DD300109A5 - Tissue plasminogen activator derivative - Google Patents

Abstract

The tissue plasminogen activator (t-PA) derivative is not glycosylated and has the following amino-acid sequence: <IMAGE>

Description

4. The method according to claim 1, characterized in that one introduces plasmid pA33 in host cells.

5. The method according to any one of claims 1 to 4, characterized in that one uses as host cells prokaryotic cells, in particular E. coli.

6. The method according to claim 5, characterized in that one separates to increase the yield of active protein formed inclusion bodies, solubilized by treatment with guanidine hydrochloride, then derivatized with oxidized glutathione and finally the t-PA derivative by adding L. -Arginine and GSH renatured.

7. The method according to any one of claims 1 to 6, characterized in that one uses for chromatographic purification an ETI adsorber column.

8. The method according to any one of claims 1 to 7, characterized in that one operates in the presence of 25 to 1 000mmol / l L-arginine.

9. The method according to any one of claims 1 to 8, characterized in that one carries out the chromatographic purification with the concentrate of the reactivation mixture containing 25 to 10OOmmol / l, preferably 200 to 1000mmol / l L-arginine, via an ETI adsorber column.

10. The method according to claim 9, characterized in that adjusting the concentration used for chromatographic purification to a pH of more than 7.0.

11. The method according to one of claims 1 to 10, characterized in that one carries out the elution at a pH of 4 to 6.

For this 3 pages drawings

The invention relates to a novel t-PA derivative, a DNA sequence which codes for the novel t-PA derivative, expression plasmids which have a DNA sequence coding for the t-PA derivative and a method for the preparation of decirtiger Plasmids, process for producing the t-PA derivative and a clot dissolving agent containing the t-PA derivative. Clotted blood contains polymeric fibrin as the major component of the protein matrix. Fibrin is dissolved by a fibrinolytic system under physiological conditions in a reaction cascade that is similar to that of blood clotting. The central reaction here is the activation of plasminogen to plasmin, the z. B. by the tissue plasminogen activator t-PA (tissue type plasminogen activator) is effected. In turn, plasmin dissolves fibrin, which is the major component of the protein matrix of clotted blood. The enzymatic activity of natural or eukaryotic genetically engineered t-PA, namely the catalytic activation of plasminogen to plasmin, is very low in the absence of fibrin or fibrinogen cleavage products, but can be significantly increased in the presence of these proteins, more than that Factor t-PA is cleaved in the blood by existing proteases into an A and a B chain. The two partial chains remain connected via a cysteine bridge. The stimulability of the activity of t-PA is a decisive advantage over other known plasminogen activators, such as. B. Urokinase or streptokinase (see, for example, Hoylaerts et al., J. Biol. Chem., (1982), 2912-2919; W. Nieuwenhuizen et al., Blechern. Biophys. Acta, 755 (1983), 531- 533).

The mechanism of action of t-PA in vivo is, for example, in Korniger and Collen, Thromb. Haemostasis 46 (1981), 561-565. The activity of the enzyme focussed on the fibrin surface appears to be a suitable means of controlling pathological vein occlusions (eg in myocardial infarction), which has been largely confirmed by clinical trials (Collen et al., Circulation 70 [1984], 1012; Circulation 73 [1986], 511).

As a disadvantage of t-PA, however, the rapid decrease in its plasma concentration (clearance rate) must be considered. The consequence of this is that a relatively large amount of t-PA is required to achieve effective in vivo lysis of thrombi. As bleeding, the result. In EP 0196920 a natural degradation product of t-PA is described welcnes only contains the kringle II and the Protea ^r e domains of t-PA and its N-terminal amino acid alanine 160 of Pennica et al., Nature 301 (1983), 214-J21. However, the rate of clearance of this t-PA degradation product is not significantly different from that of natural t-PA. Only by a chemical modification of the catalytic region by attaching a blocking group can an improvement be achieved here.

The object of the invention is therefore to modify t-PA such that the resulting derivative has a greatly reduced clearance rate and thus a prolonged half-life in the blood plasma. In this case, the thrombolytic effect and the stimulability by fibrin should be preserved.

The invention therefore relates to a tissue plasminogen activator (t-PA derivative, also called K1K2P in the examples), which is characterized in that it is not glycosylated and consists of the following amino acid sequence:

Ser Tyr Gin VaI lie Asp Thr Arg Ala Thr Cys Tyr GIu Asp Gin GIy

5 10 15

He Ser Tyr Arg Gly Thr Trp Ser Thr Ala Glu Ser Gly Ala Glu Cys 20 25 30

Thr Asn Trp Asn Ser Ser Ala Leu Ala Gin Lys Pro Tyr Ser Arg Arg 35 40 45

Arg Pro Asp Ala He Arg Leu GIy Leu GIy Asn His Asn Tyr Cys Arg 50 55 60

Asn Pro Asp Arg Asp Ser Lys Pro Trp Cys Tyr VaI Phe Lys Ala GIy 65 70 75 80

Lys Tyr Ser Ser Glu Phe Cyc Ser Thr Pro AIa Cys Ser Glu Gly Asn

85 90 95

Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr Arg Gly Thr His Ser 100 105 HO

Leu Thr GIu Ser GIy AIa Ser Cys Leu Pro Trp Asn Ser Met He Leu 115 120 125

Hey GYy Lys VaI Tyr Thr Ala GIn Asn Pro Ser Ala Gin AIa Leu GIy 130 · 135 140

Leu GIy Lys His Asn Tyr Cys Arg Asn Pro Asp GIy Asp Ala Lys Pro 145 150 155 160

Trp Cys His VaI Leu Lys Asn Arg Arg Leu Thr Trp GIu Tyr Cys Asp

165 170 175

VaI Pro Ser Cys Ser Thr Cys GIy Leu Arg GIn Tyr Ser Gin Pro GIn 180 185 190

Phe Arg He Lys Gily Gily Leu Phe Ala Asp He Ala Ser His Pro Trp 195 200 205

Gin Ala Ala He Phe AIa Lys His Arg Arg Ser Pro GIy GIu Arg Phe 210 215 220

Leu Cys GIy GIy He Leu He Ser Ser Cys Trp He Leu Ser Ala AIa 225 230 235 240

His Cys Phe Gin Giu Arg Phe Pro Pro His His Lei Thr Vai He Leu

245 250 255

Gly Arg Thr Tyr Arg VaI VaI Pro GIy GIu GIu GIu GIn Lys Phe GIu 260. 265 270

VaI GIu Lys Tyr lie VaI His Lys GIu Phe Asp Asp Asp Thr Tyr Asp 275 280 285

Asn Asp Ala Leu Leu Gin Leu Lys Ser Asp Ser Ser Arg Cys Ala 290 295 300

Gin GIu Ser Ser VaI VaI Arg Thr VaI Cys Leu Pro Pro Ala Asp Leu 305 310 315

Gin Leu Pro Asp Trp Thr GIu Cys Glu Leu Ser GIy Tyr Gly Lys His

325,330,335

GIu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Giu Ala His VaI 340 345 350

Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gin His Leu Leu Asn Arg 355 360 365

Thr VaI Thr Asp Asn Met Leu Cys Ala GIy Asp Thr Arg Ser GIy GIy 370 375 380

Pro Gin Ala Asn Leu His Asp Ala Cys Gin Giy Asp Ser GIy GIy Pro 385 390 395 "

Leu VaI Cys Leu Asn Asp GIy Arg Met Thr Leu VaI GIy lie He Ser

405 410 415

Trp GIy Leu GYy Cys GIy Gin Lys Asp VaI Pro GIy VaI Tyr Thr Lys 420 425 430

VaI Thr Asn Tyr Leu Asp Trp He Arg Asp Asn Met Arg Pro 435 440 445

Surprisingly, it was found that the deletion of the remaining regions present in native t-PA has no effect on the thrombolytic activity of the protein and the fibrin-precipitated stimulability of the mutein is equal to that of native t-PA.

A further subject of the invention is a DNA sequence which codes for the t-PA derivative according to the invention and contains the following sequence:

atgtcttaccaagtgatcgataccagggccacgtgctacgaggaccagggcatcagctac aggggcacgtggagcacagcggagagtggcgccgagtgcaccaactggaacagcagcgcg ttggcccagaagccctacagcgggcggaggccagacgccatcaggctgggcctggggaac cacaactactgcagaaacccagatcgagactcaaagccctggtgctacgtctttaaggc'g gggaagtacagctcagagttctgcagcacccctgcctgctctgagggaaacagtgactgc tactttgggaatgggtcagcctaccgtggcacgcacagcctcaccgagtcgggtgcctcc tgcctcccgtggaattccatgatcctgataggcaaggtttacacagcacagaaccccagt gcccaggcactgggcctgggcaaacataattactgccggaatcctgatggggatgccaag ccctggtgccacgtgctgaagaaccgcaggctgacgtgggagtactgtgatgtgccctcc tgctccacctgcggcctgagacagtacagccagcctcagtttcgcatcaaaggagggctc ttcgccgacatcgcctcccacccctggcaggctgccatctttgccaagcacaggaggtcg cccggagagcggttcctgtgcgggggcatactcatcagctcctgctggattctctctgcc.

gcccactgcttccaggagaggtttccgccccaccacctgacggtgatcttgggcagaaca taccgggtggtccctggcgaggaggagcagaaatttgaagtcgaaaaatacattgtccat aaggaattcgatgatgacacttacgacaatgacattgcgctgctgcagctgaaatcggat tcgtcccgctgtgcccaggagagcagcgtggtccgcactgtgtgccttcccccggcggac ctgcagctgccggactggacggagtgtgagctctccggctacggcaagcatgaggccttg tctcctttctattcggagcggctgaaggaggctcatgtcagactgtacccatccagccgc

tgcacatcacaacatttacttaacagaacagtcaccgacaacatgctgtgtgctggagac actcggagcggcgggccccaggcaaacttgcacgacgcctgccagggcgattcgggaggc cccctggtgtgtctgaacgatggccgcatgactttggtgggcatcatcagctggggcctg ggctgtggacagaaggatgtcccgggtgtgtacacaaaggttaccaactacctagactgg attcgtgacaacatgcgaccg 1341

The DNA sequence according to the invention is used for expression of the t-PA derivative according to the invention when it is present on an expression plasmid. Such an expression plasmid is a further subject of the invention, as is an expression plasmid which has a DNA sequence differing therefrom, but which also codes for the t-PA derivative according to the invention. Due to the degeneracy of the genetic code, sequences deviating from the DNA sequence shown are also suitable for this purpose.

The expression plasmid contains, in addition to an origin of replication, in addition to the sequence coding for the t-PA derivative, additionally an regulatable promoter structure (eg tac promoter), an efficient terminator (eg fd), a Selection marker (eg, β-lactamase gene).

Another subject of the invention is the plasmid pA33. The preparation of this plasmid is described in Example 1, it contains a DNA sequence which codes for the t-PA derivative according to the invention.

Yet another subject of the invention is a process for the preparation of one of the expression plasmids according to the invention, which is characterized in that a DNA sequence coding for the t-PA protein according to the invention or a derivative thereof, which via the Kringle I, Kringel II and the protease domains further comprises regions of the t-PA protein, encodes, introduces into a plasmid and directed by directed mutagenesis those regions which code for amino acids which are not present in the t-PA derivative according to the invention.

The selection of the plasmid into which the DNA sequence coding for the t-PA derivative according to the invention is introduced depends on the host cells used later for the expression of the derivative. Suitable plasmids, as well as the minimal requirements imposed on such a plasmid (eg, origin of replication, restriction cut delta)

known to a person skilled in the art. In the context of the invention, however, instead of a plasmid, it is also possible to use a cosmid, the replicative, double-stranded form of phages (λ, M13), and other vectors known to the person skilled in the art. The method of site-directed mutagenesis is described by Morinaga et al., Biotechnology 21, (1984), 634, and is carried out essentially as described therein.

Yet another object of the invention is a process for the preparation of a t-PA derivative according to the invention which comprises expressing one of the plasmids of the invention in suitable host cells and the product from the culture medium or after digestion of the host cells from the liquid, in the digestion was carried out (eg buffer or also the culture medium) wins. Preferably, prokaryotic cells are used as host cells for the preparation of the t-PA derivative according to the invention. In this case, it is again particularly preferred that the so-called "inclusion bodies" (insoluble protein aggregates) which form here are first separated from the soluble cell particles, the t-PA-containing inclusion bodies solubilized by treatment with guanidine hydrochloride, and then oxidized De-derivatizing glutathione and finally renaturing the t-PA derivative by addition of L-arginine and guanidine hydrochloride Detailed instructions for the activation of t-PA from inclusion bodies are disclosed, for example, in patent applications EP-A 0219874 and EP-A 0241002. However, any other methods for obtaining the active protein from inclusion bodies can also be used according to the invention.

The process according to the invention is preferably carried out in the presence of L-arginine, in particular in a concentration of 25 to 1000 mmol / l.

The separation according to the invention of foreign protein via an affinity chromatography is carried out in a preferred embodiment of the invention via an ETI (Erythrina trypsin inhibitor) adsorber column. Here is ETI on a support material (adsorber), such as. B. BrCN Sepharpse fixed. Purification via an ETI adsorber column has the advantage that the ETI adsorber column material can be loaded directly from the concentrated reoxidation mixture even in the presence of arginine concentrations as high as 0.8 mol / l. Aggregation of p-t-PA, which can take place at low arginion concentrations below 25 mmol / l, is thus avoided. The purification of the p-t-PA preparation therefore particularly preferably takes place via an ETI adsorption column in the presence of 0.2 to 1.0M, preferably 0.5 to 1.0M arginine. The solution containing K1 K2P / Pro preferably has a pH of more than 6.5, particularly preferably more than 7. The elution from the ETI column is carried out by lowering the pH in the presence of arginine under conditions which have a good solubility of t -PA expressed in prokaryotes. The pH during the elution is preferably in the acidic range, more preferably in the range from 4 to 6.

A K1K2P / Pro preparation produced according to the invention has a specific t-PA activity of 2 = 0.4 × 10 ^e IU / mg, preferably S0.6 × 10 ⁶ IU / mg, its stimulability by fibrinogen cleavage products (activity in the presence of fibrinogen peptides / Activity without fibrinogen peptides) is greater than 10 times, preferably greater than 20 times. The purity of the preparation according to the invention is more than 90% and preferably more than 95%, more preferably more than 98%.

The t-PA derivative according to the invention is therefore particularly suitable for use in a drug for clot dissolution, which in turn is a further object of the invention.

The following example illustrates the invention in conjunction with the image; continue.

Fig. 1: shows schematically the preparation of the plasmid ρ Α 33.

Fig. 2: shows the time course of the t-PA activity plasma concentration after intravenous bolus infection of commercial

available t-PA (ACTILYSE®) in a linear representation in comparison with the t-PA derivative according to the invention, and FIG. 3: shows the concentration profile in logarithmic representation.

example 1

Construction of the plasmid ρ Α 33

The starting plasmid was pePa 133, which is described in the application EPO 0242836. All experimental steps for specific mutagenesis, i. for the deletion of the domains F and E from pePa 133 (see FIG

essentially using the method of Morinaga et al., Biotechnology 21 (1984), 634. Peptide 133 produced two cleavage mixtures for this purpose. Batch A was cleaved with EcoFU and the largest fragment isolated. Approach B

was cleaved with Xhol to linearize the product. For heteroduplex formation, the following oligonucleotide was used

used:

5 'TAC CAA GTG ATC GAT ACC AGG GCC 3'

By colonial hybridization with the above-mentioned mutagenesis oligonucleotide, those clones were detected which contained the desired plasmid pA33. This plasmid was characterized by restriction analysis and screened for the absence of the Sspl restriction site located in the finger domain-encoding portion of the t-PA expression cassette.

Example 2

Preparation of active K1K2P / Pro from E. coli

a) Cell Lysis and Preparation of Inclusion Bodies (IBs)

1.6 kg of cell wet weight (E. coli, DSM 3689) transformed with the plasmid pA33 were suspended in 1010.1 mol / l Tris-HCl, 20 mmol / l EDTA, pH 6.5, 4 ° C. To this was added 2.5 g of lysozyme and incubated at 4 ° C for 30 minutes; then complete cell digestion was performed by high pressure dispersion. 510.1 mmol / l Tris-HCl, 20 mmol / l EDTA, 6% Triton X100 and 1.5 mol / l NaCl, pH 6.5 were added to the digestion solution and the mixture was incubated for a further 30 minutes at 4.degree. This was followed by the separation of the insoluble constituents (IBs) by centrifugation.

The pellet was suspended in 1010.1 mol / l Tris-HCl, 20 mmol / l EDTA, pH 6.5, incubated for 30 minutes at 4 ° C and IB preparation isolated by subsequent centrifugation.

b) Solubilization of the IBs

8.7 g IBs (wet weight) were suspended in 100 ml 0.1 M Tris, 6 M guanidine, 0.1 M DTE, pH 7.5 and stirred at 25 ° C for 30 min

 After adjusting the pH to pH 3 with HCl (25%), dialysis was performed against 4 mol / l guanidine-HCl, pH 2.5 (3 x 31.24 h, 4 ° C).

c) derivatization

The abovementioned dialysate was adjusted with oxidized glutathione (GSSG) ad 50 mmol / l and Tris ad 100 mmol / l and the pH was titrated to 7.5 with 5 mol / l NaOH. The mixture was incubated for 90 min at 25 ^C C. After the pH had been adjusted to pH 3 with HCl (25%), dialysis was carried out against 10 mmol / l HCl (3 × 1001.48 h, 4 ° C.).

d) Naturation

A 10-L reaction vessel was filled with 0.8 mol / L of Arg / HCl, pH 8.5.1 mmol / L EDTA, 1 mmol / L GSH (glutathione). Naturierung was carried out at 20 ° C by adding 3 times the 100ml of the previously dialyzed against 6M0I / I guanidine-HCl, pH 2.5 derivative at intervals of 24 hours.

After the renaturation, a material with a specific activity of 50-75 KU / mg is obtained (test according to H. LiII, Z. Gesamt Inn. Med., Their Grenzgeb. (1987), 42, 478-486).

e) Concentration of the Renaturler approach

The restorer approach may be concentrated as needed via a hemodialyzer.

Example 3

Purification of K1 K2P / Pro from E.coll

The purification of K1K2P / Pro from E..coli is carried out by affinity chromatography on Erythrina trypsin inhibitor

(ETI) -Sepharose.

The Naturierungsansatz was concentrated on a hemodialyzer (Asahi AM 300) 1: 5, dialyzed overnight against 0.8 mol / l Arg / HCl, pH 7.5 and centrifuged. A ETI-Sepharose column (120 ml) equilibrated with 0.8 mol / l Arg / HCl, pH 7.5, was charged with 1.81 dialysate (4 column volumes / SV) / h) and while buffered (0.8 mol / l Arg / HCl, pH7.5.0, 5 mol / l NaCl) until the absorbance of the eluate at 280 nm reaches the blank of the buffer. After a second wash with 5SV 0.3 mol / l Arg / HCl, pH 7.0, the elution with 0.3 mol / l Arg / HCl, pH4.5.

Volume activity C _P , _O |. SA F *

ml KU / ml mg / ml KU / mg

Dialysate 1800 74 1.05 70 15

K1K2P pool 200 610 0.82 744 28

F = stimulation by fibrin = activity in the presence of fibrin / activity without fibrin.

Example 4

Characterization of purified K1K2 P / Pro from E. coil

a) Protein chemical characterization

- SDS-PAGE and reverse phase HPLC

The homogeneity of the material purified by affinity chromatography on ETI-Sepharose was shown by SDS-PAGE and by reverse phase HPLC (RP-HPLC). Electrophoretic analysis of the purified material revealed an apparent molecular weight of 50800 Da ± 2000 Da for the K1K 2 P relative route from E. coli. The densitometric evaluation showed a purity of> 90%.

RP-HPLC is based on the different interaction of proteins with hydrophobic matrices. This property was used as an analytical method for quantifying the degree of purity.

The purified K1 K2 P / Pro from E. coli was analyzed on a Nucleosil 300 separation column (Knauer) using a trifluoroacetic acid / acetonitrile gradient (buffer A: 1.2 ml trifluoroacetic acid in 1000 ml H ₂ O; buffer 6: 300 ml H ₂ 0.700 ml acetonitrile, 1 ml trifluoroacetic acid, 0-100%). The integration of the chromatographic analysis showed a purity of> 95%.

- N-terminal sequence

The N-terminal amino acid sequence was determined using an ABI470 Sequentor with standard program and on-line PTH detection. The sequence found, S1-Y2-Q3-V4-I5-D6-T7-R8-A9-T10-C11-Y12-E13-D14, agrees with the anticipated sequence deduced from the DNA sequence.

b) determination of activity

The in vitro activity of K1K 2 P / Pro from E. coli was determined according to H. LiII, Z. Gesam inn. Med. Her Grenzgeb. (1987), 42, 478-486. The specific activity (SA) was 650000IU / mg ± 200000IU / mg. The stimulability of K1 K2 P / Pro from E. coli by BrCN fragments of the fibrin gas (activity in the presence of fibrinogen fragments divided by activity without fibrinogen fragments) was 25-30 in this test system.

c) in vitro binding to fibrin

The in vitro binding of K1 K2P / Pro to fibrin was determined by the method described by Higgins and Vehar (Higgins, D.L., and Vehar, G.A., [1987] Biochem. 26.778 <5-7791).

This shows that K1 K2P / Pro, in contrast to t-PA from CHO cells has no significant fibrin binding.

Example 5

Pharmacokinetics of K1K2P / Pro in rabbits

K1 K2P / Pro was compared in white New Zealand rabbits with Actilyse® (Alteplase, Thomae GmbH, Biberach, FRG) in its pharmacokinetic properties. Both fibrinolytic agents were injected intravenously at a dose of 200,000 IU / kg body weight (BW) for 1 min. Plasma samples were collected before and at defined time point after injection. The t-PA activity in the plasma was measured by a spectrophotometric assay according to J. H. Verheijen et al. (Thromb, Haemostas, 48, 266, 1982), modified to H. LiII (Z. Ges., Inn. Med., 42, 478, 1987).

For the calculation of pharmacokinetic parameters, a computer program of non-linear regression was used, modified according to H.Y. Huang (Aero-Astronautics Report 64, Rice University 1-30, 1 'x 69). When fitting the curve, a 1 - or 2-compartment model was assumed to be individually different. Vo! the B>. "In each case, the value of the body's basal level was subtracted from the following values.

K 1K2P / Pro is only eliminated in 2 of 6 animals with a fast α and a slow β phase. In these 2 animals, the alpha phase content of the total elimination is 53%. By contrast, all animals in the Actilyse® group have a rapid alpha phase, accounting for more than 70% of total elimination. K1 K 2 P / Pro is mainly eliminated with only one half-life, which is 15.1 ± 3.1 min. By contrast, Actilyse® has a fast half-life of 1.63 min and a slow half-life of 10.1 min (Table 1). The total plasma clearance of K1 K2P / Pro is 6.3 ± 1.5 ml / kg / min, which is significantly lower than Actilyse * (CI, ₀ , = 22.9 ± 9.1 ml / kg / min).

Overall, K1! <2 P / Pro is a t-PA mutant that has a markedly improved pharmacokinetic profile compared to Actilyse® as the prior art (Figures 2 and 3).

Examples

Pharmakodynamlk of K1K2P / Pro in rabbits

To test for thrombolytic efficiency, the method described by D. Collen et al. established rabbit model of jugular venous thrombosis applied (J.CIin.lnvest.71,368,1983). The fibrinolytic agents and the solvent were injected intravenously over 1 min as a bolus. Subsequently, the thrombolysis rate was determined and selected parameters of the coagulation system and the platelet count were determined (Table 2).

At the same dose (200000IU / kg bw), K1K2P / Pro achieved a statistically significantly higher thrombolysis rate of 50.7 ± 6.5% after intravenous bolus injection than Actilyse® (24.1 ± 3.7%). The comparable dose of Actilyse® in K1 K2 P / Pro's thrombolytic efficiency is 800000IU / kg bw (Table 2).

With equipotent dosing of K1K 2 P / Pro in comparison with Actilyse®, the coagulation parameters fibrinogen, plasminogen and alpha ₂ -antiplasmin have little effect on the coagulation parameters, but they do not differ from the effects of an equipotent dose of Actilyse®.

K1 K2P / Pro is thus a t-PA mutant with a thrombolytic efficiency in the rabbit model of jugular vein thrombosis after bolus injection, which is significantly increased compared to Actilyse®.

K1K2 P / Pro has retained its fibrin specificity to the same extent as Actilyse®.

Example 7

Optimized expression in E. coli

To increase the expression yield, the sequence coding for the K1K2 P gene was recloned into a high copy number plasmid. For this purpose, the plasmid pePa 126.1 described in dor patent application P 3931933.4 was used. This plasmid is composed essentially of the vector pKK 223-3 and the coding sequence for t-PA, as described in the application EP-A-0242835.

The sequence of an fd terminator was first integrated into this plasmid. For this purpose, rlas plasmid pePA 126.1 was linearized with the restriction enzyme Hind III. The thus cleaved plasmid was separated by gel electrophoresis and prepared by preparative means. Pas plasmid pLBU 1 (Gentz et al. (19811PNAS 78 (8): 4963) was restricted with Hind III, and an approximately 360 bp Hind-Ill fragment containing the fd terminator was prepared by gel electrophoresis and gel elution linearized plasmid pePa 126.1 and the 360 bp Hind III fragment from pLBU1 were ligated in. The ligation mixture was cotransformed with the plasmid pUBS 500 described in application P 3931933.4 in E. coli, DSM 2102. From the clones, those were selected which contained the desired plasmid pePa 126fd, which differs from the starting plasmid pePa 126.1 in that it contains a second Hind-IIII site.

Two fragments were recovered from the plasmid pePa 126fd: a 3.4kb BamHI / Pvul fragment and an approximately 1.3kb Pvul / Xmal fragment. The two mentioned fragments were ligated with an approximately 1.6 kb BamHI / Xmal-Fragmont from the plasmid pA33 and transformed with the plasmid pUBS 500 in E. coli. The resulting plasmid was named ρA33 fd and can be distinguished from pePa 126fd in that, in a restriction assay with EcoRI, the second smallest EcoRI fragment from pePa 126fd of about 610 bp in pA33fd is shortened by about 250 bp.

table

Pharmacokinetic parameters derived from computer calculations of plasma concentration-time data on anesthetized t-PA activity

Rabbit after iv bolus injection of 200 000 IU / kg bw K1K2P / Pro or Actilvse ^R

fibrinolytic t _w2 a (min) ^ -1 / 2 B (min) Cinj. (IU / ml) V. * (ml / kg) Cltot * (mlxkg " ¹ xmin" ¹ ) "UC ₆ χ tra ρ ο I. ^X (IUxml- ¹ xh) Actiiyse ^R (n = 6) 1.63 10.1 (n = 5) 3051.9 ± 1318.8 63.2 +29.3 22.9 ± 9.1 161.1 ± 49.8 K1K2P / Pro (n = 6) 8.9 (n = 2) 15.1 ± 3.1 1695.9 ± 345.4 119.1 ± 26.6 6.3 ± 1.5 556.4 ± 118.8

Mean + standard deviation

* V _C = volume of distribution of the central compartment Cl _tot = total plasma clearance

AUC = area under the curve; for the application of a fibrinolytic for bolus injection, the area under the curve ("AUC") is of particular interest because it allows a comparison of the plasma concentrations over time.

Table 2 Thrombolvserate, platelet count and selected parameters of the coagulation system

iv »Bolus (over 1 min) from Actilyse ^R , K1K2P / Pro or Solvent on

Rabbit model of jugular vein thrombosis

• •Solvent Actilyse ^R 200 000 IU / kg body weight K1K2P / Pro 200,000 IU / kg KG Actilyse "800 000 IU / kg KG Thrombolysis rate (%) 12.9 + 0.9 24.1 + 3.7 50.7 + 6.5 44.6 + 4.8 Fibrinogen (%) 89.5 + 2.1 90.5 + 2.6 81.1 + 5.1 81.4 + 3.4 Plasminogen (%) 90.5 + 2.7 83.8 + 4.4 60.1 + 4.3 69.6 + 3.3 Ct ₂ antiplasmin (%) 90.9 + 4.4 100.8 + 5.3 67.6 + 6.7 74.2 + 5.9 PTT (%) 113.8 + 4.9 112.9 + 4.3 113.1 + 3.0 115.1 + 5.5 Platelets (%) 86.1 +12.1 91.4 + 4.9 84.4 + 8.3 86.3 + 2.8

Coagulation parameters and platelet count as% of baseline before injection PTT = partial thromboplastin time

Mean + SEM each group η = 6 animals

Claims (3)

A process for producing a tissue plasminogen activator (t-PA) derivative which is non-glycosylated and which has the following amino acid sequence: Ser Tyr Gin VaI lie Asp Thr Arg Ala Thr Cys Tyr GIu Asp Gin GIy 5 10 15 He Ser Tyr Arg Gly Thr Trp Ser Thr AIa Giu Ser GIy Ala GIu Cys 20 '25 30 Thr Asn Trp Asn Ser Ser Ala Leu Ala Gin Lys Pro Tyr Ser Arg Arg 35 40 45 Arg Pro Asp Ala He Arg Leu GIy Leu GIy Asn His Asn Tyr Cys Arg 50 55 60 Asn Pro Asp Arg Asp Ser Lys Pro Trp Cys Tyr VaI Phe Lys Ala GIy 65 70 75 80 Lys Tyr Ser Ser GIu Phe Cys Ser Thr Pro AIa Cys Ser GIu GIy Asn 85 90 95 Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr Arg Gly Thr His Ser 100 105 110 Leu Thr GIu Ser GIy AIa Ser Cys Leu Pro Trp Asn Ser Met He Leu 115 120 125 Hey GYy Lys VaI Tyr Thr Ala GIn Asn Pro Ser Ala Gin AIa Leu GIy 130 135 140 Leu GIy Lys His Asn Tyr Cys Arg Asn Pro Asp GIy Asp Ala Lys Pro 145 150 155 160 Trp Cys His VaI Le ι Lys Asn Arg Arg Leu Thr Trp GIu Tyr Cys Asp 165 170 175 VaI Pro Ser Cys Ser Thr Cys GIy Leu Arg GIn Tyr Ser Gin Pro GIn 180 185 190 Phe Arg He Lys GIy GIy Leu Phe Ala Asp He Ala Ser His Pro Trp 195 - 200 205 Gin Ala Ala He Phe AIa Lys His Arg Arg Ser Pro GIy GIu Arg Phe 210 215 220 Leu Cys GIy GIy He Leu He Ser Ser Cys Trp He Leu Ser Ala AIa 225 230 235 240 His Cys Phe Gin Giu Arg Fhe Pro Pro His His Lei Thr Vai He Leu 245 250 255 GIy Arg Thr Tyr Arg VaI VaI Pro GIy GIu GIu GIu GIn Lys Phe GIu 260 265 270 VaI GIu Lys Tyr He VaI His Lvs GIu Phe Asp Asp Asp Thr Tyr Asp 275 280 285 Asn Asp He Ala Leu Lei Gin Leu Lys Ser Asp Ser Ser Arg Cys AIa 290 295 300 Gin GIu Ser Ser VaI VaI Arg Thr VaI Cys Leu Pro Pro Ala Asp Leu 310 315 320 Gin Leu Pro Asp Trp Thr GIu Cys Glu Leu Ser GIy Tyr Gly Lys His 325,330,335 GIu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Giu Ala His VaI 340 345 350 Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gin His Leu Leu Asn Arg 355 360 365 Thr VaI Thr Asp Asn Met Leu Cys Ala GIy Asp Thr Arg Ser GIy GIy 370 375 380 Pro Gin Ala Asn Leu His Asp Ala Cys Gin GIy Asp Ser GIy GIy Pro 390 395 400 Leu VaI Cys Leu Asn Asp GIy Arg Met Thr Leu VaI Gily Lie lie Ser 405 410 415 Trp GIy Leu GYy Cys GIy Gin Lys Asp VaI Pro GIy VaI Tyr Thr Lys 420 425 430 VaI Thr Asn Tyr Leu Asp Trp lie Arg Asp Asn Met Arg Pro
435 440 445 characterized in that there is a DNA sequence for the entire t-PA protein or a derivative thereof, in addition to the Kringel I, Kringel II and the protease domains other areas of the t-PA protein has coded, introduced into a plasmid and directed by site directed mutagenesis those areas that encode amino acids that are not present in the t-PA derivative, the plasmid obtained in suitable host cells and brings the
Expression product from the culture medium or after digestion of the host cells wins. 2. The method according to claim 1, characterized in that the DNA sequence for the
t-PA protein or a derivative thereof using the corresponding cDNA. 3. The method according to claim 1, characterized in that one uses a DNA having the following sequence. atgtcttaccaagtgatcgataccagggccacgtgctacgaggaccagggcatcagctac aggggcacgtggagcacagcggagagtggcgccgagtgcaccaactggaacagcagcgcg ttggcccagaagccctacagcgggcggaggccagacgccatcaggctgggcctggggaac cacaactactgcagaaacccagatcgagactcaaagccctggtgctacgtctttaaggcg gggaagtacagctcagagttctgcagcacccctgcctgctctgagggaaacagtgactgc tactttgggajitgggtcagcctaccgtggcacgcacagcctcaccgagtcgggtgcctcc tgcctcccgtggaattccatgatcctgataggcaaggtttacacagcacagaaccccagt gcccaggcactgggcctgggcaaacataattactgccggaatcctgatggggatgccaag ccctggtgccacgtgctgaagaaccgcaggctgacgtgggagtactgtgatgtgccctcc tgctccacctgcggcctgagacagtacagccagcctcagtttcgcatcaaaggagggctc ttcgccgacatcgcctcccacccctggcaggctgccatctttgccaagcacaggaggtcg cccggagagcggttcctgtgcgggggcatactcatcagctcctgctggattctctctgcc gcccactgcttccaggagaggtttccgccccaccacctgacggtgatcttgggcagaaca taccgggtggtccctggcgaggaggagcagaaatttgaagtcgaaaaatacattgtccat aaggaattcgatgatgacacttacgacaatgacattgcgctgctgcagctgaaatcggat tcgtcccgctgtgcccaggagagcagcgtggtccgcactgtgtgccttcccccggcggac CTGCAGCTGCCGGACTGGACGGAGTGTGAGCTCTCCGGCTACGGCAAGCATGAGGCCTTG tctcctttctattcggagcggctgaaggaggctcatgtcagactgtacccatccagccgc tgcacatcacaacatttacttaacagaacagtcaccgacaacatgctgtgtgctggagac actcggagcggcgggccccaggcaaacttgcacgacgcctgccagggcgattcgggaggc cccctggtgtgtctgaacgatggccgcatgactttggtgggcatcatcagctggggcctg ggctgtggacagaaggatgtcccgggtgtgtacacaaaggttaccaactacctagactgg attcgtgacaacatgcgaccg 1341