DK172763B1 - Isolated interleukin-1 (IL-1) inhibitor or precursor polypeptide thereto, isolated DNA molecule encoding it, vector and - Google Patents

Description

in DK 172763 B1

FIELD OF THE INVENTION

This invention relates to an isolated interleukin-1 inhibitor (IL-1I) capable of inhibiting interleukin-1 (IL-1), or a precursor polypeptide which can be converted to such an inhibitor. Furthermore, the invention relates to an isolated DNA molecule encoding the interleukin-1 inhibitor or precursor polypeptide, a recombinant DNA vector and a recombinant host cell comprising this DNA molecule, and a method for producing interleukin-1 inhibitor 10. the tumor or precursor polypeptide. In addition, the invention relates to the use of the interleukin-1 inhibitor for the preparation of a pharmaceutical composition for inhibiting interleukin-1 as well as a pharmaceutical composition comprising the interleukin-1 inhibitor.

BACKGROUND OF THE INVENTION

Interleukin-1 molecules are a class of proteins produced by numerous cell types, including monocytes and certain macrophages. This class comprises at least two 17-18 kilodalton 20 proteins known as interleukin-1 alpha and interleukin-1 beta. These proteins have important physiological effects on several different target cells involved in the inflammatory and immunological responses. The proteins are co-mitogens (with phytohemaglutinin) for T cells, they cause both fibroblasts and chondrocytes to secrete latent collagenase and increase the surface adhesive power of endothelial cells for neutrophils. Furthermore, they act on the hypothalamus as pyrogens, stimulate muscle protein catabolism, and induce hepatocytes to synthesize a protein class known as "acute phase reactants". Interleukins (IL-1) are obviously an important part of an organism's response to infection and damage to the body.

2 DK 172763 B1 However, despite their usually beneficial effects, situations have been found where the effects of IL-1 are deleterious. IL-1 can e.g. increase the level of collagenase in a rheumatoid arthritis and has been implicated as a mediator for both immunopathological acute and chronic stages of rheumatoid arthritis. IL-1 may be responsible for altered endothelial cell function, control of leukocyte and lymphocyte chemotaxis and migration into the synovial tissue, induction of capillary tissue proliferation, and stimulation of roacro-phage accumulation in the synovial tissue during the acute phase thereof. disease. In the tissue destruction phase, IL-1 is involved as a mediator in the induction of tissue damage by stimulating the release of enzymes from fibroblasts and chondrocytes.

15 Excessive production of IL-1 has also been detected in the skin of psoriatic patients, and high levels of IL-1 can be found in the synovial fluid of patients with psoriatic arthritis. IL-1 released by cells of the inflammatory synovium in psoriatic arthritis can mediate tissue destruction by stimulating enzyme release from other cells. The joint pathology of Reiter's syndrome is similar to that seen in psoriatic arthritis and in rheumatoid arthritis. IL-1 has been shown to be involved as a mediator of tissue destruction in these 3 different forms of inflammatory arthritis. Furthermore, IL-1 can be found in the synovial fluid of osteoarthritis patients. Release of IL-1 from chondrocytes has been shown to be involved in the destruction of arthritis connective tissue in this disease.

IL-1 can also make autoimmune diseases more severe. For example, decreased IL-1 production has been described from peripheral blood cells in individuals suffering from systemic lupus erythematosus. Furthermore, some of the changes in B lymphocyte function may be related to abnormalities in IL-1 production or IL-1 availability.

3 DK 172763 B1

Excessive IL-1 production has been shown in peripheral monocytes in seleroderma patents, and IL-1 has been shown to be implicated as a possible fibrosis agent in stimulating collagen production of fibroblasts. The tissue-damaging mechanism 5 of dermatomyositis may also involve cell-mediated immunity, and IL-1 may therefore be involved as a mediator in this pathophysiological process.

Acute and chronic interstitial lung disease is characterized by lung fibroblasts, which may be stimulated by IL-1, 10 producing too much collagen. Recent studies on an animal model of pulmonary hypertension indicate that IL-1 may be responsible for the induction of endothelial cell changes resulting in narrowing of pulmonary arteries. It is this constriction that leads to pulmonary hypertension and further visual injury. IL-1 inhibitors may therefore be useful in the treatment of these pulmonary diseases.

Recent studies have shown that IL-1 is capable of directly damaging the beta cells in the Langerhans Islands, which are responsible for insulin production. IL-1 damage in the 20 cells is now thought to be a primary relationship in the acute phase of juvenile diabetes mellitus.

Kidney monocyte and macrophage infiltration predominates in many forms of acute and chronic glomerulonephritis. IL-1 release from these cells may result in local accumulation of other inflammatory cells, eventually leading to inflammatory damage and fibrotic reaction in the kidney.

It has been shown that the crystals found in tissues or fluids at rheumatism and pseudogene can directly stimulate macrophages to release IL-1. Therefore, IL-1 may be an important mediator of the inflammatory cycle of these diseases.

4 DK 172763 B1 IL-1 is capable of inducing loss of bone calcium and may be responsible for osteoporosis seen in inflammatory joint diseases.

Keratinocytes from patients with psoriasis release large amounts of IL-1. This mediator may be responsible for the secondary cell proliferation and accumulation that occurs in the skin of patients with this disease.

IL-1 is one of the important endogenous pyrogens and may be responsible for inducing a pronounced rate of fever, which is seen in certain infectious diseases, such as diseases with acute fever caused by bacteria or viruses.

Sarcoidosis is characterized by granulomatous lesions in many different organs of the body. IL-1 has been shown to be capable of inducing granuloma formation in vitro and may be involved in this process in patients with sarcoidosis.

Excess IL-1 production has been detected in peripheral monocytes in both Crohn's disease and ulcerative colitis. Local IL-1 release in the gut may be an important mediator 20 for stimulating the inflammatory cycle of these diseases.

Certain lymphoma types are characterized by fever, osteoporosis and even secondary arthritis. Excess IL-1 release has been detected in some lymphoma cells in vitro and may be responsible for some of the clinical manifestations of these disease signs. In addition, IL-1 production from certain malignant lymphocytes may be responsible for some of the fever reactions, acute phased response, and cachexia reactions seen in leukemia.

30 IL-1 release from astrocytes in the brain is thought to be responsible for inducing the fibrosis that can occur following damage to the brain due to vascular occlusion.

Use of an IL-1 Inhibitor In these and other circumstances where IL-1 has a deleterious effect, there is clearly a clinical need for an inhibitor of IL-1 function. Since IL-1 is a co-mitogen for T cells, 5 it is centrally located in the development of autoimmune diseases and other immune disorders. Thus, upon systemic administration, IL-1 inhibitors could be useful immunosuppressants. Topically, such IL-1 inhibitors could serve to prevent tissue damage in an inflammatory joint and other inflammatory sites. Indeed, to prevent tissue destruction, certain IL-1 inhibitors may prove more effective when given in conjunction with collagenase inhibitors.

Therapeutic intervention against the IL-1 effect may be possible at the synthesis or secretion level or by the target cell's binding or response to the protein. IL-1 is synthesized by monocytes / macrophages and other cells in response to lipopoly saccharides, complement fragments and viruses. Any molecule that blocks the binding of these inducing agents to production cells or that interfere with their effects on the physiology of these cells can serve as a regulator of IL-1 function. IL-1 is not secreted by a traditional secretory system, since one has isolated mRNA molecules that encode at least two 30 kd precursors of the proteins but which do not contain a hydrophobic signal sequence. Release of the active protein from the inactive precursor probably requires proteolysis of this precursor. An inhibitor of the release of IL-1 or IL-1 types from their precursors could theoretically regulate the IL-1 effect. IL-1 likely acts on target cells via a classical receptor-mediated pathway, although the receptor has not yet been isolated. Thus, it may be that a molecule that interferes with the binding of IL-1 to its receptors, or which down-regulates these receptors, could also regulate the IL-1 effect. In addition, since the intracellular conditions following the receptor binding of IL-1 are not yet fully understood, it is possible that agents exist that may interfere with the cellular responses to other receptor-mediated conditions, and which therefore blocks IL-1 action. For the reasons stated above, proteins and small molecules capable of inhibiting IL-1 in one or more of these ways have been sought.

SUMMARY OF THE INVENTION

According to the present invention, at least two IL-1 inhibitor proteins with IL-1 inhibitory properties have been found. These molecules have been obtained in pure form, which will enable one skilled in the art to determine their amino acid sequence. A preparation of cells producing these proteins has been further characterized and an mRNA leading to its synthesis has been characterized.

Finally, antisera have been developed which will facilitate the screening of cDNA expression libraries for the genes encoding these inhibitors. Together, these reagents will allow cDNA encoding the IL-1 inhibitors to be cloned. These genes will then enable large-scale production of IL-1 inhibitors suitable for use in pharmaceutical formulations useful for treating pathophysiological conditions mediated by IL-1.

It is an object of the present invention to provide purified forms of IL-1 inhibitors which are active against IL-1-alpha or IL-1-beta or a combination thereof. It is a further object of the present invention to provide these inhibitors in purified form to enable determination of their amino acid sequence. It is a further object to provide the amino acid sequences of certain IL-1 inhibitors. Further, it is also an object of the invention to identify biologically active analogues of IL-1 inhibitors with enhanced or equivalent properties.

It is further an object of the present invention to provide a recombinant DNA system for production of IL-1 inhibitors as described herein. A further object of the invention includes the provision of purified forms of IL-1 inhibitors which will be valuable as pharmaceutical compositions by exhibiting activity against IL-1.

Further objects and advantages of the invention will be stated, in part, in the following description, and in part will be apparent from the description or could be experienced from the practice of the invention. The objects and advantages can be understood and can be achieved by the means and combinations thereof, which are particularly pointed out in the appended claims.

In order to achieve the objects and in accordance with the objects of the present invention, IL-1 inhibitors are shown which exhibit inhibitory activity against IL-1. The preferred inhibitors have been isolated in a pure form from 15 monocyte conditioned medium with monocytes grown on IgG coated plates.

Preferred inhibitors of the present invention are 1, 2 and 3. The inhibitors 1 and 2 are proteins that, by SDS-PAGE, run at positions characteristic of 20-22-23 kD proteins and elute at 52 mM and 60 mM NaCl, respectively. a Mono Q FPLC column under specified conditions. Inhibitor 3 is a protein that, at SDS-PAGE, runs at a position characteristic of a 20 kD protein and elutes at 48 mM NaCl from a Mono Q FPLC column under the 25 specified conditions. To further achieve the objects of the present invention, pharmaceutical compositions containing at least one of the active ingredients, an IL-1 inhibitor of the present invention or its biologically active analogue are described as described herein.

In order to further achieve the objects of the present invention, a recombinant DNA system for the preparation of these IL-1 inhibitors and their analogs is disclosed. A preferred embodiment of this system comprises at least one cDNA clone or its synthetic equivalent encoding at least one IL-1 inhibitor, together with vectors or cells, which constitute an expression system capable of to express the IL-1 inhibitors as described herein. Antisera are also provided to identify these cDNA clones. Furthermore, expression systems are provided to produce these IL-1 inhibitors using these cDNA clones, their analogs or other DNA sequences encoding these inhibitors.

Thus, according to the invention, there is provided an isolated interleukin-1 inhibitor (IL-II) capable of inhibiting interleukin-1 (IL-1) or a precursor polypeptide which can be converted to such an inhibitor which inhibitor or precursor polypeptide is distinctive to the characterizing portion of claim 1.

Furthermore, the invention provides an isolated DNA molecule encoding an interleukin-1 inhibitor (IL-1I) capable of inhibiting interleukin-1 (IL-1) or a precursor polypeptide which can be converted to a DNA inhibitor, said DNA molecule being peculiar to the characterizing portion of claim 12.

According to the invention there is also provided a recombinant DNA vector which is peculiar in that it comprises the above defined DNA molecule and a recombinant host cell which is peculiar to the characterizing part of claim 21.

According to the invention there is also provided a method for producing an interleukin-1 inhibitor (IL-1I) or a precursor polypeptide of the invention, which is unique in that the interleukin-1 inhibitor or precursor polypeptide is produced in a recombinant host cell as defined above under suitable conditions. for expression of the DNA molecule contained therein and formation of IL-1I or a precursor polypeptide.

In addition, the invention comprises the use of an interleukin-1 inhibitor (IL-1I) of the invention for the preparation of a pharmaceutical composition for inhibiting interleukin-1 and a pharmaceutical composition which is peculiar in that it comprises an interleukin-1. inhibitor (IL-1i) of the invention.

BRIEF DESCRIPTION OF THE FIGURES

Figures 1a and 1b show the protein profile from Mono Q chromatography of two metabolically labeled monocyte supernatants. The cells were grown on plates coated with IgG (1a) or fetal calf serum (1b).

Figure 2a shows silver-colored gels of fractions from regions 10 shown in Figures 1a and 1b.

Figure 2b is an autoradiogram of the gels shown in Figure 2a.

Figures 3a, b and c show data on the purified IL-1 from Example 1. Figure 3a shows the chromatography results with the radioactivity pattern superimposed. Figure 3b shows silver-colored gels run on samples of the fractions shown in Figure 3a. Figure 3c shows autoradiograms of the gels of Figure 3b.

Figures 4a and b show the results of gel filtration chromatograms of Mono Q purified IL-1I.

Figures 5a and b show Western analysis of mouse antisera.

Figure 6 shows the construction of plasmid pSVXVPL21L-li.

Figure 7 shows the construction of plasmid pMK-SGE: IL-1I.

Figures Ba-d show data on iL-li-alpha. Figures 8a and 8b show chromatography data. Figure 8c shows a silver-colored gel 25 run with samples of fractions, as shown in Figure 8b.

Figure 8d shows an autoradiogram.

Figures 9a and 9b show data on IL-1i-beta. Figure 9a shows chromatography data. Figure 9b shows results from SDS-PAGE.

10 DK 172763 B1

Figure 10 shows results for IL-1α-alpha peptide separation.

Figure 11 shows results for IL-1β beta peptide separation.

Figure 12a is a photograph of the GT10-IL-li-2A gel digested with FcoRI after electrophoresis of Example 6.

Figure 12b shows results from an autoradiogram of a Southern blot of the gel shown in Figure 12a.

Figure 13 shows part of the DNA sequence of the protein-coding region of lambda GT10-IL-li-2A and the predicted amino acid sequence of Example 6.

Figure 14 shows the nucleotide sequence of GT10-IL-li-2A.

Figure 15 shows a peptide comprising, inter alia, an IL-II sequence and a secretory leader sequence.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

Reference will now be made in detail to the presently preferred embodiments of the invention, which together with the following examples serve to explain the principles of the invention.

A. Inhibitor from human monocytes

As stated above, the present invention relates to IL-1 inhibitors which have been isolated in a pure form. The IL-1 inhibitors of the present invention preferably derive from medium conditioned with human monocytes, where the monocytes are grown on IgG-coated containers. Furthermore, the invention comprises substantially purified IL-1 inhibitors of any origin which are biologically equivalent to the inhibitor derived from human conditioned monocyte medium.

By the term "biologically equivalent" as used in the specification and claims is meant compositions of the present invention which are capable of preventing IL-1 activity in a similar manner, but not necessarily to the same degree as the natural IL-1 inhibitor isolated from monocytes. By the term "substantially homologous," as used herein in the specification and claims, is meant a greater degree of homology to the native IL-1 inhibitor isolated from monocyte-conditioned medium than that exhibited by any previously described IL-1 inhibitors. The degree of homology is preferably above 70%, more preferably 10 above 805% and even more preferably above 90%. A particularly preferred group of inhibitors is over 95% homologous to the native inhibitor. The percent homology described is calculated as the percentage of amino acid residues found in the smaller of the two sequences that match identical amino acid residues in the sequence compared to when 4 holes of 100 amino acids length can be introduced to facilitate this pairing as described by Dayhoff, MD, in the Atlas of Protein Seguence and Structure bd. 5, pp. 124 (1972), National Biochemical Research Foundation, Washington, D.C., 20 which is specifically incorporated herein by this reference.

The preferred IL-1 inhibitors of the present invention are derived from monocyte conditioned medium and have been isolated for the first time in a pure form. The terms "pure form" or "purified form" as used herein with reference to the IL-1 inhibitors described herein are intended to mean a preparation which is substantially free of other proteins other than IL-1 inhibitor proteins. The IL-1 inhibitors of the present invention are preferably at least 90% pure and more preferably 95% pure.

At least 3 purified IL-1 inhibitors have been isolated by the methods of the example. These include inhibitor 1, inhibitor 2, and inhibitor 3. Inhibitor 1 behaves as a 22-23 kD molecule at SDS-PAGE red an approximate isoelectric point of 4.8, and elutes from a Mono Q FPLC column 35 at ca. 52 mM NaCl in Tris buffer, pH 7.6. Inhibitor 2 is also a 22-23 kD protein, p1 = 4.8, but elutes from a Mono Q column at 60 mM NaCl. Inhibitor 3 is a 20 kD protein and elutes from a Mono Q column at 48 mM NaCl. Inhibitors 1, 2 and 3 are immunologically and functionally related. By obtaining these inhibitors in purified form, it has become possible for the inventors to obtain their amino acid sequences. Using the purified inhibitors described herein for the first time, and methods described in and by ABI Protein Sequencer technical manuals supplied with ABI 10 Protein Sequencer, a substantial portion of the amino acid sequences of these inhibitors can be deduced.

Example 3 shows amino acid sequence results for 3 forms of IL-1 inhibitors, namely IL-1-X, IL-1-alpha and IL-1-beta.

The inventors have described at least one antibody to an IL-1 inhibitor. Other polyclonal and monoclonal antibodies to this and other IL-1 inhibitors may be prepared by methods known to those skilled in the art. A particular polyclonal antibody is described in Example 4.

B. Recombinant Inhibitor 20 1. General

A method of recombinant DNA to produce an IL-1 inhibitor is now described. In one embodiment of the invention, the active site functions in a manner which is biologically equivalent to the function of the native IL-1 inhibitor isolated from humans. A natural or synthetic DNA sequence can be used to control the production of IL-1 inhibitors. This method comprises: (a) Preparation of a DNA sequence capable of directing a host cell to produce a protein having 30 IL-1 inhibitor activity.

(b) Cloning the DNA sequence into a vector capable of being transmitted to and replicated in a host cell, which vector contains operational elements required to express the DNA sequence.

(c) Transferring the vector containing the synthetic DNA sequence and operative elements to a host cell capable of expressing the DNA encoding the IL-1 inhibitor.

(d) Culturing the host cells under conditions suitable for amplification of the vector and expression of the inhibitor.

(E) Harvesting of the inhibitor.

(f) The inhibitor is allowed to assume an active tertiary structure, thereby possessing IL-1 inhibitor activity.

2. DNA Sequences DNA sequences for use in this method are discussed 15 in Example 5 and in Example 6. It should be understood that these sequences comprise synthetic and natural DNA sequences. The natural sequences include additional cDNA or genomic DNA segments.

In Example 6, a molecular clone of DNA that encodes a protein identical to that isolated from Examples 1-3 provides. In Example 6, a plaque, GT10-IL-li-2A, was isolated from a GT10 library. The phage in this plaque was amplified and the DNA isolated and digested with FcoRI. An 1850 base pair EcoRI fragment carries the IL-1 inhibitor coding sequence. Figure 13 shows the partial DNA sequence of the EcoRI fragment.

In view of the teachings included herein and known methods, other synthetic polynucleotide sequences will be available to one skilled in the art. As an example of the current state of the art 30 in terms of polynucleotide synthesis, reference is made to Matteucci, M.D., and Caruthers, H.H., in J. Am.

14 DK 172763 B1

Chem. Soc. 103, 3185 (1981) and Beaucage, S.L., and Cautruthers, M.H., in Tetrahedron Lett. 22, 1859 (1981), and to the instructions provided with an ABI oligonucleotide synthesizer, which references are specifically incorporated by reference.

These synthetic sequences may be identical to the natural sequences described in greater detail below, or may contain different nucleotides. If the synthetic sequences contain nucleotides different from those found in the natural DNA sequences of the invention, it is to be understood that in one embodiment, these different sequences would still encode a polypeptide having the the same primary structure as IL-1I isolated from monocytes. In an alternative embodiment 15, the synthetic sequence containing various nucleotides will encode a polypeptide having the same biological activity as the IL-1 described herein.

Furthermore, the DNA sequence may be a fragment of a natural sequence, i.e. a fragment of a naturally occurring polynucleotide that has been isolated and purified for the first time according to the present invention. In one embodiment, the DNA sequence is a restriction fragment isolated from a cDNA library.

In an alternative embodiment, the DNA Sequence is isolated from a human genome library. An example of such a library useful in this embodiment is described by Lawn et al., In Cell: bd. 5: 1157 ~ 1174 (1978), specifically incorporated herein by reference.

In a preferred version of this embodiment, it is to be understood that the natural DNA sequence will be obtained by a method comprising: (a) preparing a human cDNA library from cells, preferably monocytes, capable of producing an IL-1 inhibitor, in a vector, and a cell capable of amplifying and expressing all or part of this cDNA, (b) examining the human DNA library with at least one probe capable of binding to the IL-1 inhibitor gene 5 or its protein product, (c) identifying at least one clone containing the gene encoding the inhibitor by the clone's ability to bind at least one probe for (d) isolating the gene or a portion of the gene encoding the inhibitor and from the selected clone or clones, and (e) linking the gene or suitable fragments thereof to operational elements which are necessary to preserve and express the gene in a host sc elle.

The natural DNA sequences useful in the foregoing method may also be identified and isolated by a method comprising: (a) preparation of a human genomic DNA library preferably propagated in a recArecBC B.coll. (b) screening the human genome DNA library with at least one probe capable of binding to an IL-1 inhibitor gene or its protein product, (c) identifying at least one clone containing the gene encoding the inhibitor by the clone's ability to bind to at least one probe of the gene or its protein product, (d) isolating the gene encoding the inhibitor from the identified clone (s), and ( e) coupling the gene or suitable fragments thereof to operational elements necessary to maintain and express the gene in a host cell.

16 DK 172763 B1

In isolating a natural DNA sequence suitable for use in the above method, it is preferred to identify the two restriction sites located in or closest to the end portions of the appropriate gene or sections of the gene. The DNA segment containing the appropriate gene is then removed from the rest of the genomic material using appropriate restriction endonucleases. After excision, the 3 'and 5' ends of the DNA sequence and of all exon compound sites are reconstructed to provide convenient DNA sequences capable of encoding the N- and C-terminal ends of the IL-1 inhibitor protein, and thereby being able to fuse the DNA sequence to its operative elements.

3. Vectors 15 (a) Microorganisms, in particular E. coli

The vectors contemplated for use in the present invention comprise any vectors into which a DNA sequence may be inserted as discussed above, together with any preferred or required operational elements, which vector can then be transferred to a host cell and replicated in such a cell. Preferred vectors are those whose restriction sites are well documented and contain the operative elements that are preferred or required for transcription of the DNA sequence. However, it is also possible to envisage certain embodiments of the present invention using currently undetected vectors which could contain one or more of the cDNA sequences described herein. In particular, it is preferred that all of these vectors have some or all of the following characteristics: (30) contains a minimal number of sequences from the host organism, (2) is conserved and propagated stably in the desired host, (3) is capable of being present in a high number of copies in the desired host, (4) contains a regulatory promoter located so as to promote the transcription of the gene of interest, (5) has at least one DNA sequence marker, coding for a selectable property present on a portion of the plasmid separate from the site where the DNA sequence will be inserted, and (6) a DNA sequence capable of terminating the transcription.

In various preferred embodiments, these cloning vectors containing and capable of expressing the DNA sequences of the present invention contain various operational elements. The "operational elements" referred to herein include at least one promoter, at least one 10 Shine-Dalgarno sequence and initiator codon, and at least one terminator codon. These "operational elements" also include at least one operator, at least one leader sequence for proteins to be exported from the intracellular compartment, at least one gene for a regulatory protein, and any other DNA sequences necessary and preferred for appropriate transcription and subsequent translation of vector DNA.

Certain of these operational elements may be present in each of the preferred vectors of the present invention. It is to be understood that any additional operational element which may be required may be added to these vectors using methods known to those of ordinary skill in the art, especially in view of the teachings set forth herein.

In practice, it is possible to construct each of these vectors in a manner that allows them to be readily isolated, assembled, and exchanged with each other. This facilitates the assembly of numerous functional genes from combinations of these elements and the coding region of the DNA sequences. Furthermore, many of these elements will be useful in more than one host. In addition, it is to be understood that the vectors in particular in the preferred embodiments will contain DNA sequences capable of acting as regulators ("operators") and other DNA sequences capable of encoding 35 regulatory proteins. .

18 DK 172763 B1 (i) Regalatøtex

These regulators, in one embodiment, will serve to prevent expression of the DNA sequence in the presence of certain environmental conditions and will, in other environmental conditions 5, allow transcription and subsequent expression of the protein encoded by the DNA sequence. In particular, it is preferred that regulatory segments be inserted into the vector so that the expression of the DNA sequence will not occur, or will occur to a much reduced extent in the absence of e.g.

Isopropylthio-beta-D-galactoside. In this situation, the transformed microorganisms containing the DNA sequence can be grown to a desired density prior to initiation of the expression of IL-1I. In this embodiment, the expression of the desired protein is induced by adding to the microbial environment a substance capable of causing expression of the DNA sequence after the desired density has been obtained.

The expression vectors must contain promoters which can be used by the host organism to express its own proteins. While the lactose promoter system is commonly used, other microbial promoters have also been isolated and characterized, enabling a person skilled in the art to use them for expression of the recombined IL-1I.

(Iii) Transcription Terminator

The transcription terminators proposed here serve to stabilize the vector. In particular, the present invention proposes the use of the sequences described by Rosenberg, M. and Court, D. in Ann. Rev. The gene, vol.13: 319 ~ 30353 (1979), specifically incorporated herein by reference.

19 DK 172763 B1 (iv) Untranslated sequences

It is noted that in the preferred embodiment, it may also be desirable to reconstruct the 3 'or 5' end of the coding region to allow incorporation of 3 'or 5 5' untranslated sequences into the gene transcript. Among these untranslated sequences are the mRNA stabilizers as identified by Schmeissner, U., McKenney, K., Rosenberg, M. and Court, D. in J. Mol. Biol. Vol. 176: 39-53 (1984), which reference is specifically incorporated herein by this reference.

(v) Ribosome binding sites

The microbial expression of foreign proteins requires certain operational elements which include, but are not limited to, ribosome binding sites. A ribosome binding site 15 is a sequence that a ribosome recognizes and binds to at the beginning of protein synthesis as set forth in Gold, L. et al., Ann. Rev. Microbiol. Vol. 35, 557-580, or Marquis, D.M. et al., Gene vol. 42, 175-183 (1986), both of which are specifically incorporated herein by reference. A preferred ribosome binding site is GAGGCGCAAAAA (ATG).

(vi) Lead sequence and translational coupler.

It is further preferred that DNA encoding an appropriate secretory leader (signal) sequence is present at the S 'end of the DNA sequence as stated by Watson, M.E. in 25 Nucleic Acids Res. bd.12, 5145-5163, which reference is specifically incorporated herein by reference if the protein is to be secreted from the cytoplasm. The DNA of the leader sequence must be in a position which allows production of a fusion protein in which the leader sequence is immediately adjacent to and covalently linked to the inhibitor, i.e. there must be no transcription or translation termination signals between the two DNA coding sequences. The presence of the leader sequence is partially desired for one or more of the following reasons. First, the sequence of conductors 20 facilitates the host's processing of IL-1I. In particular, the leader sequence can control the cleavage of the initial translation product by a leader peptidase to remove the leader sequence, leaving a polypeptide redundant with the amino acid sequence having potential protein activity. Second, the presence of the leader sequence can facilitate the purification of IL-1I by directing the protein out of the cell cytoplasm. In certain species of host microorganisms, the presence of an appropriate leader sequence will allow transport of the complete protein to the periplasmic compartment, as is the case in some E. coli. In certain E. coli, Saccharomyces and strains of Bacillus and Pseudomonas, the appropriate leader sequence will allow transport of the protein through the cell membrane and into the extracellular medium. In this situation, the protein can be purified from the extracellular protein.

Third, in the case of some proteins made by the present invention, the leader sequence may be necessary to locate the complete protein in an environment where it can fold to take up its active structure, which structure possesses the appropriate protein activity.

In a preferred embodiment of the present invention, a further DNA sequence is located immediately preceding the DNA sequence encoding the IL-1 inhibitor.

The additional DNA sequence is capable of acting as a translational coupler, i.e. it is a DNA sequence encoding an RNA which serves to attach ribosomes immediately adjacent to the ribosome binding site of the inhibitor R-NA to which it abuts. In one embodiment of the present invention, the translation coupler can be derived using the DNA sequence

TAACGAGGCGCAAAAAATGAAAAAGACAGCTATCGCGATCTTGGAGGATGATTAAATG

and methods known to those of skill in the art of translational couplers.

21 DK 172763 B1 (vii) Translation Terminator

The translation terminators proposed here serve to stop the translation of mRNA. They may be either natural, as described by Kohli, J., Mol. Gen. The gene, vol.182, 5,430,439, or synthesized, as described by Pettersson, R.F., Gene vol.24, 15-27 (1983), which references are specifically incorporated herein by this reference.

(viii) Selectable marker

It is further preferred that the cloning vector contains a selectable marker, such as a resistance marker or other marker, which causes expression of a selectable property of the host microorganism. In one embodiment of the present invention, the gene for ampicillin resistance is included in the vector, while in other plasmids the gene for tetracycline resistance or the chloramphenicol resistance gene is included.

Such a resistance marker or other selectable marker is intended, in part, to facilitate the selection of the transformants. Furthermore, the presence of such a selectable marker in the cloning vector may be useful in preventing contaminating microorganisms from propagating in the culture medium. In this embodiment, a pure culture of the transformed host microorganisms could be obtained by growing the microorganisms under conditions that require the induced phenotype to survive.

The operational elements discussed here are routinely selected by one of ordinary skill in the light of previous literature and the teachings contained herein. General examples of these operational elements are cited in B. Lewin, Genes, Wiley, 30 & Sons, New York (1983), which reference is specifically included herein by this reference. Various examples of suitable operational elements can be found for the vectors discussed above and can be clarified by reviewing the publications which mention the basic properties of the aforementioned vectors.

After synthesizing and isolating all necessary and desired component parts of the vector discussed above, the vector is assembled by methods well known to those skilled in the art. Collection of such vectors is believed to be within the scope of the work of one of ordinary skill in the art and may thus be performed without undue experimentation. Similar DNA sequences are e.g. have been ligated to appropriate cloning vectors as advocated by Maniatis et al. in Molecular Cloning, Cold Spring Harbor Laboratories (1984), which reference is specifically included herein by this reference.

In addition, when constructing the cloning vectors of the present invention, it should be noted that multiple copies of the DNA sequence and its attached operational elements can be inserted into each vector. In such an embodiment, the host organism will produce larger amounts per day. vector of the desired IL-1 inhibitor. The number of multiple 20 copies of the DNA sequence that can be inserted into the vector is limited only by the ability of the resulting vector to, due to its size, be transmitted to and replicated and transcribed into a suitable host cell.

(b) Other microorganisms. Vectors suitable for use in microorganisms other than E. coli are also contemplated for use in the present invention. Such vectors are described in Table 1. In addition, certain preferred vectors are discussed below.

23 DK 172763 B1

Table 1

Transkrlp-

Tran- sional

He gu1e-acryp mRNA start site RS-bin red protonlona-atlab-fi conducting motors induce terminator Heering peptide Marker Alid Z coll Lac1.Tac2 IPTC rmB6 ompA8 bla11 amplcillin14

Lambda pL increased rmC7 lambda ompA12 tetra-

Trp5 temp int9 phoS cycln14 · 15 rature trp ^ chloraephe- IAA tlleet- nlcol16 nlng or tryptophan emptying

Bacillus' alpha C.coll rm B.amy Kanr 2 * B.amy amylase17 rm BT.T28 neutral Camr 29 neutral • sub-protease21 protease tillson18 B.amy alpha B.amy * p-4319 amylase22 alpha-spac-I2 ® IPTG B.subt. amyla- subtlllsln23 se22

Pseudo-Trp IAA-tI1-Phosphosulfone-Trp Monas (E.coll) Settlement IIpase C28 amid38 (E.coll)

Lac or exo-strep (E.coll) tryptophan toxin A29 tomycln38

Tac emptying

(E.coll) IPTC

Ger Gal I31, Glucose Cyc 1 Inver- Ura 337 1032 emptying Una tese3® Leu 238 and galactic acid phosphate

Adh I33, tose Alpha- phatase3® II34 Glucose Factor Alpha- His 3

Pho 5 emptying Sac 2 factor Tap 1

Phosphate emptying “Not regulated 1. Backman, K., Ptasnne, M., and Gilbert, W., Proc. Natl.

Acad. Sci. USA 13, 4174-4178 (1976).

2. de Boer, H.A., Comstock, L.J., and Vasser, M., Proc.

Natl. Acad. Sci. USA 80, 21-25 (1983).

3. Shimatake, H., and Rosenberg, M., Nature 292, 128-132 (1981) 4. Therefore, C., Gheysen, D., and Fiers, W., Gene 17, 15-51 (1982) .

5. Hallewell, R. A., and Entage, S., Gene 9, 27-47 (1980).

6. Grosius, J., Dull, T.J., Sleeter, D.D., and Holler, H.F., J. Mol. Biol. 148, 107-127 (1981).

7. Normanly, J., Ogden, R.C., Horvath, S.J., and Abelson, J., Nature 321, 213-219 (1986).

8. Belasco, J. G., Nilsson, G., von Gabain, A., and Conen, 15 S. N., Cell 46, 245-251 (1986).

9. Schmelssner, W., McKenney, K., Rosenberg, M., and Court, D., J. Mol. Biol. 176, 39-53 (1984).

10. Mott, J.E., Galloway, J.L. , and Platt, T., EMBO J. 4, 1887-1891 (1985).

11. Koshland, D., and Botstein, D., Cell 20, 749-760 (1980).

12. Mowa, N.R. , Nakamura, K., and Inouye, M., J. Mol. Biol.

143, 317-328 (1980).

13. Surin, B. P., Jans, D. A., Fimmel, A. L., Shaw, D. C., Cox, G. B., and Rosenberg, M., J. Bacterid. 157, 772-778 (1984).

14. Sutcliffe, J. G., Proc. Natl. Acad. Sci. USA 75, 3737-3741 (1978).

15. Peden, K. W. C., Gene 22, 277-280 (1983).

DK 172763 B1 16. Alton, N. K., and Vapnek, D., Nature 282, 864-869 (1979).

17. Yang, M., Galizzi, A., and Henner, D., Nuc. Acids Res.

11 (2), 237-248 (1983).

18. Wong, S.-L., Price, C.W., Goldfarb, D.S., and Doi, R.M., 5 Proc. Natl. Acad. Sci. USA 81, 1184-1188 (1984).

19. Wang, P.-Z., and Doi, R.M., J. Biol. Chem. 259, 8619-8625 (1984).

20. Lin, C.-K, Quinn, L.A., Rodriquez, R.L., J. Cell Biochem. Suppl. 9B, 198 (1985).

10 21. Vasantha, N., Thompson, L.D., Rhodes, C., Banner, C.,

Nagle, J., and Filpula, D., J. Bact. 159 (3), 811-819 (1984).

22. Palva, I., Sarvas, M., Lehtovaara, P., Sibazkov, M., and Kaariainen, L., Proc. Natl. Acad. Sci. USA 79, 5582-5586 (1982).

23. Wong, S.-L., Pricee, C.W., Goldfarb, D.S., and Doi, R.H., Proc. Natl. Acad. Sci USA 81, 1184-1188 (1984).

24. Sullivan, M.A., Yasbin, R.E., and Young, F.E., Gene 29, 21-46 (1984).

25. Vasantha, N., Thompson, L.D., Rhodes, C., Banner, C., 20 Nagle, J., and Filpula, D., J. Bact. 159 (3), 811-819 (1984).

26. Yansura, D. G., and Henner, D. J., PNAS 81, 439-443 (1984).

27. Gray, G. L., McKeown, K. A., Jones, A. J. S., Seeburg, P. H., and Heyneker, H. L., Biotechnology, 161-165 (1984).

28. Lory, S., and Tai, P. C., Gene 22, 95-101 (1983).

29. Liu, P.V., J. Infect. Haze. 130 (suppl.), 594-599 (1974).

26 DK 172763 B1 30. Wood, D. G., Hollinger, M. F., and Tindol, M. B., J. Bact.

145, 1448-1451 (1981).

31. St. John, T. P., and Davis, R. W., J. Mol. Biol. 152, 285-315 (1981).

32 32. Hopper, J.E., and Rowe, L.B., J. Biol. Chem. 253, 7566- 7569 (1978).

33. Denis, C. L., Ferguson, J., and Young, E. T., J. Biol.

Chem. 258, 1165-1171 (1983).

34. Lutsdorf, L., and Megnet, R., Arche. Biochem. Biophys.

10, 126, 933-944 (1968).

35. Meyhack, B., Bajwa, N., Rudolph, M., and Hinnen, A., EMBO J. 6, 675-680 (1982).

36. Watson, M.E., Nucleic Acid Research 12, 5145-5164 (1984).

37. Gerband, C., and Guerineau, M., Curr. Genet. 1, 219-228 (1980).

38. Hinnen, A., Hicks, J.B., and Fink, G.R., Proc. Natl. A-cad. Sci. USA 75, 1929-1933 (1978).

39. Jabbar, M.A., Sivasubramamian, N., and Nayak, D.P., 20 Proc. Natl. Acad. Sci. USA 82, 2019-2023 (1985).

(i) Pseudomonas vectors

As cloning vectors in hosts of the genus Pseudomonas, several vector plasmids are preferred, which autonomously replicate in a wide range of Gram-negative bacteria. Some of these are described by Tait, R. C., Close, T. J., Lundquist, R. C., Hagiya, M., Rodriguez, R. L., and Kado, C. I., in Biotechnology, May 1983, pp.269-275; Panopoulos, N.J., in Genetic Engineering in the Plant Sciences, Praeger Publishers,

New York, New York, p.163-185 (1981) and Sakagucki, K., in 27 DK 172763 B1

Current Topics in Microbiology and Immunology 96, 31-45 (1982), which references are specifically incorporated herein by these references.

In a particularly preferred embodiment, plasmid 5 RSF1010 and its derivatives are used as described by Bagdasarian, M., Bagdasarian, M.M., Coleman, S., and Timmis, R.N., in Plasmids of Medical, Environmental and Commercial Importance, Timmis, K.N. and Puhler, A. (Eds.), Elsevier / North Holland Biomedical Press (1979), which reference is specifically incorporated herein by this reference. The advantages of RSF1010 are that it is a relatively small, high-capital-plasmid plasmid that is readily transformed and stably conserved in both E. coli and Pseudomonas species. In this system, it is preferred to use the Tac expression system 15 as described for Escherichia, since the E. coli trp promoter appears to be readily recognized by Pseudomonas RNA polymerase as advocated by Sakagucki, K., in Current Topics in Microbiology and Immunology 96, 31-45 (1982) and by Gray, GL, McKeown, KA, Jones, AJS, Seeburg, PH, and Hey-20 neker, HL, in Biotechnology, Feb. 1984, 161-165, which references are specifically incorporated herein by this reference. Transcriptional activity can be further maximized by requiring replacement of the promoter with e.g. an E. coli or P. aeruginosa trp promoter. In addition, the E. coli lacl-25 gene will also be included in the plasmid to affect regulation.

Translation can be coupled to translation initiation for any Pseudomonas proteins as well as to initiation sites for any of the highly expressed 30 proteins of the type selected to produce intracellular expression of the inhibitor.

In cases where restriction-minus strains of Pseudomo-nas host species are not available, the transformation efficiency of plasmid constructs isolated from 35 E. coli is poor. Therefore, it is desirable to pass the Pseudomo-28 nasal cloning vector through a r * m + stanune of a different kind prior to transformation of the desired host, as advocated by Bagdasarian, M. et al., Plasmids of Medical, Environmental and Commercial Importance, pp. 411-422, Timmis and Puhler 5 (ed.), Elsevier / North Holland Biomedical Press (1979), which references are specifically incorporated herein by this reference.

(ii) eecJ.I

Furthermore, a preferred expression system in hosts of the genus Bacillus comprises the use of plasmid pUBHO as the cloning medium. As in other host vector systems, it is possible in Bacillus to express IL-1I of the present invention as either an intracellular or a secreted protein. The present embodiments comprise both 15 systems. Ferry vectors that replicate in both Bacillus and E. coli are available for the construction and study of various genes, as described by Dubnau, D., Gryczan, T., Contente, S., and Shivakumar, A.G., in Genetic Engineering, vol. 2, Setlow and Hollander (Eds.). Plenum Press, New York, New York, pp. 115-131 (1980), which reference is specifically incorporated herein by this reference. The alpha-amylase signal sequence is for the expression and secretion of IL-1I from fl. subtilis preferably coupled to the coding region of the protein. For intracellular inhibitor synthesis, the transportable DNA sequence is translationally coupled to the ribosome binding site of the alpha-amylase leader sequence.

Transcription of any of these constructs is preferably controlled by the alpha-amylase promoter or a derivative thereof. This derivative contains the RNA polymerase recognition sequence from the native alpha-amylase promoter, but additionally incorporates the lac operator region. Similar hybrid promoters constructed from the penicillinase gene promoter and the lac operator have been found to function in flacillus hosts in an adjustable form as stated by Yansura, DK and Henner in Genetics and Biotechnology of Bacilli, Ganesan, AT, and Hoch, JA, (ed.) Academic Press, p.

249-263 (1984), which reference is specifically incorporated herein by reference, the E. coli lac1 gene is also included in the plasmid to affect regulation.

(iii) Cl ostridium vectors

A preferred construct for expression in Clostridium is in plasmid pJU12, described by Squires, C.H., et al., In J. Bacteriol. 159, 465-471 (1984), which reference is specifically incorporated herein by reference, which plasmid is transferred to C. perfringens by the method of Heferner, D.L., et al., As described in J. Bacteriol. 159, 460-464 (1984), which reference is specifically incorporated herein by this reference. Transcription is controlled by the promoter of the tetracycline resistance gene. Translation is coupled to the Shine-Dalgarno sequences of this same tetr gene in a manner that is strictly analogous to the above plots for vectors suitable for use in other hosts.

(iv) Special Yectory: Preservation of foreign DNA introduced into yeast can be performed in various ways as described by Botstein, D., and Davis, R. W., in The Molecular Biology of the Yeast Sac Charomyces, Cold Spring Harbor Laboratory, Strathern, Jones and Broach (Eds.), Pp. 607-636 (1982), which reference is specifically incorporated herein by this reference. A preferred expression system for use with host organisms of the genus Saccharomyces has the IL-1 gene on the 2 μη plasmid. The advantages of the 2 μιη circle include relatively high copy number and stability when introduced into circular strains. These vectors preferably incorporate the replication site and at least one antibiotic resistance marker from pBR322 to allow replication and selection in E. coli. Furthermore, the plasmid preferably contains the 2 micron sequence and the yeast LEU2 gene to serve the same purposes in LEU2-defective yeast mutants.

30 DK 172763 B1

If the recombinant IL-1 inhibitors are ultimately to be expressed in yeast, it is preferred that the cloning vector is first transferred to Escherichia coli where the vector is allowed to replicate and from which the vector is obtained and purified after 5 amputation. The vector is then transferred to yeast for final expression of the IL-1 inhibitor.

(c) Mammalian cells The cDNA of the IL-1 inhibitor may serve as a gene for expression of the inhibitor in mammalian cells. It should have a sequence which will be effective for binding ribosomes as described by Kozak in Nucleic Acids Research 15, 8125-8132 (1987), which reference is specifically incorporated herein by this reference, and should have coding capacity for a leader sequence (see section 3 (a) (vi)) to control the mature protein out of the cell in a matured form. The DNA restriction fragment carrying the complete cDNA sequence can be inserted into an expression vector having a transcriptional promoter and a transcriptional enhancer, as described by Guarente, L., in Cell 52, 303-305 (1988) and Kadonaga, JT, et al. in Cell 51, 1079-1090 (1987), both of which are specifically incorporated herein by this reference. The promoter may be controllable as in plasmid pMSG (Pharmacia Cat. No. 27450601) if constitutive expression of the inhibitor is detrimental to cell growth. The vector should have a complete polyadenylation signal as described by Ausubel, F.M., et al. in Current Protocols in Molecular Biology, Wiley (1987), which reference is specifically incorporated herein by this reference so that the mRNA transcribed from this vector matures correctly. Finally, the vector 30 will have the origin of replication and at least one antibiotic resistance marker from pBR322 to allow replication and selection in E. coli.

To select a stable cell line producing the IL-1 inhibitor, the expression vector may carry the gene for a selectable marker, such as a resistance marker, or carry a complementary gene for a cell line that has a requirement such as dihydrofolate reductase. (dhfr) gene for transforming a dhfr cell line as described by Ausubel et al., see above. Alternatively, a separate plasmid carrying a selectable marker can be cotransformed with the expression vector.

4. Host cell / transformation

The vector thus obtained is transferred to a suitable host cell. These host cells may be microorganisms or mammalian cells.

(A) Microorganisms.

It is believed that any microorganism capable of recording exogenous DNA and expressing these genes and associated operational elements can be selected.

After a host organism has been selected, the vector is transferred to the host organism using methods well known to those skilled in the art. Examples of such methods can be found in Advanced Bacterial Genetics by R.W.Davis et al., Cold Spring Harbor Press, Cold Spring Harbor, New York (1980), which reference is specifically incorporated herein by this reference. It is preferred in one embodiment that the transformation takes place at low temperatures, since the temperature control is intended as a means of regulating the gene expression through the use of operational elements as discussed above. In another embodiment, in order to ensure appropriate control of the foreign genes, regulation of the salt concentrations during transformation will be required if osmolar regulators have been inserted into the vector.

It is preferred that the host microorganism be optionally anaerobic or aerobic. Particular hosts which may be preferred for use in this method include yeast and bacteria. Specific yeast species include species of the genus Saccharomyces, in particular Saccharomyces cerevisiae. Specific bacteria include species of the genera Bacillus, Escherichia 32, and Pseudomonas, in particular Bacillus subtilis and Escherichia col i. Additional host cells are listed in Table I, supra.

(b) Mammalian cells

The vector can be introduced into mammalian cells in culture by several methods such as calcium phosphate: DNA coprecipitation, electroporation or protoplast fusion. The preferred method is coprecipitation with calcium phosphate as described by Ausubel et al., See above.

There are many stable cell types capable of transforming and capable of transcribing and translating the cDNA sequence, maturating the IL-1 precursor and secreting the mature protein. However, cell types may be variable in terms of possible glycosylation of secreted proteins and post-translational modification of the amino acid residues. The ideal cell types are those that produce a recombinant IL-1 inhibitor that is identical to the natural molecule.

5. Cultivation of engineered cells The host cells are grown under conditions that are appropriate for expression of the IL-1 inhibitor. These conditions are generally specific to the host cell and are readily determined by one of ordinary skill in the light of the published literature regarding the growth conditions of such cells and the teachings herein.

Eg. information on bacterial culture conditions can be found in Bergey's Manual of Determinative Bacteriology, 8th ed. , Williams & Wilkins Company, Baltimore, Maryland, which reference is specifically incorporated herein by this reference. Similar information regarding yeast and mammalian cell culture can be obtained from Pollack, R., Mammalian Cell 30 Culture, Cold Spring Habor Laboratories (1975), which reference is specifically incorporated herein by this reference.

The necessary conditions for regulating the expression of the DNA sequence which depend on the operational elements inserted into or present in the vector will be effective at the transformation and culture stages. In one embodiment, cells are grown to high density in the presence of appropriate regulatory conditions which inhibit the expression of the DNA sequence. As optimal cell density approaches, environmental conditions are changed to those suitable for expression of the DNA sequence. Thus, it should be understood that the production of IL1 inhibitor will occur for a period of time following the growth of host cells 10 to near optimal density and that the resulting IL-1 inhibitor is harvested some time after the regulatory conditions required for its expression, was induced.

Purification 15 (a) IL-1 produced from microorganisms In a preferred embodiment of the present invention, the recombinant IL-1 inhibitor is purified after harvest and prior to its assumption of active structure. This embodiment is preferred since the inventors assume that recovery of a high yield of refolded protein is facilitated once the protein is purified. However, in a preferred alternative embodiment, the IL-1 inhibitor may be allowed to fold again to assume its active structure prior to purification. In yet another preferred alternative embodiment, the IL-1 inhibitor is present in its refolded active state upon recovery from the culture medium.

In certain circumstances, the IL-1 inhibitor will take its proper active structure upon expression in the host microorganism and transport of the protein through the cell wall or membrane or to the periplasmic compartment. This will generally happen if DNA encoding an appropriate leader sequence has been linked to the DNA encoding the recombined protein. If the IL-1 inhibitor does not ingest its correct, active structure, any disulfide bond formed and / or any non-covalent interaction that has occurred will be destroyed first by denaturation and by reducing agents. eg. guanidinium chloride 5 and beta-mercaptoethanol before allowing the IL-1 inhibitor to ingest its active structure, followed by dilution and oxidation of these agents under controlled conditions.

For purification before and after refolding, some combinations of the subsequent steps are preferably used: anion exchange chromatography (MonoQ or DEAE-Sepharose), gel filtration chromatography (superose), chromatofocusing (MonoP) and hydrophobic interaction chromatography (octyl or phenyl-Sepharose) . Of particular value or antibody affinity chromatography using IL-1I specific monoclonal antibodies (described in Example 3).

(b) IL-1I produced from mammalian cells IL-1I produced from mammalian cells can be purified from conditioned medium at steps which will include ion exchange chromatography and immunoaffinity chromatography using 20 monoclonal antibodies described in Example 3. It will be apparent to one skilled in the art that various modifications and variations may be made in the processes and products of the present invention. It is thus intended that the present invention covers modifications and variations of the invention, provided that they fall within the scope of the appended claims and their corresponding requirements.

It is to be understood that application of the teachings of the present invention to a specific problem or environment will be within the scope of one of ordinary skill in the art in light of the instructions given herein. Examples of products of the present invention and representative methods of their isolation and preparation are given below.

DK 172763 B1

The following examples illustrate various presently preferred embodiments of the present invention. The publications referenced in these examples are specifically incorporated by these references.

5 EXAMPLES

Example 1

Protein Preparation A. Materials

Hank's balanced salt solution (HBS) and RPMI were purchased 10 from Mediatech, Washington, D.C. Lymphoprep was obtained from Accurate Chemical and Scientific Corp., Westbury, N.Y. Human IgG, MTT, rabbit antiserum against prostaglandin E 21 ammonium bicarbonate, dithiothreitol, complete and incomplete Freund's adjuvants, hypoxanthine, aroinopterin and thymidine 15 were purchased from Sigma Chemical Co., St. Louis, Missouri. C3H / HeJ mice were purchased from Jackson Labs, Bar Harbor, Maine. BALB / c mice and P3 myeloma cells were obtained from dr. John Kappier and dr. Phillippa Marrack at the National Jewish Center for Immunology and Respiratory Medicine (NJC / IRM), Denver, 20 Colorado. Recombinant human IL-1 was obtained from Cistron Biotechnology, Pine Brook, N.J. Purified phytohemagglutinin was purchased from Wellcome Diagnostics, Research Triangle Park, N.C. Human foreskin fibroblasts from primary cultures were obtained from dr. Richard Clark at NJC / IRM, Denver, Colorado. Mo-25 noclonal mouse antibodies against rabbit IgG were purchased from AIA Reagents, Aurora, Colorado. Low-methionine RPMI was prepared using a "Seleet-Amine kit" from GIBCO Laboratories, Grand Island, N.Y. [3 S] -methionine, diphenyloxazole and [+ 3 C] iodoacetic acid were obtained from DuPont-NEN, Chicago, Illinois. Fetal calf serum was purchased from HyClone Laboratories, Logan, Utah. Mono-Q and Superose-12 columns were purchased from Pharmacia Inc., Piscataway, N.J. C4 reverse phase columns were obtained from Synchrom Inc., Lafayette, Indiana. C8 reverse phase columns were obtained from Applied Biosy 36 DK 172763 B1 stem Inc., Foster City, California. Acetonitrile and polyethylene glycol 8000 were purchased from J.T.Baker Chemical Co., Fhillipsburg, N.J. Trifluoroacetic acid and quanidine hydrochloride were obtained from Pierce Chemicals, Rockford, Illinois.

Endoproteinase Lys C was obtained from Boehringer Mannheim Biochemicals, Indianapolis, Indiana. The microtiter plates for use with PGE 2 ELISA were "Nunc-Immuno Plate I" obtained from the Intermountain Scientific Corporation, Bountiful,

Utah. The plates used for hybridoma production 10 were from Costar, Cambridge, Massachusetts.

B. Preparation of monocyte IL-1 inhibitor

Human leukocytes were obtained from normal donors by leucophoresis, resuspended in Hank's balanced salt solution (HBSS) with 1 part packed cells to 1 part HBSS with 15 substrates of Lymphoprep and centrifuged at 400 x g for 30 minutes at room temperature. The mononuclear fraction was sampled (typically 4-5 x 10 9 cells per donor), washed in HBSS without Ca ++ or Mg ++, suspended in serum-free RPMI and seeded on Petri dishes coated with normal 20 human IgG from which LPS was removed by chromatography over Sephadex G200 (6 x 10 7 cells in 10 ml per 100 mm dish).

All reagents contain less than 10 µg / ml LPS. The cells were cultured for 24-48 hours and the resulting conditioned medium constituted the crude IL-1 inhibitor supernatant (IL-1I supernatant). Typically, the cells of one donor utilized 700-900 ml of crude IL-1I supernatant.

C. Assays for the IL-1 Inhibitor

Two IL-1 assays have been routinely used to detect IL-1I. Thymocytes (1 x 10 6 cells from 4-6 weeks old C3H / HeJ mice) responded to 1.0 units / ml recombinant human IL-1 plus 1 microgram / ml phytohemagglutinin by proliferating half-maximally, measured at 3 H-thymidine incorporation or uptake of the tetrazolium salt MTT (Mosmann, T., J. Immunol. Methods 65, 55-61 (1983)) after 3 days of stimulation. Crude IL-1I supernatant completely inhibits this proliferative reaction by 1/10 dilution. Human skin fibroblasts (1 x 10 5 cells per well in a 96-well plate) typically responded to 0.5 units / ml of recombinant human IL-1 by secreting 5 ca. 50,000 pg / ml PGE 21 which can be measured by ELISA. This assay is as sensitive to IL-1I as the thymocyte assay.

D. Metabolic labeling of the IL-1 inhibitor IL-1 was metabolically labeled by growing the mononuclear leukocytes for 48 hours on IgG-coated plates (as described in 10 B) in serum-free RPMI containing only 0.75 micrograms / ml cold. methionine (15 micrograms / ml is normal) and to which 0.5 mCi of 3 S-methionine (1151 Ci / mmol) was added. 107 cells. Control labeling was performed in an identical manner except that the plates were coated with fetal calf serum 15 instead of IgG. Samples of such control supernatants showed that very little IL-1 was secreted when cells were grown on fetal calf serum plates.

E. Purification of the IL-1 Inhibitor Protein Raw IL-1 supernatants were adjusted to 1.0 M sodium chloride, incubated on ice for 1 hour, and centrifuged at 10,000 rpm for 15 minutes. The supernatants containing all the inhibitory activity but only 20% of the initial protein were then dialyzed at 40 ° C against 0.025 M Tris, pH 7.6 containing 0.1% sucrose 25 (the buffer) for gradient fractionation of proteins on a mono-Q anion exchange column. After dialysis, the inhibitor-containing solutions were again centrifuged at 10,000 rpm for 15 minutes and then passed through 0.22 micron nylon filters. The supernatants were typically poured into 10 ml supernatant prepared similarly after metabolic labeling and loaded onto Mono Q-Superose (Pharmacia FPLC) columns with bed volumes of either 1.0 ml or 8.0 ml was washed with A buffer until OD 280 of the drain returned to baseline and was carefully chromatographed using a linear sodium chloride gradient (0.025 M to 38 DK 172763 B1 0.10 M) in buffer A. Column fractions were collected and analyzed for radioactivity and bioactivity. Samples of each fraction were also subjected to electrophoresis on reduced 12.5% SDS-PAGE, stained with silver, soaked with 5 diphenyloxazole, dried and applied to films to obtain autoradiographic data. Figure 1a shows the protein profile after Mono Q chromatography of 40 ml of crude IL-1I supernatant mixed with 3 ml of metabolically labeled ILli supernatant. Superimposed is the amount of radioactivity found in 50 microliters of each fraction, as well as the IL-1 bioactivity measured in the PGE2 production assay. Two more radioactive and one less radioactive forms appear, which perfectly correlate with three peaks of bioactivity. Figure 1b shows the corresponding chromatography of 15 ml crude IL-1 supernatant mixed with 3 ml supernatant from monocytes metabolically labeled on plates coated with fetal calf serum (FCS) instead of JgG. The levels of the three radioactive forms mentioned above have been significantly reduced. Figure 2a shows silver-colored gels run on the fractions from the regions of interest in the chromatographic graphs shown in Figures 1a and 1b. Note that the fractions of top radioactivity and bioactivity in Figure 1a (fractions 52 and 59) both show a larger band at 22 kD (marked by arrows) on SDS-PAGE. The third form (fraction 48 in Figure 1a) shows a band at 20 kD on SDS-PAGE. Gel filtration experiments on crude IL-1 have shown that the active molecule has a molecular weight of 18-25 kD. Figure 2b is an autoradiogram of the gels shown in Figure 2a. It can easily be seen that the protein bands at 20 and 22 kD are the major radioactive forms in these fractions.

Summary of these results shows that the metabolic labeling of monocytes seeded on Petri dishes coated with IgG results in radioactive forms which are poorly formed only if the cells are seeded on dishes coated with FCS. These induced radioactive forms co-chromatograph perfectly on Mono Q with several forms of IL-1I bioactivity, and gels and resulting autoradiograms show that the three most important induced molecules are proteins of the molecular weight predicted for IL-1I. .

The IL-1I molecules were further purified for sequencing in two ways. First, the mono-Q fractions with 5 peak bioactivity and radioactivity were loaded onto a C4 reverse phase column and eluted with a H 2 O / 0.1% TFA x acetone tril / 0.1% TFA gradient. Since the IL-1I molecule was radiolabeled, the samples from each fraction were directly counted for radioactivity and were also analyzed by SDS-PAGE followed by autoradiography. Figure 3a shows such a chromatogram with superimposed radioactive pattern. The silvery gels are run on samples from each fraction (Figure 3b) and subsequent autoradiograms of the gels (Figure 3c) show that the IL-1I molecule is present in fractions 32-36. These fractions were dried and sequenced. Alternatively, Mono-Q top fractions were dried with Speed Vac, resuspended in 0.4 ml of 0.05 M NH 4 HCO 3 and directly chromatographed twice on a 10 x 300 mm Sepharose 12 gel filtration column (Pharmacia FPLC) equilibrated in the same buffer. 20 as shown in FIG. 4a and 4b. Fractions were collected and samples of each fraction were examined for radioactivity and bioactivity and analyzed by silver staining and autoradiographing after SDS-PAGE. Appropriate fractions were then dried on a Speed Vac and sequenced.

Example 2

Suggested Sequencing of the IL-1I Inhibitor

Prior to sequencing, the samples were dissolved in 6 M guanidine HCl, pH 8.6, reduced for 4 hours at 37 ° C under N 2 with 100-fold molar excess of dithiothreitol in protein and alkylated for 1 hour with 400 g of excess of C-iodoacetic acid is obtained. In this case, the reaction mixtures were desalted on a C8 reverse phase column, eluted and partially dried. N-terminal sequences are determined using an Applied Biosystems Protein 35 Sequencer. To obtain internal sequences, samples which may have been reduced and alkylated may be digested with cyano bromide or proteolytic enzymes using methods known to those skilled in the art. Reaction products are dried, dissolved in 0.1% TFA / H 2 O, and peptides are separated using a CB reverse phase column.

Example 3

Purification and sequencing of the species of IL-1 inhibitors.

A. IL-li-X. IL-li-a and IL-li-b forms 10 The mono Q purification of IL-1i dissolves the biological activity into 3 major forms as shown in Figure 1a and described in Example 1, where the peak fractions for this activity are 48, 52 and 59. SDS-PAGE on samples of these fractions, as shown in Figure 2a, shows relevant forms at 20 kD, 15 22 kD and 22 kD, respectively. Western analysis of such gels using mouse antisera, as discussed in Example 4 below, colors all three forms. When IL-1i is from cells that

• 3 C

is metabolically labeled with S-methionine during growth on plates coated with IgG, each of these bands is radioactive (as shown in Figure 2b, the autoradiogram of the above-mentioned gel). Based on the arguments mentioned in Example 1, namely that cells in parallel experiments where the cells are incubated in a non-inducing manner do not produce IL-1I bioactivity and do not produce these radioactive bands, we can conclude that these 3 forms explain the biological activity. We have provisionally named these samples IL-li-X, IL-li-a and IL-li-b, respectively.

B. Purification and Sequencing of IL-li-X

Mono-Q fractions containing IL-lI-X and / or IL-lI-a, were further purified by reverse phase HPLC chromatography on a Synchropak RP-4 (C4) column, and radioactive forms were sequenced. Numerous attempts at direct sequencing of RP-HPLC purified IL-li-a and IL-li-b have failed, suggesting that they are chemically blocked at their N-terminal end. However, a preparation of IL-li-a (IL-li-aB2p42) gave the following sequence: 5 15 10 15 20

BPSGRKSSKMQAF_I £ DVNQ

and subsequent preparations of IL-1-X, which are similarly purified by C4-RP-HPLC, have given the same 10 sequence: 15 10 15 20

PrepKxF24 _________MQAF_ IE_VN_K_F

PrepKxF2 3 £ P__RK_LKMQAF_I

These are evidently part of the sequence found in the first attempt to sequence IL-li-a. It is the inventors' conclusion that the sequence data shown is the N-terminus of the 20 kD molecule, which was called IL-1 1 -X.

In this and all subsequent sequences, an underlined position indicates either an inability to identify a 20 amino acid residue or that uncertainty exists as to the identification of the amino acid residue. When two or more amino acid residues are placed in the same position, it shows that more than one amino acid was detected at this sequencing step and the residue most likely to be the correct one is at the top.

C. Generation, purification and sequencing of. eeBr. times of IL-li-a and IL-li-b.

Since IL-li-a and IL-li-b appear to be chemically blocked at their N-terminal end, peptides of each type 30 were produced by endoproteinase digestion. In particular, Mono Q fractions containing either IL-li-a or ILli-b were passed through a 4.6 x 250 mm C3-RP-HPLC column (Zorbax Protein 421, which is an acceptable alternative to the C4 columns used in all the aforementioned examples. Very even gradients (0.2% acetonitrile per minute at 0.5 ml / min) dissolved IL-li-a (Figure 8a, b) or iL-li-b 5 (Figure ga) from the main radioactive pollutant, human lysozyme. The identity of the purified forms was confirmed by the presence of a single radioactive 22 kD protein by SDS-PAGE and subsequent autoradiograms (Figures Bc, d and gb). The proteins were collected by hand 10 in silicone treated glass tubes and to each 25 ml of a 0.2% Tween-20 solution was added. The IL-1-containing fractions were then volume reduced on a Speed-Vac to 50 ml of cholites, brought up to 300 microliters by the addition of 1% NH 4 HCO 3, followed by the addition of 1 mg of endoprotein 15. In the case of IL-li-a, the enzyme used was End-proteinase Lys C (Boehringer-Mannheim), whereas IL-li-b was cleaved with Endoproteinase Asp N (Boehringer-Mannheim). Cleavage was carried out at 37 ° C for 16 hours and the volume of the reaction mixture was then reduced to 50 20 ml on a Speed Vac.

In the case of Il-li-a, the sample was chromatographed directly, while the IL-li-b sample was first reduced by adding 5 ml of 50 mM dithiothreitol in 2 M Tris, pH 8.0 reacted for 30 minutes at 37 ° C and then carboxymethylated 25 by adding 1.1 micromoles of 3 H-iodoacetic acid in 10 ml of ethanol (reacted for 30 minutes at 37 ° C in the dark).

The separation of the peptides was performed on a 2.1 x 250 mm Brownlee Aquapore RP-300 (C8) small tube column at a flow rate of 100 microliters / min using a Beckman HPLC equipped with "micro tube width hardware" and "micro tube width" -compatible pumps. A 200 min. 0-100% linear gradient was used (H20 / 0.1% TFA for acetonitrile / 0.1% TFA). The peptide separations are shown in Figures 10 and 11. The sequence information obtained is as follows:

RaLysC-41 43 DK 172763 B1 15 10 MQAF_I_DVNQ £

RaLysC-53 5 1 5 10 15 20 25

K P

_FYL_NNQLVA_YLQGPNVNLEEQIDN_H R (xLysC-61 1 5

10 I Y

_FAT1RBH

RaLysC-31 1 5

F Y F Q E D

15 RaLysC-37 15 10 15 20

V N

G E S X T S

_QDET_LQLE AHR2 £ QL £ Efi 20 RaLysC-35 15 10 15 20

___ETfiLQLEAV_ITDLLEN

RPAspN-51 15 10 15 20 25

25 Q K T F L G

dvneieey & rnnqlvasylqgpnvnl RPAspN-43 1 5 10

DEGVMVTKFYFQ

30 RPAspN-39 15 10 15

K

_PSGRKS £ EMQAFR1!) 44 DK 172763 B1 ΗβΑ8ρΝ-25 1 5

DKRFAFIR

ΗβΑ8ρΝ-30 5 15 10

S L Q

D_ £ VHHLKK1S.

Two of the peptide sequences are obviously related to the one obtained previously from IL-1-X. One of these, RaLysC-41, is an IL-li-a sequence and the other, RPAspN-51, is an IL-li-b sequence, which is an argument that at least the three forms of IL-li are closely related proteins, if not chemically and / or physically modified forms of a single original IL-1 molecule. Combining the listed sequences results in the following composite sequences: I ....... AeLytC.il ....... i i ................. ..... ...................... AeLvtCJJ

i .................. I I ..................... UMtf.U .... .................

in ILUUpfci .............. ...............]

| i JCIU 5KHQ »r» IS0 «lt (} ltTrUIIIIIQlVAiYLQCH (VHUlSl0..S

I -MLysC-11-1

In ....... UAtpN.4) ....... I

oicvKvurnqiD

In .............. IULytC-35.17 ............. |

K

S

c ICC

BQDCTILQLEaV & QTDLLIII

In ---- Uly 'C * 1 -.-. | I --- MAY ** · 25 --- 1 o k t r a π i ui 45 DK 172763 B1

These composite sequences do not appear to be present in other known polypeptides listed in the recently updated Protein Identification Resource Database (PIR 16.0). The inventors believe that these sequences, or minor variants thereof, represent a class of molecules capable of acting as IL-1 inhibitors.

Example 4

Preparation of antibodies specific for the IL-1 inhibitor 10 week old BALB / c mice were injected subcutaneously with ILli which was partially purified (400-fold) from crude supernatants by Mono Q chromatography, dialyzed against PBS and emulsified with complete Freund's adjuvant. Each mouse received IL-1 purified from 5 ml of crude supernatant. The mice were given a 15 booster injection every 2 weeks with an equivalent amount of IL-1i emulsified with incomplete Freund's adjuvant, and serum samples were collected from the tails 7 days after each booster injection. Antisera were assayed for anti-IL activity in Western analysis of transblot of iromunogens run on SDS-PAGE, as shown in FIG. 5a. Figure 5b shows that all mice generated anti-IL antibodies after 3 injections of IL-1I.

Since monoclonal antibodies will be of great value in cloning the IL-1 gene from an expression library, by purifying recombinant IL-1 protein, and by examining the biology of the molecule, we began the preparation of a collection of monoclonal antibodies specific for IL-li. For the preparation of B cell hybridomas, the above mice were injected intravenously with the same amount of IL-1I 30 in saline solution 24 hours prior to spleen removal. Splenocytes were scratched out of the spleens into cold balanced salt solution (BSS), washed twice with BSS, n mixed with P3 myeloma cells at a ratio of 2 x 10

Q

cells per cell 10 spleen B cells and were centrifuged down.

The cells were fused by dropwise addition of 1 ml of 46 g 17563 B1 hot, gaseous (5% CO 2) PEG 6000 (40% polyethylene glycol 6000: 60% minimum essential medium) to the dry pellet. Fused cells were washed with BSS and resuspended in 10 ml of rich medium (10% FBS) containing 2 x 10 5 peritoneal cells per cell. and the pellet was gently broken up using a 10 ml pipette. The volume was adjusted to 20 ml by the addition of several peritoneal cells in the medium and the cells were seeded in 96-well plates at 0.1 ml / well. The plates were placed in a gas incubator and then treated as follows:

Day 1 - Add 3 x HAT (hypoxanthine, aminopterin, thymidine) in rich medium to a final concentration of 1 x

Day 5 - The medium is changed and replaced with 200 microliters of 1 x HAT rich media.

Day 10 - Hybrid Growth Control begins. The medium is changed and replaced with 200 microliters of 1 x HAT in rich medium containing 1.5 x 10 6 peritoneal cells per cell. ml.

When hybrid cells are nearly confluent in a well, the supernatants are transferred for testing and the cells are gently scraped off with a pipette tip and transferred to 1 ml culture vessels containing 1 x HAT in rich medium plus 3 x 10 4 peritoneal cells per well. ml.

The supernatants from well-confluent cell wells were assayed for anti-IL-1I activity using ELISA, in which partially purified IL-II (Mono-Q purified material, identical to that injected into the mice) is bound to microtiter wells. Normal mouse sera and hyperimmune antisera were used as the negative and positive controls, respectively. Positive supernatants will be re-examined by ELISA on plates coated with homogeneously purified IL-1I and by immunoprecipitation of purified, metabolically labeled IL-1I. Positive cells will then be cloned at limited dilution and injected into pristine-treated mice to form ascites. Large amounts of IL-li-specific antibodies can be produced by tissue culture or by massive formation and collection of ascites fluid in mice. Purification of these antibodies and attachment of these to insoluble spheres will produce affinity adsorbents for use in purifying the recombined IL-1 protein.

Example 5

Cloning of IL-11 cDNA

It was shown that monocytes seeded on IgG-coated Petri dishes and cultured for 24 hours in the presence of 10 [3 S] -methionine produced [3 S] -IL-II, which could be identified by its chromatographic properties of Mono Q.

To determine when (over the 24-hour period) IL-1I was produced at maximum speed,

7C

plated monocytes were exposed to [S] -methionine 15 (pulse-labeled) for a short, 2-hour period, at which time a large excess of unlabeled methionine was added and incubated for a further 2 hours. The medium was then collected and analyzed for radiolabeled IL-1I. This procedure was applied to monocytes at different time points after plating IgG-coated plates, and it was found that exposure of monocytes to (3SJ-methionine 15 hours after plating produced the maximum amount of [3 -li, indicating that IL-1I mRNA in monocytes had its maximum level 15 hours after plating on IgG.

Fresh monocytes were then seeded on LPS-free IgG as in Example 1B. After incubation in RPMI medium for 15 hours at 37 ° C, cells were washed with phosphate-buffered saline, then lysed with 4M guanidinium thiocyanate; 25 mM sodium citrate, pH 7, 0.5% sarcosyl, 0.1M 2-mercaptoethanol.

Total RNA was then isolated from this lysate by the AGPC method of P. Chromczynski and N. Sacchi, as described in Analytical Biochemistry 162, 156-159 (1987).

48 DK 172763 B1

Poly A + RNA was isolated by oligo-dT cellulose chromatography by the method of Aviv, H., and Leder, P.,

Proc. Natl. Acad. Sci USA 69, 1408-1412 (1972), precipitated with ethanol and dissolved to a concentration of 0.36 pg / μΐ. 15 µg of poly-A + RNA was used to prepare cDNA according to Gubier, U., and Hoffman, B.J., Gene 25, 263-269 (1983).

The cDNA was incorporated into a lambda gtll expression library using FcoRI linkers from Boehringer Mannheim Catalog No. 988448 or New England Bio Lab no.

10 1070 and according to instructions given by these manufacturers.

The resulting library containing 106 independent clones was screened on E. coli Y1090 rk (Promega Biotec) with a suitable polyclonal antibody to IL-1, as described previously using screening conditions, as described by RAYoung and RWDavis , PNAS described previously using screening conditions as described by RAYoung and RWDavis, PNAS 80, 1194-1198 (1983). Positive signals can be detected using biotinylated secondary antibody (such as goat IgG against 20 mice, Bethesda Research Labs) followed by a streptavidin-alkaline phosphatase conjugate (Bethesda Research Labs) as described by Bayer, E.A. and Wilchek, M. in Methods in Biochemical Analyzes (1979) and Guesdon, J. L., Ternynch, T. and Avrameas, S., J. Histochem. Cytochem. 27, 1131-1138 (1979) 25 and according to the manufacturers instructions.

Example 6

Preparation and sequencing of the gene encoding IL-1 cDNA prepared as described in Example 5 was incorporated into the cloning vector lambda GT10. This cDNA was first methylated using Eco RI methylase with S-adenosylmethionine as the substrate, Eco RI linkers were attached in a ligation reaction and excess linkers were removed by digestion with Eco RI endonuclease and chromatography on a CL6B strain. spin column. A ligation reaction containing 0.124 micrograms of linker treated, size-selected cDNA and 1 microgram of EcoRI cut and phosphatase treated lambda GT10 was performed, and the products of this ligation reaction were packed using GIGAPACK GOLD packing extracts (Stratagene). This yielded a library of 1 x 107 units.

To screen this GT10 library, oligonucleotide (antisense) probes were synthesized based on the protein and peptide sequence shown in Example 3. The sequences of the probes and their corresponding peptide sequences are as follows.

Probe ILlil-3 TTq TAC GTq CGN AAq 5 '

List With Gin Ala Phe 15 Probe ILlil-4 ττ £ AA§ ATq AA§ Gt £ Ct £ CT 5 '

Lys Phe Tyr Phe Gin Glu Asp

Probe ILlil-5 TAC CAN TGN TTq AAq ATq AA 5 '

With Val Thr List Phe Tyr Phe

Probe ILlil-6 CTq CAN TTq GTq TTq TG 5 '20 Asp Val Asn Gin Lys Thr

Probe ILlil-7 TTq GTq TTq TGN AAq AT 5 '

Asn Gin Lys Thr Phe Tyr

Note: N = A, G, C and T.

Probe No. ILlil-3 was β-phosphorylated at its 5 'end and used to screen for 3 x 10 5 plaques from the library.

The probe reproducibly hybridized to 3 plaques, and among these a plaque was also found to hybridize to probe No. ILlil-4. This plaque, GT10-ILH-2A was cultured and the DNA was isolated using Lambdasorb 30 (Promega) according to the manufacturer's instructions. GT10-IL11-2A has been deposited with American Type Culture Collection 50 DK 172763 B1 {ATCC) in Rockville, Maryland under accession number 40488.

The DNA was digested with EcoRI, divided into 5 equal aliquots and subjected to electrophoresis on a 1% agarose gel.

After electrophoresis, this gel was stained with ethidium bromide. A photograph of this gel is shown in Figure 12a.

Lanes 6, 8, 10, 12 and 14 contain 5 subsets of the Eco-R1 digestion. Lane 5 contains a mixture of wild type lambda DNA cut with HindIII and 0X17 4 RF DNA cut with Haelll (New England Biolabs) useful as molecular weight markers. Figure 12a shows that GT10-ILli-2A contains an FcoRI fragment which is 1850 base pairs long.

To demonstrate more clearly that this 1850 bp fragment carries the coding sequence for the IL-1 inhibitor, a Southern blot was performed as follows. DNA fragments in the gel, shown in Figure 12a, were transferred to nitrocellulose using standard methods. The nitrocellulose was then cut lengthwise into 5 strips so that each strip contained DNA from lanes 6, 8, 10, 12 and 14.

The strips were hybridized individually to each of the 5 oligonucleotide probes (see above) labeled at the 5- • 3 Π end with β-phosphate. The oligonucleotide concentration was 1 pmol / ml and the hybridization temperature was as follows.

Path Probe Temperature

6 ILlil-3 35 ° C

8 ILlil-4 42 ° C

10 ILlil-5 42 ° C

12 ILlil-6 40 ° C

14 ILlil-7 35 ° C

After washing, the strips were bonded together and adhered to each other to restore the original nitrocellulose sheet.

This was autoradiographed in the presence of an intensity-increasing screen at -70 ° C for 24 hours. Figure 12b is a photograph of this autoradiogram. It provides evidence that all of the probes hybridize specifically to the 1850 B1 bp fragment, proving that this fragment carries substantially coding sequences of the IL-1 inhibitor.

To determine its DNA sequence, GT10-ILli-2A DNA was digested with EcoRI, subjected to electrophoresis on a 1% agarose seal, and the 1850 bp fragment isolated. This fragment was ligated with Eco RI digested M13 mpl9 and transformed into E. coli strain JM109. Transformants were screened by searching for those lacking beta-galactosidase activity. Five such transformants were isolated, single stranded DNA was prepared and sequencing was performed according to the method of Sanger et al. The DNA sequence of 3 of the transformants corresponded to the 3 'end of the mRNA, while two transformants provided protein coding sequence. Figure 13 shows the DNA sequence obtained for the protein coding region of the cDNA.

Figure 13 also shows the predicted amino acid sequence. The amino acid sequence from the first amino acid alanine to the 29th amino acid proline and from the 79th amino acid isoleucine to the end is the hypothetical amino acid sequence. The predicted amino acid sequence from the 30th amino acid proline to the 78th amino acid proline corresponds to the peptide sequence described in Example 3.

Example 7

Sequencing of GT10-ILli-2A and IL-li 25 A portion of GT10-ILli-2A has been sequenced and shown in Figure 14. The DNA encodes a protein containing amino acid sequences characteristic of IL-li (nucleotides 99-557). However, it is assumed that several modifications of this protein occur before it is secreted to the extracellular environment. These modifications may or may not be essential for the protein to have activity as an IL-1I.

52 DK 172763 B1 GT10-ILli-2A encodes at least 32 amino acids N-terminal (nucleotides 3-98) of the amino-terminal end of the form of IL-1 known as X. It is believed that among these 32 amino acids, a secretory leader sequence starting at M encoded by nucleotides 24-26 directs the native IL-11 to the extracellular environment and is then removed by the leader peptidase and possibly other peptidases.

It is currently unknown to what extent this sequence is removed in alpha and beta form of IL-1, but the N-terminal end of these forms is believed to be close to the N-terminal end of form X. Removal of the secretory leader sequence is likely necessary for the protein to have an effective IL-1I activity.

Nucleotides 349-351 of GT10-ILli-2A encode an N residue which is part of a consensus N-glycosylation site. On the basis of their sensitivity to digestion with N-glycanase, it is believed that the alpha and beta forms of IL-1 are glycosylated. Since form X is not thought to be sensitive to digestion with this enzyme, it is believed not to be glycosylated, although this remains an option that could be readily demonstrated by one of skill in the art of sequencing proteins using the information given here. It is believed that glycosylation at this N residue is not required for the protein to show effective IL-1I activity.

Nucleotides 99-101 of GT10-ILli-2A encode a P (see Figure 15), but no P has been detected at this position (the N-terminal end) of the form X of IL-1 1. It is possible that this residue has been modified in the mature protein.

It is believed that the modification of this residue is not essential for effective IL-1 activity.

The currently unknown N-terminal amino acid residues of the alpha and beta forms are not fully detectable by Edman degradation and are likely to be modified upon removal of some of the N-terminal residues of the protein encoding GT10. -lLli-2A. It is believed that this modification is not essential for effective IL-1 activity.

Example 8

Expression of aenes encoding IL-1I in animal cells 5 Animal cell expression of IL-1I requires the following steps: a. Construction of an expression vector.

b. Selecting a host cell line.

c. Introducing the expression vector into the host cells.

d. Manipulation of Recombinant Host Cells to Increase the Expression Level of IL-1I.

1. IL-1I expression vectors intended for use in animal cells may be of several types, including strong constitutive expression constructs, or inducible gene constructs, as well as those designed for expression in particular cell types. In all cases, promoters and other gene regulatory regions such as enhancers (inducible or non-inducible) and polyadenylation signals are located in appropriate regions relative to the cDNA sequences of the plasmid-based vectors. Here are two examples of such constructs: (1) A construct using a strong constitutive promoter region can be prepared by using monkey virus gene control signals (SV40) in an arrangement similar to that found in plasmid pSV2CAT as described. by Gorman et al. for 25 mol. Cel. Biol. 2, 1044-1051 (1982), which reference is specifically incorporated herein by reference. This plasmid can be manipulated in a manner whereby coding sequences for chloramphenicol acetyltransferase (CAT) are replaced with IL-1 cDNA by molecular biological methods which are standard (Maniatis et al, see above), as shown in FIG. FIG. 6. (2)

An inducible gene construct can be prepared using the plasmid PMK containing the promoter region of mouse metallothionein (MT-1) (Brinster et al., Cell 27, 228-231 (1981)). This plasmid can be used as starting material and must be manipulated as shown in FIG. 7 to produce a metal-inducible gene structure.

2. A number of animal cell lines can be used for expression of IL-1 using the vectors described above to produce active protein. Two potential cell lines that have been well characterized for their ability to promote foreign gene expression are Ltk mouse cells and dhfr "Chinese hamster ovary (CHO cells) cells, although expression of IL-1I is not restricted to these cell lines. .

3. Vector DNA can be introduced into these cell lines using any of a number of gene transfer methods. The method used herein includes the calcium phosphate DNA precipitation method described by SLGraham and ASvan der Eb (Virology 52, 456-467 (1973)) in which the expression vector of IL-1 is coprecipitated with another expression vector. that encodes a selectable marker. In the case of Ltk "cell transfection, the selectable marker is a thymidine kinase gene and the selection is made as described by Wigler et al. (Cell 16, 777-785 (1979)), and in the case of dhfr" CHO cells, it is selective. -25 editable marker dihydrofolate reductase (DHFR), the selection of which is described by Ringold et al. In J. Mol. Appl. Genet.

1, 155-175 (1981).

4. Cells expressing the IL-1I gene constructs should be cultured under conditions that will increase the level of IL-1I production. Cells carrying the metallothionein promoter constructs can now be grown in the presence of heavy metals such as cadmium which will lead to a 5-fold increased utilization of the MT-1 promoter (Mayo et al., Cell 29, 99-108), which subsequently leads to a corresponding increase in the protein level of IL-1I. Cells that contain IL-1I expression vectors (either SV40- or MT-1-based) together with a DHFR expression vector can be taken through the gene amplification protocol as described by Rinold et al., J. Mol. Appl. Genet. 1, 165-175 (1981), using methotrexate, a competitive antagonist of DHFR. This leads to more copies of DHFR genes in the cells and at the same time increased number of copies of IL-li genes, which in turn can lead to more IL-li protein being produced by the cells.

Example 9

Purification of IL-1i from Recombinant Tumor Cells

Since IL-1I is expected to be secreted from cells like the natural substance, it is believed that the above-described procedures for purification of the natural protein 15 will allow for similar purification and characterization of the recombinant protein.

Example 10

Sequencing · of IL-li.

The amino-terminal amino acid residue of IL-1I has been identified several times by direct protein sequence determination as an arginine residue (R). The result of such sequencing is shown in Example 3. In contrast, the amino-terminal residue of IL-1I, as predicted from the cDNA sequence, is a proline residue (P). This amino terminal 25 residue corresponds to nucleotides 85-87 in Figure 13 and is surrounded by circles in Figures 14 and 15. This apparent discrepancy between the cDNA sequence and the direct protein sequence can be explained by assuming that a cDNA error has been introduced sequence during the reverse transcriptase-catalyzed synthesis from its mRNA. That is, a CGA (arginine) codon located on the mRNA where it would encode this amino-terminal residue may have been altered during the reverse transcriptase reaction to a 56D172763 B1 CCA (proline) codon in the cDNA. . This type of reverse transcriptase problem has been previously reported in the literature, e.g. B. D. Clark et al. in Nucleic Acids Research 14, 7897 (1986).

5 The inventors assume that the correct amino acid sequence of the protein is as predicted by cDNA except that the amino-terminal amino acid is arginine instead of the protein residue as shown in FIG. 13-15. The inventors are of the opinion that both the DNA sequences and their corresponding peptide sequences fall within the scope of their invention, although the amino-terminal arginine sequence is preferred.

Example 11

A protein with the sequence: 15 10 20

MEIXRGLRSHLITLLLFLFH

30 40

SETIXZPSGRKSSKMQAFRI

50 60

20 WDVNQKTFYLRNNQLVAGYL

70 80

QGPNVNLEEKIDVVPIEPHA

90 100

LFLGIHGGKMXLSXVKSGDE

25 110 120

TRLQLEAVNITDLSENRKQD

130 140

KRFAFI RSDSGPTTSFESAA

57 DK 172763 B1

150 160 XPGWFLXTAMEADQPVSLTN

170

MPDEGVMVTKFYFQEDE

5 where X is cysteine, serine or alanine and Z is arginine or proline are also part of the invention.

Claims (41)

58 DK 172763 B1 An isolated interleukin-1 inhibitor (IL-1I) capable of inhibiting interleukin-1 (IL-1) or a precursor polypeptide which can be converted to such an inhibitor, characterized in that it or comprises an amino acid sequence which is selected from: (a) an amino acid sequence which is encoded by the nucleotide 10 sequence: 10 20 30 40 50 60 GAATTCCGGGCTGCAGTCACAGAATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCA MEICRGLRSHLI 15 4 70 80 90 100 110 120 CTCTCCTCCTCTTCCTGTTCCATTCAGAGACGATCTGCCSACCCTCTGGGAGAAAATCCA TLLLFLFHSETICXPSGRKS 20130140 150 160 170 180 GCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACA SKMQAFRIWDVNQKTFYLRN 190 200 210 220 230 240 2. ACCAACTAGTTGCTGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATG NQLVAGYLQGPNVNLEEKID 250 260 270 280 290 300 30 TGGTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGT VVPIEPHALFLGIHGGKMCL 310 320 330 340 350 360 35 59 CCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACC SCVKSGDETRLQLEAVNITD DK B1 172 763 370 380 390 400 410 420 TGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCA LSENRKQDKRFAFIRSDSGP 5 430 440 450 460 470 480 CCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTG TTSFESAACPGWFLCTAMEA 490 500 510 520 530 540 10 ACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACT DQPVSLTNMPDEGVMVTKFY 550 4-560 570 580 590 600 TCCAGGAGGACGAGTAGTACTGCCCAGGCCTGCTGTTCCATTCTTGGG DG (B) an amino acid sequence encoded by the code region 20 of the sequence in (A) or a portion of the sequence in (A) encoding an IL-1 capable of inhibiting IL-1 or a precursor polypeptide there? (C) all or an IL-I inhibiting fragment of the foals-25-taking amlnosyresekvens: (D) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN NQLVAGYLQGPNVNLEEKI DVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV 30 NITDLSENRKQDKRFAFIRSDSGPTTSF ESAACPGWFLCTAMEADQPVSLTNMPDE GVMVTKFYFQEDE wherein (D) means nothing, M, or comprises an N-terminal 35 secretion , which is capable of directing the cell IL-1 formed from the cell in processed form in DK 172763 B160, and (X) means R or P; or (D) an amino acid sequence that is at least 70% homologous to the amino acid sequence in (C). Interleukin-1 inhibitor or precursor polypeptide according to claim 1, characterized in that it comprises an amino acid sequence selected from: (i) all or an IL-1 inhibitory fragment of the following amino acid sequence: (U) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN 15 NQLVAGYLQGPNVNLEEKIDVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV NITDLSENRKQDKRFAFIRSDSGPTTSF ESAACPGWFLCTAMEADQPVSLTNMPDE GVMVTKFYFQEDE 20 wherein (D) means nothing, M, or comprises an N-terminal secretion leader sequence, which is able to direct it in a cell formed IL-li out of the cell in a processed form, and (X) represents R or P; or (ii) an amino acid sequence which is at least 70% homologous to the amino acid sequence of (i). Interleukin-1 inhibitor or precursor polypeptide 30 according to claim 2, characterized in that it comprises an amino acid sequence of at least 80%, preferably at least 90%, and more preferably at least 95%, homologous to the amino acid sequence or fragment thereof in claim 2 (i). 61 DK 172763 B1 4. The interleukin-1 inhibitor, or forstadiepolypeptid according to claim 1 or 2, characterized in that it comprises the following amino acid sequence: 5 (D) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN NQLVAGYLQGPNVNLEEKIDVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV NITDLSENRKQDKRFAFIRSDSGPTTSF ESAACPGWFLCTAMEADQPVSLTNMPDE 10 GVMVTKFYFQEDE wherein (D) means nothing or M and (X ) means R or P. Interleukin-1 inhibitor precursor polypeptide according to claim 1 or 2, characterized in that it comprises an N-terminal secretion leader having all or part of the following amino acid sequence: 20 MEICRGLRSHLITLLLFLFHSETIC. Interleukin-1 inhibitor or precursor polypeptide according to any one of the preceding claims, characterized in that it or it is produced by a recombinant host cell. Interleukin-1 inhibitor or precursor polypeptide according to claim 6, characterized in that the host cell is a bacterial cell. 30 Interleukin-1 inhibitor or precursor polypeptide according to claim 7, characterized in that the host cell is Escherichia col i. 62 DK 172763 B1 Interleukin-1 inhibitor or precursor polypeptide according to claim 6, characterized in that the host cell is a mammalian cell. Interleukin-1 inhibitor or precursor polypeptide according to claim 9, characterized in that the host cell is a CHO cell. Interleukin-1 inhibitor or precursor polypeptide 10 according to any one of the preceding claims, characterized in that it is more than 90%, preferably more than 95% pure. An isolated DNA molecule encoding an interleukin-1 inhibitor (IL-1I) capable of inhibiting interleukin-1 (IL-1) or a precursor polypeptide which can be converted to a such an inhibitor, characterized in that it comprises a nucleic acid sequence selected from: 20 (a) 10 20 30 40 50 60 GAATTCCGGGCTGCAGTCACAGAATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCA ME I CRGLRSHLI 4- 25 70 80 90 100 110 120 CTCTCCTCCTCTTCCTGTTCCATTCAGAGACGATCTGCCSACCCTCTGGGAGAAAATCCA TLLLFLFHSETICXPSGRKS 130 140 150 160 170 180 3. GCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACA SKMQAFRIWDVNQKTFYLRN 190 200 210 220 230 240 35 ACCAACTAGTTGCTGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATG NQLVAGYLQGPNVNLEEKID 63 DK B1 172 763 250 260 270 280 290 300 TGGTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGT VVPIEPHALFLGIHGGKMCL 5 310 320 330 340 350 360 CCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACC SCVKSGDETRLQLEAVNITD 370 380 390 400 410 420 10 TGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCA LSENRKQDKRFAFIRSDSGP 430 440 450 460 470 480 15 CCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTG TTSFESAACPGWFLCTAMEA 490 500 510 520 530 540 ACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACT DQPVSLTNMPDEGVMVTKFY 20 550 4-560 570 580 590 600 TCCAGGAGGACGAGTAGTACTGCCCAGGCCTGCTGTTCCATTCTTGCATGGCAAGGACTG F Q E D * E wherein S is C or G, and X is R or P; (B) the code region of the sequence (A) or a portion of the sequence in (A) encoding an IL-1 capable of inhibiting IL-1 or a precursor polypeptide thereto; (C) a sequence degenerated in the coding region of the sequence of (A), or a portion thereof encoding an IL-11 capable of inhibiting IL-1 or a precursor polypeptide thereto; 64 DK 172763 B1 (D) a sequence encoding a polypeptide comprising the whole or an IL-I inhibiting fragment of the following amino nosyresekvens: 5 (D) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN NQLVAGYLQGPNVNLEEKIDVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV NITDLSENRKQDKRFAFIRSDSGPTTSF ESAACPGWFLCTAMEADQPVSLTNMPDE 10 GVMVTKFYFQEDE wherein (U) means nothing, M or comprises an N-terminal secretion leader sequence capable of directing the IL-1 formed in a cell out of the cell in processed form and 15 (X) means R or P; or (E) a sequence encoding an amino acid sequence at least 70% homologous to the amino acid sequence of (D). DNA molecule according to claim 12, characterized in that it comprises a sequence selected from: (i) a nucleic acid sequence encoding a polypeptide comprising all or an IL-1 inhibitory fragment of the following amino acid sequence: (U) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN NQLVAGYLQGPNVNLEEKIDVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV NITDLSENRKQDKRFAFIRSDSGPTTSF 30 ESAACPGWFLCTAMEADQPVSLTNMPDE GVMVTKFYFQEDE wherein (D) means nothing, M, or comprises an N-terminal secretion leader sequence, which is able to direct it in 35 a cell formed IL-li out of the cell in a processed form, and (X) means R or P; or (ii) a sequence encoding an amino acid sequence that is at least 70% homologous to the amino acid sequence of (i). DNA molecule according to claim 13, characterized in that it comprises a nucleic acid sequence encoding an amino acid sequence of at least 80%, preferably at least 90%, and more preferably at least 95%, homologous to the amino acid sequence or fragment thereof in claim 13 (i). 10 15. The DNA molecule of claim 12 or 13, characterized in that it comprises a nucleic acid sequence which encodes the following amino acid sequence: 15 (D) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN NQLVAGYLQGPNVNLEEKIDVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV NITDLSENRKQDKRFAFIRSDSGPTTSF ESAACPGWFLCTAMEADQPVSLTNMPDE 20 GVMVTKFYFQEDE wherein (D) means nothing or M, and (X) means R or P. DNA molecule according to claim 12 or 13, characterized in that it comprises a nucleic acid sequence encoding an N-terminal secretion leader having all or part of the following amino acid sequence: 30 MEICRGLRSHLITLLLFLFHSETIC. DNA molecule according to claim 12 or 13, characterized in that it is the recombinant DNA molecule GT10-ILli-2A. 66 DK 172763 B1 Recombinant DNA vector, characterized in that it comprises a DNA molecule according to any one of claims 12-17. Vector according to claim 18, characterized in that it is an expression vector and further comprises at least one regulatory element needed for the expression of the DNA molecule in a host. Vector according to claim 19, characterized in that the DNA molecule is capable of being expressed in bacteria or in mammalian cells. A recombinant host cell, characterized in that it comprises a DNA molecule encoding an interleukin-1 inhibitor (IL-1I) capable of inhibiting interleukin-1 (IL-1), or a forstadiepolypeptid which can be converted into such an inhibitor, which DNA molecule comprises a Nucle-insyresekvens selected from: 20 (a) 10 20 30 40 50 60 GAATTCCGGGCTGCAGTCACAGAATGGAAATCTGCAGAGGCCTCCGCAGTCACCTAATCA MEICRGLRSHLI 25 70 80 90100110120 CTCTCCTCCTCTTCCTGTTCCATTCAGAGACGATCTGCCSACCCTCTGGGAGAAAATCCA TLLLFLFHSETICXPSGRKS 30130140150 160 170 180 GCAAGATGCAAGCCTTCAGAATCTGGGATGTTAACCAGAAGACCTTCTATCTGAGGAACA SKMQAFRIWDVNQKTFYLRN 190 200 210 220 230 240 3. ACCAACTAGTTGCTGGATACTTGCAAGGACCAAATGTCAATTTAGAAGAAAAGATAGATG NQLVAGYLQGPNVNLEEKID 67 DK B1 172 763 250 260 270 280 290 300 TGGTACCCATTGAGCCTCATGCTCTGTTCTTGGGAATCCATGGAGGGAAGATGTGCCTGT VVPIEPHALFLGIHGGKMCL 5 310 320 330 340 350 360 CCTGTGTCAAGTCTGGTGATGAGACCAGACTCCAGCTGGAGGCAGTTAACATCACTGACC SCVKSGDETRLQLEAVNITD 10 370 380 390 400 410 420 TGAGCGAGAACAGAAAGCAGGACAAGCGCTTCGCCTTCATCCGCTCAGACAGTGGCCCCA LSENRKQDKRFAF IRSDSGP 430 440 450 460 470 480 15 CCACCAGTTTTGAGTCTGCCGCCTGCCCCGGTTGGTTCCTCTGCACAGCGATGGAAGCTG TTSFESAACPGWFLCTAMEA 490 500 510 520 530 540 550 ACCAGCCCGTCAGCCTCACCAATATGCCTGACGAAGGCGTCATGGTCACCAAATTCTACT 20 DQPVSLTNMPDEGVMVTKFY 4-560570580590 TCCAGGAGGACGAGTAGTACTGCCCAGGCCTGCTGTTCCATTCTTGCATGGCAAGGACTG 600 F Q E D E * 25 in which S is C or G, and X is R or P; (B) the coding region of the sequence (A) or a portion of the sequence of (A) encoding an IL-1 capable of inhibiting IL-1 or a precursor polypeptide thereto; (C) a sequence degenerated in the coding region of the sequence of (A), or a portion thereof encoding an IL-1 capable of inhibiting IL-1, or a precursor polypeptide thereto; 35 68 DK 172763 B1 (D) a sequence encoding a polypeptide comprising the whole or an IL-I inhibiting fragment of the following amino nosyresekvens: 5 (D) (X) PSGRKSSKMQAFRIWDVNQKTFYLRN NQLVAGYLQGPNVNLEEKIDVVPIEPHA LFLGIHGGKMCLSCVKSGDETRLQLEAV NITDLSENRKQDKRFAFIRSDSGPTTSF ESAACPGWFLCTAMEADQPVSLTNMPDE 10 GVMVTKFYFQEDE wherein (U ) means nothing, M or comprises an N-terminal secretion leader sequence capable of directing the IL-1 formed in a cell out of the cell in processed form, and (X) means R or P; or (E) a sequence encoding an amino acid sequence at least 70% homologous to the amino acid sequence of (D). Host cell according to claim 21, characterized in that it is a bacterial cell. Host cell according to claim 22, characterized in that it is Escherichia coli. 25 Host cell according to claim 21, characterized in that it is a mammalian cell. Host cell according to claim 24, characterized in that it is a CHO cell. Host cell according to any one of claims 21-25, characterized in that the DNA molecule comprises promoter DNA other than the native IL-11 promoter DNA operatively linked to the nucleic acid sequence. 69 DK 172763 B1 A method of producing an interleukin-1 inhibitor (IL-1I) or a precursor polypeptide according to any of claims 1-11, characterized in that the interleukin-1 inhibitor or precursor polypeptide is produced in a recombinant host cell according to a as claimed in any of claims 23-28 under suitable conditions for expression of the DNA molecule contained therein and formation of IL-1I or a precursor polypeptide. A method according to claim 27, characterized in that the IL-1 formed or the precursor polypeptide formed is harvested. A method according to claim 27 or 28, characterized in that the DNA molecule comprises a promoter DNA other than the native IL-1I promoter DNA, operably linked to the nucleic acid sequence. A method according to any one of claims 27 to 29, characterized in that the recombinant host cell is cultured under appropriate nutritional conditions to amplify the DNA molecule. Method according to claim 28, characterized in that it comprises the further step of combining the harvested polypeptide with a pharmaceutically acceptable carrier to form a pharmaceutical composition. Use of an interleukin-1 inhibitor (IL-1I) according to any one of claims 1-11 for the preparation of a pharmaceutical composition for inhibiting interleukin-1. A pharmaceutical composition, characterized in that it comprises an interleukin-1 inhibitor (IL-1I) according to any one of claims 1-11.