RU2286388C2 - Interleukin-1 inhibitor, method for production thereof, dna molecule encoding interleukin-1 inhibitor, and precursor thereof - Google Patents

Abstract

FIELD: biotechnology, gene engineering, medicine.

SUBSTANCE: polypeptide (IL-li) is obtained by recombinant DNA technology having activity of interleukin-1-alpha and interleukin-1-beta inhibitor. Disclosed is DNA sequences encoding inhibitor precursor and maturated form thereof. Described is method for production of vector constructs containing said DNA sequences, as well as transformed cells producing of recombinant IL-li.

EFFECT: method for large-scale production of interleukin-1-beta inhibitor, useful in medicine.

21 cl, 26 dwg, 11 ex

Description

 This application is isolated from application No. 4894343/13, filed November 26, 1990, with priority dated May 27, 1988

A. IL-1

Interleukins-1 are a class of proteins produced by many types of cells, including monocytes and some macrophages. This class includes at least two proteins with a molecular weight of 17-18 kilodaltons, known as interleukin-1 alpha and interleukin-1 beta. These proteins have important physiological effects on a number of different target cells involved in inflammatory and immune responses. Proteins are co-mitagens (with phytohemaglutinin) for T-lymphocytes, causing fibroblasts and chondrocytes to secrete latent collagenase and increasing the surface adhesion forces of endothelial cells for neutrophils. In addition, they act on the hypothalamus as pyrogens, they stimulate muscle protein catabolism, and they cause hepatocytes to synthesize a class of proteins known as "acute phase reactants." Thus, interleukins-1 (IL-1), obviously, are an important part of the body's response to infection and damage.

B. Pathological Roles of IL-1

Nevertheless, despite the usually favorable effects of IL-1, there are cases when their effects become negative. For example, IL-1 can increase the level of collagen in the gouty joint and is involved as a mediator of the acute and chronic stages of immunopathology in rheumatoid arthritis. IL-1 may be responsible for changing the function of endothelial cells, directing chemotaxis and the migration of leukocytes and lymphocytes into the synovial tissue, inducing capillary proliferation and stimulating the accumulation of macrophages in the synovial lining during the acute phase of this disease. In the phase of tissue rupture, IL-1 is involved as a mediator in inducing tissue rupture, stimulating the release of enzymes from fibroblasts and chondrocytes.

In addition, excessive production of IL-1 has been demonstrated in the skin of patients with psoriasis, and high levels of IL-1 can be found in the synovial fluid of patients with psoriatic arthritis. IL-1, released by cells in the inflammatory synovial membrane in psoriatic arthritis, can cause tissue rupture, stimulating the release of enzymes from other cells. The joint pathology of Reiter's syndrome is similar to that observed in psoriatic arthritis and rheumatoid arthritis. In addition, IL-1 can be found in the synovial fluid of patients with osteoarthritis. The release of IL-1 by chondrocytes is involved in the rupture of articular cartilage in this disease.

IL-1 can also increase the severity of autoimmune diseases. For example, decreased production of IL-1 is described from peripheral blood cells in patients suffering from common lupus erythematosus. In addition, some changes in the function of B-lymphocytes may be associated with impaired production of IL-1 or the suitability of IL-1.

Excessive production of IL-1 has been demonstrated in the peripheral monocytes of patients suffering from scleroderma, and IL-1 is involved as a potential fibrosis agent by stimulating the production of collagen by fibroblasts. The mechanism of tissue damage in dermatomycosis may also include cell-mediated immunity, and therefore, IL-1 may be involved as a mediator in this pathophysiological process.

Acute and chronic collagenic pulmonary disease is characterized by excessive collagen production by pulmonary fibroblasts, which can be stimulated by IL-1. Recent studies in an animal model regarding pulmonary hypertension show that IL-1 may be responsible for inducing changes in endothelial cells that lead to narrowing of the pulmonary arteries. It is this narrowing that leads to pulmonary hypertension and further secondary impairment. Thus, IL-1 inhibitors could be useful in the treatment of these pulmonary diseases.

Recent studies show that IL-1 is able to directly damage beta cells in the islets of Langerhans, which are responsible for insulin production. The destruction of cells using IL-1 is currently considered as the primary event in the acute phase of juvenile diabetes mellitus.

Infiltration of monocytes and macrophages in the kidneys dominates in many forms of acute and chronic glomerulonephritis. The release of IL-1 by these cells can lead to local accumulation of other inflammatory cells, ultimately leading to inflammatory destruction and fibrous kidney transfection.

It has been shown that crystals found in tissues or fluids with gout or pseudo-gout can directly simulate macrophages to release IL-1. Thus, IL-1 can be an important mediator in the inflammatory cycle in such diseases.

IL-1 is able to induce calcium loss from bones and may be responsible for osteoporosis, which is observed in inflammatory joint diseases.

Keratinocytes from patients with psoriasis release large amounts of IL-1. This mediator may be responsible for the secondary cell proliferation that occurs in the skin of patients suffering from this disease.

IL-1 is one of the important endogenous pyrogens and may be responsible for inducing a marked degree of fever observed in some infectious diseases, such as acute febrile diseases caused by bacteria or viruses.

Sarcoidosis is characterized by granulomatous lesions in many organs of the body. It was shown that IL-1 is able to induce the formation of granulomas in vitro and may be involved in this process in patients with sarcoidosis.

Excessive production of IL-1 has been demonstrated in peripheral monocytes from Crohn's disease and ulcerative colitis. Local release of IL-1 in the intestine can be an important mediator in stimulating the inflammatory cycle in such diseases.

Some lymphomas are characterized by fever, osteoporosis and even secondary arthritis. Excessive production of IL-1 is demonstrated by some in vitro lymphoma cells and may be responsible for some of the clinical manifestations of these malignancies. In addition, IL-1, produced by some malignant lymphocytes, may be responsible for certain disorders, such as fever, acute phase reaction and general exhaustion, which are observed with leukemia.

The release of IL-1 by astrocytes in the brain is thought to be responsible for the induction of fibrosis, which can occur as a result of brain damage from vascular occlusion.

C. Use of IL-1 Inhibitor

In such and other circumstances, when IL-1 has a negative effect, there is a need for clinical use of an inhibitor of the effects of IL-1. Since IL-1 is a comitogen for T-lymphocytes, it is crucial for the development of autoimmune and other immune diseases. Therefore, with systemic administration, IL-1 inhibitors can become useful immunosuppressive agents. When administered locally, such IL-1 inhibitors can serve to prevent tissue rupture in the inflammatory joint and other areas of inflammation. In fact, to prevent tissue destruction, some IL-1 inhibitors could become even more effective than when administered in combination with collagenase inhibitors.

The therapeutic effect against the effect of IL-1 may become possible at the level of synthesis, secretion, or binding of target cells to a protein. IL-1 is synthesized by monocyte / macrophages and other cells in response to lipopolysaccharides, complement fragments and viruses. Any molecule that blocks the binding of these inducing agents to producer cells or which inhibits their influence on the physiology of these cells could serve as a regulator of the action of IL-1. IL-1 is not secreted by the traditional secretion system since mRNAs encoding at least two protein precursors with a molecular weight of 50 kD, but not containing a hydrophobic signal sequence, have been isolated. The release of the active protein from the inactive precursor, apparently, requires the implementation of proteolysis of this precursor. An inhibitor of the release of one IL-1 or several IL-1 from their predecessors could theoretically regulate the effect of IL-1. Apparently, IL-1 acts on target cells via the classical receptor-mediated pathway, although this receptor has not yet been isolated. Therefore, it is likely that a molecule that inhibits the binding of IL-1 to its receptors or regulates these receptors can also regulate the effect of IL-1. In addition, although intracellular processes after IL-1 receptor binding are still well understood, it is possible that there are agents that can interfere with cellular responses to other receptor-mediated events, and therefore may block the effect of IL-1. For the reasons stated above, proteins and small molecules capable of inhibiting IL-1 by one or more of the above methods are sought. Applicant has unexpectedly discovered that there are at least two IL-1 inhibitor proteins with IL-1 inhibitory properties. These molecules are obtained in purified form, which allows a person skilled in the art to determine their amino acid sequence. Moreover, the preparation of cells that produce these proteins, as well as mRNA, which leads to their synthesis, has been characterized. Finally, antisera have been identified that facilitate the task of screening cDNA expression libraries for genes encoding these inhibitors. Together, these reagents allow coding for cDNAs encoding IL-1 inhibitors. In turn, these genes create the possibility of large-scale production of IL-1 inhibitors suitable for use in the preparation of drugs useful in the treatment of pathophysiological conditions mediated by IL-1.

The present invention relates to inhibitors of IL-1 ("IL-1i"), and more particularly, to an inhibitor of IL-1, having a monocytic origin. In addition, the present invention relates to biologically active analogues of these inhibitors.

An object of the present invention is to provide purified forms of IL-1 inhibitors that are active against IL-1 alpha or IL-1 beta, or a combination thereof. Another objective of the present invention is to obtain these inhibitors in purified forms in order to facilitate the determination of their amino acid sequence. An additional objective of the present invention is to obtain the amino acid sequences of certain inhibitors of IL-1. In addition, the identification of biologically active analogues of such IL-1 inhibitors with improved or equivalent properties is also one of the objectives of the present invention.

In addition, the aim of the present invention is to provide a recombinant DNA system for the production of IL-1 inhibitors in accordance with the invention. Another objective of the present invention is to provide purified forms of IL-1 inhibitors which would be valuable pharmaceutical preparations exhibiting activity against IL-1.

Additional objectives and advantages of the present invention will be presented in part in the description, and in part will be clear from this description or from the practice of the invention. The goals and advantages can be realized and obtained using the tools and methods specified in the attached claims.

To achieve the objectives in accordance with the present invention, IL-1 inhibitors are disclosed that exhibit inhibitory activity against IL-1. Preferred inhibitors are isolated in purified form from a monocyte-conditioned medium with monocytes grown on plates coated with immunoglobulin G (IgG).

Preferred inhibitors in accordance with the present invention are inhibitors 1, 2 and 3. Inhibitors 1 and 2 are proteins that are manipulated in positions characteristic of proteins with a molecular weight of 22-23 kDa, when polyacrylamide gel electrophoresis with sodium dodecyl sulfate, and which elute at 52 mM and 60 mM NaCl, respectively, from a Mono Q rapid liquid chromatography column under specific conditions. In addition, to achieve the objectives in accordance with the present invention, the applicant discloses pharmaceutical compositions containing at least one of the active components, an IL-1 inhibitor of the invention or a biologically active analogue thereof.

Moreover, to achieve the objectives of the present invention, a recombinant DNA system is also disclosed for the creation of these IL-1 inhibitors and their analogues. A preferred embodiment of this system includes at least one cDNA clone or synthetic equivalent thereof encoding at least one IL-1 inhibitor, together with vectors and cells constituting an expression system capable of expressing the IL-1 inhibitors disclosed herein. Antisera are also proposed for use in identifying these cDNA clones. In addition, expression systems are provided for the production of these IL-1 inhibitors using these cDNA clones, their analogs, or other DNA sequences encoding these inhibitors.

Brief Description of the Drawings

Figa and 1b depict the protein profile of Mono Q chromatography of two metabolically labeled monocyte supernatants. Cells were cultured on plates coated with IgG (1a) or fetal calf serum (1b).

Fig. 2a shows silver-stained gels of fractions from the regions indicated in Figs. 1a and 1b.

Figure 2b is an autoradiogram of the gels shown in Figure 2a.

Figures 3a, b and c show data on the purified IL-1 inhibitor of Example 1. Figure 3a provides chromatography data with a radioactivity pattern. Figure 3b is a silver stained gel relative to the fraction samples shown in Figure 3a; Figure 3c shows the autoradiograms of the gels in Figure 3b.

Figures 4a and b show the results of gel filtration chromatograms of an IL-1 inhibitor purified on a Mono Q column.

Figa and b show the results of Western analysis of murine antisera.

6 depicts the construction of plasmid pSVXVPL 2-11-1i.

7 depicts the construction of the plasmid rMK - SGE: IL-1i.

Figa-d depict data on IL-1i-α (inhibitor of IL-1-alpha), Figa and 8b display chromatographic data. Fig. 8c depicts a silver stained gel on fraction samples indicated in Fig. 8b. Fig.8d depicts an autoradiogram.

Figa and 9 represent data on the inhibitor of IL-1-beta (IL-1i-β). Figa displays the chromatography data. Fig.9 displays the data of polyacrylamide gel electrophoresis with sodium dodecyl sulfate.

Figure 10 displays data regarding the fractionation of IL-1i-α peptides.

11 shows data regarding fractionation of IL-1i-α peptides.

Figa is a photograph of a gel with GT10-IL 1i-2A digested using EcoRI after electrophoresis in accordance with Example 6.

Fig.12b reflects the data of autoradiogram Southern blotting of the gel shown in Fig.12a.

13 depicts a portion of the DNA sequence of the protein coding region of lambda GT10-IL 1i-2A and the predicted amino acid sequence in accordance with Example 6.

Fig depicts the nucleotide sequence of GT-10-IL 11i-2A.

Fig. 15 depicts a peptide comprising, inter alia, an IL-1i sequence and a secretory leader sequence of monomeric residues.

Below are given in more detail preferred embodiments of the invention, which, together with the cited examples, help to explain the principles of the present invention.

A. Inhibitor of Human Monocytes

As noted above, the present invention relates to inhibitors of IL-1, which are isolated in purified form. Preferably, the IL-1 inhibitors of the present invention are obtained from human monocyte conditioned medium in which monocytes are grown in IgG coated vessels. In addition, the present invention encompasses substantially purified IL-1 inhibitors of any origin that are biologically equivalent to an inhibitor derived from a human monocyte-containing medium.

In the description of the invention and in its formula, by the term “biologically equivalent”, the applicant means compositions of the present invention capable of preventing the action of IL-1 in a similar manner, but not necessarily to the same extent, as a native inhibitor of IL-1 isolated from monocytes. By the term “substantially homologous” in the specification and claims is meant the degree of homology to a native IL-1 inhibitor isolated from a monocyte-conditioned medium that exceeds the degree of homology that is exhibited by any of the previously listed IL-1 inhibitors. Preferably, if the degree of homology exceeds 70%, more preferably exceeds 80% and most preferably exceeds 90%. A particularly preferred group of inhibitors has over 95% homology to the native inhibitor. The homology percentage is calculated as the percentage of amino acid residues in the smallest of the two sequences that are at the same level as the identical amino acid residues in the sequence compared when four spaces of 100 amino acids in length can be introduced in order to facilitate this arrangement, as pointed out by Dehoff M. in Atlas of Protein Sequence and Structure, Volume 5, p. 124 (1972), National Organization for Biochemical Research, Washington, DC, and yes Nye's work is referred to herein as a reference.

Preferred IL-1 inhibitors of the present invention are obtained from a monocyte-conditioned medium and are first isolated in purified form. For the purposes of this application, “pure form” or “purified form” with respect to the disclosed IL-1 inhibitors means a preparation that is substantially free of other proteins that are not IL-1 inhibitor proteins. Preferably, the IL-1 inhibitors of the present invention are at least 90% pure, more preferably 95% pure.

At least three purified IL-1 inhibitors were isolated by the methods of Example. They include inhibitor 1, inhibitor 2 and inhibitor 5. Inhibitor 1 behaves as a molecule with a molecular weight of 22-23 kDa with polyacrylamide gel electrophoresis with sodium dodecyl sulfate with an approximate isoelectric point of 4.8, and it is eluted from the column of liquid rapid chromatography of proteins Mono Q at 52 mM NaCl in Tris buffer, pH 7.6. Inhibitor 2 is also a protein with a molecular weight of 22-23 kDa, an isoelectric point of 4.8, but it is eluted from a Mono Q column at 60 mM NaCl. Inhibitor 3 is a protein with a molecular weight of 20 kDa and elutes from a Mono Q column at 48 mM NaCl. Inhibitors 1, 2 and 3 are related immunologically and functionally. The preparation of these inhibitors in purified form allows the applicant to create their amino acid sequences. Using the purified inhibitors described for the first time in this application and methods such as those described here and in the ABI Protein Sequencer technical manuals, a significant portion of the amino acid sequences of these inhibitors can be derived. Example 3 shows the amino acid sequence data obtained from three types of IL-1 inhibitors, namely IL-1i-X, IL-1i-α and IL-1i-β.

Applicant has discovered at least one antibody against an IL-1 inhibitor. Other polyclonal and monoclonal antibodies against this and other IL-1 inhibitors can be obtained by methods known in the art. One particular polyclonal antibody is described in Example 4.

B. Recombinant Inhibitor

1. General

Currently, a recombinant DNA method for producing an IL-1 inhibitor has been disclosed. In one embodiment of the invention, the active site functions in a biologically equivalent manner relative to a native IL-1 inhibitor isolated from humans. The sequence of natural or synthetic DNA can be used to directly obtain IL-1 inhibitors. This method provides:

(a) obtaining a DNA sequence capable of directing the host cell to obtain a protein having IL-1 inhibition activity,

(b) cloning the DNA sequence into a vector capable of transfecting and replicating in the host cell, said vector containing the operational elements necessary for expression of the DNA sequence,

(c) transferring a vector containing a synthetic DNA sequence and operational elements into a host cell capable of expressing DNA encoding an IL-1 inhibitor,

(d) culturing the host cells under conditions suitable for amplification of the vector and expression of the inhibitor,

(e) collecting the inhibitor; and

(f) endowing the inhibitor with an active tertiary structure, whereby it possesses IL-1 inhibition activity.

2. DNA sequences

The DNA sequences provided for use in this method are discussed partially in Example 5 and partially in Example 6. These sequences are intended to include synthetic and natural DNA sequences. Natural sequences also include segments of cDNA or genomic DNA.

Example 6 provides a molecular clone of DNA encoding a protein identical to that isolated in Examples 1-3. In Example 6, the plaque GT10-IL 1i-2A was isolated from the GT10 library. Phage was propagated within the plaque and DNA was isolated and digested with EcoRI. The 1850 bp EcoRI fragment carries the coding sequence for IL 1 inhibitor. FIG. 13 shows a partial DNA sequence of the EcoRI fragment.

Based on the doctrines and techniques presented here, one skilled in the art is able to obtain other synthetic polynucleotide sequences. As an example of the present prior art relating to polynucleotide synthesis, the work of Matt euccl, M.D. and Carutners, M.N., J. Am. Chem. Soc. 103: 3185 (1981) and Beaucage, S.L. and Caruthers, M.N., Tetrahedron lett. 22: 1859 (1981), as well as instructions provided with an ABI oligonucleotide synthesizer.

These synthetic sequences may be identical to the natural sequences described in more detail below, or they may contain other nucleotides. In one embodiment, if the synthetic sequences contain nucleotides different from those found in the natural DNA sequences of the present invention, it is assumed that these different sequences encode a polypeptide that has the same primary structure as IL-1i isolated from monocytes. Alternatively, a synthetic sequence containing different nucleotides encodes a polypeptide that has the same biological activity as IL-1i described in this application.

In addition, the DNA sequence may be a fragment of a natural sequence, that is, a fragment of a polynucleotide that is found in nature and which is isolated and purified for the first time by the present applicant. In one embodiment, the DNA sequence is a restriction fragment isolated from a cDNA library.

Alternatively, the DNA sequence is isolated from the human genomic library. An example of such a library useful in this embodiment is provided by Lawn et al. Cell, 75: 1157-1174 (1978), and this work is incorporated herein by reference.

In a preferred version of this embodiment, it is assumed that the natural DNA sequence is obtained by a method that involves:

(a) obtaining a human cDNA library from cells, preferably monocytes, capable of generating an IL-1 inhibitor in a vector and a cell, capable of amplifying and expressing all or part of this cDNA,

(b) probing a library of human genomic DNA with at least one probe capable of binding to the gene or protein product of an IL-1 inhibitor,

(c) identification of at least one clone containing the gene encoding the inhibitor, due to the ability of the clone to bind at least one probe for the gene or its protein product,

(d) isolating a gene or part of a gene encoding an inhibitor from a clone or clones,

(e) binding of the gene or its suitable fragments to the operational elements necessary for maintaining and expressing the gene in the host cell.

Natural DNA sequences useful in this method can also be identified and isolated using a method that provides:

(a) obtaining a library of human genomic DNA, preferably propagated in a host of E. coli recA recBC,

(b) probing a library of human genomic DNA with at least one probe capable of binding to the gene or protein product of an IL-1 inhibitor,

(c) the identification of at least one clone containing the gene encoding the inhibitor, due to the ability of the clone to bind at least one zones for the gene or its protein product,

(d) isolating the gene encoding the inhibitor from the clone (s) that is identified, and

(e) binding of the gene or its suitable fragments to the operational elements necessary for maintaining and expressing the gene in the host cell.

When isolating a natural DNA sequence suitable for use in the above method, it is preferable to identify two restriction sites located within and in close proximity to the terminal parts of the corresponding gene or sections of the gene. The DNA segment containing the corresponding gene is then removed from the remaining genomic material using the appropriate restriction endonucleases. After 3 'and 5' excision, the ends of the DNA sequence and any exon compounds are reconstructed to obtain the corresponding DNA sequences capable of encoding the N- and C-ends of the IL-1 inhibitor protein and capable of synthesizing the DNA sequence with its operational elements.

3. Vectors

(a) Microorganisms, in particular, E. coli

The vectors intended for use in the present invention include any vectors into which the DNA sequence discussed here together with any preferred or necessary surgical elements can be inserted, and which can then be sequentially transferred to the host cell and replicated in such a cell. Preferred vectors are those whose restriction sites are well documented and which contain operational elements that are preferred or necessary for transcription of the DNA sequence. However, some embodiments of the present invention are provided that use currently unrevealed vectors that could contain one or more of the cDNA sequences discussed in this application. In particular, it is preferable that all these vectors have some or all of the following characteristics: (1) having a minimum number of host organism sequences, (2) stable maintenance and reproduction in the desired host, (3) the ability to be present in the desired host with a high copy number , (4) the presence of an adjustable promoter positioned to promote transcription of the desired gene, (5) the presence of at least one marker DNA sequence encoding a selectable trait present on the clock ti plasmid separate from that part, where the DNA sequence was inserted, (6) a DNA sequence capable of terminating transcription.

In various preferred embodiments of the invention, these cloning vectors containing and capable of expressing the DNA sequences of the present invention contain various operational elements. These "operational elements", as discussed in this application, include at least one promoter, at least one Shine-Dalgarno sequence and an initiator codon, as well as at least one termination codon. Preferably, if these "operational elements" also include at least one operator, one leader sequence for proteins exported from the intracellular space, at least one gene for the regulatory protein, as well as any other DNA sequences necessary or preferred for appropriate transcription and subsequent translation of vector DNA.

Some of these operating elements may be present in each of the preferred vectors of the present invention. It is contemplated that any additional operational elements may be incorporated into these vectors using methods known in the art, in particular in light of the teachings herein.

In practice, each of these vectors can be constructed in a way that allows for seamless selection, assembly, and interchangeability. This facilitates the assembly of numerous functional genes from combinations of these elements and the coding region of DNA sequences. In addition, many of these elements can be used in more than one host. It is also contemplated that in certain embodiments of the present invention, vectors may contain DNA sequences capable of functioning as regulators (“operators”) and other DNA sequences capable of encoding regulatory proteins.

(I) Regulators

In one embodiment of the present invention, these regulators serve to prevent the expression of the DNA sequence in the presence of certain environmental conditions, allow transcription and subsequent expression of the protein encoded by the DNA sequence. In particular, it is preferable if the regulatory segments are inserted into the vector so that the expression of the DNA sequence does not occur, or occurs to a very limited extent in the absence of, for example, isopropylthio-beta-D-galactoside. In this situation, transformed microorganisms containing the DNA sequence can be grown to the desired density before starting IL-1i expression. In this embodiment, expression of the desired protein is induced by adding a substance to the microbial medium, which is capable of causing expression of the DNA sequence after reaching the desired density.

(II) Promoters

Expression vectors should contain promoters that can be used by the host organism to express its own proteins. Although a system of lactose promoters is usually used, other microbial promoters have been isolated and characterized, allowing specialists to use them to express recombinant IL-1i.

(III) Transcriptional Terminator

Putative transcription terminators provide vector stabilization. In particular, the sequences described by Rosenberg, M. and Court, D., Ann. Rev. Genet. 13: 319-353 (1979), contemplated for use in the present invention.

(Iv) untranslated sequence

It should be noted that in a preferred embodiment of the invention, it is possible to reconstruct the 3 ′ or 5 ′ end of the coding region so that 3 ′ or 5 ′ untranslated sequences are introduced into the gene transcript. Among these untranslated sequences, those identified by Schmeissner, U., McKenney, K., Rosenberg, M. and Court, D., J. Molec can be noted. Biol., 176: 39-53 (1984), and this work is introduced into the description of the invention as a reference.

(V) Ribosome binding sites

The microbial expression of foreign proteins requires certain operational elements, which, but are not limited to, include ribosomal binding sites. The ribosome binding site is a sequence that the ribosome recognizes and binds to which at the beginning of protein synthesis, as indicated by Gold, L., et al., Ann. Rev. Microbio 35: 557-580, or the work of Marguis, D.M., et al., Genc 42: 175-183 (1986), which are incorporated herein by reference. A preferred ribosomal binding site is GAGGGCGAAAAA (ATC).

(VI) Leader Sequence and Translation Linker

In addition, it is preferable if DNA encoding the corresponding secretory leader (signal) sequence is present at the 5 'end of the DNA sequence, as indicated by Watson, M.E., Nucl. Acids Res. 12: 5145-5163, which is incorporated herein by reference, if the protein needs to be secreted from the cytoplasm, the DNA for the leader sequence may be in a position that allows the production of a hybrid protein in which the leader sequence is directly adjacent to and covalently linked to the inhibitor that is, between the two DNA coding sequences there should be no transcriptional or translational termination signals. The presence of a leader sequence is desirable in part for one or more of the following reasons. First, the presence of a leader sequence may facilitate the processing of the IL-1 inhibitor from the host. In particular, the leader sequence can direct the cleavage of the initial translation product using leader peptidase, removing the leader sequence and leaving a polypeptide with an amino acid sequence that has potential protein activity. Secondly, the presence of a leader sequence may facilitate the purification of the IL-1 inhibitor by removing the protein from the cell cytoplasm. In some types of host microorganisms, the presence of a suitable leader sequence facilitates the transport of the native protein into the periplasmic space, as is the case with some E. coli. In the case of certain E. coli, Saccharomyces and Bacillus and Pseudomonas strains, the corresponding leader sequence facilitates the transport of the protein across the cell membrane into the extracellular medium. In this case, the protein can be purified from extracellular protein. Thirdly, in the case of some proteins obtained in accordance with the present invention, the presence of a leader sequence may be necessary for the location of the native protein in the medium in which it can be ordered in order to adopt its active structure, which has the corresponding protein activity.

In one preferred embodiment of the present invention, an additional DNA sequence is located immediately before the DNA sequence that encodes an IL-1 inhibitor. The additional DNA sequence is able to function as a translational linker (cross-linking agent), that is, it is a DNA sequence that encodes an RNA that serves to arrange ribosomes in the immediate vicinity of the ribosomal binding site of the RNA of the inhibitor with which it is in contact. In one embodiment of the present invention, a translational linker can be obtained using the DNA sequence TAACGAGGCGCAAAAAAATGAAAAAGACAGCTATCGCGATCTTGGAGGATGATTAAATG and methods currently known to specialists in the field of translational linkers.

(Vii) translational terminator

Putative translational terminators serve the purpose of incrementing translation of mRNA. They can be either natural, as described in Kohli, J., Mol. Gen. Genet. 182: 450-439, or synthetic, as described by Pettersson, R.F. Gene 24: 15-2 (1983), both of which are incorporated herein by reference.

(VIII) Selectable marker

Preferably, the cloning vector contains a selectable marker that causes expression of the selectable trait by the host microorganism. In one embodiment of the present invention, a gene that confers resistance to ampicillin is included in the vector, while in other plasmids a gene that confers resistance to tetracycline, or a gene that confers resistance to chloramphenicol, is included.

Such a selectable marker or other is intended to partially assist in the selection of transformants. In addition, the presence of such a selectable marker in the cloning vector may find application in keeping contaminating microorganisms away from the propagation process in the culture medium. In this embodiment, a pure culture of transformed host microorganisms could be obtained by culturing the microorganisms under conditions that require an induced phenotype to survive.

The proposed operating elements are easily selected by specialists in the given field of technology in the light of the known level of knowledge and provisions contained in this description. The main examples of these operating elements are presented in B.Lewin, Gene, Wiley Son., New York (1983), which is incorporated herein by reference. Various examples of suitable operating elements can be found on the above vectors and can be found in a review of publications that discuss the main characteristics of the above vectors.

After synthesis and isolation of all necessary and desirable components of these vectors, the vector is collected by methods known to those skilled in the art. The assembly of such vectors is within the competence of specialists and can be carried out without burdensome experiments. For example, similar DNA sequences are ligated into the corresponding cloning vectors, as described by Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratories (1984), which is incorporated herein by reference.

When constructing the cloning vectors of the present invention, it should be remembered that many copies of the DNA sequence and its operational elements can be inserted into each vector. In such an embodiment, the host organism will produce higher amounts of the desired IL-1 inhibitor per vector. The number of multiple copies of the DNA sequence that can be inserted into the vector is limited only by the ability of the resulting vector, taking into account its size to be transferred, as well as replication and transcription in the corresponding host cell.

(b) Other microorganisms

Vectors suitable for use in microorganisms other than E. coli are also contemplated by the present invention. Such vectors are described in Table 1. In addition, some preferred vectors are discussed below.

Table 1 MASTER REGULAR PROMOTORS INDUCTOR TRANSCRIPTION TERMINATOR MRNA STABILIZATION THE SITE OF THE BEGINNING OF TRANSCRIPTION AND LEADER PEPTID MARKER Ribosome binding site E.coli Lac ¹ , Tac ² Lambda pL Trp ⁵ IPTG, fever, addition of indolylacetic acid (IAA), or tryptophan depletion rrn B ⁶ Neg A ⁸ bla ¹²
Neg A ¹²
phos ampicillin ¹⁴ tetracycline ^14.15 chloramphenicol ¹⁶ Lambda rrn C ⁷ int ⁹ trp ¹⁰ Bacillus alpha amylase ¹⁷ IPTG E.coli rrn B.amy neutral protease
B.amy alpha amylase ²²
B.subt subtilisin ²³ Kan ^r24 B.amy neutral protease
B.amy alpha amylase ²² subtilison ¹⁸ rrn BT. T ²⁰ Cam ^r25 p-43 ¹⁹ Pseudemonas Trp ²⁷ (E.coli) Lac Tac (E.coli) Addition of IAA or IPTG tryptophan depletion phospholipase C ²⁸ exotoxin A ²⁹ sulfonamide ³⁰ streptomycin ³⁰ Trp (E.coli) Yeast Depletion of glucose and galactose, Depletion of glucose Depletion of phosphate Cyc ¹ Invertase ³⁶ Acid Phosphatase ³⁶ Alpha Factor Ura 3 ³⁷ Una Leu 2 ⁵⁸ Alpha His 3 Factor Tap 1 Sac ² Unregulated (non-regulatory)

1. Backman, K., Ptasnne, M. and Gilbert, W. Proc. Natl. Acad. Sci. USA 73, 4174-4178 (1976).

2. de Boer, H. A., Comstock, L. J., and Vasser, M. Proc. Natl. Acad. Sci. USA 80, 21-25 (1983).

3. Shimatake, H. and Rosenberg, M. Nature 292, 128-132 (1981).

4. Derom, C., Gheysen, D. and Fiers, W. Gene 17, 15-51 (1982).

5. Hallewell R.A. and Entage, S. Gene 9, 27-47 (1980).

6. Grosius, J., Dull, T.J., Sleeter, D.D., and Noller, H.F., J. Mol. Biol. 148, 107-127 (1981).

7. Normanly, J. Ogden, R. C., Horvath, S. J. and Abelson, J. Nature 321, 213-219 (1986).

8. Belasco, J.G., Nilsson, G., von Gabain, A. and Conen, S.N. Cell 46, 245-251 (1986).

9. Schmelssner, W., McKenney, K., Rosenberg M. and Court, D.J. Mol. Biol. 176, 39-53 (1984).

10. Mott, J.E., Galloway, J.L. and Platt, T. EMBO J. 4, 1887-1891 (1985).

11. Koshland, D. and Botstein, D. Cell 20, 749-760 (1980).

12. Movva, N. R., Kakamura, K. and Inouye, M. J. Mol. Biol. 143, 317-328 (1980).

13. Surin, B.P., Jans, D.A., Fimmel, A.L., Shaw, D.C., Cox, G.B. and Rosenberg, M.J. Bacteriol. 157, 772-778 (1984).

14. Sutcliffe, J.G. Proc. Natl. Acad. Sci. USA 75, 3737-3741 (1978).

15. Peden K.W.C. Gene 22, 277-280 (1983).

16. Alton, N.K. and Vapnek, D. Nature 282, 864-869 (1979).

17. Yang, M., Galizzi, A., and Henner, D. Nuc. Acids Res. 11 (2), 237-248 (1983).

18. Wong, S.-L., Price, C.W., Goldfarb, D.S., and Doi, R.M. Proc. Natl. Acad. Sci. USA 81, 1184-1188 (1984).

19. Wang, P.-Z., and Doi, R.M. J. Biol. Chem. 259, 8619-3625, (1984).

20. Lin, S.-K., Quinn, L.A. Rodriquez, R.L. J. Cell. Biochem. Suppl. (98), p .98 (1985).

21. Vasantha, N., Thompson, L. D., Rhodes, C., Banner, C., Nagle, J., and Filpula, D. J. Bact. 159 (3), 811-319 (1984).

22. Palva, I., Sarvas, M., Lehtovaara, P., Sibazkov, M., and Kaariainen, L. Proc. Natl. Acad. Sci. USA 79, 5582-5586 (1982).

23. Wong, S.-L., Pricee, C.W., Goldfarb, D.S., and Doi, R.H. Proc. Natl. Acad. Sci. USA 81, 1184-1188 (1984).

24. Sullivan, M.A., Yasbin, R.E., and Young, F.E. Gene 29, 21-46 (1984).

25. Vasantha, N., Thompson, L. D., Rhodes, C., Banner, C. Nagle, J., and Filpula, D. J. Bact. 159 (3), 811-819 (1984).

26. Yansura, D.G. and Henner, D.J. PNAS 81, 439-443 (1984).

27. Gray, G.L., McKeown, K.A., Jones, A.J.S., Seeburg, P.H. and Heyneker, H.L. Biotechnology, 161-165 (1984).

28. Lory, S., and Tai, P.C. Gene 22, 95-101 (1983).

29. Liu, P.V. J. Infect. Dis. 130 (suppl), 594-599 (1974).

30. Wood, D.G., Hollinger, M.F., and Tindol, M.B. J. Bact. 145, 1448-1451 (1981).

31. St. John, T.P. and Davis, R.W. J. Mol. Biol. 152, 285-315 (1981).

32. Hopper, J.E., and Rowe, L.B. J. Biol. Chem. 253, 7566-7569 (1978).

33. Denis, C. L., Ferguson, J. and Young, E.T. J. Biol. Chem. 258, 1165-1171 (1983).

34. Lutsdorf, L. and Megnet, R. Archs. Biochem. Biophys. 126, 933-944 (1968).

35. Meyhack, B., Bajwa, N., Rudolph, M. and Hinnen, A. EMBO. J. S, 675-680 (1982).

36. Watson, M.E. Nucleic Acid Research 12, 5145-5164 (1984).

37. Gerband, C. and Guerineau, M. Curr. Genet. 1, 219-225 (1-30).

38. Hinnen, A., Hicks, J.B. and Fink, G.R. Proc. Natl. Acad, Sci. USA 75, 1929-1933 (1978).

39. Jabbar, M.A., Sivasubramamian, N. and Nayak, D.P. Proc. Natl. Acad. Sci. USA 82, 2019-2023 (1985).

(I) Pseudomonas Vectors

Several vector plasmids autonomously replicating in a wide range of gram-negative bacteria are preferred for use as host-host-cloning vector systems in hosts of the genus Pseudomonas. Some of them are described by Tait, R.C., Close, T.J., Lindquist, R.C., Hagiya, M., Redriquez, R.L. Kadoc in the journal Biotechnology, May 1983, pp. 269-275; Panopoulos, NJ, in Genetic Engineering in the Plant Sciences, Praeger Publishers, New York, pp. 163-185 (1981), as well as Sakagucki, K., Current Topic in Microbiology and Immunology 96: 31-45 (1982) and each of the mentioned works is included in this description as a reference.

One particularly preferred construct includes plasmid RSF 1010 and its derivatives as described by Bagdasarian, M., Bagdasarian, M.M., Coleman, S., and Timmis, K.N. in Plasmids of Medical, Environmental and Commercial Importance, Timmis, K.N. and Puhler, A. eds., Elsivier / North Holland Biomedical Press (1979).

The advantage of the plasmid RSF 1010 is that it is relatively small, has a large number of copies, is easily transformed, and is stably preserved both in E. coli and in Pseudomonas. In this system, it is preferable to use the Tac expression system as described for Escherichia, since it appears that the E. coli trp promoter is readily recognized by Pseudomonas RNA polymerase, as described by Sakagucki, K. in Current Topics in Microbiology and Immunology, 96: 31-45 (1982) and Gray, GL McKeown, K.A., Jones, A.J.S., Seeburg, P.H., and Heyneker, K.L. in Biotechnology, Feb., 1984, pp. 161-165, both of which are incorporated herein by reference. Transcriptional activity can be further maximized by replacing promoters, for example, the trp promoter of E. coli or P. aeruginosa. In addition, the E. coli lac1 gene will also be included in the plasmid for regulation.

Translation can be linked to translation initiation for any Pseudomonas proteins, as well as to initiation sites for any highly expressed proteins of the type selected for intracellular expression of the inhibitor.

In cases where restriction negative strains of the host species Pseudomonas cannot be obtained, the transformation efficiency with plasmid constructs isolated from E. Coli is very low. Therefore, the passage of the Pseudomonas cloning vector through a rm + strain of another species is desirable before transforming the desired host, as indicated by Bagdasarian, M., et al., Plasmids of Medical, Environmental and Commercial Importance, pp. 411-422, Timmis and Puhler eds., Elsevier / North Holland Biochemical Press (1979), which is incorporated herein by reference.

(II) Bacillus Vectors

In addition, a preferred expression system in hosts of the genus Bacillus includes the use of plasmid pu B110 as an organism-host-cloned vector system. As in another host vector system, it is possible in Bacillus to express the IL-1 inhibitor of the present invention as either an intracellular or secreted protein. Proposed embodiments of the present invention include both systems. Shuttle vectors that replicate in both Bacillus and E. coli are suitable for constructing and testing various genes as described by Dubnau, D., Gryezan, T., D, Contente, S., and Shivakumar, AG , Genetic Engineering Vol. 2, Setlov and Hollander eds., Plenum Press, New York, New York, pp. 115-131 (1980), specifically incorporated herein by reference. For the expression and secretion of an IL-1 inhibitor from B.sultilis, the alpha-amylase signal sequence is preferably linked to the coding region relative to the protein. For the synthesis of an intracellular inhibitor, the portable DNA sequence is translationally linked to the ribosome binding site of the alpha-amylase leader sequence.

The transcription of any of these constructs is preferably directed by the alpha-amylase promoter or its derivative. This derivative contains a recognition sequence for the native alpha-amylase promoter RNA polymerase, but also includes a lac operator region. Similar hybrid promoters constructed from the penicillinase gene promoter and the lac operator function in a regulated manner in Bacillus hosts as described by Yansura, D.G. and Honner, Genetics and Biotechnology of Bacilli, Ganesan, A.T. and Hoch, J.A., eds., Academic Press, pp. 24-263 (1984), which is incorporated herein by reference. The E. coli lac1 gene could also be included in the plasmid for regulation.

(III) Clostridium Vectors

One preferred construct for expression in Clostridium is the plasmid pJU 12 described in Squires, CH et al., In Journal of Bacteriology 159: 465-471 (1984), which is specifically incorporated herein by reference. This plasmid was transformed into C. perfringens by the method of Hufner, DL et al., J. Bacteriol 159: 460-464 (1984), which is specifically incorporated herein by reference. Transcription is directed by the promoter of the gene conferring resistance to tetracycline. Translation is associated with Shine-Dalgarno sequences of the same tet ^r gene, exactly in accordance with the procedure described above for vectors suitable for use in other hosts.

(IV) Yeast vectors

Foreign DNA introduced into yeast can be stored in several ways, as described by Botstein, D. and Davis, RW, The Molecular Biology of the Yeast Saccharomyces Cold Spring Harbor Laboratory, Stranthern, Jones & Broach, pp. 607-656 (1982 ), which is incorporated into this description by reference. One preferred expression system for use with host organisms of the genus Saecharomyces carries the IL-1 inhibitor gene on a 2 μm plasmid. The advantages of a 2 μm ring are a relatively high copy number and stability upon induction in cir ⁰ strains. These vectors preferably carry the origin of replication and at least one antibiotic resistance marker from plasmid pBP522 for replication and selection in E. coli. In addition, the plasmid preferably has a 2 μm sequence and the LEU2 yeast gene for the same purpose in LEU2-deficient yeast mutants.

It is assumed that if recombinant IL-1 inhibitors are eventually expressed in yeast, it is preferable that the cloning vector is first transferred to Escherichia coli, where the vector could be replicated and from where the vector could be obtained and purified after amplification. Then the vector could be transferred to yeast for the final expression of the inhibitor of IL-1.

(c) Mammalian cells

The cDNA for the IL-1 inhibitor serves as a gene for expression of the inhibitor in mammalian cells. The cDNA must have a sequence that is effective in binding ribosomes, as described, for example, in Kozak, Nucleic Acid Research 15: 8125-8132 (1987), which is specifically incorporated into this description by reference, must also have an encoding capacity for leader sequence (see section 3 (a) (VI)) in order to direct the mature protein from the cell in a processed form. A DNA restriction fragment carrying the entire cDNA sequence can be inserted into an expression vector that has a transcriptional promoter and transcriptional enhancer, as described in Guarante, L., Cell 52: 303-305 (1988) and Kadonaga, JT, et al. Cell 51: 1079-1090 (1987), which are incorporated herein by reference. The promoter can be regulated, as in plasmid pMSG (Pharmacia Cat No. 27450601), if the constitutive expression of the inhibitor is detrimental to cell growth. The vector must have a complete polyadenylation signal as described by Ausubel, F.M. et al., Current Protocols in Molecular Biology (1987), which is specifically incorporated herein by reference; so that it is possible to properly process mRNA transcribed from this vector. Finally, the vector must have a start of replication and at least one antibiotic resistance marker from plasmid pBP322 for replication and selection in E. Coli.

In order to select a stable cell line that produces an IL-1 inhibitor, the expression vector can carry a gene for a selectable marker, such as a drug resistance marker, or carry a complementary gene for a deficient cell line, such as the dihydrofolate reductase (dhfr) gene to transform a dhfr cell line as described in Ausubel et al., supra. Alternatively, a single plasmid carrying a selectable marker can be co-transformed together with an expression vector.

4. Host Cells / Transformation

The vector thus obtained is transferred to the corresponding host cell. These host cells can be microorganisms or mammalian cells.

(a) Microorganisms

It is believed that any microorganism having the ability to accept exogenous DNA and express these genes and the attached operational elements can be selected for this purpose. After selection of the host organism, the vector is transferred to the host organism using methods commonly known to those skilled in the art. Examples of such methods are descriptions provided by Advanced Bacterial Genetics, R.W. Davis et al., Cold Spring Harbor Press, Cold Spring Harbor, New York (1980), which is specifically incorporated herein by reference. Preferably, in one embodiment, the transformation occurs at low temperatures, since temperature regulation is intended as a means of regulating gene expression using the operating elements described above. In another embodiment, if osmolar regulators are inserted into the vector, to ensure proper control of foreign genes, it would be necessary to adjust salt concentrations during transformation.

Preferably, the host microorganism is an optional anaerobic or aerobic. Hosts that are preferred for use in this method include yeast and bacteria. Specific yeasts include yeasts of the genus Saecharomyces, especially Saecharomyces cerevisiae. Specific bacteria include bacteria of the genera Bacillus, Escherichia and Pseudomonas, especially Bacillus subtilis and Escherichia coli. Additional host cells are shown in Table 1, above.

(b) Mammalian cells

A vector can be introduced into mammalian cells in culture using several methods, such as calcium phosphate: DNA coprecipitation, electroporation (i.e., electroshock opening of cell pores) or protoplast fusion. A preferred method is coprecipitation with calcium phosphate as described by Ausubel et al., Supra.

There are many types of resistant cells that are transformable and capable of transcribing and translating the cDNA sequence by processing the IL-1 inhibitor precursor and secreting the mature protein. However, cell types may vary depending on the glycosylation of secreted proteins and the post-translational modification of amino acid residues. Thus, ideal cell types are those that produce a recombinant inhibitor of IL-1, which is identical to a natural molecule.

5. Cultivation of manufactured cells

Host cells are cultured under conditions suitable for expression of an IL-1 inhibitor. These conditions are mainly specific for the host cell, and they are easily determined by specialists in the light of the published literature relating to the conditions for growing such cells, as well as in light of the provisions presented here. For example, Bergey's Manual of Determinative Bacteriology, 8 ^{th Ed., Williams & Wilkins Co.} , Baltimore, Maryland, which is incorporated herein by reference, contains information on conditions for culturing bacteria. Similar information regarding the cultivation of yeast and mammalian cells can be obtained from Pollack, R. Mammalian Cell Culture, Cold Spring Harbor Laboratories (1975), incorporated herein by reference.

When carrying out work at the stages of transformation and cultivation, any conditions necessary for regulating the expression of the DNA sequence can be selected, depending on any operational elements inserted into or present in the vector. In one embodiment, the cells are grown to high density in the presence of suitable regulatory conditions that inhibit the expression of the DNA sequence. Upon reaching the optimal cell density, environmental conditions are changed to those suitable for expression of the DNA sequence. Thus, it is assumed that the production of the IL-1 inhibitor occurs in the time interval after the growth of the host cells to an almost optimal density and that the obtained IL-1 inhibitor is harvested at a certain stage after the induction of regulatory conditions necessary for its expression.

6. Cleaning

(a) IL-1 inhibitor obtained from microorganisms

In a preferred embodiment of the present invention, the recombinant inhibitor of IL-1 is purified after collection and before assuming its active structure. This option is preferred because the applicant believes that recovering a high yield of the reordered protein is facilitated if the protein is first purified. However, in one preferred, alternative embodiment, the IL-1 inhibitor can be re-ordered to accept its active structure before purification. In yet another embodiment, preferred and alternative, the IL-1 inhibitor is present in its re-ordered, active state after extraction from the culture medium. Under certain circumstances, the IL-1 inhibitor will take its proper, active structure after expression in the host microorganism and transport of the protein through the cell wall or membrane, or into the periplasmic space. This usually occurs when the DNA encoding the corresponding leader sequence is linked to the DNA encoding the recombinant protein. If the IL-1 inhibitor does not accept its proper, active structure, any disulfide bonds formed and / or any non-covalent interactions will be destroyed by denaturation agents and reducing agents, for example guanidinium chloride and beta-mercaptoethanol, before the IL-1 inhibitor assumes its active structure after dilution and oxidation of these substances under controlled conditions.

For purification before and after re-ordering, it is preferable to use a certain combination of the following operational steps: anion exchange chromatography (Mono Q or DEAE-Sepharose), gel filtration (superose), chromatofocusing (Mono P) and hydrophobic chromatography (octyl or phenyl-sepharose). Of particular value is chromatography by affinity for the antibody using an inhibitor of IL-1-specific monoclonal antibodies (described in Example 5).

(b) IL-1 inhibitor derived from mammalian cells

The IL-1 inhibitor obtained from mammalian cells is purified from the conditioned medium by a combination of the following steps: ion exchange chromatography and immunoaffinity chromatography using the monoclonal antibodies described in Example 3. The specialist will understand that various modifications are possible in the processes and products of the present invention and variations, provided that they all comprise the scope of the appended claims.

It should be understood that the application of the principles of the present invention is the responsibility of specialists in this field of technology, taking into account the provisions set forth in this application. Examples of products of the present invention and illustrative methods for their isolation and preparation are presented below.

The following examples illustrate various preferred embodiments of the present invention. The publications cited in these examples are incorporated by reference.

EXAMPLES

Example 1 - Obtaining proteins

A. Materials

Hanks Balanced Salt Solution (HBSS) and RPMI are available from MediaTech, Washington, DC. Lymphoprep is obtained from Akyurat Chemical and Scientific Corp., Westbury, New York. Human immunoglobulin G (IgG), MTT, rabbit antiserum for antiprostaglandin E ₂ , ammonium bicarbonate, dithiothreitol, Freund's complete and incomplete stimulants, hypoxanthine, aminopterin and thymidine are supplied from Sigma Chemical Co., St. Louis, Missouri. C3H / HeJ mice are obtained from Jackson Loves, Bar Narbor, Maine. BAL B / C mice and P3 myeloma cells are obtained from the funds of Doctors John Kapler and Philippa Marrake at the Jevish National Center for the Study of Immunology and Respiratory Medicine (NJ C / IPM), Denver, Colorado. Recombinant human IL-1 is obtained from Cistron Biotechnology, Pine Wrook, New York. Purified phytohemagglutinin is supplied to Welkam Diagnostics, Research Triengle Park, North Carolina. Primary cultures of human foreskin fibroblasts are obtained from Dr. Richard Clark at NJ C / IPM, Denver, Colorado. Monoclonal mouse anti-rabbit IgG antibodies are supplied from reagents AIA, Aurora, Colorado. Low methionine PPMIs are prepared using Select-Amin equipment from GIVCO Laboratories, Grand Island, New York. / ³⁵ S / methionine, diphenyloxazole, and / ¹⁴ C / -iodouksusnuyu acid obtained from DuPont-NEN, Chicago, Illinois. Amniotic calf serum is obtained from HighClon Laboratories, Logan, Utah. Mono Q and Superose 12 columns are available from Pharmacy, Inc., Piscatway, New Jersey. C4 reverse phase columns are obtained from Synchrome, Inc., Lafayette, Indiana. C8 reverse phase columns are obtained from Apple Biosystems, Inc., Foster City, CA. Acetonitrile and polyethylene glycol 8000 are supplied by J.T. Baker Chemical Co., Phillipsburg, New Jersey. Trifluoroacetic acid and guanidine hydrochloride are obtained from Pierce Chemicals, Rockford, Illinois. Lys C endoproteinase is obtained from Beringer Mannheim Biochemicals, Indianapolis, Indiana. The microtiter plates used for the PCE ₂ enzyme-linked immunosorbent assay (PCE ₂ ELISA) are Nunk-Immuno Plate 1, obtained from Intermount Scientific Corporation, Bountiful, Utah. The cups used to produce the hybridoma are obtained from Costar, Cambridge, Massachusetts.

B. Generation of an inhibitor of IL-1 monocytes

Human leukocytes are obtained from normal donors by leukophoresis, resuspended in Hanks' balanced salt solution (HBSS) at a concentration of 1 part of packed cells per 1 part of HBSS, layered with Lymphoprep and twisted at 400 kg for 50 minutes at room temperature. A mononuclear fraction is taken (usually 4-5 10 ⁹ cells are obtained from one donor), washed in HBSS without Ca ⁺⁺ or M ⁺⁺ suspended in serum-free RPM1 and plated on Petri dishes coated with normal human IgG, which is done by non-polysaccharide chromatography on a Sephadex column C200 (6 × 10 ⁷ cells in 10 ml per 100 mm cup). All reagents contain less than 10 pg / ml lipopolysaccharide (LPS). Cells were cultured for 24-48 hours, and the resulting conditioned medium constituted the crude supernatant of the IL-1 inhibitor (IL-1i). Typically, cells from one donor result in 700-900 ml of crude IL-1i supernatant.

C. Analysis of the inhibitor of IL-1

Typically, two IL-1 assays are used to determine IL-1i. Thymocytes (1 × 10 ⁶ cells from 4-6-week-old CBS / HeJ mice) are responsible for 1.0 units / ml of recombinant human IL-1 plus 1 μg / ml phytohemagglutinin during half-maximum polymerization, as measured by ³ H-thymidine administration or absorption MTT tetrazolium salt (Mesmann, T., J. Immunol Method 65: 55-61 (1983)) three days after the start of stimulation. Untreated IL-1i completely inhibits this proliferation reaction when 1/10 is diluted. Human dermal fibroblasts (1 × 10 ⁵ cells per well in a 96-well dish) are typically responsible for 0.5 units / ml recombinant human IL-1 when secreted for 6 hours of stimulation, approximately 50,000 pg / ml PCE ₂ , which can be measured ELISA method. This method is as sensitive to IL-1i as the analysis of thymocytes.

D. Metabolic labeling of the inhibitor of IL-1

IL-1 and are metabolically labeled by culturing mononuclear leukocytes for 48 hours on IgG-coated plates (as described in Part B) in serum-free PPM1 containing only 0.75 μg / ml cold methionine (15 μg / ml are normal), and which is added 0.5 mcub, an inch of ³⁵ S-methionine (1151 cubic inches / mmol) per 10 ⁷ cells. Control labeling is carried out in a similar manner except that the plates are coated with amniotic fluid of the calf, and not IgG. Analysis of such control supernatants shows that a very small amount of IL-1i is secreted when cells are cultured on plates coated with amniotic calf serum.

E. Purification of the protein of the inhibitor of IL-1

The crude IL-1i supernatants were adjusted to 1.0 M in sodium chloride, incubated on ice for one hour and centrifuged at 10,000 rpm for 15 minutes. Supernatants that contain all the inhibitory activity, but only 20% of the initial protein, are then intensively dialyzed at 4 ° C against 0.025 M Tris, pH 7.6, which contains 0.1% sucrose (buffer A), for gradient fractionation of proteins on anion with a Mono Q exchange column. After dialysis, the inhibitor-containing solutions are centrifuged again at 10,000 rpm for 15 minutes and then passed through 0.22 μm nylon filters. Supernatants are usually combined with 10 ml of a similarly prepared metabolic labeling supernatant and passed through Mono Q-Superose columns (liquid protein rapid chromatography (HPLC) on Pharmacy equipment)) with layer volumes of either 1.0 ml or 8.0 ml, washed with buffer A until the OD ₂₈₀ value of the effluent returned to the baseline is reached and carefully chromatographed using a linear gradient of sodium chloride (0.025 M-0.10 M) in buffer A. Column fractions are collected and analyzed for radioactivity and bioactivity willness. Samples of each fraction are also analyzed by polyacrylamide gel electrophoresis in 12.5% sodium dodecyl sulfate, stained with silver, impregnated with diphenylazole, dried and applied to a film to obtain autoradiographic data. Fig. 1a shows the Mono Q chromatography protein profile for 40 ml of crude IL-1i supernatant mixed with 5 ml of metabolically labeled IL-1i supernatant. The value of the radioactivity detected in 50 μl of each fraction was added, as well as the bioactivity of IL-1i measured in the analysis of obtaining PGE ₂ . Two main and one smaller type of radioactivity are shown, which completely coincide with the three peaks of bioactivity. Fig. 1b shows similar chromatography of 15 ml of crude IL-1i supernatant mixed with 5 ml of supernatant from monocytes metabolically labeled on plates coated with amniotic calf serum (FCS) rather than IgG. The levels of the three aforementioned types of radioactivity are significantly reduced. Fig. 2a shows gels stained with silver in fractions from the chromatographic regions shown in Figs. 1a and 1b. It should be noted that the fractions of peak radioactivity and bioactivity in Fig. 1a (fractions 52 and 59) show the main band at 22 kilodaltons (indicated by arrows) during polyacrylamide gel electrophoresis with sodium dodecyl sulfate (NaPAG-SDS). The third view (fraction 48 in FIG. 1a) shows the band at 20 kDa during the SDS page-SDS Na). Gel filtration experiments on crude IL-1i show that the active molecule has a molecular weight of 18-25 kDa. Fig.2b is an autoradiogram of the gels shown in Fig.2A. It is easy to understand that protein bands at 20 and 22 kD are the main radioactive species in these fractions.

Summarizing these results, the applicant shows that metabolic labeling of monocytes seeded on Petri dishes coated with IgG leads to the production of radioactive species that are poorly produced only when cells are seeded on plates coated with FCS. These induced radioactive species are well chromatographed in conjunction with several types of IL-1i bioactivity on a Mono Q column, and the gels and autoradiograms obtained show that the three main induced molecules are proteins with a predicted molecular weight for IL-1i.

The IL-1i molecules are further purified for sequencing in two ways. Firstly, Mono Q fractions with peak bioactivity and radioactivity were loaded onto a reverse phase C4 column and H ₂ O / 0.1% TFA was eluted: acetonitrile / 0.1% TFA gradient. Since the IL-1i molecule is labeled with isotopic indicators, the samples of each fraction are directly counted for the degree of radioactivity, and PAGE-DDS Na is analyzed, followed by autoradiography, Fig. 3a shows such a chromatography with an inserted radioactivity pattern. Silver-stained gels were tested on samples from each fraction (Fig. 3b), and subsequent autoradiograms of the gels (Fig. 5c) showed that the IL-1i molecule was in fractions 32-36. These fractions are dried and sequenced. Alternatively, the Mono Q peak fractions are dried using a Speed Vac, resuspended in 0.4 ml of 0.05 M NH ₄ HCO ₃ and directly chromatographed twice on a Superose 12 gel filtration column (10 × 300 mm) (HPLC Pharmacy) equilibrated in the same buffer solution, as shown in Figures 4a and 4. Fractions are collected and samples of each fraction are tested for radioactivity and thioactivity, after which they are analyzed by silver staining and autoradiographed with Na-PAGE-DDS. The appropriate fractions are then dried on a Speed Vac and sequenced.

Example 2

The proposed sequencing of the inhibitor of IL-1

Before sequencing, the samples were dissolved in 6 M guanidine-HCl, pH 8.6, reduced for 4 hours at 37 ° C under N _{2 with a} 100-fold molar excess of dithiothreitol compared to protein, and then alkylated with 400-fold for 1 hour an excess of ¹⁴ C-iodoacetic acid. In this case, the reaction mixtures can be desalted on a C8 reversed phase column, eluted and partially dried, N-terminal sequences are determined using the Apple Biosystems protein sequencer. To obtain internal sequences, reduced and alkylated samples are digested with cyanogen bromide or proteolytic enzymes using known methods. The reaction mixtures were dried, dissolved in 0.1% TFA / H ₂ O, and the peptides were isolated using a C8 reverse phase column.

Example 3

Purification and sequencing of types of inhibitors of IL-1

A. Types of IL-1i-X, IL-1i-a and IL-1i-b

Mono Q-purification of IL-1i splits the biological activity into three main species, as shown in Fig. 1a and described in Example 1, where the peak fractions relative to this activity are 48, 52 and 59. PAGE-SDS Na on samples of these fractions, as shown in Fig.2A, reveals species at 20 KD, 22 KD and 22 KD, respectively. Western analysis of such gels using murine antisera, which is discussed in Example 4 below, stains all three species. When IL-1i is obtained from cells metabolically labeled with ³⁵ S-methionine during growth on IgG-coated plates, each of these bands is radioactive (as shown in Fig. 2b, which is an autoradiogram of the aforementioned gel). Based on the doctrine presented in Example 1, namely that parallel cells incubated under uninduced conditions do not produce the bioactivity of IL-1i and do not produce these radioactive bands, the applicant concludes that these three species are responsible for biological activity. The applicant named these types of IL-1i-X, IL-1i-a, and IL-1i-b, respectively.

B. Purification and sequencing of IL-1i-X

Mono Q fractions containing IL-1i-X and / or IL-1i-a are purified from reverse-phase high-pressure liquid chromatography on a Synchropack PP-4 (C4) column, and the radioactive species are analyzed by sequencing. Numerous failed direct sequencing attempts of IL-1i-a and IL-1I-b purified by reverse phase HPLC, which indicates their chemical blocking from their N-ends. However, one drug IL-1i-a (IL-1i-aV2p42) leads to the following sequence:

and subsequent preparations of IL-1i-X, similarly purified HPLC with reversed phase C4, produce the same sequence:

They are undoubtedly part of the sequence detected during the initial attempt to sequence IL-1i-a. Applicant concludes that the sequence information provided is the N-terminus of a 20 kD species called IL-1i-X. In these and in all subsequent sequences, the underlined position indicates either the inability to identify the remainder or the existence of ambiguity regarding the identified remainder. When two or more residues are placed in the same position, this indicates that more than one amino acid has been detected in the sequencing step, and a more correct residue is at the top.

C. Generation, purification and sequencing of peptides IL-1i-a and IL-1i-b

Since IL-1i-a and IL-1i-b are chemically blocked from their N-ends, the peptides of each of them are generated by digestion of the endoproteinase. Specifically, Mono Q fractions containing either IL-1i-a or IL-1i-b are passed through a 4.6 x 250 mm reverse phase (C3) high performance liquid chromatography column (Zorbax Protein Plus), which is an alternative to C columns -4 used in all previous experiments. Very stepwise gradients (0.2% acetonitrile per minute at 0.5 ml / min) split off IL-1i-a (Fig. 8a, b) or IL-1i-b (Fig. 9a) from the main contaminating radioactive species, human lysozyme. I confirm the identity of the purified species by the presence of a single, radioactive protein with a molecular weight of 22 kD on the PAGE-SDS Na and subsequent autoradiograms (Figs, d and 9b). Proteins are manually collected in silica glass tubes, 25 ml of a 0.2% Tween-20 solution are added to each of them. IL-1i-containing fractions are then brought to a volume of 50 μl per Speed Vac, adjusted to 300 μl by adding 1% NH ₄ HCO ₃ , followed by 1 mg of endoproteinase. In the case of IL-1i-a, the enzyme LysC Endoproteinase (Behringer-Mannheim) is used, whereas IL-1i-b is cleaved with AspN Endoproteinase (Behringer Mannheim). Cleavage is carried out at a temperature of 37 ° C for 16 hours, after which the volume of the reaction mixture is reduced to 50 ml on a Speed Vac.

In the case of IL-1i-a, the sample is chromatographed directly, while the sample of IL-1i-b is first restored by adding 5 ml of 50 mM dithiothreitol in 2 M Tris, pH 8.0, and reacted for 30 minutes at 37 ° C then carboxymethylated by adding 1.1 μmol of ³ H-iodoacetic acid in 10 ml of ethanol (reacting for 30 minutes at 37 ° C in the dark). The peptides are separated on a narrow-gauge Braunley Aquapor RP-300 (C8) column with a size of 2.1 × 250 mm at a solvent front displacement of 100 μl / min using Beckman HPLC equipped with micro-calibration equipment and micro-caliber compatible pumps. A linear gradient of 200 min, 0-100% (H ₂ O / 0.1% TFA - acetonitrile / 0.1% TFA) was used. Peptide secretions are shown in FIGS. 10 and 11. The following information was obtained regarding sequences:

The two peptide sequences are apparently related in nature to that obtained previously from IL-1i-X. One of them, RaLysC-41, is the IL-1i-a sequence, and the other, RbAspN-51, is the IL-1i-b sequence, which disputes the assertion that the three types of IL-1i are at least closely related proteins, if not chemically and / or physically modified forms of the only original IL-1i molecule. If you combine the above sequences, you can get the following composite sequences:

These composite sequences do not appear to be present in any of the other known polypeptides presented in the recently published Identified Protein Resource Database (PIR 16.0). The Applicant believes that these sequences or less significant variants are a class of molecules that are capable of acting as IL-1 inhibitors.

Example 4

Obtaining antibodies specific for the inhibitor of IL-1

Ten week old BaL B / s mice were injected subcutaneously with an IL-1 inhibitor that was partially purified (400-fold) from crude supernatants using Mono Q chromatography, dialyzed against PFG (phosphate buffered saline) and emulsified with a complete Freund stimulator. Each mouse receives IL-1i, purified from 5 ml of crude supernatant. Booster mice are immunized every two weeks with an equivalent amount of an IL-1 inhibitor emulsified by an incomplete Freund stimulator, and serum samples are taken from the tails seven days after each booster. Antisera are tested for anti-IL-1 and activity by Western analysis of immunogen transblots, performed on polyacrylamide gel electrophoresis with sodium dodecyl sulfate, as shown in Fig.5A. Fig.5b shows that all mice produce antibodies to IL-1 and after three injections of an inhibitor of IL-1.

Since monoclonal antibodies will be of great value when cloning an IL-1 inhibitor gene from an expression library, purifying a recombinant protein of an IL-1 inhibitor, and studying molecular biology, the applicant has begun the process of manufacturing a battery of monoclonal antibodies specific for an IL-1 inhibitor. To obtain cell hybridomas, In the above mice, they are injected intravenously using the same amount of an IL-1 inhibitor in saline 24 hours before spleen removal. Splenocytes are dissected from the spleen and placed in a cold balanced salt solution (BSS), washed twice with BSS, mixed with RP myeloma cells at a ratio of 2 × 10 ⁷ RP cells per 10 ⁸ spleen cells B and twisted. Cells are synthesized by the dropwise addition of 1 ml of heated, gassed (5% CO ₂ ) PEG 6000 (40% polyethylene glycol 6000: 60% minimum support medium) to dry sediment. The synthesized cells were washed with BSS and resuspended in 10 ml of enriched medium (10% FBS) containing 2 × 10 ⁵ peritoneal cells per ml, and the pellet was carefully dispersed using a 10 ml pipette. The volume was adjusted to 20 ml by adding more peritoneal cells to the medium, and the cells were seeded in 96-well plates at a concentration of 0.1 ml / well. The tablets are placed in a gas incubator and then processed as follows:

1 day - the addition of 3 × GAT (hypoxanthine, aminopterin, thymidine) in an enriched medium to a final concentration of 1 ×

Day 5 - medium change by replacing 200 μl of 1 × GAT in an enriched medium

Day 10 - begin testing for hybrid growth. Change of medium by substitution of 200 μl of 1 × GAT in an enriched medium containing 1.5 x 10 ⁶ peritoneal cells per ml.

When the hybrid cells are almost confluent in the well, the supernatants are transferred for testing and the cells are carefully collected with a pipette tip and transferred to 1 ml culture wells containing 1 × GAT in an enriched medium and 3 × 10 ⁶ peritoneal cells per ml. The supernatant layers from the confluent wells are tested for activity against the IL-1 inhibitor using an enzyme-linked immunosorbent assay (ELISA), in which a partially purified IL-1 inhibitor (Mono Q-purified substance, which is identical to that injected into mice) is attached to the wells on a microtiter tablet. Normal mouse sera and hyperimmune antisera are used as negative and positive control substances, respectively. Positive supernatants are re-examined by ELISA on plates coated with a homogenously purified IL-1 inhibitor, as well as by immunoprecipitation of a purified metabolically labeled IL-1 inhibitor. Positive cells are then cloned, limiting dilution, and injected into pierced mice to generate ascites. Large quantities of IL-1 and specific antibodies can be obtained by tissue culture or mass generation and collection of ascitic fluid in mice. Purification of these antibodies and their attachment to insoluble granules produce affinity adsorbents for purification of the recombinant protein of the IL-1 inhibitor.

Example 5

Cloning of cDNA inhibitor of IL-1

It was shown that monocytes seeded on Petri dishes coated with immunoglobulin G and cultured for 24 hours in the presence of / ³⁵ S / -methionine produce / ³⁵ S / -IL-1i, which can be identified by its chromatographic properties on a Mono Q column .

To determine when (over a 24-hour period) IL-1i is produced to the maximum degree, the seeded monocytes expose to / ³⁵ S / -methionine (pulsed) for a short (2 hours) period, and a large excess is added during this time unlabeled methionine and incubation continue for another two hours. Then the medium is collected and analyzed for an IL-1 inhibitor labeled with a radioactive label. This technique is used for monocytes at different time intervals after inoculation on immunoglobulin G coated tablets, and it was found that monocytes exposed to / ³⁵ S / -methionine 15 hours after inoculation produce the maximum amount of IL-1- / ³⁵ S inhibitor /, which suggests that the mRNA of the IL-1 inhibitor in monocytes has a maximum level 15 hours after plating on immunoglobulin G.

Fresh monocytes are then plated on immunoglobulin G free of lipopolysaccharides, as in Example 1B. After incubation in RPM1 media for 15 hours at 37 ° C, the cells are washed with phosphate buffered saline, then lysed with 4 M guanidium thiocyanate, 25 mM sodium citrate, pH 7, 0.5% sarcolysis, 0.1 M 2-mercaptoethanol. Then, complete RNA is isolated from this lysate by the AGPC method in accordance with the work of P. Chomczynski and N. Sacchi, which is presented in the journal Analytical Biochemistry, Volume 2, pp. 156-159.

Poly A ⁺ RNAs are isolated by oligo-dT cellulose chromatography by Aviv, H. and Leader, P. (1972) Proc. Natl. Acad Sci. (USA) 69: 1408-1412, precipitated with ethanol and dissolved to a concentration of 0.36 μg / μl. 1 μg of poly A ⁺ RNA is used to obtain cDNA in accordance with the work of Gubler, U. and Haffman (1983) Gene 25: 263-169.

cDNAs are incorporated into the gt11 lambda expression library using Eco RI linkers from catalog number 988448 Behringer Mannheim or No. 1070 New England Bio Lab, as well as instructions provided by manufacturers.

The resulting library, which contains 10 ⁶ independent clones, is screened for E. coli Y1090rk ^- (Promega Biotek) with the appropriate polyclonal antibody to the IL-1 inhibitor, as described previously, using the screening conditions described by RAYoung and RWDavis / (1983) PNAS 80: 1194-1198 /. Positive signals will be determined using a biotinylated second antibody (such as goat anti-mouse immunoglobulin G, Bethesda Research Labs), followed by the addition of streptavidin-alkaline phosphatase conjugate (Bethesda Research Labs), as described by Bayer, EA and Wilchek, M. (1979) Methods in Biochemical, as well as Guesdon, JLTernynch. T. and Cevrameas, S. (1979) 27: 1151-1158, and also in accordance with manufacturers instructions.

Example 6

Obtaining and sequencing of the gene encoding IL-1i

The cDNA obtained in accordance with Example 5 is incorporated into the GT10 lambda cloning vector. This cDNA is first methylated using EcoRI methylase using s-adenosyl methionine as a substrate, EcoRI linkers are attached to the ligation reaction, and excess linkers are removed by digestion with EcoP endonuclease and chromatography on a CL6B spin column. A ligation reaction was carried out containing 0.124 μg of linkers selected by cDNA size and 1 μg of EcoRI-cut and phosphatase-treated lambda vector GT10, and the products of this ligation reaction were densified using GIGAPACK GOLD (Stratagen) sealing extracts. A library of 1 × 10 ⁷ members is obtained.

For the purpose of screening this GT10 library, oligonucleotide (antisense) probes are synthesized based on the protein and peptide sequence shown in Example 3. The probe sequences and their corresponding peptide sequence are as follows:

Probe No. IL1i1-3 ³² P-phosphorylate at its 5'-end and used for screening 3 × 10 ⁵ plaques of the library. The probe hybridizes reproductively to three plaques, and one of them also hybridizes to probe No. IL1i1-4. This plaque, GT10-IL1i-2A, is cultured and DNA is isolated using Lainbasorb (Promega) in accordance with the manufacturer's instructions. GT10-IL1i-2A is deposited with the American Type Culture Collection (ATCC), Rockville, Maryland, under custody number 40488. DNA is digested using EcoRI, divided into five equal aliquots and subjected to electrophoresis on a 1% agarose gel.

After electrophoresis, this gel is stained with ethidium bromide. A photograph of this gel is shown in Fig. 12a. Lanes 6, 8, 10, 12, and 14 contain five aliquots from EcoRI digestion. Lane 5 contains a mixture of wild-type lambda DNA cut with Mind III and X174 RF DNA cut with HaeIII (New England Biolabs), which are useful as molecular markers, i.e. molecular weight markers. Figure 12a shows that GT10-IL1i-2A contains an EcoRI fragment having a length of 1850 base pairs. In order to demonstrate more clearly that this 1850 bp the fragment carries the coding sequence for the inhibitor of IL-1, carry out Southern blotting as follows. The DNA fragments in the gel shown in Fig. 12a are blotted on nitrocellulose using standard methods. Nitrocellulose is then cut into five strips so that each strip contains DNA from lanes 6, 8, 10, 12 and 14. Then the strips are separately hybridized to each of the five oligonucleotide probes (above) that are labeled from the 5'-end of ³² P phosphate. The oligonucleotide concentration is 1 pmol / ml, and the hybridization temperature is as follows.

TRACK PROBE TEMPERATURE 6 No. IL1i1-3 35 ° C 8 No. IL1i1-4 42 ° C 10 No. IL1i1-5 42 ° C 12 No. IL1i1-6 40 ° C fourteen No. IL1i1-7 35 ° C

After washing, the strips are aligned and bonded to one another in order to re-form the original nitrocellulose sheet. The sheet is autoradiographed in the presence of a reinforcing screen at a temperature of -70 ° C for 24 hours. 12 is a photograph of this autoradiography. It shows that all probes hybridize specifically to a fragment of 1850 base pairs in length, ensuring that this fragment carries an essential coding sequence for an IL-1 inhibitor.

To determine the DNA sequence, GT10-Il1i-2A DNA was digested with EcoRI, subjected to electrophoresis on a 1% agarose gel, and a fragment of 1850 base pairs was isolated. This fragment is ligated with EcoRI-digested M13 mp19 and transformed into E. coli strain JM109. Transformers are screened for those that do not have beta-galactosidase activity. Five such transformers are isolated, single-stranded DNA is obtained, and sequencing is performed according to the method of Sanger et al. The DNA sequence of three transformers corresponds to the 3'-end of the mRNA, while two transformers result in a protein coding sequence. 13 shows the DNA sequence that is obtained for the protein coding region of the cDNA.

13 also shows the predicted amino acid sequence. The amino acid sequence from the first amino acid Alanine to 29 amino acids Proline and from 79 amino acids Isoleucine to the end is a hypothetical amino acid sequence. The predicted amino acid sequence from 30 amino acids of Proline to 78 amino acids of Proline is consistent with the peptide sequences described in Example 3.

Example 7

Sequencing of GT10-IL-1i-2A and IL-1i

A portion of GT10-IL1i-2A is sequenced and shown in FIG. DNA encodes a protein containing amino acid sequences that are hallmarks of an IL-1 inhibitor (nucleotides 99-557). However, it is believed that several modifications of it can be carried out before secretion of the protein into the extracellular medium. These modifications may or may not be significant for the protein so that it has activity as an inhibitor of IL-1.

GT10-IL1i-2A encodes at least 32 amino acids, N-terminal (nucleotides 3-98) to the amino terminus of that form of the IL-1 inhibitor, which is known as X. It is believed that there is a secretory leader sequence in these 32 amino acids, which begins at M, encoded by nucleotides 24-26, directs the nascent IL-1 inhibitor to extracellular medium, and then is removed by leader peptidase, and possibly other peptidases. Currently, the extent to which this sequence is deleted in the forms of the alpha and beta inhibitors of IL-1 is unknown, but the N-terminus of these forms is supposed to be close to the N-terminus of form X. Removing the secretory leader sequence is probably necessary so that the protein has an effective activity of an inhibitor of IL-1.

Nucleotides 349-351 GT10-IL1i-2A encode an N-residue that is part of a coordinated N-glycosylation site. Based on their susceptibility to N-glycanase digestion, it is believed that the alpha and beta forms of the IL-1 inhibitor are glycosylated. Since form X is not sensitive to digestion by this enzyme, it is believed that it is not glycosylated, although it remains possible that this can happen, and a specialist can easily demonstrate this by protein sequencing, taking into account the information given here. It is believed that glycosylation in this N-residue is not required for a protein exhibiting effective IL-1 inhibitor activity.

Nucleotides 99-101 GT10-IL1 and 2A encode P (see FIG. 15), however, no P was detected at this position (N-terminus) of form X of the IL-1 inhibitor. It is possible that this residue is modified in a mature protein. It is believed that the modification of this residue is not an essential step with respect to the effective activity of the IL-1 inhibitor.

The currently unknown N-terminal residues of the alpha and beta forms cannot be detected completely by Edman cleavage and, in all likelihood, they are modified following the removal of some of the N-terminal residues of the protein encoded by GT10-IL1i-2A. It is believed that this modification is not essential for the effective activity of the IL-1 inhibitor.

Example 8

Expression of genes encoding an interleukin 1 inhibitor in animal cells

The expression of animal cells of the IL-1 inhibitor involves the following stages:

but. Construction of an Expression Vector

. Host cell line selection

from. Introduction of the expression vector into host cells

Manipulation of recombinant host cells with increased levels of expression of an interleukin inhibitor 1

1. The expression vectors of the IL-1 inhibitor, intended for use in animal cells, may include several types, such as strong constitutive expression constructs, inducible gene constructs, as well as those designed for expression in certain cell types. In all cases, promoters and other gene regulatory regions, such as enhancers (inducible or not) and polyadenylation signals, are placed in the corresponding position relative to the cDNA sequences of plasmid-based vectors. The following are two examples of such constructs: (1) A construct using a strong constitutive promoter should be made using the control signals of the gene for the vacuolating monkey 40 virus (OB-40) in the order found in plasmid p SV2CAT described by Gorman et al. Mol. Cel. Biol 2: 1044-1051, 1982. Such a plasmid must be manipulated so as to replace the cDNA of the IL-1 inhibitor with coding sequences of chloramphenicol acyltransferase (CAT) using standard molecular biology techniques (Maniatis et al., Above), as shown in Fig.6. (2) The construction of inducible genes should be made using the plasmid RJ, which contains the region of the mouse metallothionein promoter (MT-1) (Brinster et al., Cell 27: 228-231, 1981). This plasmid can be used as starting material, and it must be manipulated, as shown in Fig. 7, to obtain a metal-induced gene construct.

2. A number of animal cell lines can be used to express an IL-1 inhibitor using the vectors described above to produce the active protein. Two potential cell lines that are well characterized by their ability to promote the expression of foreign genes are Ltk ^- mouse cells and Chinese hamster ovary dhfr cells (CHO), although the expression of the IL-1 inhibitor is not limited to these cell lines.

3. Vector DNA must be introduced into these cell lines using a variety of gene transfer techniques. The method used here includes the calcium phosphate DNA precipitation technique described by SLGraham & AS van der Eb (Virology) 52: 456-4670 (1973), wherein the expression vector for the IL-1 inhibitor is co-precipitated with a second expression vector encoding a selectable marker . In the case of Ltk cell transfection, the thymidine kinase gene ^{is a} selectable marker, and selection is carried out as described by Wigler et al. (Cell 16: 777-785, 1979), and in the case of CHO dhfr cells ^{, the} selectable marker is dihydrofol treductase (DHFR), the selection of which is described in Ringold et al. J. Mol. Ap. Gen. 1: 155-175, 1981.

4. Cells expressing the IL-1 inhibitor gene should be grown under conditions that increase the levels of IL-1 inhibitor production. Cells bearing the structures of the metallothionein promoter can now be grown in the presence of heavy metals such as cadmium, which lead to a 5-fold increase in the level of the MT-1 promoter used (Mayo et al., Cell 29: 99-108), subsequently leading to an increase protein levels of the IL-1 inhibitor. Cells containing IL-1 inhibitor expression vectors (either OB-40 or MT-1) together with a DHFR expression vector can be taken from the gene amplification protocol described by Ringold et al. (J. Mol. Appl. Genet 1: 165-175, 1981) using mototrexate, a competitive dihydrofolate reductase antagonist. This leads to a greater number of copies of DHFR genes present in the cells, as well as an increased number of copies of the IL-1 inhibitor genes, which, in turn, lead to the production of more IL-1 inhibitor protein produced by the cells.

Example 9

Purification of an IL-1 Inhibitor from Renombinant Animal Cells

Since the IL-1 inhibitor is secreted from cells as a natural substance, it is expected that the methods described above for the purification of a natural protein allow for the similar purification and characterization of a recombinant protein.

Example 10

The sequence of the inhibitor of IL-1

The amino-terminal residue of the IL-1 inhibitor was identified several times by direct protein sequencing as arginine. The result of such sequencing is shown in Example 3. In contrast, the amino-terminal residue of the IL-1 inhibitor predicted by the cDNA sequence is proline (P). This amino terminal residue corresponds to nucleotides 85-87 in Fig. 13 and is surrounded by a ring in Figs. 14 and 15. This apparent mismatch between the cDNA sequence and the direct protein sequence can be resolved by assuming that the error in the cDNA sequence was incorporated during the synthesis, catalyzed by reverse transcriptase from mRNA. That is, the CGA codon (arginine) located on the mRNA, where it could encode the given amino-terminal residue, could be changed during the reverse transcriptase reaction to the CCA codon (proline) in the cDNA. This type of problem with respect to reverse transcriptase has been described previously in the literature, for example, by B. D. Clark et al., Nucleric Acids Research 14: 7897 (1986).

The Applicant believes that the correct amino acid sequence of the protein is that predicted by the cDNA, except that the amino terminal amino acid is arginine instead of the proline residue indicated in FIGS. 13-15. The Applicant suggests that both DNA sequences and their corresponding peptide sequences fall within the scope of the present invention, although the amino terminal arginine sequence is still preferred.

Example 11

A protein having the sequence of:

where X is cysteine, serine or alanine, and Z is arginine or proline.

Claims (21)

1. An isolated DNA molecule encoding an interleukin-1 inhibitor precursor polypeptide (IL-li) containing a nucleotide sequence comprising a) a nucleotide sequence encoding an N-terminal leader sequence that secures the secretion of active IL-li by a cell, and b) a nucleotide the sequence encoding mature IL-li with the amino acid sequence (X) P S G R K S S K M Q A F R I W D V N Q K T F Y L R N N Q L V A G Y L Q G P N V N L E E K I D V V P I E P H A L F L G I H G G K M C L S C V K S G D E T R L Q L E A V N I T D L S E N R K Q D K R F A F I R S D S G P T T S F E S A A C P G W F L C T A M E A D Q P V S L T N M P D E G V M V T K F Y F Q E D E, where X is R or P; its fragment or homolog retaining the property to inhibit the activity of interleukin-1. 2. The selected DNA molecule according to claim 1, where the nucleotide sequence b) encodes a mature IL-li with the amino acid sequence (X) P S G R K S S K M Q A F R I W D V N Q K T F Y L R N N Q L V A G Y L Q G P N V N L E E K I D V V P I E P H A L F L G I H G G K M C L S C V K S G D E T R L Q L E A V N I T D L S E N R K Q D K R F A F I R S D S G P T T S F E S A A C P G W F L C T A M E A D Q P V S L T N M P D E G V M V T K F Y F Q E D E, where X is R or R. 3. A recombinant expression vector containing a regulatory element operably linked to a DNA molecule according to claim 1 or 2, necessary for expression of the DNA molecule in a host cell capable of cleaving a signal peptide that is part of the product synthesized by the cell. 4. The vector according to claim 3, characterized in that the host cell is a bacterial or mammalian cell. 5. A method of obtaining a biologically active inhibitor of interleukin-1 (IL-li), comprising the following operations: a) transforming a suitable host cell with the recombinant expression vector according to claim 3; b) growing a transformed cell under conditions that ensure the expression of the DNA molecule contained in the vector, and the secretion of active IL-li and c) isolation of the final product from the culture medium. 6. The method according to claim 5, characterized in that the recombinant expression vector contains a promoter other than the promoter of a natural inhibitor of IL-1, operatively linked to a DNA molecule according to claim 1. 7. The precursor polypeptide of the active secreted form of an interleukin-1 inhibitor (IL-li) having the amino acid sequence shown in FIG. 14, wherein the amino acid residue corresponding to codon 99-101 is arginine or proline. 8. Biologically active inhibitor of interleukin-1 produced by a recombinant host cell having the amino acid sequence (X) P S G R K S S K M Q A F R I W D V N Q K T F Y L R N N Q L V A G Y L Q G P N V N L E E K I D V V P I E P H A L F L G I H G G K M C L S C V K S G D E T R L Q L E A V N I T D L S E N R K Q D K R F A F I R S D S G P T T S F E S A A C P G W F L C T A M E A D Q P V S L T N M P D E G V M V T K F Y F Q E D E, where X is R or P; its fragment or homolog retaining the property to inhibit the activity of interleukin-1. 9. The interleukin-1 inhibitor of claim 8, having an amino acid sequence (X) P S G R K S S K M Q A F R I W D V N Q K T F Y L R N N Q L V A G Y L Q G P N V N L E E K I D V V P I E P H A L F L G I H G G K M C L S C V K S G D E T R L Q L E A V N I T D L S E N R K Q D K R F A F I R S D S G P T T S F E S A A C P G W F L C T A M E A D Q P V S L T N M P D E G V M V T K F Y F Q E D E, where X is R or R. 10. An interleukin-1 inhibitor according to claim 8 or 9, characterized in that the host cell is a bacterial cell. 11. The interleukin-1 inhibitor of claim 10, wherein the host cell is an Escherichia coli cell. 12. An interleukin-1 inhibitor according to claim 8 or 9, characterized in that the host cell is a mammalian cell. 13. The interleukin-1 inhibitor of claim 12, wherein the host cell is a CHO cell. 14. An interleukin-1 inhibitor according to any one of claims 8 to 13, characterized in that it has a glycosylation type different from the glycosylation type of human urinary IL-li, or is non-glycosylated. 15. A DNA molecule encoding an interleukin-1 inhibitor having a nucleotide sequence corresponding to the amino acid sequence of an IL-1 inhibitor, a fragment thereof or a homologue of claim 8. 16. The DNA molecule according to clause 15, the nucleotide sequence of which corresponds to the amino acid sequence (X) P S G R K S S K M Q A F R I W D V N Q K T F Y L R N N Q L V A G Y L Q G P N V N L E E K I D V V P I E P H A L F L G I H G G K M C L S C V K S G D E T R L Q L E A V N I T D L S E N R K Q D K R F A F I R S D S G R T T S F E S A A C P G W F L C T A M E A D Q P V S L T N M P D E G V M V T K F Y F Q E D E, where X is R or R. 17. A recombinant expression vector containing a regulatory element operably linked to a DNA molecule according to claim 15 or 16 and necessary for expression of the indicated molecule in the host cell. 18. The vector according to 17, characterized in that the host cell is a bacterial or mammalian cell. 19. A method for producing an interleukin-1 inhibitor, comprising transforming an animal cell with the recombinant expression vector according to claim 17, growing the transformed cell under conditions that allow expression of the DNA molecule contained in the vector, and isolating the final product. 20. The method according to claim 19, wherein the interleukin-1 inhibitor has a glycosylation type different from the glycosylation type of human urinary IL-li, or is non-glycosylated. 21. The method according to claim 19, wherein the recombinant expression vector has a promoter other than the natural IL-1 inhibitor promoter operably linked to a DNA molecule according to claim 15.

Images