WO1986004506A1

WO1986004506A1 - Infection-protective agent containing human granulocyte colony-stimulating factor as effective ingredient

Info

Publication number: WO1986004506A1
Application number: PCT/JP1986/000053
Authority: WO
Inventors: Masayoshi Ono; Hitoshi Nomura; Masahiko Tamura; Masahiko Matsumoto
Original assignee: Chugai Seiyaku Kabushiki Kaisha
Priority date: 1985-02-08
Filing date: 1986-02-07
Publication date: 1986-08-14
Also published as: JPH0615477B2; JPS61186327A

Abstract

An infection-protective agent containing human granulocyte colony-stimulating factor (G-CSF) as effective ingredient. Human G-CSF includes one obtained from the supernatant of a culture of human G-CSF-producing cells and polypeptide or glycoprotein having human G-CSF activity obtained by culturing transformant prepared by transforming host cells with a recombinant vector incorporating a gene coding a polypeptide having a human G-CSF activity.

Description

Infection protective agent containing human granulocyte colony-stimulating factor as active ingredient [Technical field]

The present invention relates to a human granulocyte colony stimulating factor, and particularly to a specific stimulating factor, ie, a colony stimulating factor (hereinafter referred to as a "colony stimulating factor"), which is required mainly for colony formation of human granulocyte cells. Abbreviated as “CSF”) a gene encoding an active polypeptide, a recombinant vector incorporating the gene, a transformant containing the vector, and a product produced from the transformant The present invention relates to a polypeptide or a glycoprotein having CSF activity and an infectious agent comprising CSF as an active ingredient.

(Background technology)

When the bone marrow cells are used as target cells in the upper layer and kidney cells or fetal cells in the lower layer in the two-layer soft agar culture method, part of the cells in the upper layer proliferate and differentiate, and neutrophil granules are obtained. Sphere (hereinafter "granulocyte"

(granulocyte) J ) And the formation of a colony consisting of monocyte macrophages, it has been known that there are factors that promote colony formation in living organisms (Pluznik and Sach: J. et al. Cell. Comp. Physiol., Volume 319 (1965); Bradley and Hetcalf; Aust. J. Exp. Biol. Hed. Sc, Volume 287.

(1966)).

Collectively referred to as CSF, this factor is normally widely distributed in cells, such as T cells, monocyte macrophages, osteoblasts, It is known to be produced by endothelial cells and the like. CSF has effects on granulocyte ♦ monocyte macrophage stem cells, stimulates their proliferation and induces differentiation, and is composed of granulocytes and monocyte macrophages in soft agar. Granulocyte-monocyte macrophage CSF (abbreviated as GH-CSF) that acts to form knees.Monomerocytes that mainly form colonies of monocyte macrophages. Sphere macrophage CSF (abbreviated as M-CSF), pluripotent CSF acting on more undifferentiated pluripotent stem cells (abbreviated as multi-CSF), or the present invention. However, there are subclasses such as granulocyte CSF (abbreviated as G-CSF), which mainly has the action of forming granulocyte colonies, and the target cell differentiation stage depends on each subclass. [Asano) Metabolism-Metabol ism and Disease, 22 ^ p. 249 (1985), Yunis et al .; "Growth and Maturation

Factors,,, edited by Gurf, John Wiley S Sons, NY, 1, 209 (1983)].

As for human CSF, a large number of reports have been made on CSF derived from human normal tissues and CSF derived from human tumor cells (for example, Stanley et al., Fed. Proc. 35 2272 (1975), Burgess et al. ood 49 573 (1977), Shah et al. Blood 50 811 (1977), Fojo et al. Biocheffl, 17 3109 (1978), Okabe et al. Cancer Res 38 3910 (1978), Asano et al. Blood 49 845 (1977), Golde et al. Blood 5J 1321

(1981), et al. J. Biol. Chem 254 6226 (1979), Dipersio et al.

See Blood 56 717 (1980). ).

However, these human CSFs were completely purified. Therefore, the usefulness or efficacy of human CSF as a medicament remains unknown.

In recent years, advances in chemotherapeutic drugs in the field of infectious diseases have made it possible to treat conventional virulent substance producing bacteria having a specific pathogenicity. Due to the increased number of compromised hosts, infection with pathogens that are weakly pathogenic but resistant to drugs and disinfectants (opportunistic infections) poses new clinical problems. These opportunistic infections are caused by drug-resistant bacteria and fungi that are low in useful antibiotics, and their treatment involves activation of host defenses in addition to conventional chemotherapeutic agents. Although the use of drugs is desired, no effective drug has been found to date.

In the early stage of infection, the phagocytic activity of leukocytes is thought to be the most influential among the host's defense functions, so it is necessary to enhance the proliferation and differentiation and maturation of neutrophils and macrophages. Thus, it is suggested that if the ability of the host to protect infection can be enhanced, it may be an effective therapeutic drug for infection.

Therefore, research on the mass production of pure human CSF has been actively conducted, but none has been successful to date. In such a situation, the present inventors have determined that the cell line CHU-1 which has an extremely high ability to produce human G-CSF from tumor cells of a patient with oral floor cancer and has a good proliferation ability. (CNM Accession No. “1-315”) and succeeded in the isolation of pure human CSF, which shows human neutrophil colony formation-promoting activity, from the culture supernatant of this cell line for the first time. (Japanese Patent Application No. 59-153273). The present inventors examined the protective effect of this human G-CSF using an infected animal model and found that the human G-CSF had a remarkable ability to mature neutrophils in vivo, and The present inventors have found that they are effective as a remedy for infectious diseases because they showed an infection protective effect, and then established the cell line CHU-2 derived from human oral floor carcinoma. From the culture supernatant of this cell line, G-CSF completely identical to that derived from CHU-1 was isolated from CNCM accession number I-483).

However, the method of isolating G-CSF from the culture supernatant using the cell culture method as described above is based on the fact that only a low concentration of G-CSF is produced and that a small amount of G-CSF can be obtained from a large amount of culture solution. Despite difficulties such as the need for a complicated purification process, a large amount of uniform G-CSF has not yet been obtained. Therefore, there has been a demand for mass production of G-CSF using replacement DNA technology.

[Disclosure of the Invention]

The present invention is to provide an anti-infective agent comprising human G-CSF as an active ingredient.

Human G-CSF, which is the active ingredient of the infectious protective agent of the present invention, includes human G-CSF as well as those obtained by isolating from a culture supernatant obtained by culturing human G-CSF-producing cells. A human G-CSF-active polypeptide produced by a transformant obtained by transforming a host with a recombinant vector incorporating a gene encoding a polypeptide having CSF activity. Also includes peptides or glycoproteins. (Brief description of drawings

Figure 1 shows the probe (IWQ), probe (A) and probe (LC) sequences.

Figure 2 shows the nucleotide sequence of the PHCS insert.

Figure 3 (M shows the nucleotide sequence of the PBRG4 cDNA insert.

FIGS. 3 (B) and (I) show the amino acid sequences of the human G-CSF precursors deduced from PBRG4 CDNA.

FIGS. 3 (B) and (H) show the amino acid sequence of human mature G-CSF deduced from PBRG4 CDNA.

FIG. 4 (A) shows the nucleotide sequence of the cDNA insert of pBRV2.

FIGS. 4 (B) and (I) show the amino acid sequences of the human G-CSF precursors deduced from PBRV2 CDNA.

Figure 4 (B) and (I) show the human maturation performed from PBRV2.CDNA.

2 shows the amino acid sequence of CSF.

FIG. 5 shows restriction enzyme cleavage sites of human G-CSF CDNA derived from PBRG4 or PBRV2.

Figure 6 shows part of the process for preparing the vector containing the tac promoter (+ VSE system).

Figure 7 shows the process for preparing a vector containing a synthetic PL motor (+ VSE system).

Figure 8 shows the process for preparing the vector containing the trp promoter (+ VSE system).

Figure 9 shows part of the process for preparing a vector containing the tac promoter (one VSE system).

Figure 10 shows the process for preparing a vector containing a synthetic PL motor. Indicates (— VSE series).

Figure 11 shows the process for preparing the vector containing the trp promoter (-VSF-system). '

Figure 12 shows the schematic structure of PHGA410.

FIG. 13 shows the process of constructing the expression vector PTN-G4.

Figures a and 14b show the construction process of pHGG4-dhfr, and Figure 15 shows the schematic structure of PHGV2.

FIG. 16 shows the process of constructing the expression vector PTN-V2.

FIG. 17a and FIG. 17b show the process of constructing the recombinant expression vector PHGV2-dhfr.

[A good form for carrying out the invention]

The gene encoding the polypeptide having human G-CSF activity according to the present invention has the human G-CSF activity obtained as a 15-17S fraction by sucrose density gradient centrifugation. It is a DNA (cDNA) that is complementary to a messenger RNA (mRNA) that encodes the polypeptide having it.

We have obtained two lines of such cDNAs.

One of the series of cDNAs has the gene encoding the polypeptide or の of FIG. 3 (B) or a part thereof, and more specifically, the cDNA of FIG. 3 (A). 5 'to base sequence from the end, from ATG at 32 to 34 nucleotides to CCC at 650 to 652 nucleotides, from 122 to "!! From ACC at 24 to CCC at 650 to 652 The sequence or the sequence described in Figure 3 (Α) or Having a part of This series of cDNAs is referred to as CDNA (+ V3E).

The other series of cDNAs has the gene encoding polypeptide I or I of FIG. 4 (B) or a part thereof, and more specifically, has the nucleotide sequence of FIG. 4 (A). 5 '— Sequence from ATG at nucleotide positions 31 to 33 to CCC at nucleotide positions 640 to 642, sequence from ACC at nucleotide positions 121 to 123 to CCC at positions 640 to 642 from terminal Or the sequence shown in FIG. 4 (A) or a part thereof. This series of cDNAs is referred to as cDNA (-VSE). The gene of the present invention is prepared, for example, by preparing G-CSF-encoding mRNA from a mammalian cell or the like having the ability to produce a polypeptide having G-CSF activity, and then preparing two mRNAs by a known method. It is converted to cDNA.

In the present invention, the above-mentioned mammalian cell serving as a source of mRNA is a cell line CHU-2 (Colection) derived from human oral floor cancer.

Nationate Oe Cuiteres De Hicroorganisms (C.N.C.M) Deposit No. I-483), but not limited to tumor cell lines, but may be cells that can be isolated from mammals or other established cell lines. In addition, the preparation of mRNA has already been performed when cloning genes for some other bioactive proteins, for example, liponuclease enzyme such as panadium complex. Perform surfactant treatment and phenol treatment in the presence of inhibitor (with Berger

Bikenkenep; Biochemistry, Vol. 5, p. 5143 (1979)), or after treatment with guanidine thiocyanate, perform CsCI density gradient centrifugation (Chirgwin et al., Biochemistry, 18 tickets, p. 5294, 1979). Thus, after obtaining the total RNA, the ligament (dT) —cell mouth-one-sepharose 2B using a carrier such as poly-U-sepharose as a carrier Poly (A +) RNA (mRNA) can be obtained by the tea column method or the patch method. Poly (A ⁺ ) RHA can be further fractionated by sucrose density gradient centrifugation or the like. In order to confirm that the mRNA obtained as described above encodes a polypeptide having G-CSF activity, liiRNA is translated into a protein and examined for physiological activity or A method of determining the protein using a G-CSF antibody may be used. For example, mRNA is injected into the oocyte of the African frog (Xenopus laevis) and translated (Gurdon et al .;

Nature, m_, p. 177 (1972)), or a translation reaction using the heron reticulocyte (Ret icu-locyte) system or the wheat germ (Wheat germ) system has been performed (Schleif and Wens). ink; "Practical Methods ίn Ho Iecu Iar Biology", Springer-Verlag, NY, (1981)). The assay of G CSF activity can be performed by applying the agar culture method using bone marrow cells. There is a review of these methods (Hetcalf; "Hemopoietic Coiones", Springer-Ver Iag, Berlin, Heidelberg, NY (1977) _α

After converting the raRNA obtained by the method described above into type I and synthesizing a single-stranded cDNA, a double-stranded cDNA is synthesized from the single-stranded cDNA, and the plasmid is exchanged with an appropriate vector DNA. Create This transforms Escherichia coli and the like,

A DNA group (hereinafter referred to as cDNA library) is obtained.

To obtain double-stranded cDNA from mRHA, for example, use the 3'-end of fflRNA Oligos (dT) complementary to the poly-A-chain at the site are treated with reverse transcriptase as primers, or the oligos corresponding to part of the amino acid sequence of the G-CSF protein. It synthesizes a oligonucleotide and treats it with reverse transcriptase as a primer to synthesize cDNA complementary to mRNA. Double-stranded CDNA is degraded by alkaline treatment to degrade IBRNA. ♦ After removal, the resulting single-stranded CDNA is treated with reverse transcriptase or DNA polymerase (eg, Kleenow fragment, etc.) and then treated with S1 It can be obtained by treating with nuclease or the like, or directly by treating with RNase H and DNA polymerase (for example, E. coli DNA polymerase I). (For example,

See Maniatis et al .; Molecular cloning, Cold Spring Harbor Laboratory (1982) and Gubler and Hoffman; Gene Vol. 263 (1983). ).

The double-stranded cDNA obtained in this manner is used as an appropriate vector, for example, PSC101, pDF41, ColE1, pHB9, pBR322, pBR327,

After integration into EK-type plasmid vector represented by PACYC1 or phage vector represented by igt, λc, λgt10, λgtWES, etc., E. coli (X1776; HB101; DH1, C600 strains) Can be obtained to obtain a cDNA library (for example, see "Molecular cloning", supra).

In order to ligate the double-stranded cDNA to the vector, an appropriate chemically synthesized DNA fragment is added in order to add a ligable end to the DNA end, and the vector-DNA and ATP, which have been cleaved with restriction enzymes in advance, are used. Can be performed by treating with T4 phage DNA ligase. Alternatively, a vector previously cleaved with restriction enzymes -It is also possible to add dG, dC-chain (or dA, dT-chain) to each of DNA and double-stranded cDNA, and then gradually cool the solution containing both DHA. Yes (see Molecular Cloning above).

Transformation of a host cell with the recombinant DNA obtained in this way can be performed, for example, by the method described in detail by Hanahan when the host cell is E. coli (Bio to J.H0; —1 pp. 557 (1983) )), Ie, by adding the recombinant DNA to a recombinant cell prepared in the presence of CaCi 0, HgC ₂ or RbC.

To search for cells carrying the gene of interest, use the interface J: plus-minus method used in cloning cloned cDNA (Taniguchi et al .; Proc. Jpn. Acad. 55 Ser. B, p. 464 (1979)), the hybridisation method (Nagata et al., Nature_H, p. 316 (1980)), or the amino acids of the protein. Colony or black hybridization method using an oligonucleotide probe chemically synthesized based on the sequence (Wallace et al .; Nucleic Acids Res., ^ _P.879 (1981)) ) May be used.

The fragment containing the gene encoding the polypeptide having the human G-CSF activity cloned in this manner can be re-incorporated into an appropriate vector DNA to obtain a fragment. Other prokaryotic or eukaryotic host cells can be transformed. Furthermore, by introducing an appropriate promoter and a sequence for expression into these vectors, the gene can be expressed in each host cell. Can be expressed.

Prokaryotic host cells include, for example, Escherichia COM, Bacillus subtiIis, Bacillus thermophiIus, etc.Compatible with the host to express the target gene in these host cells The host cell may be transformed with a replicon from a possible species, a plasmid vector containing the origin of replication and regulatory sequences. It is also desirable that the vector has a sequence that can impart phenotypic (phenotypic) selectivity to the transformed cells.

For example, E. col i is a vector that uses it as a host.

Transformation can be carried out using PBR322 (Boi iver et al .; see Gene 2, page 95 (1975)). pBR322 contains genes for ampicillin and tetracycline resistance, and it is possible to identify transformed cells by using either of these resistances. Promoters required for gene expression in prokaryotic hosts include the promoter for the 3-lactamase gene (Chang et al.; Nature _, Vol. 615 (1978)), the lacto-promoter (Goeddel). See Nature, Vol. 281, p. 544 (1979)) and Tributefan Promoter 1 (see Goeddel et al., Nuc Ieic Acid Res.), P. 4057 (1980)). Promoters can also be used to produce polypeptides having the activity of human G-CSF of the present invention.

Among eukaryotes, host cells for eukaryotic microorganisms include, for example, Saccharomyces cerevisiae and the like, and plasmid YRp7 (Stinchcomb and the like; see Nature 282—39 (1979)) etc Can be used for transformation. This plasmid has the TRP1 gene, which serves as a selection marker for yeast strains lacking the ability to produce tributaphan, and can be grown in the absence of tributaphan. Examples of promoters that can be used for gene expression that can be used for gene expression include acid phosphatase gene promoters (Hiyanohara et al .: Proc. Hat and Acad. USA, Vol. 80, p. 1 (1983)) and alcohol dehydrogenase gene promoter (Valenzuela et al., Nature, vol. 298, p. 347 (1982)).

Examples of mammalian cell-derived host cells include COS cells, Chinese hamster ovary (CH0) cells, C-127 cells, HeLa cells, and the like, and vectors for transforming these cells. 'I mean, i) SV2—gpt (Muligan t Berg; Proc. Natl.

Acad. Sc, USA; 1, 2072 (1981)). These vectors contain an origin of replication, a selectable marker, a promoter located in front of the gene to be expressed, an RNA splice site polyadenylation signal, and the like.

As a promoter for gene expression in mammalian cells, promoters such as retrovirus, poliovirus, adenovirus, and simian virus 40 (SV40) may be used. For example, when the promoter of SV40 is used, it can be easily carried out according to the method of Muligan et al. (Nature, Vol. 108, p. 108 (1979)).

As the replication origin, those derived from SV40, poliovirus, adenovirus, bovine papilloma virus (BPV), etc. are used. The selectable markers include the phosphotransferase APH (3 ') II or I (neo) gene, the thymidine kinase (TK) gene, and Escherichia coli xanthine-guanine. A phospholiposyltransferase (Ecogpt) gene, a dihydrofolate transporting enzyme (DHFR) gene and the like can be used.

In order to obtain a polypeptide having human G-CSF activity using the above-described host-vector system, a recombinant DNA having the gene incorporated into an appropriate site of the vector is used. After transforming the host cell and performing fc, the obtained transformant may be cultured. Further, the polypeptide can be separated and purified from the cells or from the culture solution by using known means.

In general, eukaryotic genes are considered to exhibit polymorphism (polyfflorph'ysm), as in the case of human interferon genes. (Eg, Nishi et al .; J. Biochem. ._ L_, p. 153 (1985)). In some cases, one or more amino acids may be replaced by this polymorphism. Amino acids may not change at all.

In addition, for example, one or more amino acids lacking or adding one or more amino acids in the amino acid sequence of FIG. 3 (B), or one or more amino acids Polypeptides in which one or more of the amino acids have been replaced with one or more amino acids may also have G-CSF activity. For example, a polypeptide obtained by converting a base sequence corresponding to the cystine of the human interloinkin 2 (IL-2) gene into a base sequence corresponding to serine is an i-peptide. It is already known that it retains interloukin 2 activity (Wang et al .; Science, vol. 1431 (1984)). Therefore, as long as the naturally occurring or artificially synthesized polypeptide has human G-CSF activity, all the genes encoding such polypeptides are included in the present invention. .

A gene encoding a polypeptide having the activity of human G-CSF activity of the present invention, a recombinant vector having the gene, a transformant having the gene, and the transformant A method for obtaining a polypeptide or glycoprotein having the activity of human G-CSF expressed in the above is briefly described below.

(1) Preparation of probe

The homogeneous human CSF ♦ obtained from the culture supernatant of the tumor cell line CHU-2 was purified.The amino acid sequence of the protein was determined from the N-terminus. After fragmentation, the amino acid sequence of the fragment was also determined.

[Example 3 (i), (ii), (iii)]

From the amino acid sequence, three types of nucleotide probes (A), probes (LC) and probes (IWQ) corresponding to the sequence shown in FIG. 1 were synthesized. (Example 4) The probe (A) is a mixed type probe consisting of 14 consecutive nucleotides.

Probes (IWQ) are used in the cloning of the human kinase kinin gene (Takahashi et al .; Proc. Natl. Acad. Sci., USA, ^ 1931 (1985). ) 30 consecutive nucleotides using dextrin inosine. The probe (LC) was synthesized from the amino acid sequence shown in Example 3 (i), which corresponds to positions 32 to 39 from the N-terminal, based on the base sequence shown in Fig. 3. Done 24 It is a probe consisting of individual nucleotides.

Nucleotide chemical synthesis can be carried out by applying an improved phosphotriester method to the solid-phase method and is described in a review by Harang (Tetrahedron ^ Vol. 3-22 (1983)).

The probe used may be based on the amino acid sequence at a position other than the probe used in the present invention.

(2) Construction of cDNA library

Add the guanidinium cyanate solution to CHU-2 cells, homogenize, and obtain total RNA by CsCI density gradient centrifugation.

After selecting poly (A +) RNA from all the RAs using a cell line (dT) cellulose, single-stranded cDNA was synthesized using reverse transcriptase, and RNase H and E. coli DN A The cDNA was added to obtain a double-stranded cDNA, which was added with an IIC chain and joined to a PBR322 vector having a dG chain added to the Pst I cleavage site. E. coli strain X1776 was transformed to construct a PBR322 cDNA library (Examples 5 and 6).

Similarly, a double-stranded cDNA was ligated to the 連結 gt10 vector using an EcoRI linker to construct a phage-based cDNA library (Example 7).

(3) Screening

A recombinant derived from the PBR322 cDNA library was immobilized on Pittman 541 filter paper, and colony hybridization was performed using a probe (IWQ) radiolabeled with ³² P. One clone was selected. This clone was applied to the Southern blotting method (Southern: J. Mol. Biol. 98: 503 (1975)). When used in more detail, the probe (A) was also hybridized.

The nucleotide sequence of this clone was obtained by the Sidge method.

Science Volume 1205 (1981)).

Figure 2 shows the nucleotide sequence of the obtained cDNA insert. As shown in FIG. 2, this cDNA insert consists of 308 base pairs including the probe (IWQ) and the probe (A), and contains the amino acid sequence shown in Example 3 (iii). It was found that it possessed the ability to code 83 amino acids-a open reading frame. The PBR322-derived plasmid containing 308 base pairs is abbreviated as pHCS-1 below. (Defeat 8)

A DNA fragment containing 308 base pairs obtained from PHCS-1 was radiolabeled by the nickel-slanking method (see Hole cul- lar cloning described above), and this was used as a probe. Plasmid cDNA library (from Benton)

Oavis; Screening, Science, Vol. 196, p. 180 (1977)) to obtain 5 clones, and the base sequence of clones thought to contain cDNA as described above. It was determined in the same way. (Fig. 3 (A))

As shown in FIG. 3 (A), this cDNA insert has one large open reading frame.

The amino acid sequence encoded by this cDNA can perform as shown in FIG. 3 (A).

By comparison with the N-terminal amino acid sequence of the G-CSF protein shown in Example 3 (i), this cDNA was found to be 32 to 34 nucleotides from the 5'-end. Beginning with the ATG sequence at the nucleotide position and ending with the GCC sequence at positions 119-121, a signal peptide encoded by 90 base pairs and the ACC sequence at positions 122-124 650-652 It was found to contain the nucleotide sequence corresponding to the mature G-CSF polypeptide encoded by 531 base pairs ending with the CCC sequence at position 1. Therefore, the polypeptide of the amino acid sequence I shown in FIG. 3 (B) is composed of 207 amino acids, and has a molecular weight of 207.

22292.67 Daltons were calculated. Similarly, the polypeptide of amino acid sequence E consisted of 177 amino acids and had a molecular weight of 18986.74 daltons. (Example 9)

However, regarding the initiation site of the protein, ATG at positions 32 to 34 or 68 to 70 can be considered in the same manner. The E. coli X1776 strain harboring PBR322 with this CDNA (+ VSE) inserted into the EC0R1 cleavage site was deposited at the Research Institute of Microbial Industry and Technology of the Agency of Industrial Science and Technology. (FERM Deposit No. BP-954).

FIG. 5 shows the restriction enzyme cleavage sites of the obtained gene. The plasmid obtained by linking this cDNA with pBR327 [Soberon et al., Gene j, p. 287 (1980)] at the EcoRI site is referred to as PBRG4. PBRG4 obtained in this manner is converted with the restriction enzyme EC0RI. The DNA fragment containing about 1500 base pairs of cDNA obtained by the treatment is radiolabeled by the nickel tran- sition method (see Molecular Cloning, supra), and used as a probe again. From i gtio

The cDNA library was screened using a plaque hybridization procedure (see Benton and Davis, supra). This At the same time, two sheets of nitrocellulose arrest paper with immobilized sphage DNA were prepared at the same time, and Zhou-sama's plaque-hyperidization solution was probed using the probe (LC) mentioned earlier. And selected positive phages in both props. The clones considered to be full-length were selected, and the nucleotide sequence of the cDNA insert was determined by the didexy method, as shown in FIG. 4 (A).

This CDHA has one large open reading frame, and the encoded amino acid sequence is interrupted as shown in FIG. 4 (A).

By comparison with the N-terminal amino acid sequence of the G-CSF protein shown in Example 3 (i), this CDN A was 31-33 nucleotides ATG from the 5'-terminal. Starting with the sequence, ending with the GCC sequence at positions 118-120, the signal peptide encoded by 90 base pairs and starting with the ACC sequence at positions 121-123, ending with the CCC sequence at positions 640-642 Mature G-encoded by 522 base pairs

It was found that it contained the nucleotide sequence corresponding to the C8F polypeptide. Therefore, the polypeptide of the amino acid sequence I shown in FIG. 4 (B) is composed of 204 amino acids and has a molecular weight of 204 amino acids.

It was calculated as 21977.35 daltons. Similarly, the polypeptide of the amino acid sequence E was composed of 174 amino acids and had a molecular weight of 18671.42 daltons. (Example 10)

However, regarding the start site of the protein, ATG at positions 58 to 60 or 67 to 69 in addition to positions 31 to 33 may be considered in a similar manner.

Escherichia coli harboring PBR327 with this cDNA (—VSE) inserted at the EcoRI cleavage site ♦ The E. coli X1776 strain is Deposited with the National Institute of Advanced Industrial Science and Technology (FERH Deposit No. BP-955). FIG. 5 shows the cleavage site of the ocular antioxidant enzyme obtained. A plasmid obtained by binding this cDNA to PBR327 at an EcoRI site is referred to as PBRV2.

(4) Construction of E. coli replacement vector

(A) + VSE replacement vector

From the BRG4 plasmid thus obtained (Example 9), a cDNA fragment of G-C3F polypeptide was cut out with a restriction enzyme, and this was excised.

(1) Whether a fragment prepared from PKK223-3 (Pharmacia) containing the tac promoter and an annealed synthetic linker are ligated (ligation) to construct a replacement vector ( Example 11> (FIG. 6),

② P _L Pro including motor one pPL-lambda connecting the three pieces and Annie-ring synthetic linker chromatography prepared from (full Arumashia Co.), to construct a recombinant vector te and reconstituted (Example 12) (FIG. 7)

Or

(3) A fragment prepared from pOYI plasmid containing trp promotor is ligated to the annealed synthetic linker to construct a recombinant vector (Example 13) (Figure 8).

(Β) — VSE conversion vector

Using PB V2 plasmid (Embodiment 10), three types of replacement vectors are constructed around the circumference (Embodiment 18) (FIGS. 9, 10, and 11). (5) Preparation, culture and expression of a transformant using E. coli as a host. Next, the calcium chloride method or rubidium chloride method described in the above-mentioned Molecu lar cloning using the three types of replacement vectors for the + VSE system and the -VSE system, respectively.

E. coli DH1, E. COM H4830 or E. COI .JH105 strains were transformed. (Examples 11, 12, 13 and 18) The obtained transformant was first cultured in an ampicillin-containing luria (ria) medium, and then, if necessary, induced appropriately, followed by culturing. The expression was performed. (Examples 14 and 19)

(6) Recovery and purification of G-CSF polypeptide from E. coli

Amino acid analysis

The culture of the transformant is collected by centrifugation to collect the cells, and then treated with lysozyme, followed by freezing and thawing, and then lysing. The cells are lysed to obtain the supernatant, or the supernatant is obtained by centrifugation after treatment with guanidine hydrochloride.

This was subjected to gel filtration with a Urogel ACA54 column (manufactured by LKB), and the active fraction was concentrated with an ultrafilter.

Next, an aqueous solution of trichloroacetic acid containing n-propanol is added, left on ice, centrifuged, and adsorbed and eluted with 18 columns of reversed-phase C. After elution, the activity of each fraction was examined, and an active peak was collected, subjected to the same purification procedure as above, and then freeze-dried. This freeze-dried powder is dissolved and subjected to high-speed molecular sieving chromatography, and the obtained polypeptide is subjected to SDS-polyacrylamide gel electrophoresis. A single band showing a polypeptide was identified. (Examples 15 and 19) The polypeptides obtained in this way show human G-CSF activity. Was. (Examples 16 and 19) Furthermore, the amino acid composition of the obtained G CSF polypeptide was determined using a special amino acid by using a Hitachi 835 amino acid automatic analyzer (manufactured by Hitachi, Ltd.). It was analyzed by acid analysis. N-terminal amino acid analysis was carried out by Edman degradation using a gas-phase sequencer, and using a high-speed liquid chromatograph and a Urasphere-0DS column. (Examples 17 and 20)

(7) Construction of a recombinant vector for animal cells

The construction of a recombinant vector (derived from BPV) when using C127 cells or ΝΙΗ3-3 cells as host animal cells and a recombinant vector (derived from dhfr) when using CH0 cells are performed using the + VSE system. — Performed each for the VSE system. Here, "Construction of a recombinant vector for C127 cells and CH0 cells" is abbreviated, but see the Examples for details.

(A) + Construction of VSE conversion vector

After incorporating the CDNA (+ VSE) fragment obtained in ( ³ ) above into the vector pdKCR to obtain PHGA410 plasmid (Example 21) (FIG. 12), this was partially digested with EcoRI, and the ends were planted. End (blunt end). To this DNA was added Hindlinker, followed by HindEI treatment and T4 DNA ligase treatment, and then the E.coli DHI strain was transformed using the rubidium chloride method (see above, Molecular cloning). The resulting plasmid is named pHGA410 (H) (Figure 13).

Treat PHGA410 (H) with Sal I, then blunt the ends, re-treat with HindHI and collect the Hif dfll Sal I fragment On the other hand, PdBPV-1 plasmid containing the transformant fragment of Papilloma virus was treated with HindBI, Pvuu to separate the larger DNA fragment, and the Hind IE-Sal I fragment was ligated to this fragment. . This is used to transform E.coli DHI strain to obtain pTN-G4, a plasmid having CSF-CDNA derived from PHGA410 (Figure 13) (Example 22) _α

On the other hand, pHG (-dhfr), a replacement vector for CH0 cells (+ VSE), was constructed using PHGA410 plasmid or pHGA410 (H) plasmid and pAdD26SVf) A plasmid (Fig. 14a and b) (Examples). twenty four) .

(B) Construction of a VSE-based replacement vector

After assembling the cDNA (--VSE) fragment obtained in (3) above into vector pdKCR to obtain a PHGV2 plasmid-(Example 27) This is partially digested with EcoRI, and the end is blunted. To the end (blunt end). HindDI linker was added to this DNA, followed by HiHI treatment and T40NA ligase treatment, and then the E. coli DHI strain was transformed using the rubidium chloride method (see above, Molecular cloning). Converted. The obtained plasmid is named pHGV2 (H). (Fig. 16) pHGV2 (H) was treated with SalI, then the ends were plant-ended and then treated again with HindDI to recover the HindH-SalI fragment. The resulting pdBPV-1 plasmid is treated with Hindffl and PvuI to separate the larger DNA fragment, and the Hindi-SalI fragment is ligated to the larger DNA fragment. Using this, the E. coli DHI strain is transformed to obtain pTN-V2, a plasmid having CSF-cDNA derived from PHGV2 (Fig. 16) (Example 28). PHGV2-dhfr, a recombinant vector (one VSE) for CH0 cells, was constructed using PHGV2 plasmid or pHGV2 (H) plasmid and pAdD26SVpA plasmid in the same manner as VSE (Figs. 17a and b). Example 30).

(8) Expression by animal cells

In this section, we will discuss the outline of the expression of mouse C127 cells. See each example for details.

pTN G4 plasmid or ρΐΝ-V2 plasmid has been treated with BamHI. Using this, C-127 cells grown in culture are transformed by the calcium phosphate method. The transformed cells are cultured and clones having high CSF-producing ability are selected. The glycoprotein of the expressed G-CSF was recovered and purified from the culture of the transformed cells, and it was confirmed that the glycoprotein exhibited human G-CSF activity. The target glycoprotein was also confirmed by amino acid analysis and sugar content analysis of the sample.

For the sugar content analysis, the CSF sample used for the amino acid analysis was used. The quantification of sialic acid was carried out, respectively. The quantification method is described in Chapter 13 of Biochemistry Experiment Course, Vol. 4, “Carbohydrate Chemistry (2nd volume)” (Tokyo Chemical Shujin). The weight% was converted from each quantitative value. The sugar content of the obtained G-CSF was distributed in the range of 1 to 20 (% by weight) depending on the host cell, expression vector, culture conditions, etc. Was .

The present invention also relates to an agent for preventing infection comprising human G CSF as an active ingredient. Also provide.

Human G-CSF, which is an active ingredient of the present invention, can be obtained by the above-described gene recombination technique, and was disclosed, for example, in the aforementioned patent (Japanese Patent No. 59-153273). A hybrid obtained from human CSF-producing cells (CHU-1 or CHU-2) according to the method, or a cell fusion of G-CSF-producing cells with self-proliferating malignant tumor cells Ma can also be obtained by culturing the yeast in the presence or absence of mitogen.

The human G-CSF obtained by these methods is all included in the present invention. _(The obtained human G-CSF-containing solution may be further purified and concentrated by known means as necessary, and then frozen and stored. Alternatively, the cells can be stored by removing water by means such as freeze-drying or vacuum drying, or, if desired, dissolving human G-CSF in an appropriate buffer, followed by milling. It can also be used as an injection by aseptically removing it through a pore filter or the like.

In addition, the infectious agent of the present invention comprises a pharmaceutical carrier and an excipient necessary for taking a form as a pharmaceutical preparation suitable for human or veterinary medicine, and further comprises a stabilizing agent and an adsorbent. Can contain inhibitors.

The dose and frequency of administration of the human G CSF contained in the infectious protective agent of the present invention can be determined in consideration of the condition of the target patient, but usually 0.1 to 500 ^ per adult. §F A formulation with a human G-CSF, preferably between 5 and 100 §f, can be administered 1 to 7 times per week. However, the present invention is not limited by the content of human G CSF.

Infection protective agent containing human G-CSF of the present invention as an active ingredient is used Examples of target infectious bacteria that can be performed include various bacteria, and are not particularly limited. Among them, Staphylococcus spp., Streptococcus spp., Etc. Gram-positive cocci, enterobacteria such as Escherichia, Serratia, and Klebsiella, and Gram-negative facultative anaerobic bacteria, including Hemofilus, seromonads, and alkaline Gram-negative aerobic bacteria such as Genes, Gram-negative anaerobic bacteria such as Pacteroides, fungi such as Candida and Aspergillus, and intracellular parasites such as Listeria. (1) A protective effect can be obtained against single infection or multiple infections caused by several bacteria.

〔 Example〕

Hereinafter, the present invention will be described in detail with reference to Examples, but before that, a method for measuring CSF activity and a human from CHU-1 (isolation of 3-CSF and its physicochemical properties will be described in Reference Examples. Please.

<Reference Example 1> Measurement method of CSF activity

The method for measuring CSF activity (hereinafter abbreviated as CSA) used in the present invention is as follows.

"How to measure CSA"

(3) When using human bone marrow cells;

It was performed by a single-cell agar culture method according to the method of Bradley TR, Hetcalf D. et al. (Aust. J. exp. Biol, med. Sc, vol. 41, pages 287-300, 1966). That is, fetal serum 0.2 ^, test subject 0.1 ^, human bone marrow non-adherent cell suspension 0.1 (1-2 x 10 ⁵ nucleated cells), modified McCoy's 5A culture 0.2, agar

Modified HcCoy's 5A culture containing 0.4% After solidifying in a tissue culture plastic dish of Sir, the cells were cultured at 37% in 5% carbon dioxide / "95% air, 100% humidity" conditions. One colony (a colony of 50 or more cells was defined as one colony) was counted, and the activity of forming one colony was defined as one unit (UiUt), and CSA was determined.

(b) when using mouse bone marrow cells;

ゥ serum serum 0.4, test sample 0.1, C3H / He (mes) mouse bone marrow cell suspension 0.1 ^ (0.5 to 10 ³ nucleated cells), and modified McCoy's 5A culture 0.4% containing agar 0.75 9 0.4 ^ mixed Chi was allowed et Katama placed in plastic Kdei Tsu Gerhard tissue culture having a diameter of 35 / Betaramuda, at 37, 596 carbon dioxide / ^/ 95% air, and cultured hand 5 days under the conditions of 100% humidity, The number of colonies formed (a colony consisting of 50 or more cells is referred to as ί colony) is counted, and the activity of forming one colony is defined as 1 unit (Un '). Was

The “modified HcCoy's” used in the methods (a) and (b) above

The 5A culture solution and the human bone marrow non-adherent cell suspension used in (a) were prepared as follows.

"Modified HcCoy's 5A culture solution (2x concentration)"

McCoy's 5A culture solution (GIBCO) 12§f, MH amino acid vitamin medium (Nissui Pharmaceutical) 2.553, sodium bicarbonate 2,183, penicillin and calcium 50000 After dissolving the unit twice in 500 ^ distilled water, it was sterilized with a 0.22 ^ m Millipore filter.

`` Human bone marrow non-adherent cell suspension ''

Normal human sternum; bone marrow fluid obtained by puncture was added to RPHI 1640 culture solution. 5 times, overlay on Ficol-Paque solution (Pharmacia), and centrifuge at 400X for 30 minutes at 25 to collect the cell layer at the interface (specifically 1.077). After washing the cells, adjust the concentration to 5 x 10 ° Cels / ££ with RPMI 1640 culture solution containing 2096 ゥ fetal serum, place in a 25 ² plastic culture flask, and cultivate carbon dioxide. After Bok Lee Nki Yube 30 minutes at vessel, the non-adherent cells supernatants were collected and placed in a re-25ca ² plastic flasks, after Bok Lee Nki Yube 2 hours 30 minutes, non-adherent supernatant Cells were collected and used.

<Reference Example 2> Isolation of human G-CSF

Human G- 'CSF was isolated and purified from the culture supernatant of human G-CSF-producing cell Cffli-1 (CNCH accession number "I-315") by the method described in Example 2 below.

The human G-CSF obtained in this manner had the following physicochemical properties.

) Approximately 19,000-1,000 as measured by molecular sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

I) Isoelectric points The three isoelectric points (A,

B, C) have at least one of them. I Isoelectric point (PI)

Value in the presence of 4 M urea Value in the absence of urine

A 5.7 Sat 0.1 5.5 Person 0.1

B 5.8 ± 0.1

C 6.3 0.1 0.1 6.1 0.1

I) Ultraviolet absorption: It has a maximum absorption at 280ron and a minimum at 250.

IV) The amino acid sequence up to the 21st residue from the N-terminus is as follows.

H 2 N-Thr-Pro-Leu-Θ.Ιγ-.Ρτο- Α la ^

(Ten)

-Ser-Ser-Leu-Pro-GIn- (Ser) -Pe-

(20)

L eu-L eu-L ys— X-L eu- G lu- X-V al-

V) Amino acid composition: It has the amino acid composition shown in Table 1 IT below.

Table — H

Example 1 Establishment of CHU-2

Tumors from patients with oral floor cancer with marked neutrophil enrichment were transplanted into nu nu mice. Approximately 10 days after transplantation, the tumor showed marked tumor growth and increased neutrophils. The tumors were aseptically excised after transplantation 12 days, minced into 1 ~ 2 m ³ corners, and cultured as follows this.

Put the shredded tumor mass ^ ~ 15 pieces into a 50 plastic centrifuge tube, add 5 ^ Tribsin solution (containing 0.25% Tribsin, 0.02% E0TA), and in a warm bath at 37 for 10 minutes After shaking, the supernatant was discarded, and a solution of peritubulin solution 5 was added again, followed by tribasin digestion while stirring at 37 ° C for 15 minutes. The cell suspension of the supernatant was recovered, and fetal serum was added to stop the action of tribsin, and then stored in water.

The above procedure was performed again to collect the cell suspension, and a cell pellet was obtained by centrifugation at 1,500 rpm for 10 minutes together with the previous one. F 10% - After washing hands twice 10 were implanted Ensure a cell concentration of 5 X 10 ⁶ cells Nofurasuko to 25 ^ 1 ² plastic culture flasks.ゥ Using F-10 culture solution containing 10% fetal serum, incubate overnight in a carbon dioxide gas incubator (carbon dioxide concentration 5%, humidity 100%), and then supernatant Was removed together with the non-adherent cells, and the culture was continued by adding a new culture medium. At the time of the start of the culture, the cells proliferated at the 6th time. At this point, the culture medium was replaced with a new one. On the next day, discard this culture solution and go around with anti-mouse erythrocyte antibody (Cappel) diluted 5-fold with RPHI 1640. Guinea pig complement (manufactured by Toto Pharmaceutical Co., Ltd.) 2 diluted 2.5-fold with RPHI 1640 was added, and incubated at 37 for 20 minutes. After the incubation, the cells were washed twice with F-10 containing 10% fetal bovine serum to remove fiuplasts derived from nu / nu mice, and then F-10 culture containing 10% fetal bovine serum was continued. The solution was added, and the cells were further cultured for 2 days. Then, a part of the cells was removed, and the cells were cloned by the limiting dilution method.

The CSF activity of the obtained 11 clones was examined. As a result, a clone (CHU-2) having approximately 10 times the activity of the other clones was obtained.

Example 2 CSF isolation

Cells were collected from ^two 150 cm2 culture flasks in which the cells established as described above had grown completely densely, and transferred to 500 F-10 culture medium containing 10% fetal calf serum. After floating, it was transferred to a glass port of 1580cffl ² (made by Belco).

Rotary culture was performed at a speed of 0.5 rpI. When the cells were completely and densely grown on the inner wall of the roller port, the culture medium was replaced with serum-free RPHI 1640, and after culturing for 4 days, the culture supernatant was collected and the fetal serum was recovered. Add 10% F-10 and continue the culture. After culturing for 3 days, the solution was again changed to serum-free RPHI 1640, and the culture supernatant was recovered after 4 days. By repeating the same procedure in the following, a serum-free culture supernatant of 500 / ^ each week was obtained from one bottle per week, and for a longer period of time by this method. It was possible to maintain cells and recover the culture supernatant. 5 ϋ of the obtained culture supernatant was used as one batch, and 0.01% Tween 20 was added to the batch.Then, using Hoi low Fiber DC-4 and Araicon PH-10 (manufactured by Amicon Inc.) After being concentrated approximately 1000-fold by the compost method, it was purified in the following order.

(i) 0.01 M Tris containing 0.15 MNa CS and 0.01% thin 20 (Hansui Chemicals) using a Uroge I AcA54 column (manufactured by LKB) having a diameter of 4.6 c and a length of 90. The concentrated culture supernatant 5 was passed through a gel buffer using a hydrochloric acid buffer (PH7.4) at a flow rate of about 5θΑώΖ hours.The column was previously prepared with serum albumin (molecular weight 67,000), Krypion was performed with pumine (molecular weight: 45,000) and cytochrome C (molecular weight: 12,400). After diluting 10-fold, the components showing activity were examined by the above-mentioned “Method for measuring CSA (b).” As a result, V e =

It was found that the fractions 400-700 showed macrophage-dominant CSA and the fractions with Ve = 800-1200 /) ώ showed granulocyte-dominant CSA. The mixture was collected and concentrated to about 5δώ by an ultra-low temperature regulator using ΡΜ-10 (manufactured by Amicon).

(ϋ) Add 0.1% aqueous solution of triflic acid containing 30% of n-propanol (Tokyo Kasei Co., Ltd. for amino acid sequencing) to the concentrated fraction and add it to ice for 15 minutes. After standing, the precipitate was removed by centrifugation at 15,000 pm for 10 minutes. Followed by n-propanol and trichloroacetic acid After adsorption on a Bondapak C18 column (Waters, semi-preparative, 8 / ffls _{X30 Cflt} 〉) equilibrated with an aqueous solution, 0.1% _triethyl containing n-propanol with a linear concentration gradient of 30 to 60% was used. The solution was eluted sequentially with an aqueous solution of fluoroacetic acid, using a Hitachi 685-50 high-speed liquid chromatograph and a Hitachi 638-41 detector (both manufactured by Hitachi, Ltd.) for detection.

The absorption of 280 ras was measured simultaneously. After elution, 10 µl of each fraction was collected and diluted 100-fold, and then the fractions showing activity were determined by the above-mentioned “CSA measurement method (b) J. As a result, n-propanol was determined. Since activity was observed in the peak eluted at 40%, this peak was collected, re-chromatized again under the same conditions, and the CSA was examined in the same manner as above. Since the activity was observed in the peak at the position of 40%, this peak was collected (4 fractions = 4 id) and freeze-dried.

(iii) Dissolve the freeze-dried powder in 200 ml of 0.1% aqueous solution of trichloroacetic acid containing 40% of n-propanol,

High-speed liquid chromatography (HPLC) using TSK-G 3000SW power ram (Toyo Soda Co., Ltd., 7.5 _× 60 _Cffl ) was performed. The elution was carried out at a flow rate of 0 min using the peripheral aqueous solution, and fractionation was carried out using a fraction collector FRAC-100 (manufactured by Pharmacia). The fractions collected were examined for CSA in the same manner as described above. As a result, the fraction having a retention time of 37 to 38 minutes (equivalent to a molecular weight of about 20,000) was found to be active. Collect fractions for further analysis After purification using a Bondapak C18 column (0.6 x 30 csi), the main peak was collected and lyophilized. When the obtained sample was assayed by the above-mentioned “Method for measuring CSA (a)”, it was found that the sample had human G-CSF activity.

Example 3 Determination of amino acid sequence

(i) Determination of amino acid sequence at NI-terminal

The sample was digested with Edman using a gas-phase sequencer (manufactured by Applied Dubai Saiki Systems), and the resulting PTH amino acid was subjected to a high-speed liquid chromatograph (Beckman Inn). The analysis was performed by a conventional method using an IHtrasphere-0D8 column (manufactured by Storment) and an IHtrasphere-0D8 column (manufactured by Peckman * Instrument). Column (5 m, diameter 4 '. & 4, length 250 鯽) equilibrated with starting buffer (aqueous solution containing 15 mM sodium acetate buffer PH4.5, 4096 acetonitrile) After that, a sample (dissolved in a 20 ^ starting buffer) was injected, and separation was performed by isocratic elution with a starting buffer. The flow rate was kept at 1.4βώ and the column temperature was kept at 40. The detection of PTH amino acid was based on UV absorption at 269 and 320 / wt. The standard PTH amino acid (manufactured by Sigma) 2 nmois were separated in a single system in advance, the retention time was determined, and identification was performed based on the retention time of the test sample. As a result, the amino acid sequence from the N-terminal to the 40th residue was determined as follows. H 2 N-Thr-Pro-Leu-Gly-Pro-AIa-Ser-

(Ten)

S er-L eu-P ro- G In- S er- P he- L eu- L eu- (20)

Ys-Cys-Leu-Glu-GIn-Val-Arg-Lys-

(30)

I le-G ln- G ly- A sp- G ly- A la- A la-L eu- G in-G lu- L ys- L eu- Cys- A la- T hr- T yp-

(40)

L ys-

(ii) Procyan decomposition

The sample was dissolved in 70% formic acid, and 200 equivalents of sublimated purified cyanide were added and reacted at 37 ° C overnight. Next, the reaction product was freeze-dried, and fractionated by HPLC using a TSK G3000SW column (manufactured by Toyo Soda Co., Ltd.) to obtain four peaks. The peaks were named CN-1, CN-2, CN-3, and -4 in descending order of molecular weight, and the amino acid sequence of -1 CN-2 was determined by the automatic gas phase sequencer (Applied Dubai). (Manufactured by Toshi System) under the same conditions as (（).

As a result, it was found that -1 was an peptide from the N-terminus of the G-CSF protein. In addition, CN-2 had the following amino acid sequence.

P ro- A la- P he- A la- Ser er A la- P he- G I n-

A rg- A rg- A la- G ly- G ly V a I-Le eu— V a I-A I a- Ser-His— L eu— G I n- (iii) Trypsin degradation

Dissolve the sample in 0.1 M Tris-HCl buffer (PH7.4) containing 8 M urea, and add 0.1% Tris containing 0.1% 2-Methylcaptoethanol. Sulfuric acid buffer (PH7.4) was added to adjust the final concentration to 2 M urea. Next, TPCK-treated trypsin (trade name, manufactured by Sigma) was added so that the sample and the enzyme became 50: and reacted for 4 hours at 25. Then, the same amount of TPCK-treated trypsin was added. The reaction was carried out again at 25 for 16 hours. After the reaction, the reaction product was subjected to high-speed reversed-phase column chromatography using a C8 column (manufactured by Yamamura Chemical Co., Ltd.). Elution was performed using n-propanol containing 0.196 TFA, and the n-propanol concentration was increased linearly from 5% to 60%. Of the peaks obtained by measuring the UV absorption of 280. The main peak was obtained under the same conditions as in (i) using an automatic gas phase sequencer (manufactured by Applied Dubai Saisei Systems). The sequence was analyzed. As a result, it was found that the main peak was a peptide having the following sequence containing a part of the CN-2 new fragment of (ii).

G In-L eu- A sp- V al-A la- A sp- P he- A la-

T r- T hr- I le- T rp- G ln- G ln- Met- G lu- G I u-Leu- G I y- Met-A la- Pro— A la- eu—

G In-Pro—Thr-G in-G Iy-A la-et-Pro-A la-P he-A la-Ser-

(i) Synthesis of probe (IWQ)

From the amino acid sequence obtained in Example 3 (iii), II e—T rp—G In-G In—Met—Glu-Glu-Leu—Gly—Met Based on the sequence of the amino acids, 30 contiguous nucleotides were obtained (Figure 1). In the arrangement of Figure 1, for example The nucleotide at position 9 from the 5'-end indicates that the mixture contains equal amounts of dA and dG. The starting nucleotides were mainly dimers, and mononucleotides were used as needed. Add 20 fl¾f of the starting material nucleotide resin Ap-d (G) (manufactured by Yamasa Shoyu Co., Ltd.) to the column with a glass filter, wash with methylene chloride, and repeat the 3% The 4,4′-dimethyloxytrityl group was eliminated with a methylene chloride solution containing chloro S acid, and the column was washed several times with 1 methylene chloride. J click After replacing the solvent was washed净over anhydrous pin lysine Reochi Dodaima _{(DMTr) ApTp (NHR 3)} ( manufactured by Nippon Zeon Co., Ltd.; NHR ₃ is Bok Li ethyl Ruanmoniu厶, DHTR is a dimethyl Bok carboxymethyl Application Benefits Chill Shown) 20 fl¾f and 0.2 ^ pyridine were added, and the column was vacuum dried with a vacuum pump. Then, 2,4,6-trimethylbenzenesulfonyl-3-nitrotriazolide (MSNT, manufactured by Wako Pure Chemical Industries, Ltd.) and anhydrous pyridin 0.2βώ were added. The inside of the system was replaced with nitrogen gas, and the mixture was shaken occasionally at room temperature for 45 minutes to condense the nucleotide resin and the dimer. After completion of the reaction, the column was washed with pyridine, and then the unreacted 0-group was acetylated with an excess of acetic anhydride-4-4-dimethylaminopyridin, followed by acetylation. The column was washed again with pyridine. Similarly,

{DMTr) Ip (NHR ₃ ), (DMTr) GpGp (NHR ₃ ),

(DMTr) Ip (NH), (DHTr) CpTp (NHR ₃ )

Equivalent mixture of (DHTP) TpTp (NHR ₃ ), Equivalent mixture of (DMTr) ApAp (NHR) and (OMTr) ApGp (NHR ₃ ), (DMTr) ApGp (NHR ₃ ) And (DHTr) GpGp (NHR ₃ ), (DHTr) GpAp (NHR ₃ ) (DHTr) TpGp (NHR ₃ ), (DHTr) ApAp (NHR ^)

(DHTR) equal mixture of _{GpAp (NHR 3) (DHTr)} CpAp (NHR 3) (DHTr) equal mixture of ApAp and (NHR ₃₎ and _{(DHTr) ApGp (NH 3)} , (DHTr) GpCp (NH ₃ ), (DHTr) TpGp (NH ₃ ),

(DHTr) Ip (NHR ₃ ), (DMTr) ApTp (NHR ₃ )

[(DHTr) Ip (NHR ₃ ) was manufactured by Yamasa Oil Co., Ltd., and all others were manufactured by Nippon Zesai Co., Ltd.]. After completion of the reaction at the final stage, the resin was washed with a stilt of pyridine, methylene chloride, and ether without being acetylated and dried. After suspending the dried resin in a mixed solution 1.7 of a dioxane containing 1 M tetramethyl tildinidine and 1 M α-picolinaldoxime, i; pyridine 0.5; ^, water, After standing at room temperature overnight, the solution was concentrated under reduced pressure to 100 to 200〜. After adding a small amount (2 to 3 drops) of pyridine to this concentrated solution, concentrated ammonia water 2-3 ^ was added, and the mixture was heated at 55 ° C for 6 hours. Then, ethyl acetate was added for extraction and separation. The resulting aqueous layer was concentrated under reduced pressure, and dissolved in 50 mH triethylammonium acetic acid solution (PH7.0) to give C-18 column (1.0 × 15, Waters (made by Waters). Elution was performed with a 50% triethylammonium acetic acid solution (PH7.0) using an acetonitrile having a linear concentration gradient of 10% to 30%, and an acetonitrile concentration of 25%. The peak fraction eluted in the vicinity of% was concentrated under reduced pressure.

809 Acetic acid was added to this concentrated solution, and the mixture was left at room temperature for 30 minutes, and then extracted with ethyl acetate. 層 The separated aqueous layer was concentrated under reduced pressure. Shrunk. The resulting concentrate, C 18 column (Sensi Yoo over Scientific Co., SSC- 0DS - 272, 6 Φ X 200 M) was subjected to髙速performance liquid Loma Bok graph I one with, and et al Purified. Elution was performed using _acetonitrile with a linear concentration gradient of 10% to 20% in 50fflH triethylammonium acetic acid solution (PH7.0), and synthetic DNA was obtained in a yield of 10A _26Q units or more. Obtained.

The obtained talents were obtained by the Haxam-Gilbert method (Meth.

As a result of examining the nucleotide sequence according to page 499 (1980), it was confirmed that it had the sequence shown in FIG.

(ii) Synthesis of probe (A)

From the amino acid sequence obtained in Example 3 (iii), 14 amino acids were determined based on the sequence of 5 amino acids represented by Met-Pro-Ala-Phe-Ala. Consecutive nucleotides were obtained. '(Figure Ί)

The synthesis was carried out in the same manner as in the case of the probe (IWQ), and (DHTr) CpAp (NHR ₃ ) was added to the nucleotide resin AP-d (T) (Yamasa Corporation).

(DMTr) GpGp (NHR ₃ ; (DHTr) CpAp (NHR ₃

(DMTr) CpTp (NHR ₃ , (DHTr) CpGp (NHR ₃ and

(DMTr) CpCp (Equivalent mixture of NHR ^; (DHTr Ap6p (NHR)

(DHTr) TpGp (NHR ₃ , (DHTr) GpGp (NHR ₃ and

(DHTr) CpGp (equal mixture of _{NHR 3; (DMTr ApAp (NH} 3)

(DHTr) CpAp (NH ₃ and (DMTr) Cp6p (NHR ₃ Equivalent mixture

(DHTr) Gp (NHR,) (all manufactured by Nippon Zeishin) was condensed in this order to obtain about 10A 260 units of synthetic DNA. The nucleotide sequence of the obtained oligonucleotide was examined by the Maxam-Gilbert method, which confirmed that it had the nucleotide sequence shown in Figure 1. Was.

(iii) Synthesis of probe (LC)

Automated synthesis was performed using a DNA synthesizer 380A from Applied Dubai Saisei System. This method is based on the principle described by Caruthers et al. (J. Am. Chela. Soc., JJ1: 3185 (1981)) and is called the phosphoamidite method.

After condensing the dG-S (S is a support) deprotected from the 5 'dimethyltrityl group (DHTr) with the phosphoramidite of (DMTr) -dT, which has been activated in advance with tetrazole Unreacted hydroxyl groups were acetylated, and then subjected to iodine oxidation in the presence of water to lead to phosphoric acid. The DHTr group was deprotected, and then the condensation was repeated in a similar manner to synthesize 24 nucleotides having the sequence shown in Fig. 1.The obtained nucleotides were cleaved from the support and removed. After protection, the product was purified by reversed-phase high-performance liquid chromatography using a C18 column (SSC-0DS-272 manufactured by Sensyu Kagaku).

Example 5 Culture of CHU-2 cells and purification of mRNA

1) Culture and recovery of CHU-2 cells

After closely grown completely the established the CHU-2 cells into two 150 ² culture flasks, after suspended in RPMI 1640 culture solution 500 ^ containing 10% © shea calf serum which, 1580OB ^The mixture was transferred to a glass-made roller port (manufactured by Belco), and the rotation culture was performed at a speed of 0.5 rpm for 4 days. When the cells have grown completely and densely on the inner wall of the roller bottle, remove the culture solution from the roller bottle, add physiological saline containing 0.02% of EDTA pre-warmed to 37, and add for 2 minutes at 37. After warming, by pipe operation The cells were drowned. The cell suspension obtained is centrifuged at 1500 rpm for 10 minutes to obtain a cell pellet. The cells were resuspended in 5 fflg of EIA-free saline, and centrifuged at 1500Γ PM for 10 minutes to obtain a cell pellet (wet weight: about 0.83). The cells thus obtained were Store frozen at -80ί until RNA extraction.

2) mRNA purification

Isolation of mRNA from CHU-2 cells obtained as described above was performed essentially as described in "Molecular cloning," [Maniatis et al., Cold Spring Harbor, p. (1982)]. The frozen CHU-2 cells (wet weight: 3.8 gf) were added to 20% of a 6 M guanidine solution (6 M guanidine cyanide, 5 mM sodium citrate (pH 7.0)). ), 0.1M / 3 -mercaptoethanol, 0.5% sodium sarcosylsulfate)

After mixing well for 2 to 3 minutes with a Vortex mixer, inhalation and ejection were repeated 10 times using a syringe equipped with an 18G injection needle. First, add 5.7M CsCi-0.1M EDTA (pH7.5) (6) to a poly-Lomer centrifuge tube that fits the Beckman SW40T i-mouth. The above cells were broken and filled with a guanidine solution about to become filled. After centrifuging the four centrifuge tubes prepared in this way at 30,000 p.I, 20 ° C for 15 hours, the resulting pellets are reduced to a small amount of 70% ethanol. The plate was washed three times with a tool.

The pellets obtained from each tube were combined and dissolved in 550 ml of water to adjust the NaCi concentration to 0.2M. After treatment with phenol-closed form (1: 1) and closed form, 2.5-fold volume of ethanol was added and ethanol was precipitated to obtain total RNA. . (Approximately 10.1 s¾ total RNA was obtained from 3.8 §f wet cells.)

Purification of poly (A +) -RNA from total RNA was performed as follows. This method utilizes an affinity chromatographic method that utilizes the fact that mRNA has a poly-A chain attached to its 3 'end. It is a trigraph. Rigo (dT)-Cellulose (P-L Biochemical Co., Ltd., Type 7) was used to absorb the total RNA using an adsorption buffer (10mH tris-hydrochloric acid (PH7.5), 0.5 NaCi, fflH EDTA, 0.1%). % SDS solution), heated at 651; for 5 minutes, and passed through a column filled with peripheral solution (dT) -cellulose. Elution was performed with TE solution (10 mM Tris-containing hydrochloric acid (PH7.5) and 1 mM EDTA)). The unadsorbed permeate was passed through the same column again for the same elution procedure, and mixed with the first eluate. Using such an operation, poly (+ A) -RNA4003 was obtained.

The mRNA prepared in this way is described in Schleif and Wensink's Experimental Techniques (Practical Methods in HoI ecu Iar Biology,

Sprigger-Ver Iag, New York, Heiderberg, Berlin, (1981)) and size-fractionation by sucrose density gradient centrifugation using the method similar to that described above. .

In other words, a sucrose density gradient of 5% to 25% is created in a tube for the SW40Ti rotor (made by Bechman). The sucrose solution was prepared by adding 5% and 25% of the RNase free solution to a solution of 0.1M NaCi, 10mM Tris-HCl, (t) H7.5), 1mH EDTA, 0.5% SD8, respectively. Contains sucrose (Schwarz-Hann).

(Poly (A +)-NA) 800〃3 prepared by the method described above was dissolved in a solution of 200i to 500ΤΕ, ripened at 65 ° C for 5 minutes, quenched, and then cooled. Place on the sugar density gradient solution. Collect the fractions after centrifugation at 30000 pm at 20:00 and measure the absorbance at 260 260.Based on the position of the standard RNA (28S, 18S, 5S ribosome RNA) similarly performed, Fractionated

When the size of NA was determined, the G-CSF activity of each fraction was measured at weekly intervals using an oocyte line of the African frog (Xenopus laevis). That is, the mRNA of each fraction was prepared in an aqueous solution of 1 / μ 水溶液 concentration, and injected into a single oocyte taken from a toad frog (about 1 year after birth) at a rate of 50 ng mRNA, followed by 96 wells. the microphone b Thailand - data Pure oocyte placed one by ten to one well of Bok, Bath medium their respective 100〃 (88mH NaCJl, 1 mH Ci, 2.4mM NaHC0 3, 0.82mH MgS0 4, 0.33 mH Ca (NO,) ₂ ,

Culture in 0.41 mH CaCi, 7.5 mH tris-hydrochloric acid (pH 7.6), penicillin, streptomycin sulfate 10ffl-ZJl) for 48 hours at room temperature, collect supernatant, and concentrate ♦ Purify and measure G-CSF activity.

As a result, G-CSF activity was observed in the 15-17S fraction.

Example 6 Synthesis of CDNA (Construction of PBR-based CDNA library) From the poly (A +)-RNA obtained by the above-mentioned method, the method of Land et al. [Nucleic Acids Res, _J Vol. 2251 (1981) ]

The cDNA was obtained by taking into account the method of Gubler and Hoffman [Gene, vol. 263 (1983)]. 1) Synthesis of single-stranded cDNA

Add reagents to a 1.5Βδ tube made by Eppendorf in the following manner. δθ ^ reaction buffer (500mH KCi, 50mM HgCi, 250mH tris-hydrochloric acid, pH8.3), 20 ^ ι 200 200 »distillate slate, 32χζ 12.5ηΗ dNTP (dATP, dGTP , dCTP, each containing 12.5mH the dTTP), 10 i of ³² P- dCTP (Cane-time made, PB 10205), Z2f & of old Li Gore _{_{(dT) 12 _ 18 (P}} - L Biochemical s Co., Ltd., 500? Z), 20 20 of poly (A ⁺ )-RNA (2.1), distilled water 206, a total of 400ί of the reaction solution, ripen at 65 for 5 minutes, and heat at 42 for 5 minutes.Reverse transcription to this reaction solution After adding 120 units of enzyme (Takara Shuzo), and further reacting for 42 hours for 2 hours, RNase inhibitor was added.

(Bethesda Research Laboratories¾), 20 ί

ΤΕ solution, 16 100 of 100 mM sodium pyrophosphate, and 48 units (4 uJ3) of reverse transcriptase were added, and the reaction was performed at 46 for 2 hours. After stopping the reaction by adding 0.5M E0TA 8ί and 10% SDS 8 U, single-stranded CDNA was obtained by immunochloroform treatment and ethanol precipitation (twice). .

2) dC-strand addition to single-stranded cDNA

After dissolving the single-stranded CDNA obtained above in O ^ i distilled water, add 60 d of dC-chain addition buffer (400 mM potassium cholate; 50 mM tris-hydrochloride (PH6, 9)). ： 4 mH slab, 1 mH

CoCi ₉ ; mM dCTP) and heated at 37 for 5 minutes. To this reaction mixture, add terminal transfonase (27 ut ^ !, manufactured by PL Biochemicals) 3 and react at 37 ° C for 2.5 minutes. After that, the mixture was subjected to a treatment with ethanol-cloth form (1 time) and ethanol precipitation (2 times), and dissolved in 40 ml of a TE solution containing 100Π1Η NaCJ !.

3) Synthesis of double-stranded cDNA

The 40 Y of DNA solution 4 I of old Li rubber _{(dG) _ 18 (200 ^} / ίά, PL Bioct emicals Ltd.) was added 65 ° G 5 minutes, followed after heating 30 minutes at 42, the reaction The solution was kept at zero. Add 80 緩衝 of buffer (100 mH of tris-hydrochloric acid ΡΗ7.5, 20 mH

_{_{MgCi, 50mM (H 4) 2}} S0 4, 500mH KC), including 4 of 4 mM dNTP (dATP, dCTP, dGTP, each 4 mM of dTTP), 60 3t of 1 mM 3 - NAD, and 210 I distilled Water, 20

E. coli DNA polymerase (Takara Shuzo), 15 i E. coli DNA ligase (Takara Shuzo), 15 E. coli Nase H

(Manufactured by Takara Shuzo Co., Ltd.) and allowed to react at 12 ° C for 1 hour. Then, add 4 4 of 4 mM dNTP, and react at 25 for 1 hour to obtain phenol-clone. Mouth-form treatment and ethanol precipitation (Ί twice) were performed to obtain about 8 X 3 double-stranded cDNA, which was dissolved in TE solution and electrophoresed on 1.296 agarose gel. The part corresponding to the size of about 560 base pairs (bp) to 2 kilo base pairs () was adsorbed on Wattman DE81 (manufactured by Wattman), and eluted and recovered. Was recovered.

4) Addition of dC-strand to double-stranded cDNA

Dissolve the double-stranded cDNA obtained as above in 40 ^ ί solution, add 8 d of the dC-strand addition buffer described in section 2) and heat at 37 ^ for 2 minutes. ^ タ Terminal Transferase (27 Unit / ί) was added, and the mixture was reacted at 37 for 3 minutes. The reaction solution was immediately cooled to O ^ C, and the reaction was stopped by adding 0.5ME dolling A1, followed by phenol-chloroform treatment and ethanol precipitation. Suspended in ΙΟχί.

5) Construction of pBR cDNA library

Includes 4 liters of commercially available ligato (dG) -strand-added PBR322 vector (Bethesdalisa Ichiba Laboratory, 10 ng / il) and the above dC-strand-added double-stranded cDNA2 containing 75 JI of 0.1 M NaCi The anneal was heated at 65 ° C. for 5 minutes, then at 40 ° C. for 2 hours, and then left to reach room temperature.

On the other hand, the method described in the experimental book of Haniatis et al. [Molecular cloning, Cold Spring Harbor, p. 249 (1982)] was used. Transformation was performed with the annealed plasmid, and a transformant (transformant) was obtained.

Example 7 CDNA synthesis (construction of sphage library)

1) Synthesis of single-stranded cDNA

According to the method described in Example 5, 3. & gf was cryopreserved. From the CHU-2 cells, 400 g of poly (A +) -RNA was obtained through purification with 2-year-old rigo (dT) cellulosic column. Was.

The TE solution 10i in which the poly (A ⁺ )-NA12Sf is dissolved is placed in a reaction tube containing 10 actinomycin D (manufactured by Sigma), and then the reagents are added in the following order. : 20 ^ reverse transcription buffer (250mH Tris-HCl (PH8.3), 40mM HgCJl, 250mM KCil) 20uΰ of 5mM dNTP (dATP, dGTP, dCTP, dTTP) Each including 5 mH), 20 ϋ Oh Li Gore _{_{(dT> 12 _ 18 (0.2}} ^ / id PL Biochemicals , Inc.>, 1 f & of 1 M Jichisaisu Ray door Lumpur 2 ί of 30unit / ί of RNase (Pro main Gapai old Tekusha), 10 i of reverse transcriptase (10un / ^ ΰ Seikagaku Corporation), 1 i of a - made ^[32 p] dATP <10 Ci Cane catcher arm Inc.), of 16 i The reaction solution was made up to a total volume of 100 で with water.After keeping the reaction solution at 42 for 2 hours, the reaction was stopped by adding 0.5 Η EDTA (5) and 20% SDS (1 i). 1-strand of approx. 4 JW3 after treatment with black mouth form (100 J1) and ethanol precipitation (twice)

CDNA was obtained.

2) Synthesis of double-stranded cDNA

The CDHA obtained as described above was dissolved in a 29.βΤΕ solution, and the reagents were added according to the following procedure to prepare a reaction solution; 25ί Polymerase 'buffer (400mH Hepes (pH7.6)) 16mH HgCi ₂ ; 63-mH 3-mercaptoethanol: 270mM KCi): 10]! 5 mM dNTPs in:! 1.0 ί of 15mM 3 - NAD; 1. ί of ^{a - [ "2 p] dATP} (10 Z \ / u S); 0.2 J E. co I i DNA ligase (60un Z Jl Takara Shuzo 5.0 ^ 11 E. coli DNA polymerase I (New England Biolabs, 10un /); 0.1% RNaseH (60un / Takara Shuzo): 28.7 zil of distilled water.

The reaction solution was incubated at 14 for 1 hour, then returned to room temperature, and further incubated for 1 hour. Then of

The reaction was stopped by adding 0.5H EDTA and 1% of 20% SDS, and subjected to phenol-chloroform treatment and ethanol precipitation. Dissolve the obtained DNA in 0.5 mM Ε0ΤΑ20 、 and add 3 W KI enow buffer (500mH tris-hydrochloric acid (pH 8.0), 50mM MgCJl ₂ ) 3ί of 5mH dNTP and 4d of water were added to prepare a reaction solution, and then 1 DNA polymerase was prepared. (Kleenow fragment) (Takara Shuzo) was added, and the mixture was incubated at 30 for 15 minutes.

The reaction solution was diluted with a 70 × z TE solution, and the reaction was terminated by adding 5 0.5H EDTA,> S 20% SDS. The reaction solution was subjected to phenol-chloroform treatment, and ethanol precipitation was performed to obtain about 8 ^ §f double-stranded cDNA.

3) Methylation of double-stranded cDNA

Aqueous solution 30i of double-stranded CDNA synthesized in section 2), methylated buffer (500mH tris-hydrochloric acid (PH8.0), 50mH EDTA) 40zi, SAH solution (800MS-adenosyl- L

(SAH), 50mH.jS — Mercaptoethanol) EcoR methylase (New England) in a mixture of 20 J1 and 100 Si 水 of water

Biolabs, Inc., 20 uint) was added to make the total reaction solution 200 ί, and the mixture was incubated at 37 ° C for 2 hours. Phenol treatment After ether treatment, the DNA was recovered by ethanol precipitation.

4) Add EcoRI Linker

A ligase buffer (250 mM tris-hydrochloric acid (pH 7, 5), 100 mM HgCi ₂ ) λ St-pre-phosphorylated EcoRI solution was added to about 1.2 ^ of the methylated double-stranded DNA. Lanka made one 0.5 ^ Domer. Takara Shuzo), 1.5 ϋ 10mM ATP for, 100 mH Jichisaisu Ray Bok Lumpur 1 · 5 ί, the Eta ₂ 0 of 2 I was added and the reaction was brought 15 zi Te T ₄ ΟΝΑ ligase (3.4U / μΛ, Takara Shuzo Co., Ltd.) was reacted overnight at 0.7 ^ pressurized strong point 4 ° C, was 10 minutes閻加ripe inactivate the rigger one peptidase at 65 . The reaction solution was further added to 100 mH tris-hydrochloric acid.

(PH 7.5), 5 mM HgCi 2, 50mH NaCJl, after all liquid amount at a concentration of a gelatin of OjU Z ad was prepared in earthenware pots by becomes 50 Jl,

EcoRI (10unit / i) 3.5 / ζί was added and reacted at 37 ° C for 2 hours. Then, 0.5M {2.5}; 20% 0.5S} was added, followed by phenol-chloroform treatment, and DNA was recovered by ethanol precipitation. After that, unreacted EcoR linker is removed by gel-gel method or agarose gel electrophoresis of Urogel AcA34 (manufactured by LKB), and a linker-added double-stranded CDNA of about 0.5 to 0 ·· 7 ^ §ρ was recovered.

5) Binding of double-stranded CDNA to gt10 vector

A gt10 vector (Vector Cloning Systems, Inc.) prepared by processing the above-mentioned linker-added double-stranded CDNA at 2.4 Z §f in advance with EcoRI, a ligase buffer (250 mM Hydrochloric acid, 100 mM WS ₂ )

Add 1.4χζί and 6.5ί of distilled water, and treat at 42 ° C for 15 minutes, then 10mH ATP 1] !, 0.1M dithylate plate 1 、,

After the T ₄ DNA ligase 0.5 15 The total amount added ΰ ί, it was reacted overnight at 12 ° C.

6) Invitro packaging

About 1% of the recombinant DNA obtained in 5) above

3 was packaged using an invitro packaging kit (Promega Megatech) to obtain phage plaque. Example 8 Screening of pBR-based library by probe (IWQ)

Watman 541 filter paper was placed on the agar medium on which the colonies had grown, and left at 37 ° C for 2 hours. Below, Taub and Thompson's method

According to [Anal. Biochem._i ^ Vol. 222, p. 222 (1982)] 'We processed the arrest.

That is, the colonies were transferred to 541 paper, then transferred to an agar medium containing chloramphenicol (250 ^ 3Z), and left at 37 overnight.

After taking out the 541 paper, it was left on the paper soaked with 0.5Ν NaOH solution at room temperature for 3 minutes, and this was repeated twice. The following procedure was repeated twice for 3 minutes using a 0.5M tris-hydrochloric acid (PH8) solution, and further performed at 4 ° C for 3 minutes with a 0.05M tris-hydrochloric acid (PH8) solution. 1. SfflgZ lysozyme solution (containing 0.05 M tris-hydrochloric acid (PH8), containing 25% sucrose) for 10 minutes, then X SSC (0.15 M NaCi and 0.015 sodium citrate) at 37 ° C. Lithium) solution for 2 minutes, 1X SSC solution containing 2003 ^ protease k for 30 minutes, again at room temperature for 2 minutes with 1X SSC solution, and 2 minutes with 95% I-ethanol solution for 2 minutes. After the first round, the 541 mm paper was dried. The obtained dried 541 filter paper was equilibrated at room temperature with phenol: black form isoamyl alcohol (25: 24: 1, 1OO 1H tris-hydrochloric acid (H8.5), 100mH NaCi, 10mMEDTA. Immersed in the solution for 30 minutes. Thereafter, the same operation was performed three times with a 5 × SSC solution for three minutes and then twice with a 95% ethanol solution for three minutes, and then the filter paper was dried. Probe (IWQ) is radiolabeled with ³² P according to a conventional method (see Molecular cloning), and then the method of Wallace et al.

(Nucleic Acids Res.j, Vol. 879, Army (1981)). 6 X NET E 0.9 M NaCi 0.09 M Tris-hydrochloric acid (PH7.5), 6 iBH EOTA], 5 x

Pre-hybridization buffer in a denaturt solution, 0.196 SDS, and 0.1% denatured DNA (calf thymus DNA) in a hybridase buffer at 65 ° C for 4 hours, followed by radiolabeled prop (IWQ) Hybridization was performed overnight at 56 ° C. using the above hybridization buffer containing 1 × 10 cpm. After the reaction was completed, the 541 filter paper was washed at room temperature with a 6 × SSC solution containing 0.1% SDS twice, for 30 minutes, and for 56 and 1.5 minutes, and then subjected to heat radiography.

After separating plasmid from the signaled clone, Southern blotting was performed using a probe (IHQ). High predication and heat radiography were performed under the same conditions as above.

Similarly, Southern blotting was performed using the probe (A). The hybridization was carried out for 1 hour at 491; using the above-mentioned hybridization buffer for 1 hour, cooled slowly to 39, and then carried out at 39 for 1 hour. After the completion of the reaction, the cellulosic filter was washed twice in 30 minutes at room temperature with 6 × SSC containing 0.1% SDS, and then washed for 3 minutes at 39. A radiograph was performed.

As a result, one clone was obtained as positive. When the nucleotide sequence was determined by the didexy method, as shown in Fig. 2, it was found to be a DNA consisting of 308 nucleotides including the probe (IWQ) and probe (A) portions. It was found and the plasmid derived from PBR322 containing this insert was named PHCS-.

Example 9: DNA probe derived from pHCS-1; (Screening of phage-based library)

The plaque-hyperidization was performed according to the method of Benton and Davids [Science 96, 180, (1977)]. The PHGS-1 obtained in Example 8 was treated with Sau3A and EcoRI to obtain a fragment of about 600 base pairs, and this DNA fragment was radiolabeled with a nickel translation by a conventional method. Place the phlegm on agar medium on which phage plaques were formed, transfer the phage with t-lulose® paper (S & S), denature with 0.5 M NaOH, and Filter paper was processed in the beginning. 0.1M Na0H, 1.5H NaCi for 20 seconds, followed by 0.5M Tris-HCl (pH 7.5), 1.5H NaCi for 20 seconds twice, finally 120mH NaCil, 15mM sodium citrate, 13mM

ΚΗη ΡΟ ,,, mM EDTA, pH 7.2 for 20 seconds.

Next, the compost paper was dried and ripened at 80 ° C for 2 hours to fix the DNA. In a hybridization buffer containing 5X SSC, 5X Denhardt solution, 50mM phosphate buffer, 50% formamide, 0.25 fflg / denatured DNA (鲑 testis DNA), and 1% SDS Performed a pre-hybridization step at 42 in the same step, and a pHCS-1 probe radiolabeled with a nickel transfusion 4 x 10 ⁵ cpni

Hydration solution containing 5X SSC, 5X Denhardt solution, 20mM phosphate buffer (pH 6.0), 50% form Amide, 0.1% SDS, 10% dextran sulfate,

Was performed at 42 ° C for 20 hours with denatured DNA (a mixture of testis DNA).

Nitrocellulosic paper was washed at room temperature with 2 × SSC containing 0.1% SDS for 20 minutes, then at 44, 30 minutes with 0.1 × SSC containing 0.1% SDS for 30 minutes and then at room temperature After washing with 0.1X SSC for 10 minutes, detection by heat radiography was performed.

As a result, five positive clones (G1 to 5) were obtained. Therefore, when the DNA base sequence of the clone, which is considered to contain full-length cDNA, was examined by the didexy method, the base sequence shown in Figure 3 (A) was obtained. was gotten. Therefore, this cDNA was cut out from; Igt10 vector and ligated to pBR327 [Soberon et al., Geftej, vol. 287, p. 287 (1980)] at the EcoRI site to prepare a large amount as a plasmid. This plasmid is called PBRG4. Example 10 PBRG4-derived DNA probes and probes

Screening of sparging library by (LC)

Plaque-hybridization was performed according to the method of Benton and Davis used in Example 9 (see the above-mentioned literature). Place the nitrocellulose filter paper (manufactured by S & S) on the agar medium on which the phage plaque was generated, transfer the phage, denature the DNA with 0.5 M NaOH, and perform the following steps. Filter paper was processed. NaOH 1.5M NaCJl for 20 seconds, followed by 0.5H tris-hydrochloric acid (f) H7.5), 1.5ΜNaCi for 20 seconds twice, and finally 120mM NaCil, 15mM Oxygen over _{_{Da, 13mH KH 2 P0 4, mH}} EDTA, and 20 Byosho sense at (pH 7.2). Next, the paper was dried and ripened at 80 ° C for 2 hours to fix the DNA. In this manner, two identical papers were produced,

PBRG4-derived DNA probe and probe (LC) were used for screening.

In the case of using a PBG-derived DNA probe, PBRG4 was treated with EcoRI to obtain a DNA fragment of about 1500 base pairs, and the DNA fragment was radiolabeled by a nickel translation method according to a conventional method. The above filter paper was mixed with 5X SSC, 5X Denhardt solution, 50mH phosphate buffer, 50% formamide, 0.25 fflSP / fflg denatured DNA (鲑 testis DKA), and a hybridase buffer containing 0.1% SDS. Pre-hybridization was performed overnight at 42 ° C in a prehybridization kit containing the above-mentioned radiolabeled DNA containing approximately 1500 base pairs of DNA probe (approximately 1 x-106 cpm Zid). Ion buffer [5X SSC, 5X Denhardt solution, 20mM phosphate buffer (pH 6.0), 50% formamide, 0.1% SDS, 10% dextran sulfate, denatured DNA of O.lfflSfZ (Mixture of salmon testis DNA)] and subjected to hybridization for 20 hours. The 2-cellulose filter paper is washed at room temperature with 2 × SSC containing 0.1% SDS for 20 minutes, then at 44 ° C. with 0.1 × SSC containing 0.1% SDS for 30 minutes, and then at room temperature. After washing with 0.1% SSC for 10 minutes at room temperature, detection was performed by radiography.

In the case of probe (LC), the paper was pre-treated with 3X SSC containing 0.1% SDS at 65 for 2 hours, then 6X NET, x Denhardt solution, 100 ^ denatured DNA (鲑 testis) DNA) Prehybridization was performed in the solution at 65 ° C for 2 hours.

Radiolabeled probe ^{(LC) (2 X 10 6} cpm) pre-hybridization Dizeshi Yo down buffer containing [6 X NET, 1 X

Denhardt solution, 100 gf ζηδ denatured DNA (salmon testes DNA)], overnight hybridization at 63, containing 0.1% SDS at room temperature with two microcell mouths at room temperature 6 After washing with XSSC for 20 minutes, this washing was performed three times, and then at 63 ° C for 2 minutes with 6 XSSC containing 0.1% SDS.

After drying the compost paper, it was detected by autoradiography. 'In the screening performed in this way, positive clones were selected for both probes, and the clones that would contain the full-length cDNA were selected. When the base sequence of the chromosome was examined by the didechix method, the base sequence shown in FIG. 4 (A) was obtained. Therefore, this cDNA was cut out of the; Igt10 vector and ligated with PBR327 at the EcoRI site to obtain plasmid pBRV2.

Example 11 Construction of recombinant vector for Escherichia coli (+ VSE)

And transformation [Example using a vector containing the tac promoter]

1) Construction of replacement vector

① Preparation of vector

tac Promoter-containing vector pKK223-3 (Pharmacia Co.) 5 3 3 を reaction solution (40mH Tris-HCil, 7mH)

The mixture was treated with 8 units of EcoRI (manufactured by Takara Shuzo Co., Ltd.) in MgCJl ₂ , 100 mM NaCi, 7 mM 2-mercaptoethanol> for 2 hours at 37. Next, 3 of alkaline phosphatase (Takara Shuzo Co., Ltd.) was added, and the mixture was treated with P at 60 ° C. for 30 minutes, and subjected to phenol treatment three times, ether treatment and ethanol precipitation according to a conventional method. To recover DNA fragments.

The discussions were 50mH Tris-HCil, 5fflH HgCi, 10IBH DTT,

Dissolve in a 50 ^^ mixture of ImH dATP, dCTP, dGTP and dTTP, add E. coli DNA polymerase I-Klenow fragment (Takara Shuzo) 3i, add The reaction was carried out for 2 hours, and the end was blunted.

② Preparation of synthetic linker

Synthetic linker one, Sai Li Gore j click with the sequence CGAATGACCCCCCTGGGCC and CAGGGGGGTCATTCG Reochi 3 3 50mM Tris -. HCi, -10mH MgCi 2, 10 mH 2 - main Rukapu preparative ethanolate Lumpur, consisting 1 mM ΑΓΡ reaction liquid 40 U T ₄ port I j click Reochi Dokinaze 4 units presence in I, tighten react 37 ° G, 60 minutes, and re-phosphorylation.

Then, the phosphorylated oligonucleotide was dissolved in 20 3 of TE (10mH Tris-HCJI, pH 8.0, 1 mM Ε0ΤΛ) containing 100niH NaCi in an amount of 0.23, and treated at 65 ° C for 10 minutes. Thereafter, annealing was performed by gradually cooling to room temperature.

③ Preparation of CDHA fragment of G-CSF

The PBRG4 60 gp containing the CDNA shown in FIG. 3 (A) obtained in Example 9 was reacted with 6 mM Tris-HCi, 6 mH HgCJl ₂ , 6 mM 2 —mercaptanol-reaction solution 200 ^ ϋ Medium, 100 units of restriction enzyme Apa I (New England Biolabs), Dra I (Takara Shuzo) The mixture was treated with 50 units at 37 ° C for 3 hours, and about 23 bp of a 590 bp Apa I-Dra I fragment was recovered by 1.2% agarose gel electrophoresis. -連結 Concatenation of the above fragments

①, ②, ③ each fragment Ri and respectively about 0.1, 20 i connected the reaction solution _{(66mH Tris- HCi, 6.6inH MgCi 2} , 10mH DTT, mH ATP) was dissolved in T ₄ DNA rigger Ichize 175 units Was added and reacted overnight at 4 to obtain a replacement vector (Fig. 6).

2) Shape conversion

E.col was determined by the rubidium chloride method (see T. Hani at is et al. (Molecular cloning), p. 252 (1982), supra) using 20 ^ of the reaction solution containing the replacement vector obtained in (1) above. The i 105 strain was transformed. Plasmid was isolated from the ampicillin-resistant colony culture and treated with the restriction enzymes BamHI, AccI, and Apa. Was confirmed.

Example 12 Construction and Transformation of Recombinant Vector for Escherichia coli (+ VSE) [Example Using Vector Containing PL Motor]

1) Construction of a replacement vector

① Preparation of vector

P Shipuguchi motor over vector containing te pPL-lambda (manufactured by full Arumashi § Co.) limit 100 ^ enzyme BamHI, with 50 units reaction (10mH Tri s - HCi, pH7.6 , 7 mH MgCi 2, (100mH NaCi, 10mH DTT) The cells were treated in 100 jW i at 37 ° C overnight. From this, about 49 fragments of about 4 Kbi) and about 11 fragments of about 1.2 Kbp were recovered by 1% agarose-gel electrophoresis.

Approximately 4 Kbp of the above fragments was first transferred to the ΓΕ buffer described above.

After dissolving in 100 ml, alkaline phosphatase (manufactured by Takara Shuzo Co., Ltd.) was reacted with 5 U Si and 60 for 60 minutes and dephosphorylated.

The remaining fragment of about 1.2 Kbp was dissolved in 20 μl of buffer (10 (ilM Tris-HCJl, 10mH MgCi ₉ , 6ΜπΜ KCi, 1 niM DTT) 20 μ.Si) and the enzyme Hbo I (New England Biolabs) Manufactured at 37 ° C overnight with 20 units.

Then, about 4% polyacrylamide gel electrophoresis was performed.

About 200 bp BamHI-HboI fragment of about 0.9 §f and about 310 bp of HboI-BamHI fragment of about 1.93 were recovered.

'② Preparation of synthetic linker-Synthetic linker T AA GGA GA ATTCATGGA T. and TCGATGAATTCTCCTTAG were oxidized and annealed in the same manner as in ① of Example 11 to obtain a synthetic S / D linker. I got one.

③ Preparation of expression vector

Synthetic SZD linker 0.13, annealed with the approximately 4 Kbp fragment 0.13 and the BaraHI-HboII fragment having the PL region and the HboK-BamHI fragment having the tL ^ region of 0.053, respectively. the 40 reaction solution ΰ (66mH Tris HCi, 6.6mH MgCJl 2, 0mH DTT, 1 mH ΑΓΡ) in, T ₄ DNA rigger - (Takara Shuzo) 175 units presence 12 ° C, tighten react overnight Was. Using this reaction solution 20, E. coli N99C I ⁺ strain (Pharmacia) Was transformed by the CaCi ₂ method (see “Molecular cloning” above).

The transformant was cultured, the plasmid was separated from the culture of the ampicillin-resistant colony, and treated with the restriction enzymes EcoRI, BamHI and SmaI to confirm that the desired plasmid was obtained. Was done.

Then, Ri this plasmid and 2 JU 3, 20 ^ Λ buffer _{dOraH Tris- HCi, 6 inH HgCJl 2} , 50raH NaCJl) during the restriction enzyme Cla I (New an England Biolabs, Inc.) 37 ° C After reacting for 2 hours, it was inactivated at 65 ° C. for 10 minutes.

Furthermore the coupling reaction and tau ₄ DNA rigger of the reaction solution 1 Ρ 20 i - peptidase (Takara Shuzo Co., Ltd.) using a 175 unit 12 ° C, after reaction overnight, E in the same manner as described above The .col i N99C I ⁺ strain (Pharmacia) was transformed again. Plasmid was separated from the ampicillin-resistant colony culture and treated with EcoRI and BamH to confirm the desired plasmid.

調製 Preparation of recombinant vector and transformant for G-CSF expression

The plasmid for expression obtained in (3) is treated with the restriction enzyme ClaI, and the end is made into a plant end. After that, as in Example 11, the cDNA fragment of G-CSF is inserted and the recombinant vector is inserted. Obtained . Using this, E.co was transformed with IN4830 strain (manufactured by Pharmacia) by the CaCil ₂ method described in the above-mentioned Molecular cloning. The intended transformant was confirmed in the same manner as in Example 11 (FIG. 7). Example 13 Construction and transformation of a recombinant vector for Escherichia coli (+ VSE) [Example using vector containing trp promoter]

1) Construction of replacement vector

① Preparation of vector

Approximately 330 bp of the HpaI-TaqI fragment containing the triple-fan promoter was introduced into the ClaI site of PBR322, and pOY1 plasmid 103, which was prepared by 10 mM Tris-HCi, 6πιΗHgCi, 50mH NaCi, was prepared. The mixture was treated with 7 units of restriction enzyme Cla I and 8 units of Pvu I in 30 ml of the reaction solution at 37 ° C. for 3 hours.

Then, 2 liters of alkaline phosphatase (Takara Shuzo) was added, and the mixture was reacted for 60 hours.

From this, about 2.53 fragments of about 2.6 Kbp were recovered by 1% agarone gel electrophoresis.

② Preparation of synthetic linker

Synthetic linker CGCGAATCGACCCCCCCTGGGCC and CAGGGGGGGTCCATTCG were phosphorylated and annealed in the same manner as in (11) of Example 11.

③ Preparation of recombinant vector

About 1 m of the vector fragment prepared in (1) above and about 13 of the synthetic linker of (2) and about 13 of the G-CSF CDNA fragment prepared in (3) of Example 11 were combined with the ligation reaction solution (20 ^). during I, to obtain a T ₄ DNA ligase (Takara Shuzo) 175 units and tighten recombinant vector te allowed overnight reaction at 12 ° C (Figure 8). 2) Shape conversion

The reaction solution 20 ^ in (3) above was transformed into the E. coli DHI strain by the rubidium chloride method of "Holecular cloning" described above.

Plasmids were obtained from ampicillin-resistant colonies in the same manner as in Example 11, and the desired transformants were obtained with the restriction enzymes Apal, Dral, NruI, and Pstl. It was confirmed.

Example 14 Culture of Transformant

1) Culture of the transformant (containing tac) obtained in Example 11

To a Luria medium containing ampicillin 25 // or 50 ^ 3 / ^, add the culture 1 of the transformant cultured overnight at 37, and incubate at 37 for 2-3 hours .

Then, isopropyl one 3 - it was 37 in the D- Ji old galactopyranoside Bok shea de 2 fflH ^e C, and incubated 2-4 hours'. '

2) Culture of the transformant obtained in Example 12)

Luria medium containing ampicillin 25 3 ^ or 50 §f // ^

1 / s of the culture solution of the transformant cultured overnight at 28/100 / ^ was added and cultured at 28 ° C for about 4 hours.

Thereafter, the temperature was reduced to 42 and culture was performed for 2 to 4 hours.

3) Culture of the transformant (containing trp) obtained in Example 13

Contains 0.5% glucose, 0.5% casamino acid (manufactured by D-CO), ampicillin 25 §fZ or 50 3 // ^!! Add 1 ^ of culture solution and incubate at 37 for 4-6 hours. Then, 3-3-indoleacrylic acid (IAA) was added, and the cells were cultured at 37 for 4 to 8 hours. Example 15 Recovery of G-CSF polypeptide from E. coli ♦ Purification

1) Recovery

The following recovery operation was performed on each of the transformed strains cultured in Example 14.

The culture was centrifuged to collect the cells, and the cells were suspended in a mixed solution 5a of 20mH Tris-HCi (pH 7.5) and 30mH NaCi.

Then, 0.2 M phenylmethylsulfonyl fluoride, 0.2H E0TA, and lysozyme were added to each at 1 mH, 10H, and 0.2 fflg /, and the mixture was allowed to stand at 0 ° C for 30 minutes.

Next, freeze-thaw was repeated three times or sonication was performed to lyse the cells. The supernatant is obtained by centrifugation of the obtained lysate, or finally converted into 6 M guanidine hydrochloride using 8 M guanidine hydrochloride, and then centrifuged at 30,000 rpm for 5 hours. And the supernatant was obtained.

2) Refining

(i) The supernatant obtained in 1) was passed through an IHtrogel ACA54 column (manufactured by LKB) having a diameter of 4.6 _Cffl and a length of 90 ^ (0.15 M NaCi and 0.01% Tween 20 (manufactured by Hanka Kagaku)). The gel was arrested using a 0.01 M tris-hydrochloric acid buffer solution (PH7.4) containing the same at a flow rate of about 50 ^ h.

Next, a fraction showing more activity according to the above-mentioned “Method for measuring CSA (b)” was collected, and reduced by an ultrafiltration device using PH-10 (manufactured by Amicon). did.

(ii) n-propanol (Tokyo Kasei Co., Ltd. (For amino acid sequencing) and triflic acid, and adjust to final concentrations of 30% and 0.1%, respectively, and leave it on ice for about 15 minutes, then at 15,000 rpm for 10 minutes. The precipitate was removed by heart. Then, after adsorbing to a Bondapak C18 column (Waters, semi-preparative, 8 nm 30CJ ») equilibrated with the above aqueous solution containing n-propanol and trifluroacetic acid, 30-60% Second elution was performed with a 0.1% aqueous solution of trichloroacetic acid containing a linear concentration gradient of n-propanol. Using a Hitachi 685-50 high-speed liquid chromatograph and a Hitachi 638-41 detector (both manufactured by Hitachi, Ltd.), the absorption of 220 «/ Β and 280 was measured simultaneously. After elution, from each fraction 10]! Was diluted 100-fold, and fractions showing activity were examined by the above-mentioned “Method for measuring CSA (b)”. As a result, activity was observed in the peak eluted at 40% n-propanol.These peaks were collected, re-chromatized again under the same conditions, and CSA was examined in the same manner as above. At this time, the activity was observed in the peak at the position of n-propanol 40%, and this peak was collected (4 fractions-freeze-dried).

(iii) The above freeze-dried powder was dissolved in 200% of a 0.1% aqueous solution of trichloroacetic acid containing 40% of n-propanol, and TSK-G3000SW column (7.5% 60 «1 manufactured by Toyo Soda Co., Ltd.) was used. High-performance liquid chromatography using HPLC (HPLC). Elution was performed with the same aqueous solution at a flow rate of 0 min. Fraction collector FRAC-100 (manufactured by Pharmacia) fractionated 0.4δώ each. The collected fractions were examined for CSA in the same manner as described above, and the active fractions were collected. After purification using ^ apapak C18 galum (4.6 M x 30 cn) for analysis, the fractions were collected. The peak was collected and lyophilized.

The obtained protein was treated with 2-mercaptoethanol, subjected to SDS-polyacrylamide gel (15.0%) electrophoresis (15 mV, 6 hours), and stained with a coomassie gel. At this point, the target G-CSF polypeptide was confirmed as a single band.

Example 16 Assay of G-CSF activity of expressed substance (+ VSE) The CSF sample obtained in Example 15 was assayed according to the aforementioned <Reference example> CSF activity 'measurement method (a). The results are shown in Table 1.

Human neutrophil colony number / di sh Purified human G-CSF (20ng) 73

CSF sample obtained in Example 15 (50 ng) 68

Plank 0 Example 17 Amino Acid Analysis (+ VSE)

1) Analysis of amino acid composition

The CSF sample purified in step 15 is hydrolyzed by a conventional method, and the crude amino acid in the protein portion is converted to a special amino acid using a Hitachi 835 amino acid automatic analyzer (manufactured by Hitachi, Ltd.). The analysis was performed by the acid analysis method. The results are shown in Table-2. The hydrolysis conditions are as follows.

① 6 N HC, 110 ° C, 24 hours, in vacuum

② 4 N methanesulfonic acid + 0.2% 3- (2-aminoethyl) indole at 110, 24 hours, 48 hours, 72 hours, in the air

Samples were dissolved in a solution (1.5 ^) containing 40% n-propanol and 0.1% triflic acid, and each was taken and dried with dry nitrogen gas. Alternatively, the reagent of (1) was added, the tube was sealed in a vacuum, and subjected to hydrolysis.

In the table, the measured values are the average of four times of the 24-hour value of ① and the 24, 48, 72-hour values of ②. However, T hr, Ser, 1/2 Cys, Met, Val, II e, and T rp were calculated by the following methods (Biochemical Chemistry Laboratory Course, Protein Chemistry H (Tokyo Kagaku Dojin Press)). Reference].

. T hr, Ser, V ₂ Cys, and Met take the time-dependent changes of 24, 48, and 72 hours in ②, and extrapolate to zero hours.

. V a and I le are 72 hour values of ②.

. T rp is the average of 24, 48, and 72 hour values of ②. Table 1 2 (Amino acid analysis table)

2) N-terminal amino acid analysis

The sample was digested with Edman using a gas-phase sequencer (manufactured by Applied Biosystems), and the resulting PTH The acid was routinely analyzed using a high-speed liquid chromatograph (Beckman ♦ Instrument) and an intrasphere-0DS column (Beckman * Instrument). More analysis. A column (5 m, diameter 4.6 mm, length 250 mm) was equilibrated with a starting buffer (aqueous solution containing 15 mH sodium acetate buffer PH4.5, 40% acetate 2 tol). Thereafter, a sample (dissolved in 20 starting buffer solutions) was injected, and separation was performed by isocratic elution with the starting buffer solution. The flow rate was kept at min, and the column temperature was kept at 40 ° C. The detection of PTH amino acids utilized the UV absorption of 269 and 320. In advance, 2 nmoi of standard PTH amino acid (manufactured by Sigma) was separated in a single system, the retention time was determined, and identification was performed based on the retention time of the test sample.

As a result, PTH-methyl and P-threen were detected.

Example 18 Construction and transformation of a recombinant vector for Escherichia coli (-VSE)

1) Example using a tac port motor-containing vector

Use "PBRV2 containing CDNA shown in Figure 4 (A) obtained in Example 10" instead of "PBRG4 containing CDNA shown in Figure 3 (A) obtained in Example 9" in Example 11 (3) Otherwise, the same operations as in Example 11 were performed, and it was confirmed that the obtained transformant was the target transformant (FIG. 9).

2) Example using a vector containing a PL promoter

Example 12 was repeated using CDNA (--VSE), and it was confirmed that the obtained transformant was the target transformant (FIG. 10). 3) Example using trp port motor-containing vector

Example 13 was repeated using CONA (-VSE), and it was confirmed that the desired transformant was obtained (FIG. 11).

Example 19 Assay of G-CSF activity of expressed substance (—VSE) Each of the transformants obtained in Example 18 was cultured according to the method described in Example 14, and then the Escherichia coli cultured was described in Example 15 According to the method described above, G-CSF polypeptide was recovered and purified to obtain human G-CSF polypeptide as a single band.

The CSF sample thus obtained was assayed according to the aforementioned <Reference example> Method for measuring CSF activity (a). Table 13 shows the results.

Three

Example 20 Amino acid analysis (-VSE)

1) Analysis of amino acid composition

The amino acid composition analysis of the CSF sample purified in Example 19 was performed by the method described in Example 17-1). The results obtained are shown in Table 1. Table I 4 (Amino acid analysis table)

2) N-terminal amino acid analysis

The sample was subjected to N-terminal amino acid analysis according to the method described in Example 17-2). As a result, PTH-methine and および -threenine were detected.

Example 21 Preparation of PHGA410 Vector

(For animal cells, system)

The EcoRI fragment of the cDNA shown in Figure 3 (A) obtained in Experiment 9 was treated with the restriction enzyme Dral at 37 for 2 hours, and then the Klenow fragment of DNA polymerase I (Takara Shuzo) ) To make the ends smooth. The Bglll linker (8mer: manufactured by Takara Shuzo Co., Ltd.) was phosphorylated using ATP, and then ligated to the DNA fragment mixture of about Ί obtained above. Then, it was treated with restriction enzyme B glH and subjected to agarose gel electrophoresis, and only the largest DNA fragment was recovered.

This DNA fragment corresponded to about 710 base pairs including the portion coding for the human G-CSF polypeptide as shown in FIG. Vector-pdKCR (Fukunaga; Proc. Natl. Acad. Sc, USA; 81, 5086 (1984)) was treated with the restriction enzyme BamHI, and then treated with Alfa Lifos Phatase (Takara Shuzo Co., Ltd.). the vectored one DNA obtained in manufacturing) was de-phosphate was obtained T ₄ DNA ligase (Takara Shuzo Co., Ltd.) was added to PHGA 410 is combined with CDNA fragment (Figure 12). As shown in Figure 12, this plasmid is the promoter of the SV40 early gene, the replication initiation region of SV40, a portion of the egret 3-globin gene, the replication initiation region of PBR322, and | 3 derived from PBR322. —Includes the lactamase gene (Amp ^P ), and the human G-CSF gene is connected downstream of the promoter of the SV40 initial gene. Example 22 Construction of recombinant vector for C127 cells (+ VSE) 1) Construction of HGA410 (H)

PHGA410 plasmid 20xz §f obtained in Example 21 was converted to 50mH Tris-HC (pH 7.5), 7 raM HgCi! ₉ , 100mH NaCJl, 7 DIM 2 — mercaptoethanol, 0.01%溶解 Dissolved in the reaction solution of serum alpmin (BSA), added the restriction enzyme EcoRI (Takara Shuzo Co., Ltd., 10 to 15 units), reacted for about 30 minutes and 37, and performed partial digestion with EcoRI. . Then, the DNA fragment was treated twice with ethanol-chloroform (11) treatment twice, followed by ether treatment and ethanol precipitation.

This DNA fragment 50IIIM TPIS - HCi, 5 mH HgCJl 2, 10inH DTT, 1 mH of dATP, dCTP, dGTP, consisting of dTTP 50]! E. coli DNA polymerase-K-enow fragment (manufactured by Takara Shuzo Co., Ltd.) (5 加え) was added, and the mixture was incubated at ° C for 2 hours to obtain a blunt end. .

From this, fragment 6iSf of about 5.8 kb was recovered by 0.8% agarose gel electrophoresis.

The recovered DNA fragment (5 §f) was dissolved again in a reaction mixture 50 containing 50 mM Tpis-HCJl (pH 7.6), 10 mM MgCil ₂ , 10 mM DTT, and 1 mM ATP, and Hίnd Linker (Takara Shuzo) 2 adding m and T ₄ DNA rigger over peptidase (Takara Shuzo) 100 units, it was reacted hands overnight 4.

Next, after treatment with ethanol, ether, and ethanol precipitation, it was dissolved in 30 Jl of 10 mM Tris-HCi (pH 7.5), 7 mM MgCi, and 60 mM NaCJl, and 10 units of Hindfll restriction enzyme was present. Lower 3 hours Incubated at 37Ό. After Risho management by the T ₄ DNA ligase again, this DNA rubidium chloride method (of the

Was transformed rolling conversion to "Molecular cloning" reference) by the Ri E.coH DHI strain, with the colonies of ampicillin Li down resistance (A mp ^p), pHGA 410 plasmid of the EcoRI site Tsu I or placed Hind ΠΙ Bacteria that retained the plasmid were selected. The resulting plasmid is named PHGA410 (H) (Fig. 13).

2) Expression vector-Construction of PTN-G4

Above 1) PHGA410 obtained in (H) · (20 / §f ) a 10mH Tris-- HCJi (ρΗ7 · 5) , 7 mH HgCi 9, 175mH NaCi!, 0.2mH EDTA 7 mH 2- mercapto Bok ethanolate Solution, dissolved in 50 ^. (1) consisting of 0.01% ゥ serum alpmin, add 20 units of restriction enzyme Sail (Takara Shuzo), and incubate at 37 ° C for 5 hours. The mixture was collected, then treated with phenol, precipitated with ethanol, and treated with a DNA polymerase tf Klenow fragment (manufactured by Takara Shuzo) at 14 ° C in the same manner as in the previous reaction. After incubating for about 2 hours to obtain a plant end, this was treated with the restriction enzyme Hind DI, and the ethanol-precipitated DNA fragment was treated with the restriction enzyme Hind DI without recovering with agarose. About 2.7 kb of Hind I-Sail fragment was recovered 5% by 1% agarose gel electrophoresis, while bovine papi loma virus (BPV) was recovered. Plasmid-1 (Sarver, n.,

SByrne, J.C S Howley, P.H. (1982) PPOC. Nat I. Acad.

Sci, 113 / \ _ 1 _Vol. 7147-7151; obtained from Dr. Howley) as described by Nagata et al. (Fukukunaga, Sokawa, Nagata, (1984) Proc. Nat. Acad. Sci, USA 81—Vol. 5086- 5090) to Hind HI and Treat with Pvul [to obtain an 8.4 kb DNA fragment. The HindH- S al I DNA fragment of DNA fragment and the above about 2.7kb of this 8.4kb was treated Ri by the T ₄ DNA ligase in accordance with the ordinary law, supra

The E. coli DHI strain was transformed by the rubidium chloride method described in "Molecular cloning", and the E. coli colony having a plasmid having cDHA of G-CSF derived from PHGA410 was selected. The plasmid is named pTN-G4 (Figure 13).

Example 23 Transformation of C127 cells and its expression (+ VSE) The PTN-G4 obtained in Example 22 is treated with a restriction enzyme BamHI before transforming into mouse C127 cells. That is, pTN-G4 plasmid 20 gp was dissolved in 10 mM Tris-HCi (pH 8.0), 7 mH HgCi ₂ , IOO 1H NaCil, 2 mH 2 -mercaptoethanol, 0.01% BSA100 St and dissolved in BamHI. Treated in 20 units (manufactured by Takara Shuzo), phenol treatment, ether treatment, and ethanol precipitation.

Mouse C127I cells contain 10% fetal calf serum (GIBC0)

Grow in DuI becco's minimal essentiaI medium. C127I cells grown on a 5 era plate were plated with the above-prepared DNA at a ratio of 10 to the phosphate-calcium method (Haynes, JS Weissmann, C (1983) Nucleic Transformation was carried out according to Acid Res 11, 687-706), and the cells were incubated for 12 hours and 37 hours after the treatment with glycerol.

Next, the cells were transferred to three new five-diameter plates, and the medium was exchanged twice a week. On the 16th day, the portions where Foci (agglomerates) were formed were each transferred to a new plate and subcultured in the above-mentioned medium, and clones having high G-CSF productivity were selected. As a result, G-CSF production at ~ 1 «Sf / i level was observed. It should be noted that in addition to the above-mentioned C127I cells, ΚΙΗ3ΚΙΗ3 cells can be used as host cells.

Example 24 Expression of G-CSF by CH0 cells (+ VSE) 1) Construction of PHGG4-dhfr

Solution containing the PHGA410 plasmid 20 ^ gf obtained in Example 21 containing 10 mM Tris-HC5 (ρΗ7.5), 7 mM MgCi ₂ , 175 mH NaCi, 0.2 mM EOTA 0.7 mH 2-mercaptoethanol 0.01% BSA After dissolving in 100 l / l, adding 20 units of restriction enzyme Sail (Takara Shuzo) and reacting 37 overnight, the mixture was subjected to phenol treatment, ether washing, and ethanol precipitation.

Next, the obtained DHA precipitate was subjected to 50 mM Tris-HCil, 5 οιΗ

MgCi ₉ is dissolved in a reaction solution 100 containing 10 mM DTT and 1 mH dATP, dCTP, dGTP, and TTP, and added with E. coli DNA polymerase—Klenow fragment (Takara Shuzo Co., Ltd.) and added to 14C, After reacting for 2 hours, perform ethanol treatment, ether washing, and ethanol precipitation.

An EcoRI linker is added to this DNA. That is, the above DNA was dissolved in a reaction mixture consisting of 50 μl of 50 mM Tris-HCi (pH 7.4), 10 mM DTT, 0.5 niM spermidine, 2 mM ATP, 2.5 mM hexamin chloride copartol, and 20 / flig BSA. , EcoR I linker scratch (Takara Shuzo) was added, in 4 added 200 units of T ₄ DNA ligase (Takara Shuzo Co., Ltd.), was reacted for 12-16 hours. After performing phenol treatment, ether washing, and ethanol precipitation according to a conventional method, the resultant was partially digested with EcoRI, and was subjected to about 2.7% by 1% agarose gel electrophoresis. 3 jw of the kb fragment was recovered.

On the other hand, pAdD26SVpA plasmid (Kaufman, RGS Sharp, PA (1982) Hoi. Cell BiO I, ___________________________ 1304-1319) is treated with EcoRI, and then treated with EcoRI. BAP) treatment and dephosphorylation. That, pAdD26SVpA 20 gf and EcoRI 20 units of the reaction solution 50mM Tris- HCi (pH7.5), 7 niH HgCi 2, 100 mM NaCJl, 7 mM 2 - main Rukapu Bok ethanolate Lumpur, in addition to the 0.01% BSA 100 The mixture was allowed to react at 37 ° C for 10 hours. Subsequently, 5 units of BAP was added to the above reaction solution, and the mixture was reacted at 68 ° C for 30 minutes. Then, it was subjected to phenol treatment, and the EcoRI fragment of pAdD26SVpA was recovered by electrophoresis (〜53).

The above-mentioned fragment of about 2.7 kb and the fragment of pAdD26SVpA were each annealed with 0.5 ^ 3 primers / "c. This plasmid was transformed into the E.coUDHI strain by the rubidium chloride method to obtain PHGG4-dhfr. A clone retaining the positive plasmid was selected, and the resulting plasmid was named dhfr (Fig. 14a).

As an alternative to the above, PHGG4 plasmid was treated with Sail and partially digested with EcoRI without addition of EcoRI linker to recover a fragment of about 2.7 kb. i DNA Polymerase

Treat the DNA fragment with the Klenow fragment and blunt-end the ends.

On the other hand above the peripheral Ji prepared brand Bok-end of the EcoRI fragment of pAdD26SVpA a way, T both _lambda DNA rigger one t 'process to

PHGG4-dhfr can also be prepared.

The PHGA410 (H) obtained in Example 22 was described in Example 22-2). After treatment with restriction enzymes HindHI and Sall as described,

The PHGG4-dhfr can also be obtained by ligating the Hindni-SalI fragment to the plant-end EcoRI fragment of pAdD26SVpA (Fig. 14b).

2) Transformation and expression

CH0 cells (strain dhfr, obtained from University of Columbia, Dr. L. Chasin) were used in a 9 C / B plate (Nunc) containing 10% calf serum. -HEH, adenosine, deoxyxy-adenosine, and thymidine) and proliferate by culture using the calcium phosphate method (Wigler et al., Cel I, Vol. 14, p. 725 (1978)). Converted.

That is, to 1 tt of PHGG4-dhfr plasmid prepared in 1), add an appropriate amount of carrier-DNA (calf thymus DNA), dissolve in 375 ^ solution, and add 1H CaCi ₂ 125 ^^. After cooling on water for 3-5 minutes, add 500i of 2X HBS (50mH Hepes, 280mM NaCil, 1.5mM phosphate buffer), cool on ice again, mix with CH0 cell culture solution 1 described above, and plate. transfer to, and culture between 9 o'clock in C0 ₂ Lee Nkyu beta foremost.

Following washing, addition of TBS (Tris-Buffered Sine) containing 20% glycerol, washing again, and 2 days after addition of the selection medium (α-HEM medium, added with nucleotides) After incubation, the cells were divided into 1:10 cells using a selection medium (without adding nucleotides), and the culture was continued every two days while changing the medium using the selection medium, resulting in the formation of foci. ) Was selected and moved to a new plate. In the new plate, the cells were grown in the presence of 0.02 H metrexet (MTX) and then grown again in the presence of 0.1XH HTX for cloning.

In addition, the transformation of CH0 cells

Cotransformation of pAdD26SVpA can also be performed (see Scaffill et al., Proc. Nat., Acad. Sc, USA__, Volume 4654-4658 (1983)).

In addition, a recombinant vector can be constructed by a method using a so-called liposome nick gene, and this can be used to transform CH0 cells. For example, pA (JD26SVpA is treated with PstI, two fragments are recovered, and these are combined with a PBRG4-derived CSF cDNA fragment to obtain the adenovirus promoter, CSFcDNA, DHF, and SV40. A recombinant vector arranged in the order of the A site was constructed and inserted into CH0 cells.

Example 25 Assay of G-CSF activity of expressed substance (+ VSE) The culture supernatants of C127 cells and CH0 cells obtained in Examples 23 and 24 were each adjusted to PH4 with 1N acetic acid, etc. After adding a volume of n-propanol, the resulting precipitate is removed by centrifugation, and an open column (1Φ) packed with C8 reversed-phase support (Yamamura Chemical Co., Ltd.) is used.

2 cm) and eluted with 50% n-propanol. After diluting the eluate twice with water, reverse phase high performance liquid chromatography using YHC-C8 column (Yamamura Chemical Co., Ltd.) containing 30% to 60% linear line containing 0.1% TFA Elution gradient of n-propanol was eluted. n—The fraction eluted at the position where the propanol concentration is around 40% is collected, freeze-dried, and 0.1 M glycine buffer (PH9) Dissolved in water. By going through such a process,

G-CSF was approximately 20-fold enriched from C127 and CH0 cell supernatants.

As a control, cells were transformed with a plasmid containing no human G-CSF CDNA according to the method described above, and then the culture supernatant was concentrated. The obtained preparation was assayed for human G-CSF activity by a method based on “Method for measuring human G-CSF (a)” described in Reference Example. If the expression efficiency is sufficiently high, the culture supernatant may be directly subjected to the assay. Here, the results are shown for an example of contraction. The results were as shown in Table 5

Table 1 Assay of human G-CSF activity Human neutrophil colonies / dish Purified human G-CSF (20 ng) 96 pd BPV-1C *

0

C127 cell culture solution (20 times concentration)

pu BPV-1 in the form of ¾

0

BPV 3T3 cell culture solution (20 times concentration)

82

Cell culture solution (20 times concentration)

Culture solution of 3T3 85 cells transformed with PTNG4 (20-fold lipase)

Transformed with pAdD26SVpA

0

dhfr r CH0 cell culture solution (20 times concentration)

110 transformed with PHGG4-dhfr

Culture solution of CH0 cells (20-fold concentration) Example 26 Amino acid analysis and sugar analysis (+ VSE) 1) Analysis of amino acid composition

The crude CSF sample obtained in Example 25 was further purified according to the method (Hi) of Example 2. The purified CSF sample is hydrolyzed by a conventional method, and the amino acid composition of the protein portion is analyzed using a special amino acid composition using a Hitachi 835 amino acid automatic analyzer (manufactured by Hitachi, Ltd.). The analysis was performed by the analysis method. The results are shown in Table-6. In addition, water The decomposition conditions are as follows.

① 6 N HCi, 110 ° C, 24 hours, in vacuum

② 4 N methanesulfonic acid + 0.2% 3 — (2-aminoethyl) indole, at 110, 24 hours, 48 hours, 72 hours, in vacuum

The sample was dissolved in a solution (1.5δώ) containing 40% n-propanol and 0.1% trifluoro group acid, each was taken to 0.1 / πδ, and dried with dry nitrogen gas. Alternatively, the reagent of (1) was added, the tube was sealed in a vacuum, and subjected to hydrolysis.

In the table, the measured values are the average of four times of the 24-hour value of ① and the 24, 48, 72-hour values of ②. However, T hr, Ser, V ₂ Cys, Met, Val, II e and rp rp were calculated by the following methods (Experimental Course in Biological Chemistry ', Protein Chemistry I (Tokyo Chemical Co., Ltd. Publishing)). _{TlK, S er, V 2 C} ys, Met is Ri DOO the time course of 24, 48, 72-hour value of ②, extrapolation to zero hours.

. V a and I le are 72 hour values of ②.

. T rp is the average of 24, 48, and 72 hour values of ②.

6 (Amino acid analysis table)

2) Sugar composition analysis

To 200 ng of the purified CSF sample used in the amino acid composition analysis described above, 25 nmo of inositol was added as 5 internal standards, and 1.5 NHCi was added. The reaction solution was reacted at 90 ° C for 4 hours in a sealed tube purged with nitrogen gas by adding a methanol solution (500 ^) containing the same. After neutralization by addition of open tube after silver carbonate (Ag ₂ C0 _3), it was shaken over anhydrous醉酸50 ^ and left Ichi晚in the dark at room temperature. The upper layer was placed in a sample tube and dried with nitrogen gas. Methanol was added to the precipitate, washed, centrifuged lightly, and the upper layer was added to the same sample tube and dried. To this, 50 TMS-forming reagents (pyridin: hexamethyl disilazane trimethyl chlorosilane-5: 1: mixed with 混合) were added, and the mixture was reacted at 40 ° C for 20 minutes. saved. The same operation is performed by combining galactose (Gal), N-acetylgalactosamine (GalNAc), sialic acid, etc. with 50 n moi and inositol 25 n moi as standard. Was performed.

This sample was subjected to gas chromatographic analysis under the following conditions.

〔 Analysis conditions〕

Column 2% 0V—17 VINport HP 60-80 mesh, 3m, glass

110 ^e until C~ 250 ° C 4 ° CZ amount of temperature increase key Ya Ri Yagasu initially 1.2 to 1. et an, ²

(Nitrogen pressure) at the end of the 2~ 2.5H ²

Sensitivity 10 ³ MΩ range 0.1 to 0.4 V

Pressure hydrogen gas 0, 8 an ²

Air 0.8 / era ²

Sample amount 2.5 to 3.0

As a result of analysis, the CSF of the present invention showed that galactose and Ν-acetyl Lugalactosamine and sialic acid were confirmed.

Example 27 Preparation of PHGV2 vector

(For animal cells, VSE system)

After treating the EC0RI fragment of the CDNA shown in FIG. 4 (A) obtained in Example 10 with the restriction enzyme DraI at 37 ° C. for 2 hours, the Klenow fragment of DNA polymerase I (Takara Shuzo Co., Ltd.) ) To make the ends smooth. 1 §f Bgl linker (8 mer; manufactured by Takara Shuzo) was phosphorylated using ATP, and then combined with the mixture of about 1 DNA fragment obtained above. Then, it was treated with the restriction enzyme Bgl i and subjected to agarose gel electrophoresis, and only the largest DNA fragment was recovered.

As shown in FIG. 5, this DNA fragment corresponded to about 710 base pairs including a portion coding for the human G-CSF polypeptide. After treating pdKCR (Fukunaga ^; Proc. Nat., Acad. Sc Sc. USA; Vol. 50, page 6 (1984)) with the restriction enzyme BamH I, the enzyme was re-phosphorylated (Takara Shuzo). the vectored one DNA obtained by de-phosphate was obtained PHGV 2 is combined with CDNA fragments by the addition of T ₄ 0 nA rigger one t (manufactured by Takara Shuzo Co., Ltd.) at a company Ltd.) (Figure 15). As shown in FIG. 15, this plasmid contains the promoter of the SV40 early gene, the replication initiation region of SV40, a part of the egret i3—globin gene,

It contains the replication initiation region of PBR322 and the 3-lactamase gene (Affl [) ^p ) derived from PBR322, and has a human G-CSF gene downstream of the promoter of the SV40 early gene. Example 28 Construction of a recombinant vector for C127 cells (— VSE)

1) Construction of PHGV2 (H)

Using the -pHGV2 plasmid 20 obtained in Example 27 (Figure 15), a plasmid named PHGV2 (H) was obtained by the method described in 1) of Example 22 (Figure 16). .

2) Construction of recombinant vector PTN-V2 for expression

Using the PHGV2 (H) 20ίΖ3 obtained above, E. coli harboring a plasmid containing the PHGV2-derived G-CSF cDNA by the method described in Example 22-2) Ronnie was selected, and this plasmid was named PTN-V2 (Figure 16).

Example 29 Transformation of C127 cells and its expression (1 VSE) V2 obtained in Example 28 is treated with a restriction enzyme BamHI before transforming into mouse C127 cells.

Next, mouse C1271 cells were transformed with the above-prepared DNA and expressed (see Example 23), and clones having high G-CSF-producing ability were selected. As a result, G-CSF production of ~ 〜 level was observed.

In addition, Τ3Τ3 cells can be used as host cells in addition to the above-mentioned C127I cells.

Example 30 Expression of G-CSF by CH0 cells (— VSE)

1) Construction of pHGV2-dhfr

A fragment of about 2.7 kb obtained from the PHGV2 plasmid 20 i §f obtained in Example 27 by the method described in 1) of Example 24

0.5 of each of the fragments of pAdD26SVpA was annealed. This plasmid was transformed into the E. coli DHI strain by the rubidium chloride method. Select a colony that retains the PHGV2-dhfr plasmid by transmutation. The resulting plasmid was designated as PHGV2-dhfr (FIG. 17a).

As an alternative to the above, PHGV2 plasmid was treated with Sail and partially digested with EcoRI without addition of EcoRI linker to recover a fragment of about 2.7 kb. col i DNA polymerase

Treat the DNA fragment with the Klenow fragment and blunt-end the ends.

Meanwhile bran Bok-end of the EcoRI fragment of pAdD26SVpA at above the same way were prepared, both with T ₄ DNA re gar peptidase processing

PHGV2-dhfr can also be prepared.

The PHGV2 (H) obtained in Example 28 was treated with the restriction enzymes Hindll and SalI described in Example 28-2), and the Hind IE-Sal I fragment was ligated to the pAdD26SVpA plasmid. PHGV2-dhfr can be obtained even when ligated to the endogenous EcoRI fragment (Fig. 17b) 2) Transformation and expression

Using the PHGV2-dhfr plasmid prepared in 1) above, CH0 cells were transformed and expressed by the method described in 2) of Example 24.

Transformation of CH0 cells was performed with PHGV2 on CH0 cells.

It can also be performed by cotransformation of p / \ dD26SVpA.

In addition, a replacement vector can be constructed by a method using a so-called nick of the lip of the liposome, and this can be used to transform CH0 cells. For example, pAdD26SVpA is processed by Pstl, By recovering the fragments and combining them with the CSF cDNA fragment derived from PBRV2, the recombinant vector arranged in the direction of the poly A site of adenovirus promoter, CSF CDNA, DHFR and SV40 was obtained. Was constructed and put into CH0 cells.

Example 31 Assay of G-CSF activity of expressed substance (—VSE) From the culture supernatants of C127 cells and CH0 cells obtained in Examples 29 and 30, according to the method described in Example 25, Human G-CSF was obtained, and its human G-CSF activity was assayed. The results are shown in Table 7.

Table 7: Assay for human G-CSF activity Human neutrophil colony count Zdish-purified human G-CSF (20 ng) 96 pd BPV-1 (20 times concentration)

P a D r V-I A? M ¾ 5¾ ci 1 T.

0

BPV 3T3 cell culture solution (20 times concentration)

Η Ι Η V V C C ¾ C S C / »培養» 培養（»J C

Culture medium of 3Τ3 103 cells transformed with PTN-V2 (20, double concentration)

Culture solution of 0 dhfr CH0 cells transformed with pAdD26SVpA (20-fold rasp)

111 transformed with PHGV2-dhfr

Culture solution of CH0 cells (20 times concentration) Example 32 Amino acid analysis and sugar analysis (—VSE) 1) Analysis of amino acid composition

The crude CSF sample obtained in Example 31 was further purified according to the method (Hi) of Example 2. This purified CSF sample was purified by the method described in Example 26-1) to obtain an amino acid. It was subjected to acid composition analysis. Table 8 shows the results. Table 1-8 (Amino acid analysis table)

2) Sugar composition analysis

Using the purified CSF sample used in the above amino acid composition analysis, the same method and the same analysis conditions as described in Example 26-2) were used. The sugar composition was analyzed. As a result of the analysis, galactose, N-acetylgalactosamine and sialic acid were confirmed from the CSF of the present invention.

G

Example 33 Infection Defense Effect of Human G-CSF

1. Protective effect against Pseudomonas aerug i nosa infection

After intraperitoneal administration of endoxane (trade name, manufactured by Shisai-nogi) / to ICR mice (male) weighing 8 to 9 weeks (body weight: 35.3, 1.38 g), the mice were divided into three groups, and G-CSF (25000U / mouse or 50000UZ mouse) containing a solvent (Ί% propanol in saline, 0.596 (W / V) mouse serum albumin) and another group containing only the solvent. Each was subcutaneously administered 0.1 times every 24 hours for 4 times. Three hours after the fourth administration, each group was infected subcutaneously with Pseudomonas aeruginosa GNB-139 (3.9 × 10 ⁵ CFU mouse). Twenty-one hours after the infection, a vehicle containing human G-CSF (250001 / mouse or 50000 UZ mouse) or the vehicle alone was subcutaneously administered again to the corresponding groups.

The effect of preventing infection was examined based on the number of surviving mice up to 10 days after infection.

[Preparation of bacterial solution]

Incubate Pseudomonas aeruginosa GNB-139 overnight at 37 ° C in a Hart Infusion liquid medium (trade name, manufactured by Dco). The culture was prepared by suspending the culture in saline. 2. Defensive effects on Candida infection

After intraperitoneal administration of endoxan (manufactured by Shisai-Nogi Co., Ltd., 200fflSf½) to an ICR mouse (male), 8 weeks old (weight: 40.5 soil: 1.60?), It was divided into two groups, and human G was given to one group. -CSF (50000U / mouse) -containing solvent (1% propanol in physiological saline, 10% (W / V) allogeneic mouse serum) and another group containing only solvent every 24 hours Four hours after the fourth dose, Candida albicans was added to each group.

U-50-1 (a urine isolate from a leukemia patient, provided by the Department of Bacteriology, Tohoku University) 5.6 × 10 ⁵ CFU / mouse was intravenously administered for infection. The effect of preventing infection was examined based on the number of surviving mice up to 10 days after infection. (Preparation of bacterial solution)

Sabouraud liquid medium containing yeast extract (2% Dextrose (manufactured by Junsei Chemical Co., Ltd.)) 10% Tribute case peptone (manufactured by ΒΒΙ ·: trade name), 5% yeast extract (manufactured by DCO) : Shake and culture Candida al bicans U-50-1 at 37 ° C using PH5.6) at night. The culture was washed twice with saline and then suspended in saline to prepare.

3. Intracellular parasites! Defense effect against listeria infection

A 7-week-old (34.7 soil 1.249) ICR mouse (male) was administered with endoxan (Shionogi: trade name) 200ffig Z intraperitoneally and divided into two groups. Solvent containing CSF (50,000 UZ mice) (1% n-propanol in physiological saline, 10% (W / V) peripheral mouse serum) in a separate group, and only vehicle every 24 hours. Was administered subcutaneously four times each at 4 o'clock after the fourth dose In the meantime, each group has a lister ♦ Monosite Jenners

(Listeria monocytogenes) 46 (Department of Bacteriology, Tohoku Univ.) 1.0 × 10 ⁷ mice were infected intravenously and infected. The protective effect of infection was examined by the number of surviving mice up to 12 post-infection. Preparation of bacterial solution]

Incubate the Listeria monocytogenes 46 overnight in a plain heart infusion liquid medium (manufactured by Dco, trade name) at 37 ° C with shaking. It was prepared by turbidity <Results>

(1) Infection protection effect of natural human G-CSF The above tests I, 2 and 3 were performed on human G-CSF obtained from CHU-1 described in Reference Example 2.

The obtained results are shown in Table 9, Table 10 and Table 11. .

'' Table 9

Effect on sinus aeruginosa

Group CSF concentration (U / mouse day) Number of surviving total number of solvents 0 0/11

Including C8F

25000 6/10 solvent

Including CSF

50000 8/11 solvent Table 1 Infection protection effects on 10 Candida albicans

Table 1 Infection prevention and control effects on listerial monolithic engineering

② Infection protection effect of human G-CSF obtained from transgenic plants

i) For the G-CSF (+ VSE) polypeptide from Escherichia coli obtained in Example 15, the above Tests 1, 2 and 3 were performed. The results are shown in Tables 1, 12, 13 and 14. Table 1 Effect on 12-Monads aeruginosa

Table 1 13 Infection protective effect against Candida albicans Group CSF strain (UZ mouse Z day) Surviving number Total solvent 0 0 10

Including CSF

50000 10/10 solvent Table 1 Infection protection effect on u-listenosis

ii) The above test 1 was performed on the (3-CSF (-VSE) polypeptide from Escherichia coli obtained in Example 19.

Table 15 shows the results.

15 Effect on pseudomonas aeruginosa

ϋί) The same CHO used for the amino acid composition analysis in Example 26 The above Test 1 was performed on a cell-derived purified human G-CSF sample (+ VSE).

Table 16 shows the results. Table 1.Effects on 16 Monaco aeruginosa

As described above, the infection protective effect of the above Test 1 was examined using the same purified human G-CSF sample derived from C127 cells used in the amino acid composition analysis of Example 26. Almost the same result was obtained.

iV) The same test 1 described above was performed on the same purified human G-CSF sample (one VSE) derived from CHO cells used in the amino acid composition analysis of Example 32.

Table 17 shows the results. Table 1 17 Effects on pseudomonas aeruginosa

Similarly, using the purified human G-CSF sample derived from C127 cells used for the amino acid composition analysis in Example 32, the effect of the above-mentioned test 1 for preventing infection was examined. Similar results were obtained. Example 34

The freeze-dried preparation of human G-CSF obtained in Example 2 was dissolved in a solubilizer for injection and dispensed so as to have a desired number of dosage units to obtain an injection.

Example 35

A freeze-dried preparation of human G-CSF polypeptide from Escherichia coli obtained in Example 15 was dissolved in a solubilizer for injection and dispensed to obtain a desired number of dosage units to obtain an injection. .

Claims

The scope of the claims

(1) An anti-infective agent comprising human granulocyte colony stimulating factor as an active ingredient.

(2) The infection preventive agent according to claim 1, wherein the human granulocyte colony stimulating factor is a neutrophil colony stimulating factor.

(3) The agent for preventing infection according to claim 1, wherein the human granulocyte colony stimulating factor is obtained from a culture supernatant of a human granulocyte colony stimulating factor-producing cell.

(4) The agent for preventing infection according to claim 3, wherein the human granulocyte colony-stimulating factor has the following physicochemical properties.

`` Physicochemical properties

I) Molecular weight Approximately 19,000 soil 1,000 as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

H) Isoelectric points The three isoelectric points (A

B, C) have at least one of them. I Isoelectric point (PI)

Value in the presence of 4 M urea Value in the absence of urea

A 5.7 Sat 0.1 5.5 Person 0.1

B 6.0 Sat 0.1 5.8 Sat '0, 1

C 6.1 soil 0.1

O

l +

DI) Ultraviolet absorption: has maximum absorption at 280na and minimum value at 250ras.

IV) The amino acid sequence from the N-terminal to the 21st residue is as follows.

H 2 N — T hr— P ro— L euU y— P.ro— A la-

(Ten)

One Ser—Ser—Sheu—Pro—GIn— (Ser) One Phe—

(20)

L eu-L eu-L ys- X— L eu- G I u-X— V a I-

(5) Human granulocyte colony stimulation produced from a transformant containing a recombinant vector containing a gene encoding a polypeptide having human granulocyte colony stimulating factor activity 2. The infection protective agent according to claim 1, comprising a polypeptide or a glycoprotein having a factor activity as an active ingredient.

(6) A gene encoding a polypeptide having human granulocyte colony stimulating factor activity encodes a polypeptide sequence shown below or a part thereof. Certain claims Infection protective agent according to Item.

M et A la G ly Pro A la T hr G In Ser

Pro M et ys and eu M et A la then eu G In and en eu L eu T rp H is Ser A la and eu

T rp T hr V al G In G lu A la T hr P ro

L eu G I y P ro A la S er S er then eu P ro

G In Ser P he then eu then eu then ys C ys then eu

G In G In V al A rg ys I le G In G ly

A sp G I y A I a A la then eu G In G lu then ys

L eu (V a IS er ^{G lu} ) _m C ys A la T hp T yr ys eu cy C ys H is Pro Glu G lu eu

V al then eu L eu G ly H is Ser er eu G ly I le P ro D rp A la P ro then eu Ser er Ser Cys Pro Ser G In A la then eu G In then eu A la GI y C ys then eu SerG In then eu H is Ser GIy L euP he then eu T yr G In Gly then eu then eu GI n A la then eu G lu G ly I le Ser Pro GI u eu G ly Pro Thr eu A sp T hr eu G In eu A sp V al A la A sp P he AI a T hr T hr I le T rp GI n G In et G lu G lu shi eu G ly M et A la P ro A la l eu G In Pro ro T hr G In G ly A la et P ro A la P he A la Ser A la P he GI n A rg A rg A la G ly G ly Val al eu V a IAI a Ser H Is is eu G In Ser P he L eu G Ιυ V a IS er Tyr A rg V a I

L eu A rg H is L eu A la G in P ro

(However, ffl represents 0 or 1.)

(7) A gene encoding a polypeptide having human granulocyte colony stimulating factor activity encodes a polypeptide sequence shown below or a part thereof. 6. The infection protective agent according to claim 5.

T hr P ro s en G I y P ro A la S er S er

L eu Pro G in Ser P he L eu then eu then ys

C ys and eu G I u G in Val Al rg and ys I le

G in G ly A sp G ly A la A la then eu G In

G lu L ys L eu (Val Ser Glu) m Cys A la .. T Jir Tyr-Lys L eu c ys H is P ro G lu

G lu L eu V a I L eu L eu G ly H is Ser

L eu G ly l ie P ro T rp A la P ro then eu

S er S er Cys Pro S er G in A la

G in and eu A la G ly Cys L eu SerGin In eu H is SerGly and euP he and eu T yr

G in G ly L eu L eu G I n A I a shi eu G lu

G ly lie S er P ro G lu L eu G ly P ro

T hp L eu A sp T hr eu G in eu A sp

V a I A la A sp P he A la T hr T hr I le

T rp G in G in Met G lu G lu then eu G ly

Met A la P PO A I a Le eu G in P PO T hr

G in G ly A la Met P ro A la P he A la S er A la P he G In A rg A rg A la G ly

G ly V al shi eu V al A la Ser H

G In S er P he shi eu G lu V al S er T yr

A rg Val al eu A rg H is shi eu A la G In

P ro (where m represents 0 or 1)

(8) The gene according to claim 5, wherein the gene encoding a polypeptide having human granulocyte colony-stimulating factor activity has the following nucleotide sequence or a part thereof: Described in 'Infection protective agents.

ATG GCT G6A CCT GCC ACC CAG AGC

CCC ATG AAG CTG ATG GCC CTG CAG

CTG CTG CTG TGG CAC AGT GCA CTC

'' TGG ACA GTG CAG GAA GCC ACC CCC

CTG GGC CCT GCC AGC TCC CTG CCC

CAG AGC TTC CTG CTC AAG TGC TTA

GAG CAA GTG AGG AAG ATC CAG GGC

GAT GGC GCA GCG CTC CAG GAG AAG

CTG (GTG AGT T6T GCC ACC TAC

AAG CTG TGC CAC CCC GAG GAG CTG

GTG CTG CTC G6A CAC TCT CTG GGC

ATC CCC TGG GCT CCC CTG AGC AGC

TGC CCC AGC CAG GCC CTG CAG CTG

GCA GGC TGC TTG AGC CAA CTC CAT

AGC GGC CTT TTC CTC TAC CAG GGG

CTC CTG CAG GCC CTG GAA GGG ATC TCC CCC GAG TTG G6T CCC ACC TTG GAC ACA CTG CAG CTG GAC GTC GCC

GAC TTT GCC ACC ACC ATC TGG CAG CAG ATG GAA GAA CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG G6T GCC ATG CCG GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG GTC CTG GTT GCC TCC CAT CTG CAG AGC GAG GTG TCG TAC CGC GTT

CTA CGC CAC CTT GCC CAG CCC

(However, m represents 0 or Ί)

(9) The gene for encoding a polypeptide having human granulocyte colony stimulating factor activity has a base sequence shown below or a part thereof. Item 6. The infection protective agent according to Item 5.

ACC CCC CTG GGC CCT GCC AGC TCC

CTG CCC CAG AGC TTC CTG CTC AAG

TGC TTA GAG CAA GTG AGQ AAG ATC

CAG GGC GAT GGC GCA GCG CTC CAG

GAG AAG CTG (GTG AGT ^GAG ) _m TGT GCC

ACC TAC AAG CTG TGC CAC CCC GAG

GAG CTG GTG CTG CTC GGA CAC TCT

CTG GGC ATC CCC TGG GCT CCC CTG

AGC AGC TGC CCC AGC CAG GCC CTG

CAG CTG GCA GGC TGC TTG AGC CAA CTC CAT AGC GQC CTT TTC CTC TAC

CAG GGG CTC CTG CAG GCC CTG GAA

GQG ATC-TCC CCC GAG TTG GGT CCC

ACC TTG GAC ACA CTG CAG CTG GAC

GTC GCC GAC TTT GCC ACC ACC ATC

TGG CAG CAG ATG GAA GAA CTG GGA

ATG GCC CCT GCC CTG CAG CCC ACC

CAG GGT GCC ATG CCG GCC TTC GCC

TCT GCT TTC CAG CGC CGG GCA GGA

GGG GTC CTG GTT GCC TCC CAT CTG

CAG AGC TTC CTG GAG GTG TCG TAC

CGC GTT CTA CGC CAC CTT GCC CAG

CCC (where m represents 0 or 1).

(10) The gene encoding a polypeptide having human granulocyte colony stimulating factor activity has the nucleotide sequence shown in FIG. 3 (A) or a part thereof. Infection protective agents described in Paragraph 5 of the Scope.

(11) The gene encoding the polypeptide having human granulocyte co-primary stimulatory activity has the nucleotide sequence shown in FIG. 4 (A) or a part thereof. An infectious agent according to claim 5.

(12) Claims wherein the gene encoding a polypeptide having human granulocyte colony stimulating factor activity is connected to a microorganism or a virus-derived revicon. Infection protective agent according to any of paragraphs 5 to 11 (13) The infection preventive agent according to claim 5, wherein the transformant is obtained by transforming Escherichia coli.

(14) The agent according to claim 5, wherein the transformant is obtained by transforming an animal cell.

(15) The infection protective agent according to item 5, wherein the polypeptide having human granulocyte colony stimulating factor activity is represented by the following amino acid sequence or a part thereof.

(Met) _n T hr P po L eu G ly P PO A la Ser Ser L eu Pro GI n S ep P he L eu eu L ys Cys L eu G iu G In V a IA rg ys lie G in G ly Asp G ly A la A la shi eu G in G lu L ys L eu (Va IS er Glu) Cys A la T hr T yr Lys shi eu. G lu L eu V a I Leu L eu G ly H is Ser L eu G ly lie P ro T rp AI a P ro L eu S er S er C ys P ro S er G in A la L eu G in L eu A la G ly Cys L eu SerG in L eu His Ser Gly L eu P he L eu Tyr G ln G ly L eu eu eu G in A la eu G lu G ly l ie SerProGluLeuGlyProThrLeuAspThrLeuGin euAspValAlaAspPheAlaThrThrlieTrpGinGIn Met G lu G lu shi eu G ly Met A la P ro A la L eu G In P PO T hr G in G ly A la M et P ro A la P he A ia S er AI a P he G in A rg A rg A la G ly G ly V al eu V a IA la Ser H is L eu G in Ser P he L eu GI u V a IS er T yr A rg V a I or eu A rg H is L eu A la GI n Pro (where m represents 0 or 1 and n represents 0 or 1)

(16) The claim wherein the glycoprotein having human granulocyte colony stimulating factor activity has the following amino acid sequence or a polypeptide represented by a part thereof and a sugar chain portion. Infection protective agent according to item 5 in the scope.

T hr P ro L eu G ly Pro A la Ser Ser Ser L eu Pro G in Ser P he eu eu ys, Cys L eu G lu .GI n V al A rg ys I le G In G ly A sp G ly A la A la shi eu G In G lu L ys L eu (Val Ser Glu) m Cys A la T hr T yr shi ys shi eu C ys H is P ro G lu

GI u L eu V a IL eu shi eu G ly H is Ser L eu G ly l ie P ro T rp A la P ro shi eu Ser Ser Ser Cys Pro Ro Ser G In A la shi eu GI n L eu A la G iy Cys shi eu SerG In L eu His Sep G ly shi eu P he shi eu T yr GI n G ly L eu L eu G In A la shi eu G lu GI yl ie S er P ro G lu eu G ly P ro T hr L eu A sp T hr eu G In eu A sp V a IAI a A sp P he A la Ding hr T r I le T ΡΡ G In G In et G lu G lu shi eu G ly et A la P ro A la shi eu G In Pro ro Tr G In G ly A la M et P ro A la P he A la Ser a la P he G In A rg A rg A la G ly G ly V ai then en Val Al A la Ser H is then eu G In Ser Phe then eu G lu V al Ser yr T yr A rg V al then eu A rg H is eu A la G In Pro (where m represents 0 or 1)