0.1% SDS, 10% dextran sulfate and 0.1 mg / ml denatured DNA (salmon sperm DNA).

The hybridized nitrocellulose filter was washed with 2 x SSC containing 0.1% SDS at room temperature for 20 minutes, then 30 minutes with 0.1 x SSC containing 0.1% SDS at 44 ° C, and finally for 10 minutes with 0.1 x SSC at room temperature. We then performed autograph detection. 5 positive clones (G1-G5) were obtained. A clone containing the entire length of the cDNA strand was examined for DNA dinucleotide detection by the dideoxy method. The nucleotide sequence shown in Figure 3 (A) was identified. This cDNA was attached to pBR327 after excision of the Xgtl0 vector / Sorberon et al., Gene, 9,287 (1980) / to

-4949

EcoRI site so that a plasmid can be constructed that can be obtained in large quantities. This plasmid was named pBRG4.

Example 10: Testing an Ifaga line library with a pBRG4-derived probe and (LC) probe

Hybridization of the infection was performed according to the Benton and Davis procedure (see Science, same) used in Example 9. A nitrocellulose filter (S&S) was placed in a phage agar medium to raise the infection to transmit the phage to the filter.

After denaturing the phage DNA with 0.5 M NaOH, the filter was treated with the following procedures: treatment with 0.1 M NaOH and 1.5 NaCI for 20 seconds; then twice treated with 0.5 M Trsi-HCl (pH 7.5) and 1.5 M NaCI for 20 seconds; and finally treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH ₂ PO ₄ and 1 mM EDTA (pH 7.2) for 20 seconds. The filter was then dried and heated for 2 hours at 80 ° C to immobilize DNA. Two sheets of the same filter paper were prepared in a manner that will be described further, and then subjected to treatment with pBRG4-derived DNA probes and probes (LC).

Testing with the pBRG4-performed probe was performed as follows. pBRG44 was treated with EcoRI to obtain a DNA fragment of about 1500 bp in length. This fragment was radiolabeled with translational incision according to routine procedures. One of the two nitrocellulose filters was subjected to pre-hybridization in pre-hybridization buffer, I containing 5 x SSC, 5 x Denhardt solution, 50 mM phosphate buffer, 50% formaldehyde, 0.25 mg / ml denatured DNA (salmon sperm DNA) and 0.1% SDS . The re-hybridizations were performed overnight at 42 ° C. Then, the filter was subjected to hybridization at 42 ° C for 20 hours in hybridization buffer containing a radiolabeled DNA probe (about 1 10 ⁶ cpm / ml) of about 1500 bp in length. Hybridization buffer is a mixture of 5 x SSC, 5 x Dehnhardt solution, 20 mM phosphate buffer fpH 6), 50%

-5050 formamide, 0.1% SDS, 10% dextran sulfate and 0.1 mg / ml denatured DNA (salmon sperm DNA). The hybridized nitrocellulose filter was washed for 20 minutes with 2 x SSC containing 0.1% SDS at room temperature, then 30 minutes with 0.1 x SSC containing 0.1% SDS at 44 ° C and then for 10 minutes with 0.1% SSC at room temperature. Detection is performed using autoradiography. Probe testing (LC) is performed using the following procedures. The second filter was pretreated with SSC containing 0.1% SDS for 2 hours at 65 ° C. Then, the hybridization was carried out for 2 hours at 65 ° C in a solution containing 6 χ NET, 1 x Dehnhardt solution and 100 gg of denatured DNA (salmon sperm DNA). Hybridization was then performed overnight at 63 ° C in hybridization buffer containing a radiolabeled probe (LC) (2 χ 10 ⁶ cpm / ml). This hybridization ski buffer is also a mixture of 6 x NET, 1 x Dehnhardt solution and 100 gg / ml denatured DNA (salmon sperm DNA). The hybridized nitrocellulose filter was washed three times (20 min each) with 3 x SSC containing 0.1% SDS at room temperature and then washed for 2 minutes at 63 ° C with 6 x SSC containing 0.1% SDS.

The filter was then dried and autoradiographically detected.

In the testing described below, clones that were positive in both probes were separated and a clone having the entire length of the cDNA strand was examined by a dideoxy method to determine the nucleotide sequence. the nucleotide array was found to have shown in Figure 4 (A). This DNA was cut from the KgtlO vector and attached to pBR327 at the EcoRI site to construct the pBRV2 plasmid.

Example 11: Human chromosomal gene library testing

1) Building a Human Chromosomal Gene Library

Human chromosomal gene library obtained thanks to Dr. Harvard University Manitastis was prepared using the following procedures: the entire DNA of the chromosome was

-5151 was extracted from the liver of the human embryo with phenol or other appropriate chemicals and was partially degraded by the Haelll and Alul restriction enzymes; the resulting DNA fragments were treated with a centrifugal sucrose density gradient such that the concentrate of the fragment having the chains was about 18-25 kb long; the concentrated fragments were attached to the DNA arm of E.coli phage λ Charon 4A by synthetic short-chain nucleotides, which were attached to EcoRI restriction enzyme sites to construct infected phage DNA recombinants; to reduce infectivity, particles of purer λ phage were obtained by packing. The human gene library thus obtained is theoretically treated as a set of recombinants containing human DNA with 18-25 kb long chains contained in virtually all human genes.

2) Human chromosomal gene library testing with pHCS-1 derived DNA probe

Hybridization of infection was performed using the Benton-Davis method / Science, 196, 180 (1977) /. The pHCS-1 obtained in Example 8 was treated with Sau3A and EcoRI to yield a fragment of about 800 bp in length. This DNA fragment was radiolabelled using a translation slit according to routine procedures. A nitrocellulose filter (S&S) was placed in a phage agar medium to raise infection due to the transmission of the phage to the filter. After denaturing the phage DNA with 0.5 M NaOH, the filter paper was treated by the following procedures: treatment with 1.5 M NaCl for 20 seconds, twice treatment with 0.5 M Tris-HCl (pH 7.5) and 1.5 M NaCl for 20 seconds; finally, treatment with 120 mM NaCl, 15 mM sodium citrate, 13 mM KH ₂ PO _4, and finally with 1 mM EDTA (pH 7.2) for 20 seconds.

The filter was then dried and heated to 80 ° C for 2 hours to immobilize DNA. The re-hybridization was done via

-5252 nights at 42 ° C in pre-hybridization buffer containing 5 x SSC, 5 x Dhnhardt's solution, 50 mM phosphate buffer, 50% formamide, 0.25 mg / ml denatured DNA (salmon sperm DNA) and 0.1% SDS. Then, a 20 h hybridization at 42 ° C was thrown in hybridization buffer containing 4 χ 10 ⁵ cpm / ml pHCS-1 probe, which was radiolabeled with translational notch. This hybridization buffer was a mixture of 5 x SSC, 5 x Dehnhardt solution, 20 mM phosphate buffer (pH 6), 50% formamide, 0.1% SDS, 10% dextran sulfate and 0.1 mg / ml denatured DNA (salmon sperm DNA).

The hybridized nitrocellulose filter was washed for 20 minutes with 2 x SSC containing 0.1% SDS and at room temperature for 30 minutes with 0.1 x SSC containing 0.1% SDS at 44 ° C and finally for 10 minutes with 0.1 x SSC at room temperature. The detection was then performed by autoradiography.

10 mapped positive clones were obtained. DNA recombinants were obtained from these clones by the Manitatis method (Celi, 15, 687 (1987)). The resulting DNAs were treated with restriction enzymes such as EcoRI, BemHI and Bglll, analyzed by agarose gel electrophoresis, and a map of their restriction enzyme was obtained by the method of Fritsch et al. (see Whole, same).

Southern hybridization was performed with a probe that was radiolabeled with a pHCS-1 derived DNA fragment, which is the same as that used in the testing above. A DNA fragment about 8 kbp in length that was digested with EcoRI was selected from clones that were hybridized with the probe.

A fragment that was subcloned into EcoRI at site pBR327. subcloned DNA was subjected to another restriction enzyme treatment, and Southern hybridization was performed several times. A 4 kbp DNA fragment digested with EcoRI and Xhol was found to contain a gene encoding a human G-CSF polypeptide. This DNA fragment was investigated

-5353 to determine the sequence of its 3-kbp by the dideoxy method, and the string was identified in Fig. 5. This fragment has the restriction enzyme termination site shown in Fig.

7.

Testing of human chromosomal genes was performed by using pBRG4-derived DNA and pBRV2-derived DNA cacopers.

In both cases, the DNA fragment of 1500 bp treated with EcoRI was directly radioactively labeled with transection incision as described above or, alternatively, the DNA fragment of 700 bp obtained by alternating treatments with EcoRI and It was read and radiolabeled with translational notching. The probe thus obtained is used in hybridization of the infection, which was performed under the same conditions as described below. The selected clones were analyzed by Southern hybridization to obtain a DNA fragment having the nucleotide sequence shown in Figure 5. The plasmid thus obtained was named pBRCE3.

Example 12: Construction of E. coli recombinant vector (+ ALL) And transformation (using a tac promoter containing a vector)

l) Construction of recombinant vector (i) Preparation of microgram vector of tac promoter containing vector pKK223-3 (pharmacia) was treated with 8 EcoRI units (Takara Shuzo Co., Ltd.) for 2 hours at 37 ° C in 30 μ C of the reaction solution (40 mM Tris-HCl, 7 mM MgCl ₂ , 100 mM NaCl and 7 mM 2mercaptoethanol).

To this was added 3 μΐ of alkaline phosphatase (Takara Shuzo Co., Ltd.), and treatment was performed at 60 ° C for 30 minutes. The DNA fragment was extracted by triple treatment with phenol and single treatment with ether and ethanol precipitation. Everything was done according to routine procedures.

-5454

The isolated DNA fragment was dissolved in 50 microliters of a mixture consisting of 50 mM Tris-HCl, 5 mM MgCl ₂ , 10 mM DTT and 1 mM dATP, dCTP, dGTP and dTTP each. After addition of 3 μΐ of E.coli DNA polymerase I-Klenow fragment (Takara Shuzo Co., Ltd.), the reaction was carried out at 14 ° C for 2 hours, building open ends.

(ii) Obtaining a synthetic binder

Three micrograms of oiigonucleotides, which has strings of synthetic binders CGAATGACCCCCCTGGGCC and CAGGGGGGTCATTGG, were phosphorylated by carrying out the reaction in 40 μΐ of the reaction solution (consisting of 50 mM Tris-HCl, 10 mM MgCl ₂ , 10 mM 2-merc) and mercapetane ° C for 60 minutes in the presence of 4 units of T ₄ polynucleotide kinase.

Each of the phosphorylated oligonucleotides (0.2 pg) was dissolved in 20 μ! 100 mM NaCl-containing TE solution / 10 mM Tris-HCl (pH 8) and 1 mM EDTA /. After treatment at 65 ° C for 10 minutes, the oligonucleotides were quenched by slow cooling to room temperature.

(iii) Obtaining the G-CSE 'cDNA microgram fragment of pBRG4 obtained in Example 9 containing the cDNA shown in Figure 3 (A) was treated with 100 units of Apal restriction enzyme (New England Biolabs) and 50 units of Dral (Takara Shuzo Co.). , Ltd.) at 37 ° C for 3 hours in a 200 μΐ reaction mixture consisting of 6 mM Tris-HCl, 6 mM MgCl ₂ and 6 mM 2-mercaptoethanol. About 2 μg of the Apal-Dral fragment (about 590 bp) was separated by 1.2% agarose gel electrophoresis.

-5555 (iv) Fragment binding

After about 0.1 micrograms of each of the fragments obtained in (i) to (iii) were dissolved in 20 μΐ of the binding solution (66 mM Tris-HCl, 6.6 mM MgCl ₂ , 10 mM DTT and 1 mM ATP). After the addition of 175 units of T ₄ ligase, a solution is left overnight at 4 ° C, so that the obtained recombinant vector.

2) Transformation

Using a 20 µl reaction mixture that harbors the recombinant vector obtained in (iv), E. coli of type OM105 was transformed in a rubidium chloride process (see T. Manitatis et al., Molecular Cloning, p. 252 (1982)). The plasmid was separated from the amplicillin-resistant transformant culture colony and treated with BamHI, AccII and Apal restriction enzymes to confirm that the transformants were the ones we wanted.

Example 13: Construction of E.Coli recombinant vector (+ ALL) and transformation (using PL promoter containing vector)

1) Construction of recombinant vector (i) Retrieval of vector

100 micrograms of the PL promoter containing vector PPL-lambda (Pharmacia) through the night is treated with 50 units of restriction enzyme BamHI in 100 pl of the reaction mixture / 10 mM Tris-HCl (pH 7.6), 7 mM MgCl _2/100 mM NaCl and 10 mM DTT / at 37 ° C.

By introducing the reaction solution into 1% agarose gel electrophoresis, about 49 pg of about 4 kbp fragment and about 11 pg of about 1.2 kbp fragment are eliminated.

The 4-kbp fragment was dissolved in 100 µl TE buffer (composition described below) and then dephosphorylated by reaction with alkaline phosphatase (Takara Shuzo Co., Ltd.) at 60 ° C for 60 minutes.

-5656

A second fragment about 1.2 kb long was dissolved in 20 μΐ of buffer (10 mM Tris-HCl, 10 mM MgCl ₂ and 1 mM DTT) and treated with 20 units of MboII restriction enzyme overnight at 37 ° C (New England Biolabs).

With 4% polyacrylamide gel electrophoresis, about 0.9 gg of BamHI-MboII fragments (about 200 bp) and about 1.9 gg of MboII-BamHI fragments were extracted.

(ii) Obtaining a synthetic binder

Oligonucleotides having strands of synthetic binders

TAAGGAGAATTCATCGAT and TCGATGAATTCTCCTTAG were phosphorylated and tempered as in (ii) in Example 12 to give a synthetic S / D binder.

(iii) Retrieval of expression vector

0.1 gg around a 4-kb fragment, 0.05 gg each of a BamHI fragment having an O _L P _L region and an MboII-BamHI fragment having a tL _x region / three fragments obtained in (I) / and 0.1 gg of hardened synthetic S / D binder obtained in (ii) is reacted overnight at 12 ° C in 40 μΐ reaction mixture (66 mM Tris-HCl, 6.6 mM MgCl ₂ , 10 mM DTT and 1 mM ATP) in the presence of 175 units of T ₄ DNA ligase (Takara Shuzo Co., Ltd.). 20 g of the reaction solution was used to transform E. coli type N99CI ⁺ (Pharmacia) in a process involving calcium chloride (see Molecular Cloning, same).

Transformants were cultured and a plasmid was isolated from their culture of ampicillin-resistant colonies. Treatment of the plasmid with the restriction enzymes EcoRI, BamHI and Smal indicates that this was the desired plasmid.

Two micrograms of this plasmid were reacted with Cial (New England Biolabs) restriction enzyme at 37 ° C for 2 hours in 20

-5757 μΐ buffer (10 mM Tris-HCl, 6 mM MgCl ₂ and 50 mM NaCI). Subsequently, the enzyme was deactivated by heating to 65 ° C for 10 minutes.

One microliter of the reaction solution was reacted overnight at 12 ° C with 175 units of T ₄ DNA ligase (Takara Shuzo Co., Ltd.) in a binding solution having the composition described below. The reaction mixture was then used to transform E. coli type N99cl ⁺ (Pharmacia). The plasmid was eliminated from the culture of the ampicillin-resistant transformant colonies and then treated with EcoRI and BamHI, thus confirming that the plasmid obtained was also desired! plasmid.

(iv) Retrieval of G-CSF expressing recombinant vector and transformants

The expression plasmid obtained in (iii) was treated with the Clal restriction enzyme. After creating the open ends, the plasmid was treated as in Example 12 to obtain the recombinant vector of a given cDNA fragment of G-CSF. This vector was used to transform E. coli type N4830 (Pharmacia Fine Chemicals) into a process involving calcium chloride, which was described in Molecular Cloning, same. Identification of the desired transformants was performed as in Example 12 (Figure 9).

Example 14: Construction of E.coli recombinant vector (+ ALL) and transformation (using trp promoter having vector)

1) Construction of recombinant vector (i) Preparation of vector

The plasmid pOZl obtained by inserting a tryptophan promoter containing the Hpall-TagI fragment (about 330 bp) into pBR322 at the Clal site. Ten micrograms of this plasmid were treated with 7 units of Clal restriction enzyme and 8 units of PvuII at 37 ° C for 3 hours in a 30 μΐ reaction mixture consisting of 10 mM Tris-HCl, 6 mM MgCl ₂ and 50 mM NaCI.

-5858

Then, 2 μΐ of alkaline phosphatase (Takara Shuzo Co. _f Ltd.) was added and the reaction was carried out at 60 ° C for 1 hour.

By electrophoresis, a DNA fragment (about 2.5 μς) of about 2.6 kb long was extracted from the 1% agarose / gel reaction solution.

(ii) Obtaining a synthetic binder

Oiigonucleotides having arrays of synthetic binders

The CGCGAATGACCCCCCTGGGCC and CAGGGGGGTCATTCG were phospholyzed and tempered as described in (ii) in Example 12 to provide a synthetic binder.

(iii) Retrieval of the recombinant vector

About 1 μφ of the vector fragment obtained in (I), about 1 pg of the synthetic binder obtained in (ii), and about 1 μς of the G-CSF fragment obtained in (iii) in Example 12 reacted with 175 units of T ₄ DNA ligase overnight at 12 ° C in 20 μΐ of the binding solution having the composition described in Example 12, 1) (iv) to obtain a recombinant vector (Figure 10).

2) Transformation

Twenty microlitres of the reaction mixture obtained in (iii) was used to transform E.coli DH1 in a process involving rubidium chloride and was described in Molecular Cloning, same.

As in Example 12, the plasmid was eliminated from the ampicillin-resistant transformant colonies, and treatment of this piazmid with the restriction enzymes Apal, Dral, Nrul, and Pstl indicated that the desired transformants were obtained.

-5959

Example 15: Cultivation of transformants

1) Cultivation of the transformants (s tac) obtained in Example 12 The transformants were cultured overnight at 37 ° C, 1 ml of culture was then added to 100 ml of Luria medium containing 25 pg / ml and 50 pg / ml ampicillin. The cultivation was carried out for 2-3 hours at 37 ° C. Cultivation was then resumed at 37 ° C for 2-4 hours after the addition of isopropyl-β-D-thiogalactose to produce a final concentration of 2 mM.

2) Cultivation of transformants (with P _L ) obtained in Example 13 Transformants were cultured overnight at 28 ° C. Subsequently, 100 ml of Luria medium containing 25 or 50 pg of ampicillin was added to 1 ml of culture. Cultivation was carried out at about 4C for about 4 hours. Cultivation was continued for 2-4 hours at 42 ° C.

3) Cultivation of the transformants (with trp) obtained in Example 14 The transformants were cultured overnight at 37 ° C, followed by the addition of 100 ml of M9 medium containing 0.5% glucose, 0.5% Casamino acids (Difco; mild and 25 or 50 pg / ml ampicillin. Cultivation was performed for 4-6 hours at 37 ° C. After addition of 50 pg / ml 3-p-indolacrylic acid (IAA), the cultivation was continued for 4-8 hours at 37 ° C.

Example 16: Separation and Purification of G-CSF Polypeptides from £ .coli

1) Separation

The three types of transformants cultured in Example 15 were subjected to the following separation procedures.

The culture (100 ml) was centrifuged to give a cell tablet, which was then suspended in 5 ml of a mixture of 20 mM Tris-HCl (pH 7.5) and 30 mM NaCI.

-6060

Then 0.2 M phenylmethylsulfonyl fluoride, 0.2 M EDTA and lysozyme were added at appropriate concentrations of 1 mM, mM and 0.2 mg / ml, and then the suspension was left at 0 ° C for 30 minutes. Cells were lysed with help for three freeze / thaw cycles. The lysate was then centrifuged to give a supernatant. Alternatively, the lysate can be treated with 8 M guanidine hydrochloride so that its final concentration is 6 M guanidine hydrochloride and then centrifuged at 30,000 rpm for 5 hours after which the supernatant is eliminated.

2) Purification (i) The supernatant obtained vi) is gel filtered on an Ultrogel AcA54 column (4.6 cm x 90 cm in length) at a flow rate of about 50 ml / hour with 0.01 M Tris-HCI buffer (pH 7.4) containing 0.15 M NaCI and 0.01% Tween 20 (Nakar Kagaku Co., Ltd.). Fractions that showed activity in the CSA assay (b) (described previously in this specification) were selected and concentrated to a volume of about 5 ml with the pM-10 ultrafiltration device (Amicon).

(ii) To the concentrated fractions was added n-propanol (with a purity favorable for the amino acid test; Tokyo Kasei Co., Ltd.) and trifluoroacetic acid. The mixture was treated so that the final concentrations of the two constituents were 30% and 0.1%, respectively. The treated mixture was left in ice for about 15 minutes and then centrifuged at 15,000 rpm for 10 minutes to separate the precipitate. The supernatant was adsorbed on a u-Bondpak C18 column (semi-prep quality; Waters; 8 mm x 30 cm), which was balanced with an aqueous solution containing n-propanol (see below) and trifluoroacetic acid. The column was continuously eluted with an aqueous solution of 0.1% trifluoroacetic acid containing n-propanol with a linear density gradient of 30-60%. With the Hitachi Model 685-50 (HPLC

The -6161 apparatus of Hitachi, Ltd.) and the Hitachi Model · 638-41 (Hitachi detectors, Ltd.) used were also simultaneously measured adsorption at 220 nm and 280 nm. After elution, 10 μΐ aliquots of each fraction were diluted 100 times, and the solutions were tested for active fractions using the CSA blotting method (b). Activity was observed on peaks eluted with 40% n-propanol. These peaks were combined and re-chromatographed under the same conditions as above, and fractions were examined for their activity by method (b). Activity was again found in peaks for 40% n-propanol. These active peaks were collected (4 fractions = 4 mi) and freeze-dried.

(iii) The dry frozen powder was dissolved in 200 μΐ of an aqueous solution of 0.1% trifluoroacetic acid containing 40% npropanol. The solution was then subjected to HPLC on a TSK-G3000SW column (7.5 mm x 60 cm; Tokyo Soda Manufacturing Co., Ltd.). The elution was performed at a flow rate of 0.4 ml / min with an aqueous solution of 0.1% trifluoroacetic acid containing 40% n-propanol. 0.4 ml fractions were collected with a fraction collector, FRAC-100 (Pharmacia Fine Chemicals). These were then examined for CSA as described below and the extracted fractions were eliminated. These were further purified on a μ-Bondpak C18 column (4.6 mm x 30 cm) and the main peak was removed, which was then freeze-dried.

The protein thus obtained was treated with 2-mercaptoethanol and then subjected to SDS polyacrylgel (15%) electrophoresis (15 mV, 6 h). After staining with Coomassie Blue, the desired G-CSF polypeptide was identified as a single strand.

Example 17: Investigating G-CSF Activities (+ ALL)

The CSF sample obtained in Example 16 was examined according to the CSF test method (a) described previously in this specification. The results are shown in Table 1 below:

-6262

TABLE 1

Human neutrophil colonies (colonies per container) Purified Human G-CSF (20 ng) 73 CSF pattern obtained in Example 15 (50 ng) 68 Control 0

Example 18: Analysis of amino acids (+ ALL)

1) Analysis of amino acid composition

The CSF purified in Example 16 was hydrolyzed by routine procedures. The amino acid composition of the protein portion of the hydrolyzate was analyzed by the amino acid analysis method with an automatic amino acid analyzer, Hitachi 835 (Hitachi Ltd.). The results are shown in Table 2. The hydrolysis was carried out under the following conditions:

(i) 6 N Hcl, 110 ° C, 24 h in vacuo (ii) 4 N methanesulfonic acid + 0.2% 3- (2-aminomethyl) indole, 110 ° C, 24 h, 48 h, 72 h, in vacuo

The sample was dissolved in a solution (1.5 ml) containing 40% n-propanol and 0.1% trifluoroacetic acid. Aliquots of each mass of 0.1 ml were dried with dry gaseous nitrogen and, after the addition of the reagents listed in (i) or (ii), the vessels were submerged in vacuum and hydrolyzed.

Each of the values shown in Table 2 is the mean of 4 measurements, the value for 24 hours (i) and the value for 24.48 and 72 hours (ii), except that the contents of Thr, Ser, l / 2Cys,

Meth, Val, Ile and Trp calculated by the following methods (see

-6363

Tampaku Kagaku (Protein Chemsitry) II Course in Biochemical Ezperiments, Tokyo Kagaku Dohjiin);

For Thr, Ser, l / 2Cys, and Met, the time dependence of the profile at 24, 48, and 72 hours for (il) was extrapolated from 0 hours.

For Val and Ile, a 72 hour value for (ii) was used.

For Trp, the mean of 24, 48, 72 hours from (ii) was used.

Table 2:

Amino acid analysis data

Amino acid Mol%

Asp (Asp + Asn) 2.3 Thr 4.0 Ser 8.5 Glu (Glu + Gln) 15.2 Pro 7.3 Gly 7.9 Ala 10.7 1/2 Cys 2.8 Val 4.5 Met 2.0 Ile 2.3 Leu 18.3 Tyr 1.7 Phe 3.4 Lys 2.3 His 2.8 Trp 1.1 Arg 2.9

-6464

2) Analysis of N-terminal amino acids

The sample was subjected to Edman decomposition by a gas-phase array tester (Applied Biosystems), after which the obtained PTH amino acid was analyzed by routine procedures using an HPLC device (Beckman Instruments) and an Ultrasphere-ODS column (Beckman Instruments). Thereafter, the column (5 pm; 4.6 mm in diameter and 250 mm in length) was equilibrated with initial buffer (aqueous solution containing 15 mM sodium acetate buffer (pH 4.5) and 40% acetonitrile). A sample (dissolved in 20 µl of initial buffer) was inserted and a single elution was performed with initial buffer. During this operation, the flow was kept constant at 1.4 ml / min and the column temperature was kept at 40 ° C. PTH amino acid detection was performed using absorption in the ultraviolet band at 269 nm and 320 nm. Standard samples (rolls of 2 nmol weight) of PTH amino acids (Sigma) were separated on the same line to determine their retention times, which were compared with those for the sample to identify N-terminal amino acids. PTH-methionine and PTH-threonine were thus detected.

Example 19: Construction of E.coli recombinant vector (-ALL) and transformations a

1) Using a tac promoter containing a vector

The procedures of Example 12 were repeated except that the pBRG4 obtained in Example 9 containing the cDNA was shown in Figure 3 (A) / see (iii) in Example 12 / was frozen with pBRV2 obtained in Example 10 contains the cDNA shown in Figure 4 (A). As in Example 12, the transformants obtained were confirmed as desirable (Figure 11).

2) Using a PL promoter containing a vector

-6565

The procedures of Example 13 were repeated using cDNA (-ALL), and the transformants obtained were confirmed as desired (Figure 12).

3) Use of trp promoter containing vector

The procedures of Example 14 were repeated using cDNA (ALL) and the transformants obtained were confirmed as desired (Figure 13).

Example 20: Investigating G-CSF Activities (-ALL)

The three types of transformants obtained in Example 19 were cultured using the method described in Example 15. From the cultured E. coli, G-CSF polypeptides were extracted and purified by the method described in Example 16, so that the human GCSF polypeptide was obtained as a single strand .

The CSF pattern thus obtained was investigated by the method of investigation of CSF activity (a) described previously in this specification. The results are shown in Table 3.

Table 3:

Human neutrophil colonies (colonies per container) Purified human G-CSF (20 ng) 73 CSF pattern obtained in Example 19 (50 ng) 73 Control 0

Example 21: Analysis of amino acids (-ALL)

1) Analysis of amino acid composition

The amino acid composition of the CSF sample of the purified sample in Example 20 was analyzed by the method described in vi) in Example 18. The results are shown in Table 4.

-6666

Table 4:

Amino acids Mol%

Asp (Asp + Asn) 2.3 Thr 4.0 Ser 8.1 Glu (Glu + Gln) 15.0 Pro 7.5 Gly 8.1 Ala 11.0 1/2 Cys 2.9 Val 4.1 Met 2.0 Ile 2.2 Leu 18.8 Tyr 1.7 Phe 3.4 Lys 2.3 His 2.7 Trp 1.1 Arg 2.8

2) Analysis of N-terminal amino acids

The sample was subjected to the analysis of N-terminal amino acids by the method described in 2) in Example 18. PTH-methionine and PTH-threonine were thus detected.

Example 22: Obtaining a pHGA410 Vector (for use with animal cells + ALL lines)

The EcoRI fragment obtained in Example 9, whose cDNA is shown in Figure 3 (A), was treated with the Dral restriction enzyme at

-6767

37 ° C for 2 hours, followed by a Klenow DNA polymerase I fragment (Takara Shuzo Co., Ltd.) so that open ends were built. One microgram of Bglll binder (8raer, Takara Shuzo Co., Ltd.) was phosphorylated by ATP and attached to 1 gg of a specially obtained mixture of DNA fragments. The attached fragments were treated with Bglll restriction enzyme and then subjected to agarose gel electrophoresis. Then only the largest DNA fragment was extracted.

This DNA fragment was equivalent to about 710 base pairs containing the human G-CSF coding polypeptide (see Figure 6). Vector pdKCR / Fukunga et al ·, Proc. Natl. Acad. Sci., Usa, 81, 5086 (1984) / was treated with Barall restriction enzyme and then dephosphorylated with alkaline phosphatase (Takara Shuzo Co., Ltd.). DNA vector obtained by attachment to a 710 bp cDNA fragment in the presence of T ₄ DNA iigase (Takara Shuzo Co., Ltd.) to obtain pHGA410 (Figure 14). As shown in Fig. 14, this plasmid promoter of the SV40 precursor gene, replication of the SV40 starter replicate, part of the rabbit β-globin gene, replication of the initiation region pBR322 and pBR322 derived β-lactamase gene (Amp ^r ), with the human gene attached under the SV40 promoter of the previous gene.

Example 23: Construction of a recombinant vector (+ ALL) for use in the C 127 cell transformation

1) Construction of pHGA410 (H)

Twenty micrograms of the pGA plasmid pHGA410 (Figure 14) obtained in Example 22 were dissolved in a reaction solution consisting of 50 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ , 100 mM naCl, 7 mM 2mercaptoethanol and 0.01% bovine albumin serum (BSA) . The EcoRI restriction enzyme (10-15 units; Takara Shuzo Co., Ltd.) was also added and the reaction solution was kept at 37 ° C for 30 minutes due to partial degradation with EcoRI. Thereafter, the DNA fragment was subjected to two treatments with a 1: 1 mixture

-6868 phenol / chloroform, one treatment with ether and ethanol precipitation.

The resulting DNA fragment was dissolved in 50 μΐ solutions consisting of 50 mM Tris-HCl, 5 mM MgCl ₂ , 10 mM DTT and one mM dATP, dCTP, dGTP and d TTP each. Then, 5 μΐ of the Klenow fragment of E.coli DNA polymerase (Takara Shuzo Co., Ltd.) was added and the solution was incubated at 14 ° C for 2 hours, so that open ends were built.

Subsequently, 6 gg of DNA fragment about 5.8 kbp in length was isolated by 0.8% agarose gel electrophoresis.

Five micrograms of the isolated DNA fragment was dissolved in 50 μΐ of a reaction mixture consisting of 50 mM Tris-HCl ipH 7.6), 10 mM MgCl ₂ , 10 mM DTT and 1 mM ATP. After the addition of 2 gg Hindlll binder (Takara Shuzo Co., Ltd.), the reaction was allowed to proceed overnight at 4 ° C.

Further, phenol and ether treatments and ethanol precipitation were performed. The precipitate was dissolved in 30 μΐ of a solution composed of 10 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ and 60 mM NaCI. The solution was then incubated for 3 hours at 37 ° C in the presence of 10 HindIII units. After re-treatment with T ₄ DNA ligase, the resulting DNA was used to transform E.coli DHl in a process involving rubidium chloride (see Molecular Cloning, same). From ampicillin-resistant (Amp ^r ), a colony of transformed cells was grown that harbored a pHGA410-identical plasmid except that HindIII was positioned at the EcoRI site. The plasmid thus obtained was named pHGA410 (H) (Figure 15).

2) Construction of the recombinant pTN-G4 expression vector

Twenty micrograms of the obtained pHGA410 (H) was dissolved in 50 μΐ reaction solution consisting of 10 mM Tris-HCl (pH 7.5), 7 mM MgCi ₂ , 175 mM NaCI, 0.2 mM

-6969

EDTA, 7 mM 2-mercaptoethanol and 0.01% bovine serum albumin.

After the addition of 20 units of Shali (Takara Shuzo Co., Ltd.), the reaction mixture was incubated at 37 ° C for 5 hours. After treatment with phenol and ethanol precipitation, incubation was performed as you did) for 14 hours at 14 ° C in the presence of Klenov / DNA polymerase fragment (Takara Shuzo Co., Ltd.) by building open ends. Without first separating the DNA by agarose gel electrophoresis, the reaction mixture was immediately subjected to ethanol precipitation. The resulting DNA fragment was treated with HindIII and 5 gg of HindIII-Sall fragment (about 2.7 kbp) was recovered by 1% agarose gel electrophoresis. In a particular step, the plasmid was pdBPV-1, which has bovine papillomavirus (BPV) / this plasmid was obtained thanks to Dr. Howley and was described in Sarvewr, N, Sbyrne, JC & Howley, PM, Away. Nati. Acad. Sci., USA, 79, 7147-7151 (1982) / treated with Hindlll and Pvul, as described by Nagata et al./Fukunga, Sokawa and Nagata, Proc. Nati. Acad. Sci., USA, 81, 5086-5090 (1984), yielding an 8.4 kb DNA fragment. This 8.4 kb DNA fragment and a particularly separate HindIII-Sall DNA fragment (about 2.7 kb) is linked to T ₄ DNA ligase. The coupling product was used to transform E.coli type DH1 by a process involving rubidium chloride and was described in Molecular Cloning, same. E. coli colonies culturing a plasmid having a pHGA410-derived G-CSF cDNA were separated. This plasmid was named pTN-G4 (Figure 15).

Type II Adenovirus / Tanpakushitsu, Kakusan, Koso (Proteins, Nucleic acids and Encymes), 27, December, 1982, Kyoritsu Shuppan / was treated similarly to obtain a plasmid, pVA containing about 1700-bp Sall -Hindlll fragment. VAI and VAH and a fragment containing VAI and VAII were extracted from this plasmid. This fragment was placed in pTNG4 at the Hindlll site so that pTNGSVAa and pTNG4VAp were obtained (Fig. 15). This makes the VAN the adenovirus gene of these

-7070 plasmids able to show expression of transcription product from an older SV40 promoter.

Example 24; C127 Cell Transformation and G-CSF Expression (+ ALL)

Before it was used to transform C127 cells, pTN-G4 obtained in Example 23 was treated with the BamHI restriction enzyme. Twenty micrograms of plasmid pTN-G4 were dissolved in 100 μΐ of the reaction solution / 10 mM Tris-HCl (pH 8), 7 mM MgCl ₂ , 100 mM NaCl, 2 mM 2-mercaptoethanol and 0.01% BSA / were treated with 20 units of BamHI (Takara Shuzo Co., Ltd.), then treated with phenol and ether and precipitated with ethanol.

C127 mouse cells cultured in Dulbec's minimum basic environment containing 10% bovine embryo serum (Gibco). C127 cells cultured on a 5 cm diameter tray were transformed with 10 μg per tray of specially obtained DNA in the calcium phosphate process / see Haynes, J. & Weissman C., Nucleic Acids res., 11, 687-706 (1983) / . After glycerol treatment, the cells were incubated at 37 ° C for 12 hours.

The incubated cells were transformed on three fresh 5 cm trays, and the environment was changed twice weekly. 1 (FOKE days were transferred to fresh trays and batch cultured on Dulbec's minimum basic medium containing 10% bovine embryo serum (Gibco) so that clones with high G-CSF production rate were separated. the clones produced about 1 mg / l of G-CSF, and further cloning produced an increase in clones capable of producing G-CSF at 10 mg / l or more, as an additive in C127 cells, NIH3T3 could also be used as host cells.

-7171

Example 25: Expression of G-CSF in CHO Cells (+ ALL)

1) Construction of pHGG4-dhfr

Twenty micrograms of the pHGA410 pla2mid obtained in Example 22 were dissolved in 100 μΐ of a reaction mixture containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ , 175 mM NaCI, 0.2 mM EDTA, 0.7 mM 2-mercaptoethanol and 0.01 % BSA. The reaction was carried out overnight at 37 ° C in the presence of 20 units of the Shali restriction enzyme (Takara Shuzo Co., Ltd.) and then treated with phenol and ether tel precipitation with ethanol.

The DNA precipitate was dissolved in 100 μΐ reaction mixture consisting of 50 mM Tris-HCl, 5 mM MgCl ₂ , 10 mM DTT and 1 mM dATP, dCTP, dGTP and dTTP each. The reaction was carried out at 14 ° C for 2 hours in the presence of Klenow fragment and E.coli DNA polymerase (10 μΐ; Takara Shuzo Co., Ltd.), and then the solution was further treated with phenol and ether and further precipitated with ethanol.

The EcoRI binder was attached to the DNA in the precipitate in the following procedures:

DNA dissolved in 50 μΐ reaction solution consisting of 50 mM Tris-HCl (pH 7.4), 10 mM DTT, 0.5 mM spermidine, 2 mM ATP, 2 mM hexamine-cobalt chloride and 20 ng / ml BSA. The reaction was carried out at 4 ° C for 12-16 hours in the presence of an EcoRI binder (Takara Shuzo Co., Ltd.) and 200 units of T ₄ DNA ligase (Takara Shuzo Co., Ltd.). After treatment with phenol, washing with ether and ethanol precipitation, everything was done according to routine procedures. The DNA precipitate was partially digested with EcoRI, and agarose gel electrophoresis extracted a 3ng DNA fragment of about 2.7 kbp in length.

Plasmid pAdD26SVpA / Kaufman, R.G. & Sharp, P.A., Mol. Whole Biol., 2, 1304-1319 (1982) / was treated with bacterial alkaline phosphatase (BAP). Specifically, 20 ng of pAdD26SVpA and 20 units of EcoRI were added to the reaction solution / 50 mM Tris-HCl

-7272 (ρΗ 7.5), 7 mM MgCl ₂ , 100 mM NaCl, 7 mM 2-mercaptoethanol and 0.01% BSA /. The reaction was carried out at 37 ° C for 10 hours. Then 5 BAP units were added to the reaction mixture and the reaction was carried out at 68 ° C for 30 minutes. After treatment with phenol, the EcoRI fragment of pdD26SVpA was separated by electrophoresis in a contribution of about 5 pg.

Fragmernt lengths of about 2.7 kbp and pAdD26SVpA, each of 0.5 μς mass, were quenched. The resulting plasmid was used to transform E.coli DH1 in the rubidium chloride process, and the plasmid culture colonies of pHGG4-dhfr were separated. The resulting plasmid was named pHGG4-dhfr (Fig. 16a).

An alternative procedure is as follows: Plasmid pHGA 410 is treated with Scarf and partially degraded with RcoRI without the addition of an EcoRI binder. A DNA fragment of about 2.7 kbp in length is extracted and treated with the Klenov fragment of the E.coli DNA polymerase to create open ends. An EcoRI fragment having open ends is obtained from pAdD26SVpA in the manner described below. The TA EcoRI fragment and the specially prepared fragment (about 2.7 kbp) is treated with T ₄ DNA ligase to give pHGG4-dhfr.

The pHGA410 (H) obtained in Example 23 is treated with the Hindlll and Shali restriction enzymes as described in 2), Example 23. The Hindlll-Sall fragment is attached to the open end of the EcoRI fragment as described below. This method can also be used to obtain pHGG4-dhfr (Figure 16b).

2) Construction of pG4DRI and pG4DR2

Ten micrograms of the pAdD26SVpA plasmid mentioned in 1) were dissolved in 50 ml of a reaction solution containing 50 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ , 100 mM NaCl, 7 mM 2mercaptoethanol and 0.01% BSA. After the addition of 10 units of each of the EcoRI and BamHI restriction enzymes, the reaction was carried out at 37 ° C for 10 hours, followed by treatment.

-7373 continued with phenol and washing with ether. A DNA fragment of about 2 kbp in length was isolated by electrophoresis via a 1% low melting point agarose gel. The isolated DNA fragment was treated with the Klenow DNA polymerase fragment in routine procedures so that open ends were constructed. The open-ended DNA fragment was then treated with phenol, washed with ether and stained with ethanol.

Ten micrograms of the pHGA410 (H) plasmid obtained in 1), Example 23, were dissolved in 50 μΐ reaction mixture containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ and 60 mM NaCl. The reaction was carried out for 6 hours at 37 ° C in the presence of 10 units of HindIII. The DNA fragment was isolated by electrophoresis from 1% low melting point agarose gel by routine procedures. The isolated DNA fragment was then treated with BAP and open ends were created by treatment with the Klenow fragment. Then fraagment, after treatment with phenol and washing with ether, are attached to the open end of the previously obtained 2-kb DNA fragment with T ₄ DNA ligase according to the above procedure: after 1 gg of each DNA fragment was dissolved in 30 μΐ reaction solution, containing 66 mM Tris-HCl {pH 7.5), 6.6 mM MgCl _z , 5 mM DTT, and 1 mM ATP. The reaction was carried out at 6 ° C for 12 hours and the presence of T ₄ DNA iigase. The coupling product was tested for transformation of E. coli type DH1. The pG4DRl and pGADR2 shown in Figure 16c were thus obtained.

3) Transformation and expression

CHO cells (dhfr species; courtesy of Dr. L. Chasin of Columbia University) were cultured for breeding on an alpha-minimum base containing 10% bovine serum (α-MEN supplemented with adenosine, deoxyadenosine and thymidine) on a 9 cm (Nune) tray. The cultured cells were transformed in a process that

-7474 also uses calcium phosphate / Wigler et al., Celi, 14, 725 (1987) i as follows.

The DNA carrier (calf DNA thymus) is added in an appropriate amount in 1 pg of plasmid pHGG4-dhfr obtained in 1), and the mixture is then dissolved in 375 μΐ TE solution, which is further monitored by the addition of 125 μΐ 1 M CaCl _2- Solution. it was cooled on ice for 3-5 minutes and then 500 μΐ 2 x HBS (50 mM Hepes, 280 mM NaCI and 1.5 mM phosphate buffer) were added. After re-cooling on ice, the solution was mixed with 1 ml of CHO cell culture transferred to trays and incubated for 9 hours in a C0 ₂ incubator. The environment was then removed from the tray and washed with TBS (Tris buffered saline). This was followed by the addition of 20% TBS-containing glycerol, after which the environment was washed again, and then a non-selective environment was added (α-MEN environment described above without nucleotide supplementation), After the second day of incubation, 10 times diluted culture was transferred to selective environment (not supplemented with nucleotides). Cultivation was continued by replacing the environment with a new selective medium every 2 days, and the resulting colonies were selected and transferred to fresh trays where cells were grown in the presence of 0.02 μΜ methotrexate (ΜΤΧ), which was monitored by cloning via growth in the presence of 0.05 μΜ ΜΤΧ, which was then further increased to 0.1 μΜ ΜΤΧ.

Transformation of CHO cells can also be accomplished by counter-transformation with pHGG4 and pAdD26SVpA / see Scahill et al., Et al. Nati. Acad. Sci., USA, 80, 4654-4658 (1983) /.

CHO cells were also transformed by the following procedures: pG4DR1 or pG4DR2, obtained in 2) were pretreated respectively with Shali and KpnI to obtain DNA fragments, and 10 pg of these fragments were used to transform CHO cells further; transformed cells were subjected to continuous cultivation in series

-7575 selective environments as described above; about 7 days later, no fewer than 100 separate colonies appeared on each tray; these colonies were transferred in mass to a fresh tray where they were further cultured in a series of selective media in the presence of 0.01 mM ΜΤΧ until 10 odd colonies appeared; the same procedures were repeated with oko concentrations of about 0.02, 0.05 and 0.1 μΜ, and the surviving colonies were selected; colony selection can be done in a similar way even when the 10 odd colonies obtained are subjected to cultivation with increasing ΜΤΧ concentrations. The recombinant vector that harbors the polycistronic gene ”can also be used to transform CHO cells. The following is an example of this alternative method: pAdD26SVpA is treated with Pst1, and then two fragments are isolated that attach to the pBRG4-derived CSF cDNA fragment by constructing a recombinant vector, where the adeno virus is a promoter, CSF cDNA, DHFR and poly (A ) instead of SV40 installed in the written order. This recombinant vector is used to transform CHO cells.

Example 26: Investigating G-CSF Activities (+ ALL)

Supernatants of C127 and CHO cell cultures obtained in Examples 24 and 25 were subjected to appropriate pH = 4 with IM acetic acid. After the addition of an equal volume of n-propanol, the resulting precipitate was removed by centrifugation.

The supernatant was passed through an open column (1 cm in diameter and 2 cm in length) filled with a C8 reverse phase carrier (Yamamura Kagaku K.K.), and elution was performed with 50% propanol. The eluate was diluted twice with water, then subjected to reverse phase HPLC on a YMC-C8 column (Yamamura Kagaku KK) and then eluted with n-propanol (3060% linear density gradient) containing 0.1% TFA. . Fractions eluted with n-propanol at a concentration of about 40% were isolated, freeze dried and dissolved in 0.1 M glycine

-7676 buffer (pH 9). As a result of these procedures, human G-CSF was concentrated about 20-fold in C127 and CHO cells.

As a control, cells were transformed with human G-CSF cDNA-free plasmids, and the supernatants of their cultures were concentrated according to the procedures described below. The activities of the human G-CSF sample were investigated using the method of human G-CSF activity assay (a) described earlier in this specification.

If the efficiency is high enough, the culture supernatants can be directly investigated without prior concentration. The results are given in Table 5, where the data are based on concentration samples.

Table 5: Investigations of human G-CSF activity

Human neutrophil colonies (colonies per serving) Purified human G-CSF (20 ng) 96 Culture of C127 cells transformed with pdBPV-1 (concentrated 20x) 0 BPV Culture of 3T3 cells transformed with pdBV-1 (concentrated 20x) 0 C127 cell culture, transformed with pTNG-4 (concentrated 20x) 82 Culture of 3T3 cells transformed with pTNG-4 85

-7777

Culture of CHO cells transformed with pAdD26SVpA (concentrated 20x) 0 CHO culture cells transformed dhf r with pHGG4-dhfr (20x concentration) 110 CHO culture cells transformed with pG4DRl (20 short concentration) 105

Example 27; Analysis of amino acids and sugar (+ ALL)

1) Analysis of amino acid composition

The crude CSF sample obtained in Example 26 was purified by the procedures described in Example (iii). The purified CSF sample was hydrolyzed by routine procedures, and the hydrolyzate part protein was tested for amino acid composition using a specific amino acid analysis method using a Hitachi 835 automatic amino acid analyzer (manufactured by Hitachi, Ltd.). The results are shown in Table 6. The hydrolysis was performed under the following conditions:

(I) & N Hcl, 110 ° C, 24 h in vacuo (ii) 4 N methanesulfonic acid + 0.2% 3- (2-aminoethyl) indole ·, 110 ° C, 24 h, 48 h, 12 h, in vacuo .

The sample was dissolved in a solution (1.5 ml) containing 40% n-propanol and 0.1% trifluoroacetic acid. Aliquots of the solution, 0.1 ml each, were dried with dry gaseous nitrogen after the addition of the reagents listed in (i) or (ii), and the solution containers were sealed in vacuo, which was followed by hydrolysis of the contents.

Each of the values shown in Table 6 is the mean of 4 measurements, 24 values for (i) and 24, 48 and 72 hours

-7878 for (ii), except that they contain Thr, Ser, 1/2 Cys, Met, Val, Ile and Trp, were calculated according to the following procedure (see Tampaku Kagaku: Protein Chemistry Ii; A course in Biochemical Experiment, Tokyo Kagaku Dohjin);

For Thr, Ser, 1/2 Cys, Met, the time dependence of the profile is 24, and the 72 h values on (ii) are extrapolated to 0 h.

For Val and Ile, a 72 hour value for (ii) was used.

The mean of 24, 48, 72 hourly values for (ii) was used for Trp.

Table 6: Amino acid analysis data

Amino acids Mol%

Asp (Asp + Asn) 2.3 Thr 3.9 Ser 8.5 Glu (Glu + Gln) 15.3 Pro 7.4 Gly 7.8 Ala 10.8 1/2 Cys 2.8

Val

4.5

Met

Ile

1.7

2.3

Leu

18.6

Tyr

Phe

1.7

3.4

Lys

His

2.3

2.8

Trp

Arg

1.1

2.8

-7979

2) Sugar content analysis

200 ng of purified CSF sample used for analysis of amino acid composition was added to the internal standard (25 nmol inositol). After the addition of a solution of methanol (pl) containing 1.5 N Hcl, the reaction was carried out at 90 ° C for 4 hours in purified N ₂ in a sealed tube. The tube was then opened and silver carbonate (Ag ₂ CO ₃ ) was added to neutralize the contents. Then 50 µl of acetanhydride was added and the tube was shaken for some time. The tube was then left overnight at room temperature. The top layer was placed in a sample tube and dried with gaseous nitrogen. Methanol was added to the precipitate and the mixture was then washed and centrifuged in light. The top layer was placed in the same sample tube and dried. After the addition of 50 µl of TMS reagent (5: 1: 1 mixture of pyridine, hexamethyl disilysane and trimethylchlorolysilane), the reaction was carried out at 40 ° C for 2 minutes and the reaction product was placed in a freezer for deep freezing. The standard was obtained by combining 25 nmol inositol with 50 nmol galactose (Gal), N-acetyl galactosamine (Gal Nac), sialic acid and some other suitable reagent.

The samples thus obtained were subjected to gas analysis under the following conditions:

Column:

Temperature:

Conditions of analysis

2% OV-17 VINport HP, 0.25-0.18 mm, 3 m, glass raised from 110 ° C to 250 ° C at 4 ° C / min.

Carrier gas (N ₂ ) pressure: initial 0.12-0.16 Pa

Sensitivity: Pressure:

Sample Final 0.2-0.25 Pa

10 ³ M range, 0.1-0.4 Volts H ₂ , 0.08 Pa air, 0.08 Pa

2.5-3.0 pl

-8080

Thus, in the CSF sample of the present invention, gaiactosome N-acetyl galactosamine and sialic acid were identified.

Example 28: Obtaining a pHGV2 Vector (for use with animal cells, - ALL line)

The EcoRI fragment obtained in Example 10 having the cDNA shown in Figure 4 (A) was treated with the Dral restriction enzyme for 2 hours at 37 ° C followed by the Klenow DNA polymerase fragment I (Takara Shuzo Co., Ltd .) so that open ends were built. The EN microgram of the Bglll binder (8mer; Takara Shuzo Co., Ltd.) was phosphorylated by ATP and attached to about 1 pg of a specially obtained mixture of DNA fragments. The attached fragments were treated with the Bglll restriction enzyme and then subjected to agarose gel electrophoresis. Subsequently, only the largest DNA fragment was isolated.

This DNA fragment was equivalent to about 700 bp containing the coding portion of human G-CSF. Vector pdKCR / Fukunaga et al.,

Away. Natl, Acad. Sci., USA 81, 5086 (1984) / was treated with the MaMHI restriction enzyme and then dephosphorylated with alkaline phosphatase (Takara Shuzo Co., Ltd.). The resulting DNA vector was attached to about 700 cDNA fragment in the presence of T ₄ DNA ligase (Takara Shuzo Co., Ltd.) to give pHGV2 (Figure 17). As shown in Figure 17, this plasmid contains the SV40 promoter of the precursor gene, replication of the start region of the SC40 moiety, β-globin of the rabbit gene, replication of the start region of pBR322 and pBR322-derived β-lactamase gene (Amp ^r ), with the human G-CSF gene fused under the promoter for the SV40 precursor gene.

-8181

Example 29: Construction of recombinant vector (-ALL) for use in transforming C127 cells

1) Construction of pHGV2 (H)

Twenty micrograms of the pHGV2 plasmid (Figure 17} obtained in Example 28 was treated by the procedure described in 1) in Example 23 by constructing a plasmid called pHGV2 (H) (Figure 18).

2) Construction of recombinant expression vectors pTN-V2, pTNVAa and pTNVAp.

Using 20 gg of pHGV2 (H), repeated procedures were described in 2) in Example 2 to select an E.coli cultured plasmid having a pHGV2-derived G-CSF cDNA. This plasmid was named pTN-V2 (Figure 18).

Adenovirus type II / Tampakushitsu, Kakusan Koso (Proteins, Nucleic Acids and Enzymes), 27, December, 1982, Kyoritsu Shuppan / were similarly treated to obtain a plasmid, ApVA containing about 1700 bp Sall-Hindlll moiety, which breeds VAI and VAH and a fragment containing VAI and VAII has been eliminated from this plasmid. This fragment was placed in pTN-2 at the HindlH site so that pTNVAa and pTNVAp were obtained (Fig. 18). Due to the VA gene of adenovirosis, this plasmid is able to amplify the transcription of the product from a previous SV40 promoter.

Example 30: Transformation of C127 Cells and G-CSF Expression into (-All) pTN-V2 obtained in Example 29 was treated with the BamHI restriction enzyme before being used to transform C127 mouse cells.

C127 mouse cells were transformed with the DNA thus obtained for expression of G-CSF (see Example 24), and clones were selected that possessed a high rate of G-CSF production. These clones produce G-CSF of about 1 mg / l.

-8282

By further cloning, clones capable of producing G-CSF of about 10 mg / l can be isolated. Similarly, C127 cells were transformed with pTNVAa and pTNVAp obtained in Example 29, and transformants were selected for clones having high G-CSF production capability; thus, clones with pTNVAa capable of producing G-CSF in a contribution of about 20 mg / l or more can be obtained, while clones with lower productivity (some mg / 1) are obtained with pTNVAp. In addition to C127 cells, NIH3T3 cells can also be used.

Example 31: Expression of G-CSP in CHO Cells (-ALL)

1) Construction of pHGV2-dhfr

A DNA fragment about 2.7 kbp in length was recovered from 20 gg of plasmid pHGV2 (Example 28) using the procedures described in 1) in Example 25. This fragment (0.5 gg) and the EcoRI fragment of pAdD26SVpA (0.5 gg) were CROSSED. The resulting plasmid was used to transform E.coli DH1 species in a process using rubidium chloride, and then colonies harboring a pHGV2-dhfr plasmid were selected. The resulting plasmid was named pHGV2-dhfr (Fig. 19a).

An alternative procedure is as follows: The pHGV2 plasmid is treated with a Scarf to partially degrade with EcoRI without attaching some EcoRI binder. A DNA fragment of about 2.7 kbp in length is flushed out and treated with the Klenow fragment of E.coli DNA polymerase so that open ends are constructed. The open ends of the EcoRI fragment are obtained from pAdD26SVpA, as described below. This EcoRI fragment and a separately prepared fragment (about 2.7 kbp in length) are treated with T ₄ DNA ligase to build pHGV2-dhfr. The pHGV2 (H) obtained in 1) in Example 29 was treated with the Hindlll and Sandll restriction enzyme as described in 2) in Example 29, and then the Hindlll-Sall fragment was attached to the open ends of the EcoRI fragment of pAdD26SVpA described above. This method can also be used to prepare pHGG4-dhfr (Figure 19b).

-8383

2) Construction of pV2DRl and pV2DR2

Ten micrograms of the plasmid pAdD26SVpA of said vi) were dissolved in 50 ml of a reaction solution containing 50 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ , 100 mM NaCl, 7 mM 2mercaptoethanol and 0.01% BSA. The reaction was carried out at 37 ° C for 10 hours in the presence of 10 units of each of the following enzymes: EcoRI and BamHI. Subsequently, phenol treatment and ether washing were performed, following routine procedures. A DNA fragment about 2 kbp in length was isolated by electrophoresis through a 1% low melting point agarose gel. The isolated DNA fragment was treated with the Klenov / DNA polymerase fragment by a routine procedure so that open ends were constructed. The open-ended DNA fragment was subjected to phenol treatment, ether washing, and ethanol precipitation.

Ten micrograms of plasmid pHGV2 (H) obtained in 1) in Example 29 were dissolved in 50 μΐ of a reaction solution containing 10 mM Tris-HCl (pH 7.5), 7 mM MgCl ₂ and 60 mM NaCI. The reaction was carried out at 37 ° C for 6 hours in the presence of 10 HindIII units. The DNA fragment was isolated by electrophoresis through a 1% low melting point agarose gel in routine procedures. The isolated fragment was then treated with BAP, and the open ends were upgraded in Klenov / fragment treatment. Through the treatment with the phenol and washing with ether, it was the DNA fragment attached to the open end of the previously obtained 2-kb DNA fragment with T ₄ DNA ligase in the following procedure: 1 gg of each fragment was dissolved in 30 gl reaction solution ej containing 66 mM Tris-HCl (pH 7.5), 6.6 mM MgCl ₂ , 5 mM DTT and 1 mM ATP. The reaction was carried out at 6 ° C for 6 hours in the presence of 50 units of T ₄ DNA ligase. The binding product was used to transform E.coli species> DH1. The pV2DRl and pV2DR2 shown in Figure 19c were thus obtained.

3) Transformation and expression

-8484

CHO cells were transformed with the plasmid pHGV2-dhfr to express G-CSF, using the procedures described in 3) in Example 25. Transformation of CHO cells can also be performed by counter-transformation with pHGV2 and pAdD26SVpA.

CHO cells were transformed by the following procedure: pV2DR1 or pV2DR2, which were obtained in 2), were previously respectively treated with Shali and KpmI, so that DNA fragments were obtained. 10 gg of these fragments were used to transform CHO cells as described below; transformed cells were subjected to continued cultivation in a series of selective media in the manner described below, and no fewer than 100 separate colonies appeared on the tray about 7 days later; these colonies were massively transferred to a fresh tray where they were subjected to continued cultivation in batches of selective media in the presence of 0.01 μΜ ΜΤΧ until 10 odd colonies appeared, and the same procedures were repeated with concentrations of ΜΤΧ that were serially increased to 0.02 μΜ , 0.05 μΜ and 0.1 μΜ. Then the surviving colonies were isolated. Colony selection can be done in the same way even if 10 odd colonies are obtained by individual selection and subjected to cultivation with increasing mTX concentrations.

The recombinant vector that harbors the polycistronic gene can also be used to transform CHO cells. An example of an alternative method is the following: pAdD26SVpA is treated with Pstl, and then two fragments are isolated that attach to the pBRV2-derived CSF cDNA fragment by constructing a recombinant vector where the virus is a promoter, CSF cDNA, DHFR, and poly (A) instead of SV40 installed in the order described. This recombinant vector is then used to transform CHO cells.

-8585

Example 32: Investigating G-CSF Activities (-ALL)

Using the procedures described in Example 26, human G-CSF obtained from the culture supernatant of C127 cells and CHO cells, respectively, obtained in Examples 30 and 31. The human G-CSF activity of each of the samples obtained was investigated following the example in Example 26. The results are shown in Table 7.

Table 7: Investigation of human G-CSF activity

Human neutrophil colonies (colonies per container)

Purified human G-CSF (20 ng) 96

C127 culture transformed with pdBPV-1 (20x concentrated) 0 BPV Culture of 3T3 cells transformed with pdBPV-1 (20x concentrated) 0 Culture of C127 cells transformed with pTN-V2 (concentrated 20x) 107 Culture of 3T3 cells transformed with pTN-V2 (concentrated 20x) 103 Culture of CHO cells transformed with pAdDSV26pA (20x concentrated) 0 dhf r Culture of CHO cells transformed with pHGV2-dhfr (concentrated 20x) no

-8686 dhf r

Culture of CHO cells transformed with pV2DRl (concentrated 20x)

113

Example 33: Analysis of amino acids and sugar (-ALL)

1) Analysis of amino acid composition

The crude CSF sample obtained in Example 32 was purified according to the procedures described in Example 2 (iii). The purified sample was then sent for analysis of the amino acid composition via the procedures described in 1) in Example 27. The results are shown in Table 8.

Table 8: Amino acid composition results:

Amino acids Mol%

Asp (Asp + Asn) 2.3 Thr 4.0 Ser 8.1 Glu (Glu + Gln) 15.1 Dec 7.5 Gly 8.0 Ala 10.9 1/2 Cys 2.8 Val 3.9 Met 1.7 Ile 2.3 Leu 18.9 Tyr 1.7 Phe 3.5 Lys 2.3 His 2.9 Trp 1.2 Arg 2.9

-8787

2) Analysis of sugar composition

The purified CSF sample used in the analysis of amino acid composition in 1) was also sent to a sugar content analysis using the same procedures and conditions as described in 2) in Example 27. In this way, the presence in the sample of the present invention was confirmed galactose, N-acetyl galactosamine and sialic acid.

Example 34: Construction of a recombinant vector containing a chromosomal gene for expression in COS cells

The plasmid pBRCE3p obtained in Example 11 containing the chromosomal gene shown in Figure 5 was treated with EcoRI. pSVH ⁺ K ⁺ plasmid obsd. by Banerji et al., and Celi, 27;

299 (1981) was treated with KpnI to remove the depth gene. The plasmid was then subjected to partial degradation with HindIII to remove a portion of the residual gene ONLY. The fragments were recombined to obtain the expression vector pML-E ⁺ .

This vector was treated with the EcoRI restriction enzyme and then dephosphorylated with alkaline phosphatase (Takara Shuzo Co.;

Ltd) so that a DNA vector was obtained that was anchored to the aforementioned chromosomal DNA by T ₄ DNA ligase (Takara Shu2o Co., Ltd) to give pMLCE3. As shown in Figure 20, this plasmid contains the ONLY gene enhancer, ONLY replica onset, pBR322 onset and pBR322 onset derived β-lactamase gene (Amp ^r ), and the human G-CSF chromosomal gene attached under the ONLY gene enhancer.

Example 35: Expression of the human G-CSF chromosomal gene in COS cells

COS-1 cells (courtesy of Dr. Giuzman of Cold Spring Harbor Laboratory, USA), which grew to a density of about 70% in Petri dishes (9 cm diameter, Nune) with

-8888 use of DMEM medium (Dulbec's modification of Eagle's environment purchased from Nissui Seiyak KK under the trade name Nissui ”) containing 10% calf serum were transformed in a process using calcium phosphate / Wigler et al., Whole , 14, 725 (1987) / or DEAE-dextran: the chlorichin method / see, e.g., Gordon et al., Science, 228, 810 (1985) /. Transformation in the calcium phosphate process was as follows: 160 gg of plasmid pMLCE3 obtained in Example 34 was dissolved in 320 gg TE solution, and after the addition of distilled water (3.2 ml) 504 g of 2 M CaCl ₂ was added.

An additional 4 ml of 2 x HBS (50 mM Hepes, 280 mM NaCl, 1.5 mM phosphate buffer pH 7.12) was added to the resulting solution and the mixture was cooled in ice for 20-30 minutes. The cooled mixture was added dropwise to the environment in an amount of 1 ml per Petri dish, where COS-1 cells were grown. After culturing at 37 ° C for 4 hours in a C0 ₂ incubator, the cells were washed with serum-free DMEM medium and then allowed to stand for about 3 minutes at room temperature in 5 ml of DMEM medium containing 20% glycerol. Finally, they were washed again with serum-free DMEM. After removal of the serum-free DMEM medium, another 10 ml of DMEM medium containing 10% calf serum was added, followed by overnight cultivation in a C0 ₂ incubator. The environment was then replaced with fresh environment of the same type and cultivation continued for another 3 days.

DEAE-Dextran: Chloroquine Transformation was performed as follows: As in the calcium phosphate process, COS-1 cells were cultured to grow to a density of 70% and then washed twice with DMEM media, which contains no serum; the washed cells were added serum-free DMEM medium containing 250 gg / ml DEAE-dextran and 2 gg / ml plasmid pMLCE3 obtained in Example 34. Cultivation was then carried out at 37 ° C for a duration.

-8989 hours; the cells were then washed twice with serum-free DMEM medium and then further cultured at 37 ° C for 2 hours in DMEM medium containing 10% calf serum and 1 mM chloroquine; the cells were then washed twice with serum-free DMEM medium and cultured at 37 ° C for three days in DMEM containing 10% calf serum,

The supernatant of the resulting COS-1 cell culture was adjusted to pH 4 with IN acetic acid. After lactation of the same volume of n-propanol, the resulting precipitate was removed by centrifugation. The supernatant was passed through an open column, 1 cm in diameter and 2 cm in length, which was filled with a C8 reverse phase carrier (Yamamura Kagaku K.K.), and elution was performed with 50% propanol. The eluate was then diluted twice with water, then subjected to reverse phase HPLC on a YMC-C8 column (Yamamura Kagaku K.K.) eluting with npropanol (30.60% linear density gradient) containing 0.1% TFA. Fractions eluted with n-propanol at concentrations of about 40% were isolated, freeze dried and dissolved in 0.1M glycid buffer (pH 9). As a result of this procedure, human G-CSF was concentrated about 20-fold in the supernatant of COS-1 cell culture.

As a control, COS-1 cells were transformed with the G-CSF chromosomal gene free pML-E ⁺ by the procedures described above. The supernatant of the resulting culture was then concentrated.

The human G-CSF activity of the samples obtained was investigated using the Human G-CSF Activity Assay (a) method described previously in this specification. The results are given in Table 9.

-9090

Table 9

Human neutrophil colonies (colonies per serving) Purified human G-CSF 18 Culture of COS cells transformed with pML-E ⁺ (concentrated 20x) 0 COS cell culture transformed with pMLCE3a (20x concentrated) 23 COS cell culture transformed with pMLCE3a (20x concentrated) 19

Example 36: RNA analysis of G-CSF (chromosomal gene)

COS cells cultured to a concentration of 8 χ 10 ⁶ cells per tray (9 cm in diameter) were transformed with 80 μς of pMLCE3a. After 48 hours, total RNA was obtained according to the Chirgwin procedure (Biochemistry, 18, 5294-5299 (1979)). The plasmid pBRG4 obtained in Example 9 was digested with the Ahalll restriction enzyme. The pBRG4-derived DNA fragment thus obtained was radiolabeled with / γ ³² -Ρ / ΑΤΡ using a T polynucleotide kinase so that a 2.8-kb fragment containing G-CSF cDNA was obtained. The fragment was isolated and digested as a DNA probe. After denaturing the DNA probe (1.5 x 10 ⁵ ppm, 2.8 x 106 ppm / pg DNA), this was mixed with 20 pg total RNA obtained from COS cells by hybridization for 15 hours. The mixture was decomposed 2 200-400 units / ml Sl nuclease (pL Biochemicals) according to the procedure of Weaver and Weissmann /

-9191

Nucleic Acid Res., 7, 1175-1193 (1979), which was accompanied by 4% polyacrylamide gel electrophoresis in the presence of 8.3 M urea. The detection was then performed using autoradiography.

A 722 bp cord was observed as a strongly radiolabeled line in COS cells, and a corresponding 487 bp cord was detected.

Therefore, the RNA of COS cells was found to contain G-CSF + ALL and-ALL lines.

Example 37: Amino acid analysis and sugar analysis (chromosomal gene)

The crude CSF sample obtained in Example 35 was purified according to the procedures described in Example 2 (iii). The purified CSF sample was subjected to amino acid composition analysis using the procedures described in 1) in Example 27. The results are described in Table 10.

Table 10: Amino acid analysis data:

Amino acids Mol% Asp (Asp + Asn) 2.3 Thr 4.9 Sir 8.3 Glu (Glu + Gln) 15.3 Pro 7.4 Gly 7.9 Ala 10.8 1/2 Cys 2.8 Val 4.3 Met 1.7 lle 2.3 Leu 18.7 Tyr 1.7 Phe 3.4 Lys 2.3

-9292

His

Trp

Arg

2.9

1.1

2.9

2) Analysis of sugar composition

The purified sample used in the analysis of amino acid composition in

1) was also subjected to an analysis of the sugar composition by the same procedures and the same conditions as described in 2) in Example 27. The KoT result of this analysis confirmed the presence of galactose, N-acetyl galactosamine and sialic acid in the CSF sample of the present invention .

Example 38: Expression of the human G-CSF chromosomal gene in C127 cells

The pMLCEa plasmid obtained in Example 24 was treated with EcoRI and then a fragment of about 4 kbp in length was isolated by the procedures described in Molecular Cloning. The isolated fragment was used as the origin of the chromosomal G-CSF gene.

The fragment was treated with the Klenow DNA polymerase I fragment so that open ends (A) were built.

The SV40 promoter (about 0.4 kb EcoRI-EcoRI fragment) was cut from plasmid pHGA410 (obtained in Example 22) using the procedures described in Molecular Cloning, and then treated with the Klenov / DNA polymerase fragment (B).

In a separate stage, the plasmid was pdBPV-1, which has bovine papillomavirus (BPV) / this plasmid was obtained thanks to the kindness of Dr. Howley and was described in Sarver N., Sbyrne, J.C. & Howley, P.M. Away. Natl. Acad. Sci., USA, 79, 7147-7151 (1982) / treated with HindIII and PvulI so that a DNA fragment of about 8 * 4 kbp in length was obtained. This fragment was then treated with the Klenov / DNA polymerase I fragment and then dephospholyzed with bacterial alkaline phosphatase (C).

-9393

DNA fragments (A), (B), (C), each weighing 0.1 pg, were dissolved in 20 pl of the reaction solution / 50 mM Tris-HCl (pH 7.6), 10 mM MgCl ₂ , 10 mM DTT, 1 mM ATP / then the reaction was performed overnight at 4 ° C in the presence of 180 units of T ₄ DNA ligase. The reaction solution was then treated with rubidium chloride in the procedure described in Molecular Cioning, the same, so that the plasmid pTNCE3a was obtained (Figure 21).

The DNA fragment (A) used as the origin of the chromosomal G-CSF gene can be replaced with a DNA fragment of about 1.87 kbp length, which was obtained by the following procedures: 20 pg pMLCE3a was dissolved in 100 µl of a 10 mM Tris- HCl (pH 8), 7 mM MgCl ₂ , 100 mM NaCl, 7 mM 2 mercaptoethanol and 0.01% BSA; the solution was incubated at 37 ° C for 5 hours in the presence of 20 units of Stul, then subjected to electrophoresis through a 1.2% agarose gel.

The plasmid pTNCE3a thus obtained was used to transform the C127 mouse cell as in Example 24. Clones expressing the human G-CSF chromosomal gene and having a high capacity to produce G-CSF were isolated.

Example 39: Expression of the human G-CSF chromosomal gene in CHO cells

As in the expression in C127 cells, plasmid pMLCE3a was treated with Stul, after which a DNA fragment of about 1.78 kbp in length was eliminated; alternatively, the same plasmid is treated with EcoRI and an EcoRI fragment about 4 kb in length is eliminated. Both fragments are favorable as the origin of the chromosomal G-CSF gene.

The fragment source is treated with the Kienow DNA polymerase fragment I (a).

-9494

As in Example 38, the SV4O promoter (EcoRI-EcoRI fragment) was excised from pHGA410 to give a fragment about 0.4 kbp in length, which was similarly treated with the Klenow DNA polymerase fragment (b).

In a separate step, the plasmid pAdD26SVpA / Kaufman, RG & Sharp, PA, Mol. Whole. Biol., 2, 1304-1319 (1982) / treated with EcoRI and then Klenov / DNA polymerase fragment finally dephosphorylated by treatment with bacterial alkaline phosphatase (c). Fragments (a), (b) and (c), each weighing 0.1 μς, were dissolved in 20 μΐ of the reaction mixture / 50 mM Tris-HCl (pH 7.6), 10 mM MgCl ₂ , 10 mM DTT, 1 mM ATP / min. the reaction was allowed to proceed overnight at 4 ° C in the presence of 180 units of T ₄ DNA ligase. The reaction mixture is then treated with rubidium chloride in the procedure described in Molecular Cloning, the same way that E. coli species of DH1 are transformed. The resulting Tet ^r colonies are tested for pD26SVCE3a content. As shown in Fig. 22, the plasmid pD26SVCE3a CSF gene is linked to the early SV40 gene and the dhfr gene bound under the principally posterior promoter of adenovirosis.

The plasmid pAdD26SVpA was treated with EcoRI and BamHI as in 2) in Example 25 to give a DNA fragment (about 2 kb) containing the dhfr gene. This gene is bound to fragment (a) and EcoRISall fragment pHGA410 (H) by constructing the Amp ^r expression vector pDRCE3a (Fig. 22).

CHO cells were transformed with the plasmids pD26SVCE3a and pDRCE3a thus obtained, as in Example 25. Repeated selection through growth in the presence of ΜΤΧ clones yielded the G-CSF-producing species.

Example 40: Investigation of G-CSF activity of transformants (expressing chromosomal gene)

The cell culture supernatants of C127 and CHO cells obtained in Examples 38 and 39 were treated as shown

-9595

Example 26 so that human G-CSF was obtained the activity was investigated. The results are shown in Table 11 below. Table 11: Investigation of human G-CSF activity Human neutrophil colonies (colonies / container) Purified human G-CSF (20 ng) 85 Culture of C127 cells transformed with pdBPV-1 (20x concentrated) 0 BPV Culture of C127 cells transformed with pTNCE3a (20x concentrated) 83 Culture of CHO cells transformed with pAdD26SVpA (20x concentrate) 0 dhf r Culture of CHO cells transformed with pD26SVpA (20x concentrate) 85 Culture of CHO cells transformed with pDRCE3a (20x concentrate) 86

Example 41: Molecular weight and isoelectric point of transf orts

The purified CSF samples used in the amino acid composition analyzes in cases 16, 20, 27, 33 and 37 were subjected to

-9696 molecular weight and isoelectric point measurements using the following procedures.

1) Molecular mass

The molecular weight of CSF was determined by sodium dodecylsulfatepolyacriamide gel electrophoresis (SDE-PAGE). The electrophoresis equipment was PROTEAN ™ (16 cm, Biorad Corp. product) using a gel made of polyacrylamide plate gel (T = 15%, C = 2.6%) with dimensions 140 mm x 160 mm x 1.5 mm and gel concentrator (T = 3%, C = 20%). The denatured CSF sample was obtained by the following procedure: CSF was cultured for 3 minutes in a solution containing 2% sodium dodecyl sulfate in 0.46 M 2-mercaptoethanol. After performing electrophoresis with a 4 pg sample at a constant current of 30 mA for 4 hours, the gel was separated and stained with 0.24% Cpomassie Brilliant Blue R 250 (product of Sigma Chemical Co.) for strip detection. The following substances were used as molecular weight markers after similar treatments: phosphorylase B (mol. Mass 92500), bovine albumin serum (BSA, mol.m. 67000) ovalbumin (OVA, mol.m. 45000), carbon anhydrase (mol. m. 31000), soybean trypsin inhibitor (mol.m. 21500) and lysozyme (mol.m. 14400).

In this way, a single strand corresponding to a molecular weight of 185000 +/- 1000 was identified for each of the CSF samples obtained in Example 18 (E.coli cDNA (+ ALL)) and Case 20 /E.coli cDNA (-VSE) /; and a single strand corresponding to a molecular weight of 19000 +/- 1000 and identified for each sample obtained in Example 27 / C127, CHO / cDNA (-VSE) /, Example 33 / C127, CHO / cDNA (-VSE), and Example 37 (COS / gDNA).

2) Isoelectric point

The CSF isoelectric point of the present invention was determined using a BACKGROUND, isoelectric apparatus, FBE-3000 (Pharmacia Fine Chemicals product). After two hours of electrophoresis at a constant power of 30 W (Vmax = 2000 V) on polyacrylamide gel

-9797 (Τ = 5%, 03%, 115 mm χ 230 mm) containing Framalite (pHM-6.5, Pharmacia Fine Chemicals) and 4 M urea, CSF was fixed with 30% methanol / 10% trichloroacetic acid / 35% sulfosalicylic acid, and stained with Coomassie Brilliant Blue R-250. A low pl kit (pH: 2.5-6.5, Pharmacia Fine Chemicals product) is used as an isoelectric point marker.

Analysis of the separation of strips at pH 4 to 6.5 yields a single strand corresponding to pl) 6.1 for each of the CSF samples obtained in Examples 16 and 20, and yields three separate strips responsible for pl = 5.5, 5.8, and 6.5 of each of the samples obtained in Examples 27, 33 and 37.

Example 42: Protective effect of human G-CSF against microbial infections

Research Method

1) Protection against Pseudomas aeruginosa infection

Endoxan (a trademark of Shinogi & Co., Ltd.) was injected interperially into 8-9 weeks old mice (males; 35.3 +/- 1.38 g body weight) at a dose of 200 mg / kg. The mice were then divided into three groups (two groups were given subcutaneously 4 injections of solute (0.1 ml dose) every 24 hours / 1% propanol and 0.5% (x / v) mouse serum albumin in saline) containing human G -CSF (25,000 or 50,000 units per mouse) while only the same solvent was given to the other group. Three hours after the last injection, mice of each group were infected with Pseudomonas aeruginosa GNB-139 by subcutaneous injection (3.9 x 105 CFU / mouse). Twenty-one hours after infection, mice of the first group were given a second subcutaneous injection of toil containing human G-CSF (250,000 or 50,000 units / mouse), and only the solvent was given to the second group.

The protective effect of human G-CSF was determined by counting the number of mice remaining alive 10 days after infection.

-9898

Preparation of cell suspensions

Pseudomonas aeruginosa GNB-139 was cultured overnight by stirring at 37 ° C in a Difco cardiac infusion fluid (trademark: Op. Prev). The culture was suspended in saline.

2) Protection against Candida infection

Endoxan was administered intraperitoneally to 8-week-old ICR mice (males; 40.5 +/- 1.6 g body weight) at a dose of 200 mg / kg. Mice were divided into two groups; one group was given 4 subcutaneous injections of the solvent solution (1% propanoic and 10% w / v)

ICR of serum of mice in saline / containing Human G-CSF (50000 units per mouse) (0.1 ml dose) every 24 hours, while only the solvent was given in the same order in the second group. Four hours after the last injection, mice in each group were infected with Candida albicans U-50-1 (a species isolated from urine or leukemic patients; thanks to courtesy

Bacteriology Laboratory, Tohoku University, Schooi of Medicine) by intravenous injection (5.6 χ 10 ⁵ CFU / mouse).

The protective effect of human G-CSF was investigated by counting mice alive ten days after infection.

Preparation of cell suspension

Candida albicans U-50-1 was cultured overnight at 37 ° C by shaking, in a yeast extract containing a Sabouraud-liquid medium (2% dextro2e from Junsei Pure Chemicals Co., Ltd.; Peptone Triptocases, trade name BBL; 5% Difco yeast extract; pH 5.6). The culture was washed twice with saline and suspended in saline.

-9999

3) Protection against infections by the intracellular parasite Listeria Endotoxan (trademark of Shinogi & Co., Ltd.) was introduced intraperitoneally into 7-week-old ICR mice; 34, 7 +/- 1, 24 g body weight) at a dose of 200 mg / kg. Mice were divided into two groups; one group was given 4 subcutaneous injections, 0.1 ml dose) every 24 hours of solution (1% npropanol and 10% (w / v) ICR mouse serum in saline / containing human G-CSF (50000 units / mouse) , meanwhile, only the solvent was given the same schedule in the second group. Four hours after the last injection, mice of each group were infected with Listeria monocytogenees 46 (courtesy of the Microbiology Laboratory, Tohoku University, School of Medicine) with intravenous injections of 1 χ 10 ⁷ CFU / mouse. the protective effect of human G-CSF was determined by counting mice that were alive 12 days after infection.

Preparation of cell suspension

Disteria monocytogenes 46 is cultured overnight with stirring at 37 ° C in a brain-heart infusion third Difco environment. The culture is suspended in saline.

Results:

i) Studies 1, 2 and 3 were performed with the E.coli G-CSF (+ ALL) polypeptide obtained in Example 16. The results are shown in Tables 12, 13 and 14.

-100100

Table 12: Effect against Pseudontonas aeruginosa

The group CSF concentration (mouse / days unit) Live mice / investigated mice Solvent 0 0/10 CSF-containing solvent 25,000 6/8 CSF-containing solvent 50,000 8/10

Table 13: Effect against Canria by a1bican The group CSF concentration Live mice / (unit / mouse / day) investigated mice Solvent 0 0/10 CSFs contains a solvent of 50,000 10/10

Table 14: Effect against Listeria monocytogenes The group CSF concentration Live mice / (unit / mouse / day) investigated mice Solvent 0 0/10 CSFs contains a solvent of 50,000 10/10

ii) Investigation 1 was performed with the E.coli G-CSF (-ALL) polypeptide obtained in Example 20. The results are shown in Table 15.

-101101

Table 15: Effect against Pseudomonas aeruginosa

The group

CSF concentration (unit / mouse / day)

Live mice / mice examined

Solvent 0 CSF-containing solvent 25,000 CSF-containing solvent 50,000

0/10

6/10

8/10 iii) Test 1 was performed on purified human G-CSF sample (+ ALL) from CHO cells, which was the same as that used in the analysis of the amino acid composition of Example 27. The results are shown in Table 16.

Table 16: Effect against Pseudomonas aeruginosa

The group

CSF concentration (unit / mouse / day)

Live mice / mice examined

Solvent 0 CSF-containing solvent 25000 CSF-containing solvent 50000

0/10

9/10

10/10

Essentially, the same results are obtained if Study 1 is performed with C127 derived cells, purified human G-CSF sample (+ ALL), which is the same as that used in the analysis of amino acid composition in Example 33. The results are shown in Table 17.

-102102

Table 17: Effect against Pseudoroona aeruginosa

The group CSF concentrations a (unit / mouse / day) Live mice / investigated mice Solvent 0 0/10 CSFs containing solvent 25,000 9/10 CSFs containing solvent 50,000 10/10

Essentially, the same results were obtained when test 1 was performed with C127 derived cells of purified human G-CSF sample, which was identical to that used in the analysis of the amino acid composition of Example 33.

Claims (57)

PATENT APPLICATIONS A gene characterized in that it is a coding gene for a polypeptide having a stimulating activity factor for a human granulocyte colony. A gene according to claim 1, characterized in that the DNA is complementary to the curation RNA obtained as a 15 to 17 fraction of a sucrose density centrifugation gradient and which encodes a polypeptide containing a stimulating factor for human granulocyte colony. A gene according to claim 1, characterized in that it is a human chromosomal gene. A gene according to claim 3, characterized in that said chromosomal gene contains a nucleotide sequence that is involved in transcriptional control. The gene of claim 1, which encodes all or part of the polypeptide, characterized in that it has the following set: Met Ala Gly Pro Ala Thr Gin Sir Pro Met Lys Leu Met Ala Leu Gin Leu Leu Leu Trp His Sir Ala Leu Trp Thr Val Gin Glu Ala Thr Pro Leu Gly Pro Ala Sir Sir Leu Pro Gin Sir Phe Leu Leu Lys Cys Leu Glu Gin Val Arg Lys Ile Gin Giy Asp Gly Ala Ala Leu Gin Glu Lys Leu {Val Sir Glu) m Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Sir Leu Gly Ile Pro Trp Ala Pro Leu Sir Sir Cys Pro Sir Gin Ala Leu Gin Leu Ala Gly Cys Leu Sir Gin Leu His Sir Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly Ile Sir Pro Glu Leu Ala Asp Phe Ala Thr Thr Ile Trp Gin Gin Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala Met Pro Ala Phe Ala Sir Ala Phe Gin Arg Arg Ala Gly Gly Val Leu Val Ala -104104 Ser His Leu Gin Ser Phe Leu Glu Val · Ser Tyr Arg Val Leu Arg His Leu Aia Gin Pro The gene of claim 1, which encodes all or part of the polypeptide, characterized in that said polypeptide has the following set: (where m = 0 or 1) Thr Pro Leu Gly Pro Ala Sir Sir Leu Pro Gin Sir Phe Leu Leu Lys Cys Leu Glu Gin Val Arg Lys Ile Gin Gly Asp Gly Ala Ala Leu Gin Glu Lys Leu (Val Sir Glu) m Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Sir Leu Gly Ile Pro Trp Ala Pro Leu Sir Sir Cys Pro Sir Gin Ala Leu Gin Leu Ala Gly Cys Leu Sir Gin Leu His Sir Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly Ile Sir Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gin Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gin Gin Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala Met Pro Ala Phe Ala Sir Ala Phe Gin Arg Arg Ala Gly Gly Val Leu Val Ala Sir His Leu Gin Sir Phe Leu Glu Val Sir Tyr Arg Val Leu Arg His Leu Ala Gin Pro • 7. Gen according to the claim 1, characterized in that to contain is complete, or del the next nucleotide string, where is m 0 or 1: ATG GCT GGA CCT GCC ACC CAG AGC CCC ATG AAG CTG ATG GCC CGT CAG CTG CTG CTG TGG CAC AGT GCA CTC TGG ACA GTG CAG GAA GCC ACC CCC CTG GGC CCT GCC AGC TCC CTG CCC CAG AGC TTC CTG CTC AAG TGC TTA GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG CTC CAG GAG AAG CTG (GTG AGT GAG) m TGT GCC ACC TAC AAG CTG TGC CAC CCC -105105 GAG GAG CTG GTG CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GCT CCC CTG AGC AGC TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG AGC CAA CTC CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC CTG CAG GCC CTG GAA GGG ATC TCC CCC GAG TTG GGT CCC ACC TTG GAC ACA CTG CAG CTG GAC CTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG GAA GAA CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG GGT GCC ATG CCG GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TCG TAC CGC GTT CTA CGC CAC CTT GCC CAG CCC 8. Gen , po claim 1, characterized by so, to contain whole or del the next nucleotide string, where it is m 0 or 1 ACC CCC CTG GGC CCT GCC AGC TCC CTG CCC CAG AGC TTC CTG CTC AAG TGC TTA GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG CTC CAG GAG AAG CTG (GTG AGT GAG) _m TGT GCC ACC TAC AAG CTG TGC CAC CCC GAG GAG CTG GTG CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GTC CCC CTG AGC AGC TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG AGC CAA CTC CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC CTG CAG GCC CTG GAA GGG ATC TCC CCC GAG TTG GGT CCC ACC TTG GAC ACA CTG CAG CTG GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG GAA GAA CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG GGT GCC ATG CCG GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TCG TAC CGC GTT CTA CGC CAC CTT GCC CAG CCC -106106 A gene according to claim 1, characterized in that it contains part or all of the nucleotide sequence shown in the accompanying Figure 3 (A). Gene according to claim 1, characterized in that it contains part or all of the nucleotide sequence shown in the accompanying Figure 4 (a). The gene of claim 1, wherein said human chromosomal gene has all or part of the nucleotide sequence shown in Figure 5. A gene according to any one of claims 1 to 11, characterized in that it is fused to microorganisms or virus-derived replicates. 13. A recombinant vector comprising a gene encoding a polypeptide having a stimulating factor for human granulocyte colony. A recombinant vector according to claim 13, characterized in that said gene is complementary to a transfer RNA obtained as a 15 to 16 sucrose density centrifugal fraction encoding a polypeptide having a stimulating factor for human colony activity granulocytes. 15. The recombinant vector of claim 13, wherein said gene is a chromosomal gene. 16. The recombinant vector of claim 15, wherein said chromosomal gene comprises a nucleotide sequence that is involved in transcriptional control. A recombinant vector according to claim 13, characterized in that said gene is coding for all or part of the polypeptide sequence shown in claim 5. 18. The recombinant vector of claim 13, wherein said gene is coding for all or part of the polypeptide sequence shown in claim 6. A recombinant vector according to claim 13, characterized in that said gene has all or part of the nucleotide sequence shown in claim 7. -107107 20. The recombinant vector of claim 13, wherein said gene has all or part of the nucleotide sequence shown in claim 8. 21. The recombinant vector of claim 13, wherein said gene has all or part of the nucleotide sequence shown in attached Figure 3 (A). 22. The recombinant vector of claim 13, wherein said gene has part or all of the nucleotide sequence shown in the accompanying Figure 4 (A). 23. The recombinant vector of claim 13, wherein said human chromosomal gene has all or part of the nucleotide sequence shown in the accompanying Figure 5. A recombinant vector according to any one of claims 13 to 23, characterized in that it was used together with E. coli. A recombinant vector according to any one of claims 13 to 23, characterized in that it can be used with animal cells. 26. E. coli recombinant vector according to claim 13, characterized in that said gene encodes all or part of the polypeptide series, where is m 0 or 1 Met Thr Pro Leu Gly Pro Ala Sir Sir Leu Pro Gin Sir Phe Leu Leu Lys Cys Leu Glu Gin Val Arg Lys Ile Gin Gly Asp Giy Ala Ala Leu Gin Glu Lys Leu (Val Sir Glu) m Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Sir Leu Gly Ile Pro Trp Ala Pro Leu Sir Sir Cys Pro Sir Gin Ala Leu Gin Leu Ala Gly Cys Leu Sir Gin Leu His Sir Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly Ile Sir Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gin Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gin Gin Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala Met Pro Ala -108108 Phe Ala Sir Ala Phe Gin Arg Arg Ala Gly Gly Val Leu Val Ala Sir His Leu Gin Sir Phe Leu Glu Val Sir Tyr Arg Val Leu Arg His Leu Ala Gin Pro 27. A transformant comprising a recombinant vector that harbors a gene encoding a polypeptide having a stimulating factor of activity on a human granulocyte colony. 28. The transformant of claim 27, wherein said DNA gene is complementary to a transfer RNA obtained as 15 to 17 sucrose density gradient centrifugal fraction encoding a polypeptide containing a stimulating factor of activity on a human granulocyte colony. A transformant according to claim 27, characterized in that said gene encodes all or part of the polypeptide sequence shown in claim 5. A transformant according to claim 27, characterized in that said gene encodes all or part of the nucleotide sequence shown in claim 6. A transformant according to claim 27, characterized in that said gene has all or part of the nucleotide sequence shown in claim 7. 32. The transformant of claim 27, wherein said gene has all or part of the nucleotide sequence shown in claim 8. 33. The transformant of claim 27, wherein said gene has all or part of the nucleotide sequence shown in Figure 3 (A). 34. The transformant of claim 27, wherein said gene has all or part of the nucleotide sequence shown in attached Figure 4 (A). -109109 35 * Transformant according to claim 27, characterized in that said human chromosomal gene has all or part of the nucleotide sequence shown in the accompanying Figure 5. 36. The E.coli transformant according to any one of claims 27 to 35, characterized in that it is obtained by transformation with the recombinant vector E.coli. Animal cell transformant according to any one of claims 27 to 35, characterized in that it was obtained by transformation with a recombinant vector for use with animal cells. 38. E.coli transformant according to claim 27, characterized in that it is obtained by transformation with a recombinant vector E.coli according to claim 26. 39. A polypeptide, characterized in that it represents all or part of the amino acid sequence shown below, wherein m is 0 or 1 and n is 0 or 1: (Met) _n Thr Pro Leu Gly Pro Ala Sir Sir Leu Pro Gin Sir Phe Leu Leu Lys Cys Leu Glu Gin Val Arg Lys Ile Gin Gly Asp Gly Ala Ala Leu Gin Glu Lys Leu (Val Sir Glu) m Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Sir Leu Gly Ile Pro Trp Ala Pro Leu Sir Sir Cys Pro Sir Gin Ala Leu Gin Leu Ala Gly Cys Leu Sir Gin Leu His Sir Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly Ile Sir Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gin Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gin Gin Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala Met Pro Ala Phe Ala Sir Ala Phe Gin Arg Arg Ala Gly Gly Val Leu Val Ala Sir His Leu Gin Sir Phe Leu -110110 Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gin Pro 40. A polypeptide according to claim 39, characterized in that it has a stimulating factor of activity on a human granulocyte colony. 41. A polypeptide containing a substance having a stimulating factor on a human granulocyte colony, characterized in that it is obtained from a transformant containing a recombinant vector that harbors a gene encoding a polypeptide having a stimulating factor of activity on a human granulocyte colony. 42. A polypeptide having a stimulating factor of activity on a human gramulocyte colony, characterized in that it is represented by a portion of the amino acid sequence shown in Figure 3 (B) (II). 43. A polypeptide having a stimulating factor of activity on a human granulocyte colony, characterized in that it is represented by a portion of the amino acid sequence shown in Figure 4 (B) (II). 44. A glycoprotein having a stimulating factor for activity on a granulocyte human colony, characterized in that it contains sugar and a polypeptide comprising all or part of the following amino acid sequence: Thr Pro Leu Gly Pro Ala Sir Sir Leu Pro Gin Sir Phe Leu Leu Lys Cys Leu Glu Gin Val Arg Lys lle Gin Gly Asp Gly Ala Ala Leu Gin Glu Lys Leu (Val Sir Glu) m Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His Sir Leu Gly lle Pro Trp Ala Pro Leu Sir Sir Cys Pro Sir Gin Ala Leu Gin Leu Ala Gly Cys Leu Sir Gin Leu His Sir Gly Leu Phe Leu Tyr Gin Gly Leu Leu Gin Ala Leu Glu Gly lle Sir Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gin -111111 Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gin Gin Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gin Pro Thr Gin Gly Ala Met Pro Ala Phe Ala Sir Ala Phe Gin Arg Arg Ala Gly Gly Val Leu Val Ala Sir His Leu Gin Sir Phe Leu Glu Val Sir Tyr Arg Val Leu Arg His Leu Ala Gin Pro 45. A glycoprotein containing a substance having a stimulating factor of activity on a human granulocyte colony, characterized in that it is derived from animal cells that have been transformed with a recombinant vector for use with animal cells and that harbors a gene encoding a polypeptide that contains a stimulating factor of activity on human granulocyte colony. 46. A method of producing a polypeptide or a glycoprotein having a stimulating factor of activity on a human granulocyte colony, characterized in that it comprises: a) obtaining a gene encoding a polypeptide having a stimulating factor of activity on a human granulocyte colony, b) obtaining a recombinant vector inserted into said gene, c) transforming the host cells with said vector, d) the cultivation of the transformant, and e) separating the desired polypeptide or glycoprotein from the cultures. -112112 47. The method of claim 46, wherein said DNA gene is complementary to a transfer RNA obtained as a 15 to 17 sucrose density centrifugal fraction encoding a polypeptide having a stimulating factor on a human granulocyte colony. The method of claim 46, wherein said gene is a human chromosomal gene. 49. The method of claim 46, wherein said chromosomal gene comprises a basic strand that is involved in transcriptional control. The method according to claim 46, characterized in that said gene encodes all or part of the polypeptide sequence shown in claim 5. 51. The method of claim 46, wherein said gene encodes all or part of the polypeptide array shown in claim 6. 52. The method of claim 46, wherein said E.coli gene is the recombinant vector of claim 26. The method of claim 46, wherein said gene has part or all of the nucleotide record shown in claim 7. 54. The method of claim 46, wherein said gene has all or part of the nucleotide sequence shown in claim 8. 55. The method of claim 46, wherein said gene has part or all of the nucleotide sequence shown in Figure 3 (A). The method of claim 46, wherein said gene comprises all or part of the nucleotide sequence shown in attached Figure 4 (A). 57. The method of claim 46, wherein said human chromosomal gene has all or part of the nucleotide sequence shown in the accompanying Figure 5. -113113 58. The method of claim 46, wherein the polypeptide is represented by part or all of the amino acid sequence shown in claim 39. 59. The method of claim 46, wherein the glycoprotein contains sugar and a polypeptide represented by the whole or part of the amino acid sequence shown in claim 44.