IE19950317A1 - Interleukin-1 inhibitors - Google Patents

Description

INTERLEUKIN—1 INHIBITORS SYNERGEN, INC.

This invention relates to Interleukin-l inhibitors.

Interleukins-1 are a class of proteins produced by numerous cell-types, including monocytes and some macrophages. This class includes at least two l7-16 kilodalton proteins known as interleukin-1 alpha and interleukin-1 beta. These proteins have important physiological effects on a number of different target cells involved in the inflammatory and immune responses. The proteins are co-mitogens (with phytohemaglutinin) for T-cells, cause both fibroblasts and chondrocytes to secrete latent col- lagenase, and increase the surface adhesive powers of endothelial cells for neutrophils. In addition, they act on the hypothalamus as pyrogens, they stimulate the catabolism of muscle protein, and they cause hepatocytes to synthesize a class of proteins known as "acute phase reactants." Thus, interleukins-l (IL-1) are obvi- ously an important part of an organism's response to infection and injury.

. Patholooical Roles of IL-1 However, despite their normally beneficial effects. circum- stances have come to light in which the actions of IL-1 are harm- ful. For example, IL-l may increase the level of collagenase in an arthritic joint and has been implicated as a mediator of both: the acute and chronic stages of immunopathology in rheumatoid arthritis. IL-l may be responsible for altering endothelial cell function, directing the chemotaxis and migration of leukocytes and lymphocytes into the synovial tissue, inducing capillary proliferation, and stimulating macrophage accumulation in the synovial lining during the acute phase of this disease. In the phase of tissue destruction, IL-1 has been implicated as a media- tor in induction of tissue damage through stimulating release of enzymes from fibroblasts and chondrocytes.

In addition, excessive IL-1 production has been demonstrated in the skin of patients with psoriasis and high levels of IL-1 can be found in the synovial fluid of patients with psoriatic arthritis. IL-1 released by cells in the inflamed synovium in psoriatic arthritis may mediate tissue destruction through stimu- lation of enzyme release from other cells. The joint pathology of Reiter's syhdrome is similar to that seen in psoriatic arthri- tis and in rheumatoid arthritis. IL-1 has been implicated as a mediator of tissue destruction in these three different forms of inflammatory arthritis. Moreover, IL-l may be found in the synovial fluid of patients with osteoarthritis. The release of IL-1 by chondrocytes has been implicated in the destruction of articular cartilage in this disease.

IL-1 may also increase the severity of autoimmune diseases.

For example, decreased IL-1 production has been described from peripheral blood cells in persons suffering from systemic lupus |E950317 erythematosus. Moreover, some of the alterations in B lymphocyte function may be related to abnormalities in IL-1 production or IL-1 availability.

Excessive IL-1 production has been demonstrated in the pe- ripheral monocytes of patients with scleroderma, and IL-1 has been implicated as a possible agent of fibrosis through stimula- tion of collagen production by fibroblasts. The mechanism of tissue damage in dermatomyositis might also involve cell-mediated immunity and IL-1 may therefore be involved as a mediator in this pathophysiological process.

Acute and chronic interstitial lung disease is characterized by excessive collagen production by lung fibroblasts which may be stimulated by IL-1. Recent studies on an animal model of pulmo- nary hypertension indicate that IL-1 may be responsible for in- duction of endothelial cell changes that result in narrowing of pulmonary arteries. It is this narrowing that leads to pulmonary hypertension and further secondary damage. Thus, IL-l inhibitors could be useful in treating these lung diseases.

Recent studies have described that IL-1 is capable of directly damaging the beta cells in the Islets of Langerhans that are responsible for the production of insulin. IL-l damage to the cells is now hypothesized to be a primary event in the acute phase of juvenile diabetes mellitus.

Monocyte and macrophage infiltration in the kidneys predomi- nates in many forms of acute and chronic glomerulonephritis.

IL-1 release by these cells may result in local accumulation of lE950317 other inflammatory cells, eventually leading to inflammatory dam- age and fibrotic reaction in the kidneys.

It has been demonstrated that the crystals found in tissues or fluids in gout or pseudogout can directly stimulate macrophages to release IL-l. Thus, IL-l may be an important me- diator in the inflammatory cycle in these diseases.

IL-1 is capable of inducing loss of calcium from bones and may be responsible for the osteoporosis that is seen in inflamma- tory joint diseases.

Keratinocytes from patients with psoriasis release large amounts of IL-1. This mediator may be responsible for the sec- ondary cell proliferation and accumulation which occurs in the skin in patients with this disease.

IL-1 is one of the important endogenous pyrogens and may be responsible for inducing the marked degree of fever seen in some infectious diseases such as acute febrile illnesses due to bacte- ria or viruses.

Sarcoidosis is characterized by granulomatous lesions in many different organs in the body. IL-1 has been shown to be capable of inducing granuloma formation ig_gi;;g and may be in- volved in this process in patients with sarcoidosis.

Excessive IL-1 production has been demonstrated in peripher- al monocytes from both Crohn's disease and ulcerative colitis.

Local IL-1 release in the intestine may be an important mediator in stimulating the inflammatory cycle in these diseases.

!E950317 Certain lymphomas are characterized by fever, osteoporosis and even secondary arthritis. Excessive IL-1 release has been demonstrated by some lymphoma cells in vitro and may be responsi— ble for some of the clinical manifestations of these ma- lignancies. Also, IL-1 production by some malignant lymphocytes may be responsible for some of the fever, acute phase response and cachexia seen with leukemias.

IL-l release by astrocytes in the brain is thought to be re- sponsible for inducing the fibrosis that may result after damage to the brain from vascular occlusion.

C. Uses for an I;-1 Inhibitor In these and other circumstances in which IL-1 has a harmful effect, there is clearly a clinical use for an lnnlbltur of 13-1 action. As IL-1 is a co-mitogen for T-cells, it is central to the development of autoimmune and other immune diseases. Thus, systemically administered, IL-l inhibitors could be useful immunosuppressive agents. Locally applied, such IL-l inhibitors could serve to prevent tissue destruction in an inflamed joint and other sites of inflammation. Indeed, to prevent tissue destruction some IL-l inhibitors could be even more effective when administered in conjunction with collagenase inhibitors.

Therapeutic intervention against the action of IL-1 might be possible at the level of synthesis, secretion, or the target cell's binding or response to the protein. IL-1 is synthesized by monocyte/macrophages and other cells in response to lipopolysaccharides, complement fragments and viruses. Any $950317 molecule that blocks binding of these inducing agents to producer cells or which interferes with their effects on the physiology of these cells would serve as a regulator of IL-1 action. IL-1 is not secreted by a traditional secretion system since mRNAs have been isolated that code for at least two 30 kd precursors of the proteins but which do not contain a hydrophobic signal sequence.

Release of the active protein from the inactive precursor proba- bly requires proteolysis of that precursor. An inhibitor of the release of IL~l or IL-ls from their precursors could theoreti- cally regulate IL-l action. IL-l probably acts on target cells through a classical receptor-mediated pathway, although that receptor has not yet been isolated. Thus, it could be that a molecule that interferes with IL-1 binding to its receptors, or down-regulates these receptors, could also regulate IL-1 action.

Moreover, although the intracellular events following receptor binding of IL-1 are not yet fully understood, it is possible that agents exist that can interfere with the cellular responses to other receptor-mediated events and therefore block IL-1 action.

For the reasons stated above, proteins and small molecules capa- ble of inhibiting IL-1 in one or more of these manners have been sought.

Surprisingly, the present inventors have found at least two IL-1 inhibitor proteins with IL-1 inhibiting properties. These molecules have been obtained in a purified form which will enable one of ordinary skill in the art to determine their amino acid sequence. Furthermore, a preparation of cells has been [E95031] characterized which produce these proteins, and an mRNA that leads to its synthesis has been characterized. Finally, an antisera has been developed that will facilitate screening of cDNA expression libraries for the genes coding for these inhib- itors. Together these reagents will allow cDNAs encoding the IL-1 inhibitors to be cloned. These genes will, in turn, make possible the large scale production of IL-1 inhibitors suitable for use in pharmaceutical formulations useful in treating pathophysicological conditions mediated by IL-1.

Summary of the Invention This invention relates to IL-1 inhibitors (‘IL-li") gener- ally and, more specifically, to a monocyte-derived IL-l inhib- itor. Additionally, the present invention relates to biologically-active analogs of these inhibitors.

An object of the present invention is to provide purified forms of IL-1 inhibitors which are active against IL-la or IL-18 or a combination thereof. An additional object of the present invention is to provide these inhibitors in purified forms to enable the determination of their amino acid sequence. A further object is to provide the amino acid sequences of certain IL-1 in- hibitors. Furthermore, the identification of biologically-active analogs of such IL-1 inhibitors with enhanced or equivalent prop- erties is also one of the objects of the invention.

Additionally, it is an object of this invention to provide a recombinant-DNA system for the production of the IL-1 inhibitors described herein. A further object of the present invention lE950317 includes providing purified forms of IL-1 inhibitors which vould be valuable as pharmaceutical preparations exhibiting activity against IL-l.

Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description or may be learned from the practice of the invention. The objects and advantages may be re- alized and attained by means of the instrumentalities and combi- nations particularly pointed out in the appended claims.

To achieve the objects and in accordance with the purposes of the present invention, IL-l inhibitors are disclosed which exhibit inhibitory activity against IL-l. The preferred inhib- itors have been isolated in a purified form from monocyte-conditioned medium with monocytes grown on IgG-coated plates.

Preferred inhibitors of the present invention are l, 2 and 3. Inhibitors l and 2 are proteins running at positions charac- teristic of 22-23 kDa proteins on SDS-PAGE and eluting at 52 mM and 60 mM Nacl, respectively, from a Mono Q FPLC column under specified conditions. Inhibitor 3 is a protein running at a position characteristic of a 20kD protein on SDS-PAGE and eluting at 48 mM Nacl from a Mono Q FPLC column under the specified con- ditions. Additionally, to achieve the objects and in accordance with the purposes of the present invention, pharmaceutical compo- sitions containing, at least one of the active ingredients, an IL-l inhibitor in accordance with the present invention or its biologically-active analog as set forth herein are disclosed.

Moreover, to achieve the objects and in accordance with the purposes of the present invention. a recombinant-DNA system for the creation of these IL-l inhibitors and their analogs is also disclosed. A preferred embodiment of this system includes at least one CDNA clone or its synthetic equivalent encoding at least one IL-l inhibitor along with vectors and cells constituting an expression system capable of expressing the IL-1 inhibitors disclosed herein. Antisera for use in identifying these CDNA clones is also provided. Expression systems for pro- ducing these IL-l inhibitors using these cDNA clones, their analogs, or other DNA sequences encoding these inhibitors are also provided.

Brief Description of the Figures Figures la and lb depict the protein profile of the Mono Q chromatography of two metabolically-labelled monocyte su- pernatants. The cells were cultured on IgG (la) or fetal calf serum (lb) coated plates.

Figure 2a shows silver stained gels of fractions from the regions indicated in Figures la and lb.

Figure 2b is an autoradiogram of the gels shown in Figure 2a.

Figures 3a, b and c present data on the purified IL-li of Example 1. Figure 3a presents chromatography data with the ra- dioactivity pattern superimposed. Figure 3b presents silver stained gels run on samples of the fractions indicated in Figure a. Figure 3c presents autoradiograms of the gels in Figure 3b.

E95031? Figures 4a and b present the results of gel filtration chromatograms of Mono Q-purified IL-li.

Figures 5a and b present Western analysis of mouse antisera.

Figure 6 depicts the construction of plasmid pSvXvPL2lL-li.

Figure 7 depicts the construction of plasmid pMK-SGE:IL-li.

Figures 8a-d present data on IL-li-a. Figures 8a and 8b present chromatography data. Figure 8c presents a silver stained gel run on samples of fractions indicated in figure 8b. Figure 8d presents an autoradiogram.

Figures 9a and 9b present data on IL-li-B. Figure 9a pres- ents chromatography data. Figure 9b presents SDS-PAGE data.

Figure 10 presents data of IL-li-d peptide separation.

Figure 11 presents data of IL-li-B peptide separation.

Figure 12b presents data of an auzoradiogram of a Southern blot of the gel shown in Figure 12a.

Figure 13 depicts a part of the DNA sequence of the protein coding region of lambda GT10-IL1i-2A and the predicted amino acid sequence according to Example 6.

Figure 14 depicts the nucleotide sequence of GTIO-illI-2A.

Figure 15 depicts a peptide including, inter alia, an IL-li sequence and a secretory leader sequence. ggscription of the Preferred Embodiment Reference will now be made in detail to the presently pre- ferred embodiments of the invention, which, together with the !!) following examples, serve to explain the principles of the inven- tion.

A. Inhibitor from Human Monocvtes As noted above, the present invention relates to IL-1 inhib- itors which have been isolated in a purified form. Preferably, the IL-1 inhibitors of the present invention are derived from human monocyte conditioned medium where the monocytes are grown on IgG coated vessels. In addition, the invention encompasses substantially purified IL-l inhibitors of any origin which are biologically equivalent to the inhibitor derived from human monocyte-contained medium.

By "biologically equivalent," as used throughout the speci- fication and claims, we mean compositions of the present inven- tion that are capable of preventing IL-1 action in a similar fashion, but not necessarily to the same degree, as the native IL-1 inhibitor isolated from monocytes. By "substantially homol- ogous‘ as used throughout the ensuing specification and claims, is meant a degree of homology to the native IL-1 inhibitor iso- lated from monocyte-conditioned medium in excess of that dis- played by any previously rcoorted IL-l inhibitors. Preferably, the degree of homology in excess of 70 percent, more preferably in excess of 80 percent and even more preferably in excess of 90 per cent. A particularly preferred group of inhibitors are in excess of 95 percent homologous with the native inhibitor. The percentage of homology as described is calculated as the percent- age of amino acid residues found in the smaller of the two sequences that align with identical amino acid residues in the sequence being compared when four gaps in a length of 100 amino acids may be introduced to assist in that alignment as set forth by Dayhoff, M.D. in Atlas of Protein Sequence and Structure Vol.5, p. 124 (1972), National Biochemical Research Foundation, Washington, D.C., specifically incorporated herein by reference.

The preferred IL-1 inhibitors of the present invention have been derived from monocyte-conditioned medium and, for the first time, have been isolated in a purified form. For the purposes of the present application, "pure form" or "purified form" when used to refer to the IL-1 inhibitors disclosed herein, shall mean a preparation which is substantially free of other proteins which are not IL-1 inhibitor proteins. Preferrably, the IL-1 inhib- itors of the present invention are at least 90% pure and prefer- ably 95% pure.

At least three purified IL-l inhibitors have been isolated by the methods of the Example. These include inhibitor 1, inhib- itor 2 and inhibitor 3. Inhibitor l is behaving as a 22-23 kDa molecule on SDS-PAGE with an approximate isoelectric point of 4.8 and eluting from a Mono:Q FPLC column at around 52 mM Nacl in Tris buffer, pH 7.6. Inhibitor 2 is also a 22-23 kDa protein, pI-4.8, but eluting from a Mono Q column at 60 mM Nacl. Inhib- itor 3 is a 20kDa protein and elutes from a Mono Q column at 48 mM Nacl. Inhibitors 1, 2 and 3 are related immumologically and functionally. Having obtained these inhibitors in purified forms has enabled the present inventors to obtain their amino acid IE950317. sequences. Using the purified inhibitors disclosed for the first time herein and methods such as those described in and by ABI Protein Sequencer technical manuals supplied with the AB: Protein Sequencer, a substantial proportion of the amino acid sequences of these inhibitors can be deduced.

Example 3 shows amino acid sequence data obtained of three species of IL-1 inhibitors, namely IL-li-X, IL-li-o and [L-lg-3.

The present inventors have discovered at least one antibody raised against an IL-1 inhibitor. other polyclonal and monoclonal antibodies against this and other IL-1 inhibitors may be prepared by methods known to those of ordinary skill in the art. One particular polyclonal antibody is described in Example 4.

B. Recombinant Inhibitor 1. General A recombinant DNA method for the manufacture of an IL-1 inhibitor is now disclosed. In one embodiment of the invention, the active site functions in a manner biologically equivalent to that of the native IL-1 inhibitor isolated from human. A natural or synthetic DNA sequence may be used to direct production of the IL-1 inhibitors» This method comprises: (a) Preparation of a DNA sequence capable of directing a host cell to produce a protein having IL-1 inhibitor activity; (b) Cloning the DNA sequence into a vector capable of being transferred into and replicated in a host cell, such E9503-1.7 vector containing operational elements needed to express the DNA sequence: (C) Transferring the vector containing the synthetic DNA sequence and operational elements into a host cell capa- ble of expressing the DNA encoding IL-1 inhibitor; (d) Culturing the host cells under conditions appro- priate for amplification of the vector and expression of the inhibitor; (e) Harvesting the inhibitor; and (f) Permitting the inhibitor to assume an active ter- tiary structure whereby it possesses IL-l inhibitory activ- ity.

. DNA Seguences DNA sequences contemplated for use in this method are discussed in part in Example 5 and in part in Example 6. It is contemplated that these sequences include synthetic and natural EDNA sequences. The natural sequences further include cDNA or genomic DNA segments.

Example 6 provides a molecular clone of DNA encoding a pro- carries the coding sequence for ILl inhibitor. Figure l3 shows E950317 In light of the teachings contained herein and procedures known, other synthetic polynucleotide sequences will be available :0 one of ordinary skill in the art. As an example of the cur- rent state of the art relating to polynucleotide synthesis, one is directed to Matteucci, M.D. and Caruthers, M.H., in J. Am.

Chem. Soc. l03:3l8S (1981) and Beaucage, S.L. and Caruthers, M.H. in Tetrahedron Lett. 22:l8S9 (1981), and to the instructions supplied with an ABI oligonucleotide synthesizer, each of which is specifically incorporated herein by reference.

These synthetic sequences may be identical to the natural sequences described in more detail below or they may contain difs ferent nucleotides. In one embodiment, if the synthetic se- quences contain nucleotides different from those found in the natural DNA sequences of this invention, it is contemplated that these different sequences will still encode a polypeptide which has the same primary structure as IL—li isolated from monocytes.

In an alternate embodiment, the synthetic sequence containing different nucleotides will encode a polypeptide which has the same biological activity as the IL-li described herein.

Additionally, the DNA sequence may be a fragment of a natu- ral sequence, i.e., a fragment of a polynucleotide which occurred in nature and which has been isolated and purified for the first time by the present inventors. In one embodiment, the DNA se- quence is a restriction fragment isolated from a cDNA library.

In an alternative embodiment, the DNA sequence is isolated from a human genomic library. .An example of such a library $950317 useful in this embodiment is set forth by Lawn et al. in cell l5:ll57-ll74 (1978), specifically incorporated herein by refer- ERCE.

In a preferred version of this embodiment, it is contem- plated that the natural DNA sequence will be obtained by a method comprising: (a) Preparation of a human cDNA library from cells, preferably monocytes, capable of generating an IL-l inhib- itor in a vector and cell capable of amplifying and expressing all or part of that cDNA; (b) Probing the human DNA library with at least one probe capable of binding to the IL-1 inhibitor gene or its protein product; (c) Identifying at least one clone containing the gene coding for the inhibitor by virtue of the ability of the clone to bind at least one probe for the gene or its protein product: (d) Isolation of the gene or portion of the gene coding for the inhibitor from the clone or clones chosen: (2) Linking the gene, or suitable fragments thereof, to operational elements necessary to maintain and express the gene in a host cell.

The natural DNA sequences useful in the foregoing process may also be identified and isolated through a method comprising: (a) Preparation of a human genomic DNA library, pref- erably propagated in a recA;gg8C E. coli host; (b) Probing the human genomic DNA library with at least one probe capable of binding to an IL-l inhibitor gene or its protein product; (c) Identification of at least one clone containing the gene coding for the inhibitor by virtue of the ability of the clone to bind at least one probe for the gene or its protein product; id) Isolation of the gene coding for the inhibitor from the clone(s) identified; and (e) Linking the gene, or suitable fragments thereof, to operational elements necessary to maintain and express the gene in a host cell.

In isolating a natural DNA sequence suitable for use in the above-method, it is preferred to identify the two restriction sites located within and closest to the end portions of the appropriate gene or sections of the gene. The DNA segment con- taining the appropriate gene is then removed from the remainder of the genomic material using appropriate restriction endo- nucleases. After excision, the 3' and 5' ends of the DNA se- quence and any exon junctions are reconstructed to provide appro- priate DNA sequences capable of coding for the N- and C- termini of the IL-1 inhibitor protein and capable of fusing the DNA se- quence to its operational elements. . (a) V€CtOl'S Microorqanisms, especially E. coli The vectors contemplated for use in the present inven- tion include any vectors into which a DNA sequence as discussed above can be inserted, along with any preferred or required oper- tional elements, and which vector can then be subsequently transferred into a host cell and replicated in such cell. Pre- ferred vectors are those whose restriction sites have been well documented and which contain the operational elements preferred or required for transcription of the DNA sequence. However, cer- tain embodiments of the present invention are also envisioned which employ currently undiscovered vectors which would contain one or more of the CDNA sequences described herein. In particu- lar, it is preferred that all of these vectors have some or all of the following characteristics: (1) possess a minimal number of host-organism sequences; (2) be stably maintained and propa- gated in the desired host; (3) be capable of being present in a high copy number in the desired host; (4) possess a regulatable promoter positioned so as to promote transcription of the gene of interest: (5) have at least one marker DNA sequence coding for a selectable trait present on a portion of the plasmid separate from that where the DNA sequence will be inserted: and (6) a DNA sequence capable of terminating transcription.

In various preferred embodiments, these cloning vectors con- taining and capable of expressing the DNA sequences of the pres- ent invention contain various operational elements. These "oper- ational elements," as discussed herein, include at least one promoter, at least one Shine-Dalgarno sequence and initiator codon, and at least one terminator codon. Preferably, these "op- erational elements" also include at least one operator, at least one leader sequence for proteins to be exported from intracell- ular space, at least one gene for a regulator protein, and any other DNA sequences necessary or preferred for appropriate tran- scription and subsequence translation of the vector DNA.

Certain of these operational elements may be present in each of the preferred vectors of the present invention. It is contem- plated that any additional operational elements which may be re- quired may be added to these vectors using methods known to those of ordinary skill in the art, particularly in light of the teach- ings herein.

In practice, it is possible to construct each of these vectors in a way that allows them to be easily isolated, assem- bled and interchanged. This facilitates assembly of numerous functional genes from combinations of these elements and the coding region of the DNA sequences. Further, many of these ele- ments will be applicable in more than one host. It is addition- ally contemplated that the vectors, in certain preferred embodi- ments, will contain DNA sequences capable of functioning as regulators ("operators"), and other DNA sequenes capable of coding for regulator proteins. (i) Regulators These regulators, in one embodiment, will serve to prevent expression of the DNA sequence in the presence of certain envi- ronmental conditions and, in the presence of other environmental |E9503‘l7 conditions, will allow transcription and subsequent expression of the protein coded for by the DNA sequence. In particular, it is preferred that regulatory segments be inserted into the vector such that expression of the DHA sequence will not occur, or will occur to a greatly reduced extent, in the absence of. for exam- ple, isopropylthio-beta-D—galactoside. In this situation, the transformed microorganisms containing the DNA sequence may be grown to at a desired density prior to initiation of the expres- sion of IL-li. In this embodiment, expression of the desired protein is induced by addition of a substance to the microbial environment capable of causing expression of the DNA sequence after the desired density has been achieved. (ii) Promoters The expression vectors must contain promoters which can be used by the host organism for expression of its own proteins. while the lactose promoter system is commonly used, other micro- bial promoters have been isolated and characterized, enabling one skilled in the art to use them for expression of the recombinant IL-li. (iii) zggggcription Terminator The transcription terminators contemplated herein serve to stabilize the vector. In particular, those sequences as described by Rosenberg, M. and Court, D., in Ann. Rev. Genet. ;;:3l9-353 (1979), specifically incorporated herein by reference, are contemplated for use in the present invention. (iv) Non-Translated Sequence It is noted that, in the preferred embodiment. it may also The microbial expression of foreign proteins requires cer- tain operational elements which include, but are not limited to, ribosome binding sites. A ribosome binding site is a sequence which a ribosome recognizes and binds to in the initiation of protein synthesis as set forth in Gold, L., et al., Ann. Rev. (1986), both of which are specifically incorporated herein by reference. A preferred ribosome binding site is GAGGCGCAAAAA(ATG). (vi) Leader Sequence and Translational Coupler Additionally, it is preferred that DNA coding for an appro- priate secretory leader (signal) sequence be present at the 5' end of the DNA sequence as set forth by Watson, M.E. in Nucleic Acids Res. l;:Sl4S-5163, specifically incorporated herein by ref- erence, if the protein is to be excreted from the cytoplasm. The DNA for the leader sequence must be in a position which allows I/E95031] the production of a fusion protein in which the leader sequence is immediately adjacent to and covalently joined to the inhib- itor, i.e., there must be no transcription or translation termi- nation signals between the two DNA coding sequences. The pres- ence of the leader sequence is desired in part for one or more of the following reasons.

First, the presence of the leader se- active structure, which structure possesses the appropriate pro- tein activity. lE950317 In one preferred embodiment of the present invention, an additional DNA sequence is located immediately preceding the DNA sequence which codes for the IL-1 inhibitor. The additional DNA sequence is capable of functioning as a translational coupler, i.e., it is a DNA sequence that encodes an RNA which serves to position ribosomes immediately adjacent to the ribosome binding site of the inhibitor RNA with which it is contiguous. In one embodiment of the present invention, the translational coupler may be derived using the DNA sequence 10TAACGAGGCGCAAAAAATGAAAAAGACAGCTATCGCGATCTTGGAGGATGATTAAATG and methods currently known to those of ordinary skill in the art re- lated to translational couplers. (vii) Iggnslation Termingtor (viii) Selectable Marker Additionally, it is preferred that the cloning vector con- tain a selectable marker, such as a drug resistance marker or other marker which causes expression of a selectable trait by the host microorganism. In one embodiment of the present invention, the gene for ampicillin resistance is included in the vector while, in other plasmids, the gene for tetracycline resistance or the gene for chloramphenicol resistance is included.

Such a drug resistance or other selectable marker is intend- ed in part to facilitate in the selection of transformants.

Additionally, the presence of such a selectable marker in the cloning vector may be of use in keeping contaminating microorga- nisms from multiplying in the culture medium. In this embodi- ment, a pure culture of the transformed host microorganisms would be obtained by culturing the microorganisms under conditions which require the induced phenotype for survival.

The operational elements as discussed herein are routinely selected by those of ordinary skill in the art in light of prior literature and the teachings contained herein. General examples of these operational elements are set forth in B. Levin, ggggs, Wiley & Sons, New York (1983), which is specifically incorporated herein by reference. Various examples of suitable operational elements may be found on the vectors discussed above and may be elucidated through review of the publications discussing the basic characteristics of the aforementioned vectors.

Upon synthesis and isolation of all necessary and desired component parts of the above-discussed vector, the vector is assembled by methods generally known to those of ordinary skill in the art. Assembly of such vectors is believed to be within the duties and tasks performed by those with ordinary skill in the art and, as such, is capable of being performed without undue experimentation. For example, similar DNA sequences have been ligated into appropriate cloning vectors, as set forth by Ma- niatis g;_al. in Molecular Cloning, Cold Spring Harbor -2;- E95051; Laboratories (1984), which is specifically incorporated herein by reference.

In construction of the cloning vectors of the present inven- tion, it should additionally be noted that multiple copies of the DNA sequence and its attendant operational elements may be in- serted into each vector. In such an embodiment, the host organ- ism would produce greater amounts per vector of the desired IL-l inhibitor. The number of multiple copies of the DNA sequence which may be inserted into the vector is limited only by the ability of the resultant vector, due to its size, to be trans- ferred into and replicated and transcribed in an appropriate host cell. (b) Other Microorganisms vectors suitable for use in microorganisms other than g; ggli are also contemplated for this invention. Such vectors are described in Table 1. In addition, certain preferred vectors are discussed below.

EUUHQUOHICOCC coauoamov muozmnozm coauoamwu m ozm A man. ~ umm omousuo em: n ma: uouumm nan: uouunu «:3: mmouuudnm .nmH 5.4 moan» 9.3 man 50.. Iflzmuonm mini 1:: cofioumuc . N%o.n mam ran 5...: ono!~u...o>:H A 0.5 oaou=.G and «.0 u » Oahu A38 JCUMB coauaamou omfiuaaoumauum 3: 5230.3 cnnaoumbs no A33 .593 mace...

A18 .5 mun. onuuaaacouasm nnu wmamfionmmozm éofléum 53 A28 .5 humus uouswmm 25335:" . uni .n 2.3 ouuuuumm N amnaaaa 3nTm.. wuonaabfinunmau ?:a.m nu: an >505 camfiaunsmc mw uadu A onuououm o~u..u.n CHM Sumatran onoououm Hausa: >Eo.m vu ucdx aouwaoc hand F: .300 .u mama... naadumm coauwamov cmzmoumauu no cofiduua <5 m.n.nou.Eo:.w=uuoa:u monm H95 ouauuuonwnov mmuu. 3.2ac3u>um.5ou Nasmfio «£3 «mafia such vomfluufi .3 «B23 Zcfiiufieu Sufi mamao each 09.: ~una Jung Sou .u uaum 02523 muxmtz magnum mn.E mm a Him .545 <59. zoH.EEumz$F QMHSDONK A umamumzfiu.

A manta . 21. 22. . . 2!. . 37. |. 29.

J0.

J1.

J2. 33.

. J5. . )7.

II.

II.

E95031) eacxnan. K., Pzasnno. H. and Gxlcorz. H. Prac. N011. Acjd. :1, us; 11, 0170-0l7l t1970t. do 000r. !.A.. CcMI%° .¢.¢_ 5¢,_ U5. gg 21-15 (1953). shiaazouo. u. and !°s¢nt-r1- 0. Haturo ;1g. l2!-132 (1901). :orom, c.. c:0y:0fi- 0- SP5 F-Ors. U. C0n0 ;; AS-SI (L982).

Hlllovtll. -.0. and 5-2160' 5. Cone Q. 2‘-a‘ (.901). aros..s ;.. Iull. T J.. Skeeter. C.C. and Hollqr, n,r, 1 Hal. 01:1. ;;g. 12'-I27 ISSLI. uormnnly. 5.. oqaon, l.C.. Harv.gh_ s_c_ ‘,4 A¢.1,°n' C_ Ndturt ;;;, Zll-2l9 (L986). solasco, J.c.. uilsson. 3..

Cell 35. 245-25: '1900).

Schno.sxn0:. u.. NcK0nncy, K.. Ronqnhgr n, .fid J. Hal. Dicl. ;;g. :9-sz Matt. J.0.. Callcvay. J.L. and Plagt, 7. zxpo 3, g, L007-1001 (1905). xasalond. D. and aotazonn. 0. coll 19. 709-700 (19|o)_ Hevvn. u.n.. lananurn. K. and lnouyc. n. J. H91. liol. lg}, 317-320 (1000).

Surxn, 0.0.. Jans, 0.0., Plmnol. A.L.. Shnv. D.C.. Cox, 6.0. and nosonnorq. N. J. loezurlol. 111, 172-170 (1900), Sutclllfl. J.G. Proc. Natl. Acod. sci. USA 1}, 1137.374; (l990!.

Podon. x.u.c. Gone 13. 277-100 (1903).

Alton. u.x. and Vopnon. D. fiazuro 111. 000-009 (l079), Yang. H.. Gallsxu. A.. and Runner. 0. Rue. Acids I00.

Llijl. 237-200 (1903).

Honq. 8.-L.. Price. C.U.. Goldtorb. 0.0.. and Del. 0.3.

Proc. Natl. Acod. 0:1. USA 1;. ll00-ll00 (1000).

:. P.-2.. and 000. a.u. J. 0191. Cash. 113. 0000-0010. (1 0).

Lln, C.-K.. Quinn. L.A. Iodrlqucn. 0.0.

Suppl. L111, p.100 (1000).

Vasanzho. l., faonon. L.0.. anodes, c., jannqp, c., n¢g;., J.. and Pllpulo. 0. J. 00:0. 1. 0ll-01! (1000).

Pnlvu. 1.. Servos. I.. Lahtevncra. .. Slbozkov. n., and x;;;;:in0n. L. Iroe. Incl. Aead. set. USA 11, 0002-0000 ( . ‘ Bong. 0.-0.. Irlcoo. c.v.. Goldtarb. 0.3.. and 001. n.n.

Proe. N001. Acod. 0:1. 000 I1. ll00-ll00 (1900).

Sullivan. I.0.. tanbln. 0.0.. 0nd Young. 0.0. Gone 1}. 21-00 (1000). vasancha. l.. Thetpcon. L.0.. lhodol. C.. Iannor. C. waqlo.

J.. and P119010. 9. J. 00:0. 111111. Ill-ll! (X000).

Y0fl0Ut0. 0.0. and Manner. 0.J. DIAS [1, 030-003 (1000).

Gf.’, O.‘.. my ‘0‘no J°fl..p .IJ0'uo SOODUPI. P.l|. ‘M xoynohor. 3.0. llocoeunology. 101-I00 (l000l.

Lory, 0.. and $00. 0.6. Geno . 95-101 (1001).

Llu. 0.V. J. Infect. 0l0. 113 Iupoll. 000-500 (1070).

H, ‘coco HOUJIIQOP. "0'op ‘ha "M01. *4‘. J. "CC. m, 1000-1001 (l00x). _ . c.L.. for unon. J. and Young. 0.T. J. 0091. Chen. 11[;‘ll:!-£171"; 0011. ‘ h " L1‘ Luz or . . 0 Magnet, . Ar: 0. aches. Ilopnya. . 011-900 (l!00). noyhael. 0.. 00 vs. I.. Rudolph. R. 0nd Klnnoa. 0. Into.

J. 5. 010-000 ( 002). action. I.0.0. Iuclole Acld Research 11. 3100-0100 (1000). ?:;::?d. C. And ducvinonu. I. Curr. acnoc. 1. 210-110 ulnnon. 1.. llcls. J.0. and Vlah. 0.0. 010:. Incl. 0:04. 0:0. 00 11. 1939-1933 (1010).

Jabbor. l.A.. 0lv0subr0nAnI0n. I. and l0‘0I. 0.0. Iroc.

I001. 0:04. 0:0. U00 [1, 2030-1013 (l00S . van cabaln. A. and Canon, s.n.

J. Coll Ilochon.

E95031; (i) Pseudomonas Vectors Several vector plasmids which autonomously replicate in a broad range of Gram negative bacteria are preferred for use as cloning vehicles in hosts of the genus Pseudomonas. Certain of these are described by Tait, R.C., Close, T.J., Lundquist, R.C., Hagiya, M., Rodriguez, R.L., and Kado, C.I. In Biotechnology, May, 1983, pp. 269-275; Panopoulos, N.J. in Genetic Engineering in the Plant Sciences, Praeger Publishers, New York, New York, pp. 163-185 (1981); and Sakagucki, K. in Current Topic in specifically incorporated herein by reference.

One particularly preferred construction would employ the plasmid RSF10l0 and derivatives thereof as described by Bagdasarian, M., Bagdasarian, M.M., Coleman, S., and Timmis, K.N. in Plasmids of Medical. Environmental and Commercial Importance, Timmis, K.N. and Puhler, A. eds., Elsevier/North Holland Biomedical Press (1979). specifically incorporated herein by ref- erence. The advantages of RSFl010 are that it is relatively a small, high copy number plasmid which is readily transformed into and stably maintained in both E. coli and ggguggmgngg species.

Mcxeown, K.A., Jones, A.J.s., Seeburg, P.H., and Heyneker, H.L.

E95031; in Biotechnology, Feb. 1984, pp. 161-165, both of which are spe- cifically incorporated herein by reference. Transcriptional activity may be further maximized by requiring the exchange of the promoter with, e.g., an E. coli or P. aeruginosa trp promot- er. Additionally, the lacl gene of E. coli would also be includ- ed in the plasmid to effect regulation.

Translation may be coupled to translation initiation for any of the Pseudomonas proteins, as well as to initiation sites for any of the highly expressed proteins of the type chosen to cause intrace1lular expression of the inhibitor.

In those cases where restriction minus strains of a host Pseudomonas species are not available, transformation efficiency with plasmid constructs isolated from E. coli are poor.‘ There- fore, passage of the Pseudomonas cloning vector through an r- m+ 15strain of another species prior to transformation of the desired host, as set forth in Bagdasarian, M., et al., Plasmids of Medical, Environmental and Commercial Importance, pp. 411-422, Timmis and Puhler eds., Blsevier/North Holland Biomedical Press (1979), specifically incorporated herein by reference, is desired. (ii) Bacillus Vectors Furthermore, a preferred expression system in hosts of the genus Bacillus involves using plasmid pUBll0 as the cloning vehicle. As in other host vectors system, it is possible in Bacillus to express the IL-1i of the present invention as either an intracellular or a secreted protein. The present embodiments include both systems. Shuttle vectors that replicate in both Bacillus and E. coli are available for constructing and testing various genes as described by Dubnau, D., Gryczan, T., Contente, S., and Shivakumar, A.G. in Genetic Engineering, Vol. 2, Setlov and Hollander eds., Plenum Press, New York, New York, pp. llS-131 (1980), specifically incorporated herein by reference. For the expression and secretion of the IL-li from B. subtilis, the sig- nal sequence of alpha-amylase is preferably coupled to the coding region for the protein. For synthesis of intracellular inhib- itor, the portable DNA sequence will be translationally coupled to the ribosome binding site of the alpha-amylase leader se- quence.

Transcription of either of these constructs is preferably directed by the alpha-amylase promoter or a derivative thereof.

This derivative contains the RNA polymerase recognition sequence of the native alpha-amylase promoter but incorporates the lac op- erator region as well. Similar hybrid promoters constructed from the penicillinase gene promoter and the lac operator have been shown to function in Bacillus hosts in a regulatable fashion as set forth by Yansura, D.G. and Henner in Genetics and Biotechnology ofgggcilli, Ganesan, A.T. and Hoch, J.A., eds., ,Academic Press, pp. 249-263 (1984), specifically incorporated by reference.

The lacl gene of E. coli would also be included in the plasmid to effect regulation. ve95o317 (iii) Clostridium vectors one preferred construction for expression in Clostridium is (iv) Yeast Vectors Maintenance of foreign DNA introduced into yeast can be effected in several ways as described by Botstein, D. and Davis.

R.W., in The Molecular Bioloqy of the Yeast Saccharomyces, Cold Spring Harbor Laboratory, Strathern, Jones and Broach, eds., pp. 607-636 (1982), specifically incorporated hereby by reference. one preferred expression system for use with host organisms of the genus Saccharomyces'harbors the IL-li gene on the 2 micron plasmid. The advantages of the 2 micron circle include rela- tively high copy number and stablility when introduced into cir° strains. These vectors preferably incorporate the replication origin and at least one antibiotic resistance marker from pBR322 the to allow replication and selection in E. coli. In addition, plasmid will preferably have the two micron sequence and the yeast LEU2 gene to serve the same purposes in LEU2 defective mu- tants of yeast.

If it is contemplated that the recombinant IL-1 inhibitors will ultimately be expressed in yeast, it is preferred that the cloning vector first be transferred into Escherichia coli, where the vector would be allowed to replicate and from which the vector would be obtained and purified after amplification. The vector would then be transferred into the yeast for ultimate growth. The vector should have a complete polyadenylation signal -32.. vs95o317 as described by Ausubel, F.M. g£_al. in Current Protocols in Mo- lecular Biology, Wiley (l987), specifically incorporated herein by reference, so that the mRNA transcribed from this vector is processed properly. Finally, the vector will have the replica- tion origin and at least one antibiotic resistance marker from pBR322 to allow replication and selection in E. coli.

In order to select a stable cell line that produces the IL-1 inhibitor, the expression vector can carry the gene for a se- lectable marker such as a drug resistance marker or carry a com- plementary gene for a deficient cell line, such as a dihydrofolate reductase (dhfr) gene for transforming a dhfr‘ cell line as described by Ausubel gt_gl., ggpga. Alternatively, a separate plasmid carrying the selectable marker can be cotransformed along with the expression vector.

. Host Cells/Transformation The vector thus obtained is transferred into an appropriate host cell. These host cells may be microorganisms or mammalian cells. (a) Microorganisms It is believed that any microorganism having the ability to take up exogenous DNA and express those genes and attendant oper- ational elements may be chosen. After a host organism has been chosen, the vector is transferred into the host organism using methods generally known to those of ordinary skill in the art.

Examples of such methods may be found in Advanced Bacterial Genetics by R. W. Davis et al., Cold Spring Harbor Press, Cold E95031; Spring Harbor, New York, (1980), which is specifically incorpo- rated herein by reference. It is preferred, in one embodiment, that the transformation occur at low temperatures, as temperature regulation is contemplated as a means of regulating gene expres- sion through the use of operational elements as set forth above.

In another embodiment, if osmolar regulators have been inserted into the vector, regulation of the salt concentrations during the transformation would be required to insure appropriate control of the foreign genes.

It is preferred that the host microorganism be a facultative anaerobe or an aerobe. Particular hosts which may be preferable for use in this method include yeasts and bacteria. Specific yeasts include those of the genus Saccharomyces, and especially Saccharomyces cerevisiae.

Specific bacteria include those of the genera gacillus, gscherichia, and Pseudomonas, especially Bacillus subtilis and Escherichia ggli. Additional host cells are listed in Table I, ggggg. (b) Mammalian Cells The vector can be introduced into mammalian cells in culture by several techniques such as calcium phosphate:DNA coprecipita- tion, electroporation, or protoplast fusion. The preferred meth- od is coprecipitation with calcium phosphate as described by Ausubel g;_al., supra.

Many stable cell types exist that are transformable and capable of transcribing and translating the cDNA sequence, pro- cessing the precursor IL-li and secreting the mature protein. -34..

|E9503*17 However, cell types may be variable with regard to glycosylation of secreted proteins and post-translational modification of amino acid residues, if any. Thus, the ideal cell types are those that produce a recombinant IL-1 inhibitor identical to the natural molecule.

. Culturinq Engineered Cells The host cells are cultured under conditions appropri- ate for the expression of the IL-1 inhibitor. These conditions are generally specific for the host cell, and are readily deter- mined by one of ordinary skill in the art in light of the pub- lished literature regarding the growth conditions for such cells and the teachings contained herein. For example, Bergey‘s Manual of Determinative Bacteriology, 8th Ed., Williams & Wilkins Com- pany, Baltimore, Maryland, which is specifically incorporated herein by reference, contains information on conditions for culturing bacteria. Similar information on culturing yeast and mammalian cells may be obtained from Pollack, R. Mammalian Cell _Culture, Cold Spring Habor Laboratories (1975), specifically in- corporated herein by reference.

Any conditions necessary for the regulation of the expres- sion of the DNA sequence, dependent upon any operational elements inserted into or present in the vector, would be in effect at the transformation and culturing stages. In one embodiment, cells are grown to a high density in the presence of appropriate regu- latory conditions which inhibit the expression of the DNA se- quence. when optimal cell density is approached, the -35..

IE950317 environmental conditions are altered to those appropriate for expression of the DNA sequence. It is thus contemplated that the production of the IL-1 inhibitor will occur in a time span subse- quent to the growth of the host cells to near optimal density, and that the resultant IL-1 inhibitor will be harvested at some time after the regulatory conditions necessary for its expression were induced.

. Purification IL-li Produced From Microorganisms In a preferred embodiment of the present invention, the recombinant IL-1 inhibitor is purified subsequent to harvesting and prior to assumption of its active structure. This embodiment is preferred as the inventors believe that recovery of a high yield of re-folded protein is facilitated if the protein is first purified. However. in one preferred, alternate embodiment, the IL-1 inhibitor may be allowed re-fold to assume its active struc- ture prior to purification. In yet another preferred, alternate embodiment, the IL-1 inhibitor is present in its re-folded. active state upon recovery from the culturing medium.

In certain circumstances, the IL-l inhibitor will assume its proper, active structure upon expression in the host microorga- nism and transport of the protein through the cell wall or mem- brane or into the periplasmic space. This will generally occur if DNA coding for an appropriate leader sequence has been linked to the DNA coding for the recombinant protein. If the IL-1 in- hibitor does not assume its proper, active structure, any IE950317 disulfide bonds which have formed and/or any noncovalent interac- tions which have occurred will first be disrupted by denaturing and reducing agents, for example, guanidinium chloride and beta-mercaptoethanol, before the IL-1 inhibitor is allowed to assume its active structure following dilution and oxidation of these agents under controlled conditions.

For purification prior to and after refolding, some combina- tion of the following steps is preferably used: anion exchange chromatography (MonoQ or DEAE-Sepharose), gel filtration chromatography (superose), chromatofocusing (MonoP), and hydrophobic interaction chromatography (octyl or phenyl sepharose). Of particular value will be antibody affinity chromatography using the IL-li-specific monoclonal antibodies (described in Example 3). (b) IL-li Produced from Mammalian Cells IL-li produced from mammalian cells will be purified from conditioned medium by steps that will include ion exchange chromatography and immunoaffinity chromatography using monoclonal antibodies described in Example 3. It will be apparent to those skilled in the art that various modifications and variations can be made in the processes and products of the present invention.

Thus, it is intended that the present invention cover the modifi- cations and variations of this invention provided they come within the scope of the appended claims and their equivalents.

It is to be understood that application of the teachings of the present invention to a specific problem or environment will -37..

E95031; be within the capabilities of one having ordinary skill in the art in light of the teachings contained herein. Examples of the products of the present invention and representative processes for their isolation and manufacture appear in the following.

The following examples illustrate various presently pre- ferred embodiments of the present invention. The publications provided in this examples are specifically incorporated by refer- ence herein.

EXAMPLES Example 1 - Protein Preparation A. Materials Hank's Balanced Salt Solution (H855) and RPMI were purchased from Mediatech, Washington, D.C. Lymphoprep was obtained from Accurate Chemical and Scientific Corp., westbury, N.Y;’ Human Igc, MTT, rabbit anti-prostaglandin E2 antiserum, ammonium bicar- bonate, dithiothreitol, complete and incomplete Freundfs adjuvants, hypoxanthine, aminopterin, and thymidine were pur- chased from Sigma Chemical Co., St. Louis, Missouri. C3H/HeJ mice were purchased from Jackson Labs, Bar Harbor, Maine. BALB/c mice and P3 myeloma cells were obtained from Drs. John Kappler and Philippa Marrack at the National Jewish Center for Immunology and Respiratory Medicine (NJC/IRM), Denver, Colorado.

Recombinant human IL-1 was obtained from Cistron Biotechnology, Pine Brook, N.J. Purified phytohemagglutinin was purchased from wellcome Diagnostics, Research Triangle Park, N.C.

Human IE950317 foreskin fibroblasts from primary cultures were obtained from Dr.

Richard Clark at the NJC/IRM, Denver, Colorado. Monoclonal mouse anti-rabbitt IgG antibodies were purchased from AIA reagents, Low methionine RPMI was made using a Select- Aurora, Colorado.

Amine kit from GIBCO Laboratories, Grand Island, N.Y. id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355"

[355]-methionine, diphenyloxazole, and [l4C]-iodoacetic acid were obtained from DuPont-NEN, Chicago, Illinois. Fetal calf serum was purchased from Hyclone Laboratories, Logan, Utah. Mono Q and Superose 12 columns were purchased from Pharmacia, Inc., Piscataway, N.J. C4—reversed phase columns were obtained from Synchrom, Inc., Lafayette, Indiana. C8-reversed phase columns were obtained from Applied Biosystems, Inc., Foster City, California. Acetonitrile and polyethylene glycol 8000 were pur- chased from J. T. Baker Chemical Co., Phillipsburg, N.J.

Trifluroacetic acid and guanidine hydrochloride were obtained from Pierce Chemicals, Rockford, Illinois.

Endoproteinase Lys C was obtained from Boehringer Mannheim Biochemicals, Indianapolis.

Indiana. The microtitering plates used for PGE2 ELISA were Nunc-Immuno Plate I obtained from Intermountain Scientific Corpo- ration, Bountiful, Utah.’ The plates used for hybridoma produc- tion were from Costar, Cambridge, Massachusetts.

. Generation of Monocyte IL-l Inhibitor Human leukocytes were obtained from normal donors by leukophoresis, resuspended in Hank's balanced salt solution (HESS) at 1 part packed cells to 1 part HBSS, underlayed with The Lymphoprep and spun at 400 xg for 30' at room temperature. mononuclear fraction was taken (typically 4-5 X 109 cells were obtained per donor), washed in HBSS without Ca’* or Mg*+, sus- pended in serum-free RPMI and plated on petri dishes coated with normal human IgG made LPS free by chromatography over Sephapex G200 (6 X 107 cells in 10ml per 100 mm dish). All reagents con- tained less than 10 pg/ml LPS. The cells were cultured 24-48 hr, and the resulting conditioned medium constituted the crude IL-1 inhibitor (IL-li) supernatant. Typically, the cells from one donor yielded 700-900 ml crude IL-li supernatant.

C. Assays for the Ig:1 Inhibitor Two IL-1 assays have been used routinely to detect the IL-li. Thymocytes (1 x 105 cells from 4 to 6 week old C3H/HeJ measured by ELISA. This assay is as sensitive to IL-li as is the thymocyte assay.

D. Metabolic Labelinqgof the IL-1 Inhibitor IE950317 The IL-li was metabolically labeled by culturing mononuclear leukocytes for 48 hours on IgG—coated plates (as described in B) in serum-free RPMI containing only 0.75 ug/ml cold methionine (lSug/ml is normal) and to which was added 0.5 mCi 35S—methionine (ll5l Ci/mmol) per lO7 cells. Control labelings were performed identically except that the plates were coated with fetal calf serum rather than IgG. Assays on such control supernatants showed that very little IL-li was secreted when the cells were cultured on fetal calf serum-coated plates.

E. Purification of the IL-1 Inhibitor Protein Crude IL-li supernatants were made 1.0 M in sodium chloride, incubated on ice for 1 hour and centrifuged at 10,000 rpm for 15 minutes. The supernatants, which contained all of the inhibitor activity but only 20% of the initial protein, were then dialyzed extensively at 4°C versus 0.02SM Tris, pH 7.6 containing 0.1% sucrose (the A buffer) for gradient fractionation of proteins on a Mono Q anion exchange column.‘ Following dialysis the inhibitor-containing solutions were recentrifuged at 10,000 rpm for 15 minutes and then passed through 0.22u nylon filters. The supernatants were typically combined with 10 ml of similarly pre- pared supernatant from a metabolic labeling and loaded onto Mono Q-Superose (Pharmacia FPLC) columns with bed volumes of either 1.0 ml or 8.0 ml, washed with A buffer until the OD250 of the effluent returned to baseline, and carefully chromatographed using a linear sodium chloride gradient (.025M to .l0M) in buffer A. Column fractions were collected and analyzed for IE950317 radioactivity and bioactivity. Samples of each fraction were also run on reduced 12.5% SDS—PAGE, silver stained, permeated with diphenyloxazole, dried and put onto film to obtain autoradiographic data. Figure la shows the protein profile of the Mono Q chromatography of 40 ml crude I1-li supernatant mixed with 3 ml of metabolically labeled IL-li supernatant. Superim- posed are the amount of radioactivity found in 50 ul of each fraction as well as the IL—li bioactivity as measured in the PGE2-production assay. Two major and one minor radioactive spe- cies are shown that perfectly correlate with three peaks of bioactivity. Figure lb shows the similar chromatography of 15 ml of crude Il-li supernatant mixed with 3 ml of supernatant from monocytes metabolically labeled on plates coated with fetal calf serum (FCS) rather than IgG. The levels of the three radioactive species discussed above are markedly diminished. Figure 2a shows silver stained gels run on the fractions from the regions of in- terest in the chromatographies shown in Figures la and lb. Note that the fractions of peak radioactivity and bioactivity in Fig- ure la (fractions 52 and 59) both show a major band at 22 Kd (marked with arrows) on SbS—PAGE. The third species (fraction 48 in Figure la) shows a band at 20kD on SDS-PAGE. Gel filtration experiments on crude IL-li have shown that the active molecule has a molecular weight of 18-25 Kd. Figure 2b is an autoradiogram of the gels shown in Figure 2a. It can be readily seen that the protein bands at 20 and 22 Kd are the major radio- active species in those fractions.

E950317 Summarizing these results, we have shown that the metabolic labeling of monocytes plated on petri dishes coated with IgG results in radioactive species that are only poorly produced if the cells are plated on dishes coated with PCS. These induced radioactive species perfectly co-chromatograph with several spe- cies of IL-li bioactivity on Mono Q, and gels and resulting autoradiograms show that the three major induced molecules are proteins of the predicted molecular weight for IL-li.

The IL-li molecules were further purified for sequencing in two ways. First, Mono Q fractions with peak bioactivity and ra- dioactivity were loaded onto a C4-reversed phase column and eluted with an H20/0.l%TFA: acetonitrile/0.l%TFA gradient.

Since the IL-li molecule was trace labeled, samples from each fraction were directly counted for radioactivity and were also analyzed by SDS-PAGE followed by autoradiography. Figure 3a shows such a chromatograph with the radioactivity pattern super- imposed. The silver stained gels run on samples from each frac- tion (Figure 3b) and subsequent autoradiograms of the gels (Fig- ure 3c) shows that the IL—li molecule is found in fractions 32-36. These fractions were dried down and sequenced. Alterna- tively, the peak Mono Q fractions were dried by Speed Vac. resuspended in 0.4 ml 0.05 M NH4HC03 and directly chromatographcd two times on a 10 X 300mm Superose 12 gel filtration column (Pharmacia FPLC) equilibrated in the same buffer, as shown in Figs. 4a and 4b. Fractions were collected and samples of each -43..

IE950317 were tested for radioactivity and bioactivity and were analyzed by silver stained and autoradiographed SDS-PAGE. Appropriate fractions were then dried on a speed vac and sequenced.

Example 2 Proposed Sequencing of the IL-1 Inhibitor Prior to sequencing, samples were dissolved in 6 M guanidine-HCl, pH 8.6, reduced for 4 hours at 37°C under N2 with 100-fold molar excess dithiothreitol over protein, and alkylated for 1 hour with 400-fold excess 14C-iodoacetic acid. In that case, the reactions would be desalted on a C8-reversed phase col- umn, eluted, and partially dried. N-terminal sequences will be determined using an Applied Biosystems Protein Sequencer. To obtain internal sequences, samples which may have been reduced and alkylated would be digested with cyanogen bromide or proteolytic enzymes using methods known to those of ordinary skill in the art. Reactions will be dried, dissolved in 0.1% TFA/H20, and peptides will be separated using a C8-reverse phase column.

Example 3 Purification and Sequencing of the Species of IL-1 Inhibitors A. IL-li-X, IL—1i-a and XL—li-b species The Mono Q purification of IL-li resolves the biological activity into three major species, as shown in Figure la and described in Example 1, where the peak fractions for this lE950317 activity are 48, 52, and 59. SDS-PAGE on samples of these frac- tions, as shown in Figure 2a, reveal pertinent species at 20 kD, 22 RD, and 22kD, respectively. Western analysis of such gels, using the mouse antisera discussed in Example 4 below, stains all three of these species. when IL-li is prepared from cells metabolically labeled with 35$-methionine, during growth on plates coated with IgG, each of these bands is radioactive (as shown in Figure 2b, the autoradiogram of the above-mentioned gel). Based on the logic discussed in Example 1, namely that parallel cells incubated in a non-inducing condition do not pro- duce the IL-li bioactivity and do not produce these radioactive bands, we can conclude that these three species account for the biological activity. we have tentatively named these species IL- li-X, IL—li-a, and IL-li-b, respectively.

. Purification and Seqgencinq of IL-li-X Mono Q fractions containing IL-1i-X and/or IL-li-a were fur- ther purified by reversed-phase HPLC chromatography on a Synchropak RP-4 (C4) column, and radioactive species were sub- mitted for sequence analysis. Numerous attempts at directly sequencing RP-HPLC-purified IL-li-a and IL-li-b have failed, sug- gesting that they are chemically blocked at their N-termini.

However, one preparation of IL-li-a (IL-1i-aB2p42) yielded the following sequence: IE950317 and subsequent preparations of IL-li-X, similarly purified by C4 RP-HPLC, have produced the same sequence: S .10 15 mpxxrzz. , 3° and . . . - ‘ ' ‘ "HQAF-In-J‘V—K..7 PnpKxF23 , P--3K_LKMQAF_L These are obviously part of the sequence found in the ini- tial attempt at sequencing IL-li-a. It is the inventors‘ conclu- sion that the sequence data shown is the N-terminus of the 20 RD species called IL-li-X.

In these and all subsequent sequences an underlined position indicates either an inability to identify a residue or that ambi- guity exists with respect to the residue identified. when two or more residues are put in one position, it indicates that more IL-li-a and IL-li-b Since IL-li-a and IL-li-b are apparently chemically blocked at their N-termini, peptides of each were generated by endoproteinase digestion. Specifically, Mono Q fractions con- taining either IL-li-a or IL-li-b were passed through a 4.6x250 nm C3-RPHPLC column (Zorbax Protein Plus), an acceptable alterna- tive to the C-4 columns used in all previous experiments. Very gradual gradients (0.2% acetonitrile per minute at 0.5 ml/min) E95031; resolved the IL-li-a (Figure 8a,b) or IL-li-b (Figure 9a) away from the major contaminating radioactive species, human lysozyme.

The identities of the purified species were confirmed by the presence of a single, radioactivei 22 kD protein on SDS-PAGE and subsequent autoradiograms (Figures 8c,d and 9b). The proteins were hand—col1ected into siliconized glass tubes and to each was added 25 ml of a 0.2% Tween-20 solution. The IL-li-containing fractions were then reduced in volume on a Speed-Vac to 50 ml, brought up to 300 ml by the addition of 1% NH4HCO3, followed by the addition of 1 mg of endoproteinase. In the case of IL-1i-a, the enzyme used was Endoproteinase Lys C (Boehringer-Mannheim), while IL-li-b was cleaved with Endoproteinase Asp N (Boehringer- Mannheim). Cleavage was carried out at 37°C for 16 hr, and then the volume of the reaction mix was reduced to 50 ml on a Speed Vac.

In the case of IL-1i-a, the sample was directly chromatographed, whereas the IL-1i-b sample was first reduced by the addition of Sml of 50 mM dithiothreitol in 2 M Tris, pH 8.0. reacted for 30 min at 37’C, and then carboxymethylated by addi- tion of 1.1 umole 3H-iodéacetic acid in 10 ml ethanol (reacted 30 min at 37°C in the dark). Separation of the peptides was per- formed on a 2.1x25O mm Brownlee Aquapore RP-300 (C8) narrow-bore column at a flow rate of 100 ml/min using a Beckman HPLC out- fitted with microbore hardware and microbore-compatible pumps. A min 0-100% linear gradient was used (H20/0.1% TFA to acetonitrile/0.1% TFA). The peptide separations are shown in Figures lows: RaLysC- RaLysC- RaLysC- RaLy:C- RaLysC- RaLysC- R£AspN- R£A:pH~ P.aAs1>N - RAMP"- R6AspN- and 11. 1 5 '.1 HQAF__ 1 s 53 _ FY 1_ 1 5x 61 FA 1: 1 5 31 FY so 2 1 5 c 2 37 _ QIDE r 1 5 _ 1 s Q x n nvuzz 1 3 as n 1 s 39 1 5 1 I s s L m u_;vu $950317 The sequence information obtained is as fol- o I _ D V N Q 5 1o 15 20 K 25 N N Q L V A _ Y L Q G P N V N L E E Q I D E _ 3 Y RHYH n V 15 N 20 S I T S QL£AflRQiQI-£39 __£T3LQLEAV_1TDLLEN 25 T F L G I 2 Y Q R N N Q L V A 5 Y L Q G P N V N L zcvnvrxrvrg K 10 15 _ P 5 G I X S g { H Q A F R I Q nxnrarxn E95031; Two of the peptide sequences are obviously related to that which was obtained earlier from IL-li-X. one of these, RaLysC- 41, is an IL-li-a sequence, and the other, RbAspN-Sl, is an IL-li-b sequence, arguing that the three species of IL-li are at least closely related proteins if not chemically and/or physi- believe that these sequences, or minor variants thereof, [E95031] represent a class of molecules that are capable of acting as IL-1 inhibitors.

Example 4 Preparation of Antibodies Specific For the IL-1 Inhibitor Ten week old BALB/c mice were injected subcutaneously with IL-li that was partially purified (400-fold) from crude supernatants by Mono Q-chromatography, dialyzed versus PBS, and emulsified with Complete Freund's Adjuvant. Each mouse received the IL-li purified from 5 ml of crude supernatant. The mice were boosted every two weeks with an equivalent amount of IL-li emulsifed with Incomplete Freund's Adjuvant, and serum samples were taken from the tails seven days after each boost. Antisera were tested for anti—IL-li activity by Western analysis of transblots of the immunogen run on SDS-PAGE, as shown in Fig. 5a.

Fig. Sb shows that all of the mice were making anti-IL-1i antibodies after three injections of IL-li.

Since monoclonal antibodies will be of great value in cloning the IL-li gene from an expression library, purifying the recombinant IL-11 protein, and studying the biology of the mole- cule, we have begun the process of making a battery of monoclonal antibodies specific for ll-li. To produce B cell hybridomas, the above mice were injected intravenously with the same amount of IL-li in saline 24 hours prior to removal of the spleens.

Splenocytes were teased out of the spleens into cold balanced salt solution (BSS), washed two times with 855, mixed with P3 myeloma cells at a ratio of 2 x 107 P3 cells per 108 splenic B E95031; cells and spun down. The cells were fused by the dropwise addi- tion of 1 ml of warm, gassed (5% CO2) PEG 6000 (40% polyethylene glycol 6000 : 60% minimal essential medium) to the dry pellet.

Fused cells were washed with 858 and resuspended in l0 ml of rich media (10% PBS) containing 2 x l05 peritoneal cells per ml and the pellet was gently broken up using a lo ml pipet. The volume was adjusted to 20 ml with the addition of more peritoneal cells in media, and the cells were plated out in 96 well plates at 0.1 ml/well. Plates were placed in a gas incubater and treated in the following manner thereafter: Day 1 - Add 3x HAT (hypoxanthine, aminopterin, thymidine) in rich medium to a final concentration of 1x Day 5 - Change medium, replacing with 200 ul lx HAT in rich medium Day 10 - Begin checking for hybrid growth. Change medium, replacing with 200 ul lx HAT in rich medium containing 1.5 x 105 peritoneal cells per ml. when hybrid cells are nearly confluent in a well the supernatants are transfered for testing, and the cells are gently scraped with a pipet tip and transfered to 1 ml culture wells containing lx HAT in rich medium plus 3 x 106 peritoneal cells per ml.

The supernatants from the confluent wells are tested for anti-IL-li activity using an ELISA in which partially E950317 purified IL-li (Mono Q-purified material identical to that injected into the mice) is bound to microtitering wells. Normal mouse sera and hyperimmune antisera are used as the negative and positive controls, respectively. ‘Positive supernatants will be retested by ELISA on plates coated with homogeneously purified IL-li and by immunoprecipitation of purified metabolically labeled IL-li. Positive cells will then be cloned by limiting dilution and injected into pristane-treated mice for the generation of ascites. Large quantities of IL-li—specific antibodies can be produced by tissue culture or by massive 10generation and collection of ascitic fluid in mice. Purification of these antibodies and attachment thereof to insoluble beads will produce affinity adsorbents for the purification of the recombinant IL-li protein.

Example 5 Cloninq the I1-li CDNA It was shown that monocytes plated on IgG-coated petri dishes and cultured for 24 hours in the presence of id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355" id="p-355"

[355]-methionine produced [355]-IL-1i which could be identified Zoby its chromotographic properties on Mono Q.

In order to determine when (during the 24 hour period) IL-li was being produced at a maximal rate, plated monocytes were exposed to [355]-methionine (pulsed) for a short, two-hour peri- od, at which time a large excess of unlabelled methionine was zsadded and incubated for an additional two hours. The medium was then collected and analyzed for ratiolabelled IL—li. This procedure was applied to monocytes at various times after plating of IgG—coated plates and it was found that exposing monocytes to id="p-358" id="p-358" id="p-358" id="p-358" id="p-358" id="p-358" id="p-358" id="p-358" id="p-358"

[358]-methionine at 15 hours after plating produced the maximal amount of [358]-IL-li, indicating that IL-li mRNA in monocytes was at its maximal level 15 hours after plating on IgG.

Fresh monocytes were then plated on LPS free IgG obtained as in Example 18. After incubating in RPMI media for 15 hours at 37°C, the cells are washed with phosphate buffered saline then lysed with 4M guanidinium thiocyanate; 25 mM sodium citrate, 10pH 7, 0.5% sarcosyl, 0.13 2-mercaptoethanol. Total RNA was then isolated from this lysate by the AGPC method of P. Chomczynski and N. Sacchi described in Analytical Biochemistry, vol. 162, pp. 156-159 (1987).

The cDNA was incorporated into a lambda gtll expression li- brary using ggo R1 linkers from Boehringer Mannheim catalog No. 988448 or New England Bio Lab No. 1070 and instructions provided by these manufacturers.

The resulting library, which contains 105 independent clones, was screened on E. coli Yl090 rk' (Promega Biotec) with an appropriate polyclonal antibody to IL-li as described IE950317 (1979) J. Histochem. Cytochem. ;1:ll3l-ll38 and according to manufacturer's instructions.

Example 6 Preparation and Sequencing of Gene Encodinq_IL-li In order to screen this GTl0 library, oligonucleotide (antisense) probes were synthesized based on protein and peptide sequence presented in Example 3.

The sequences of the probes and of their corresponding peptide sequence are as follows.

Probe Probe Probo Probe Probe Nata: lE950317 IE950317 Probe #lLli1-3 was 32?-phosphorylated at its 5' end and used to screen 3x105 plaques of the library. The probe hybridized reproducibly to three plaques, and out of these, one plaque was -ymn l.'U' shown to also hybridize to probe #ILlil-4. This plaque, ILli-2A, was cultivated and the DNA was isolated using Lambdasorb (Promega) according to the manufacturer's instructions.

GTl0-ILli-2A has been deposited at American Type Culture Collec- tion (ATCC) in Rockville, Maryland under Accession No. 40488.

The DNA was digested with gggal, divided into five equal ali- quots, and electrophoresed on a 1% agarose gel.

In order to demonstrate more conclusively that this 1850 bp fragment carries coding sequence for the ILl inhibitor, a South- ern blot was performed as follows. The DNA fragments in the gel shown in Figure 12a were blotted onto nitrocellulose using stan- dard methods. The nitrocellulose was then cut lengthwise into five strips such that each strip contained the DNA from lanes 6. 8, 10, and 14.

, The strips were then individually hybridized to each of the five oligonucleotide probes (above) which were I (ll 0\ lE950317 labeled at the 5' end with 32? phosphate. The oligonucleotide concentration was 1 pmole/ml and the hybridization temperatures were as follows.

LANE pnoss TEMPERATURE 6 #ILlil—3 35°C 8 #ILlil-4 42°C 1' HLlil-5 42°C 12 ntlil-6 40°C 14 #ILlil-7 35°C --------------------------------------------- -- After washing, the strips were lined up and taped together to reform the original nitrocellulose sheet. This was autoradiographed in the presence of an intensifying screen at -70°C for 24 hours. Figure 12b is a photograph of this autoradiograph. It provides evidence that all of the probes hy- bridize specifically to the 1850 bp fragment, proving that this fragment carries substantial coding sequences for the ILl inhib- itor.

In order to determine its DNA sequence, GTl0—IL1I-2A DNA was beta-galactosidase activity. Five such transformants were iso- .25 lated, single-stranded DNA was prepared, and sequencing was IE950517 performed according to Sanger et al. The DNA sequence of three of the transformants corresponded to the 3' end of the mRNA. while two transformants provided protein coding sequence. In Figure 13, the DNA sequence is shown that was obtained for the protein coding region of the CDNA.

Figure 13 also shows the predicted amino acid sequence. The amino acid sequence from the first amino acid Alanine to the 29th amino acid Proline and from the 79th amino acid isoleucine to the end is the hypothesized amino acid sequence. The predicted amino acid sequence from the 30th amino acid Proline to the 78th amino acid Proline agrees with the peptide sequences described in Exam- ple 3. L Example 7 Sequencing GTl0-IL-lI-2A and IL-li A portion of GT10~ILlI—2A has been sequenced and is set forth in Figure 14. The DNA encodes a protein containing amino acid sequences that are characteristic of IL-li (nucleotides 99- 557). However, it is believed that several modifications may be made to this protein before it is secreted into the extracellular milieu. These modifications may or may not be essential for the protein to have activity as an IL-li.

GT10—ILli-2A encodes at least 32 amino acids N-terminal (nucleotides 3-98) to the amino terminus of the form of IL-li known as X. It is believed that included in these 32 amino acids is a secretory leader seqeunce that starts at the M encoded by nucleotides 24-26, directs the nascent IL-li to the lE950317 extracellular milieu, and is then removed by a leader peptidase, and possibly other peptidases. The extent to which this sequence is removed in forms alpha and beta of IL-li is presently unknown. but the N-terminus of these forms is thought to be close to that of form X. Removal of the secretory leader sequence is probably required for the protein to have effective IL-li activity.

Nucleotides 349-351 of GTl0-ILlI-2A encode an N residue that is part of a concensus N-glycosylation site. On the basis of their susceptibility to digestion with N-glycanase it is believed that forms alpha and beta of IL-li are glycosylated. since form X is not believed to be susceptible to digestion with this enzyme it is believed that it is not glycosylated, although this remains a possibility that could easily be demonstrated by one of ordi- nary skill in the art of protein sequencing using the information provided here. It is believed that glycosylation at this N resi- due is not required for the protein to show effective IL-li activity.

Nucleotides 99-101 of GT10-ILli-2A encode a P (see Figure ), but no P has been detected at this position (the N-terminus) of form X of IL-li. It is possible that this residue has been modified in the mature protein. It is believed that modification of this residue is not essential for effective IL-li activity.

The presently unknown N-terminus residues of forms alpha and beta are not wholly detectable by Edman degradation and are like- ly to be modified following removal of some of the N-terminal residues of the protein encoded by GT10-ILli-2A. It is believed that this modification is not essential for effective IL-li activity.

E95031] Example 8 Expression of Genes Encoding IL-11 in Animal Cells Animal-cell expression of IL-li requires the following steps: a. Construction of an expression vector b. Choice of a host cell line c. Introduction of the expression vector into host cells d. Manipulation of recombinant host cells to increase expression levels of IL-li l. IL-li expression vectors designed for use in animal cells can be of several types including strong consitutitve expression constructs, inducible gene constructs, as well as those designed for expression in particular cell types. In all cases promoters and other gene regulatory regions such as enhancers (inducible or not) and polyadenylation signals are placed in the appropriate location in relation to the CDNA se- quences in plasmid-based vectors.

Two examples of such con- structs follow: (1) A construct using a strong constitutive pro- moter region should be made using the simian virus 40 (SV40) gene control signals in an arrangement such as that found in the plasmid pSV2CAT as described by German et al. in M01. Cel. Biol. g:l044-l0Sl,.l982, specifically incorporated herein by reference.

This plasmid should be manipulated in such a way as to substitute IE950317 the IL—1i CDNA for the chloramphenicol acetyltransferase (CAT) coding sequences using standard molecular biological techniques (Maniatis et al., sugggl, as shown in Fig. 6. (2) An inducible gene construct should be made utilizing the plasmid PMK which contains the mouse metallothionein (MT-l) promoter region (Brinster et al., Cell g1:22e-231, 1981). This plasmid can be used as a starting material and should be manipulated as shown in Fig. 7 to yield a metal-inducible gene construct.

. A number of animal cell lines should be used to express IL-li using the vectors described above to produce active pro- tein. Tvo potential cell lines that have been well-characterized for their ability to promote foreign gene expression are mouse Ltk' and Chinese hamster ovary (CHO) dhfr‘ cells, although expression of Il-li is not limited to these cell lines.

Ringold et al. in J. Mol. Appl. Genet. l:l65-175, 1981. leading to a comparable increase in IL-li protein levels. Cells containing IL-1i expression vectors (either SV40- or MT-l-based) along with a DHFR expression vector can be taken through the gene amplification protocol described by Ringold et al. (J. Mol. Appl.

Genet. l:l65-l75, 1981) using methotrexate, a competitive antago- nist of DHFR. This leads to more copies of the DHFR genes pres- ent in the cells and, concomitantly, increased copies of the IL-li genes which, in turn, can lead to more IL-1i protein being produced by the cells.

Example 9 Purification of ll-li From Recombinant Animal Cell; Since the IL-li are expected to be secreted from cells like the natural material, it is anticipated that the methods described above for purification of the natural protein will allow similar purification and characterization of the recombinant protein.

Example 10 Sequence of IL—li The amino terminal residue of IL-li has been identified several times by direct protein sequencing as an arginine (R).

The result of such sequencing is shown in Example 3. In contrast, the amino terminal residue of IL-11 predicted by the sequence of the CDNA is a proline (P). This amino terminal residue corresponds to nucleotides 85-87 in Fig. 13, and is circled in Figs. 14 and 15. This apparent disagreement between the CDNA sequence and the direct protein sequence can be resolved by assuming that an error in the CDNA sequence was incorporated during the reverse transcriptase-catalyzed synthesis from its mRNA. That is, a CGA (arginine) codon, located on the mRNA where it would code for that amino terminal residue, could have been changed during the reverse-transcriptase reaction to a CCA (proline) codon in the CDNA. This type of reverse transscriptase problem has been reported in the literature before, e.g., by B.

D. Clark et al. in Nucleic Acids Research l4:7897 (1986).

The present inventors believe that the correct amino acid sequence of the protein is as predicted by the CDNA except that the amino terminal amino acid is an arginine instead of the proline residue indicated in Figs. 13-15. The inventors contemplate that both DNA sequences and their corresponding peptide sequences fall within the scope of their invention although the amino terminal arginine sequence is preferred.

Examgle 11 A protein having the sequence: x R G L R S H L I T L I X Z P S G R K S S K 50 N 0 K T F Y L R M d U 70 N v N L E E K I D v v P 90 6 I H G G K H X L S X V 110 Q L E A V N I r o g 5 130 A F I R S D S G P T T S 150 u r L X 7 A H I A D E 170 wherein X is cysteine, serine or alanine: and Z is arginine or proxinc is also incLuded in the invention-

Claims (9)

1.CLAIMS 1. An IL-1 inhibitor (IL-1i) in substantially pure form, capable of inhibiting IL-1 induced thymocyte proliferation and having an N~terminal amino acid sequence as follows: (X) P S G R K S S K M Q A F R I W D V N Q wherein (X) is R or P.

2. The IL-1 inhibitor of Claim 1 which is at least about 90% pure. 10

3. The IL-1 inhibitor of Claim 1 which is at least about 95% pure.

4. The IL-1 inhibitor of Claim 1 which is derived from monocytes stimulated with IgG.

5. The IL-1 inhibitor of Claim 4 wherein the monocytes are 15 human monocytes.

6. The IL-1 inhibitor of Claim 1 which is derived from a host cell transformed by recombinant DNA.

7. The IL-1 inhibitor of Claim 1, 4 or 6 which is a glycosylated polypeptide. 20

8. The IL-1 inhibitor of Claim 1, 4 or 6 which is a substantially unglycosylated polypeptide. The IL-1 inhibitor of Claim 1 which is selected fro the group consisting of IL-1 inhibitor alpha, IL-1 inhibitor beta, IL-1 inhibitor X and mixtures thereof. 10. An IL-1 inhibitor in substantially pure form, capable of inhibiting IL-1 induced thymocyte proliferation and having at least a part of the following amino acid sequence or at least a part of a substantially homologous sequence: a)rsonxssxxoarnxvuvuuxrrvnnu xqnvaarnoconvxnxxxxnvvrzzrng LFLGIRGGXXCLICVRIODIIRLOLIAV x11onaxnxxonxnrxrznnnoorrrsr zsaxcrcuracrxxnanqtvstruxrnt cvxvrxrvrqxnx wherein (X) is R or P. 11. The IL-1 inhibitor of Claim 10, further including a N-terminal secretion leader sequence which is capable of directing the inhibitor out of a cell in a processed form. 12. The IL-1 inhibitor of Claim 11, wherein the secretion leader sequence has all or part of the following amino acid sequence: M E I C R G L R S H L I T L L L F L F H S E T I C. 'Ihe IL-1 inhibitor of Claim 10, which is at least about 70% homologous to the sequence shown in Claim 10. ‘me IL-1 inhibitor of claim 10, which is at least about 80% homologous to the sequence shown in Claim 10. The IL-1 inhibitor of Claim 10, which is at least about 90% homologous to the sequence shown in Claim 10. A process for producing the IL-1 inhibitor (IL-li) of Claim 1 comprising: (a) culturing monocytes in a culture medium on an IgG coated surface; and (b) isolating the IL-li from the culture medium. The process of Claim 16 wherein the cells are cultured on a human IgG coated surface. The process of Claim 16 whereinthe cells are cultured in a culture medium which is substantially serum-free. The process of Claim 16 wherein the monocytes are isolated from normal human donors. A process for preparing the IL-1 inhibitor (IL-li) of Claim 1 comprising: (a) fractionating a source of impure IL-li by anion exchange chromatography and collecting the fractions IL-li; IL-li-containing fractions obtained gel filtration chromatography and fractions containing the IL-li; and IL-1i-containing fractions obtained reversed phase chromatography and fractions containing the IL-li. containing the subjecting the in step (a) to collecting the subjecting the in step (b) to collecting the The process of Claim 20 wherein the reversed phase chromatography is perfonned on a hydrophobic chromatography resin in the absorbing group is selected from the group consisting of C4, octyl and phenyl. 'I‘he process of Claim 20 wherein in step (c) the reversed phase chromatography is substituted by a second cycle of gel filtration chromatography. A process for preparing the IL-1 inhibitor (IL-1i) of Claim 1 comprising: (a) contacting a source of impure IL-li with an antibody which specifically binds the IL—1i; and (b) separating the IL-1i from the antibody. The process of Claim 23 wherein the source of impure IL-li is contacted with a polyclonal antibody. 'I‘he process of Claim 23 wherein the source of impure IL-1i is contacted with a monoclonal antibody. The process of Claim 23, 24 or 25 wherein the source of impure IL-1i is contacted with an antibody which is immobilized on a solid support. An isolated DNA sequence coding for the IL-1 inhibitor of Claim 1. An isolated DNA sequence coding for an IL-1 inhibitor (IL-1i) capable of inhibiting IL-1 induced thymocyte proliferation comprising a cross-hybridizing DNA sequence that is detectable by cross-hybridization to the following DNA sequence : ccc rcrccaauxueccaccua rcccxrc:-rucuauaaccnc c'na'n'cc-raaxucrrccnccx GM MG 171 GA’! 670 GT3 CCC A1‘! naaaaxrccx:-ccnaaaucxrc m-aarcnuaaccacac-rcua ACTGACCTGAGCGAGMCAGAAAG '1-rc ATCCGCTCA ac mt cccccc ccccccrcccccacrraar-rec:-c uccacccccrcmccrcaccnw we are Ac: an 1-»: me we can wherein Y is C or G. OAGGACGAG 3' An isolated DNA sequence coding for an IL-1 inhibitor (IL-1i) capable of inhibiting IL-1 induced thymocyte proliferation comprising a DNA sequence that encodes an amino acid sequence substantially homologous to an amino acid sequence encoded by the cross-hybridizing DNA sequence of Claim 28. The isolated DNA sequence of Claims 28 or 29 comprising all or part of the DNA sequence listed in Claim 28. An isolated DNA sequence which is the complement of the DNA sequence of Claim 28, 29 or 30. The isolated DNA sequence of Claim 28, 29 or 30 further including at the 5' end a DNA segment coding for a secretory leader sequence which is capable of directing IL—1i out of a cell in a processed form. The isolated DNA sequence of Claim 32 wherein the segment coding for the secretory leader sequence comrises all or part of the following nucleotide sequence: ATG GAA ATC TGC AGA GGC CTC CGC AGT CAC CTA ATC ACT CTC CTC CTC TTC CTG TTC CAT TCA GAG ACG ATC TGC 3' . The isolated DNA of Claim 28, 29, 30 or 32 which is selected from CDNA, genomic or synthetic DNA. An isolated DNA which is substantially equivalent to the nucleotide sequence of Claim 28, 29, 30 or 32 by virtue of codon degeneracy. The DNA sequence of Claim 27 or 28 which is contained in lambda GT10-IL2A, having ATCC Accession No. 40488. An isolated DNA sequence which codes for a second IL-1 inhibitor which is biologically equivalent and substantially homologous to the IL-1i of claim 1. A recombinant DNA vector comprising the DNA sequence of Claim 27, 28, 29 or 37. The vector of Claim 38 which is an expression vector for IL-1 inhibitor. The vector of Claim 38 or 39 further comprising at the 5’ end of the DNA sequence coding for the IL-11, a second DNA sequence coding for a secretory leader sequence which is capable of directing the IL—1i out of a cell in processed form. IE950317 41. The vector of Claim 40 wherein the second DNA sequence codes for a naturally-occurring IL-li secretory leader sequence. ' 5 42. The vector of Claim 41 further coprising a translational coupler imediately preceding the DNA sequence coding for the IL-li. 43. The vector of Claim 42 wherein the translational coupler includes the following nucleotide sequence: 10 TAACGAGGCGCAAAAAATGAAAAAGACAGCTATCGCGATCTTGGAGGATGATTAAATG. 44. The vector of Claim 39 for use in expressing IL-11 in mammalian cells. 15 45. The vector of Claim 44 for use in expressing Ilrli in CHO cells. 46. The vector of Claim 44 or 45 which further comprises a strong constitutive promoter region upstream of the IL-li coding region. 20 47. The vector of Claim 46 wherein the promoter is an SV40 promoter. 48. The vector of Claim 39 for use in expressing ILr1i in microbial cells. 25 4

9. The vector of Claim 48 for use in expressing ILe1i in E. coli cells. 50. A transformed host cell carrying the vector of at least one of the Claims 38 to 49. 51. The host cell of Claim 50 which is a microbial cell. The host cell of Claim 51 which is an E, coli cell. The host cell of Claim 50 which is a mammalian cell. The host cell of Claim 53 which is a 010 cell. A process of using the host cell of Claims 50 to 54 to produce an IL-1 inhibitor comprising: (a) culturing the transformed host cell under conditions which allow expression of the IL-1 inhibitor and (b) isolating the IL-1 inhibitor. The process of Claim 55 further comprising the steps of denaturing the IL-1 inhibitor and allowing the IL-1 inhibitor to refold to assume an active structure. I The process of Claim 56 wherein the IL-1 inhibitor is allowed to refold prior to isolation. The process of Claim 56 wherein the IL-1 inhibitor is allowed to refold subsequent to isolation. The process of Claim 55 wherein the IL-1 inhibitor is isolated from a culture medium. The process of Claim 55 wherein the IL-1 inhibitor is isolated according to the method of Claim 21, 23 or 24. An antibody which binds to the IL-1 inhibitor of Claim 1. An antibody which binds to an IL-1 inhibitor substantially homologous to the IL-1 inhibitor of Claim 1. The antibody of Claim 61 or 62 which is a polyclonal antibody. The antibody of Claim 61 or 62 which is a monoclonal antibody. An immunoaffinity adsorbent comprising the anitibody of at least one of the Claims 61 to 64 attached to an insoluble support. A pharmaceutical composition comprising, in a pharmaceutically acceptable preparation, the IL-1 inhibitor of at least one of the Claims 1 to 15. A pharmaceutical composition comprising, in a pharmaceutically acceptable preparation, an IL-1 inhibitor that is biologically equivalent and substantially homologous to the IL-1 inhibitor of Claim 1. F. R. KELLY & co., AGENTS FOR THE APPLICANTS.,