NZ233796A - T-pa derivative, recombinant production - Google Patents
T-pa derivative, recombinant productionInfo
- Publication number
- NZ233796A NZ233796A NZ233796A NZ23379690A NZ233796A NZ 233796 A NZ233796 A NZ 233796A NZ 233796 A NZ233796 A NZ 233796A NZ 23379690 A NZ23379690 A NZ 23379690A NZ 233796 A NZ233796 A NZ 233796A
- Authority
- NZ
- New Zealand
- Prior art keywords
- ser
- gly
- leu
- arg
- ala
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6456—Plasminogen activators
- C12N9/6459—Plasminogen activators t-plasminogen activator (3.4.21.68), i.e. tPA
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6456—Plasminogen activators
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21069—Protein C activated (3.4.21.69)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Veterinary Medicine (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Diabetes (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Luminescent Compositions (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Nitrogen Condensed Heterocyclic Rings (AREA)
Abstract
The tissue plasminogen activator (t-PA) derivative is not glycosylated and has the following amino-acid sequence: <IMAGE>
Description
_23 37 96
Priority Dais!,
S*;-:.' '■.':ct.on Fiies: :
Class: I /l.t j>x..."<a.v:.!.(
Publication Date: P.O. Journal. Nc:
ZEiE'M
NEW ZEALAND PATENTS ACT, 1953
No.:
Date:
COMPLETE SPECIFICATION
derivative op tissue-type plasminogen activator
NEW ZEALAND •:ATENT OFFICE
1
"> A
4 MAY J990
we. boehringer mannheim gmbh, a West German company of Sandhofer
Strasse 112-132, D-6800 Mannheim-Waldhof, West Germany hereby declare the invention for which "S3 we pray that a patent may be granted to S2/us, and the method by which it is to be performed, to be particularly described in and by the following statement:-
23 3 7
Description
The invention concerns a new t-PA derivative, a DNA sequence which codes for the new t-PA derivative, expression plasmids which contain a DNA sequence which codes for the t-PA derivative as well as a process for the preparation of such plasmids, a process for the production of the t-PA derivative and an agent for dissolving blood clots which contains the t-PA derivative.
Coagulated blood contains polymeric fibrin which is the main component of the protein matrix. Fibrin is dissolved under physiological conditions by a fibrinolytic system in a reaction cascade which is similar to that of blood coagulation. The central reaction in this is the activation of plasminogen to plasmin which is for example mediated by the tissue-type plasminogen activator t-PA. Plasmin, in turn, dissolves fibrin which is the main component of the protein matrix of coagulated blood. The enzymatic activity of natural t-PA or t-PA obtained from eukaryotes by genetic engineering, i.e. the catalytic activation of plasminogen to plasmin, is very low in the absence of fibrin or fibrinogen cleavage products, but it can be substantially increased in the presence of these proteins, namely by more than ten-fold.
T-PA is cleaved by proteases present in the blood into an A-chain and a B-chain. Both parts of the chain remain bound via a cysteine-bridge. The ability to stimulate the activity of t-PA is a significant advantage in comparison with other known plasminogen activators such as, for example urokinase or streptokinase (cf. for example M. Hoylaerts et al., J. Biol. Chem. 257 (1982),
2337
2912-2919; W. Nieuwenhuizen et al., Biochem. Biophys. Acta, 755 (1983), 531-533).
The mechanism of action of t-PA in vivo is described for example in Korniger and Collen, Thromb. Hamostasis 46 (1981), 561-565. The focus of enzymatic activity on the fibrin surface would seem to make it a suitable agent for the treatment of pathological vascular occlusions (for example myocardial infarction) which has been confirmed to a large extent by clinical trials (Collen et al., Circulation 70. (1984), 1012; Circulation 73. (1986) , 511).
A disadvantage of t-PA is however the rapid decrease in its plasma concentration (clearance rate). As a result, a relatively large amount of t-PA is necessary to achieve an effective lysis of thrombi. On the other hand, high therapeutic doses result in side effects such as for example bleeding.
A natural degradation product of t-PA is described in EP 0 196 92 0 which only contains the kringle 2 and the protease domains of the t-PA, and whose N-terminal amino acid is alanine 160 of the amino acid sequence described by Pennica et al. in Nature 301 (1983), 214-221. The clearance rate of this product of t-PA degradation does not, however, differ significantly from that of the natural t-PA. An improvement of this can only be achieved by a chemical modification of the catalytic domain via attachment of a blocking group.
It is therefore the object of the invention to modify t-PA such that the resultant derivative has a much reduced clearance rate and thus a longer half-life in
23 37
blood plasma. In this process the ability to lyse thrombi as well as the ability to be stimulated by fibrin should be preserved.
The object of the invention is therefore a tissue-type plasminogen activator (t-PA derivative, also denoted K1K2P in the Examples) which is characterized in that it is not glycosylated and consists of the following amino acid sequence:
(M)
Ser Tvr Gin Val lie Aso Thr Arg Ala Thr Cys Tyr Glu Asp Gin Gly
10 15
lie Ser Tyr Arg Gly Thr Trp Ser Thr Ala Glu Ser Gly Ala Glu Cys 20 25 30
Thr Asn Trp Asn Ser Ser Ala Leu Ala Gin Lys Pro Tyr Ser Gly Arg 35 40 45
Arq Pro Asp Ala lie Arg Leu Gly Leu Gly Asn His Asn Tyr Cys Arg 50 55 60
Asn Pro Asp Arg Asp Ser Lys Pro Trp Cys Tyr Val Phe Lys Ala Gly 65 70 75 80
Lvs Tvr Ser Ser Glu Phe Cys Ser Thr Pro Ala Cys Ser Glu Gly Asn
85 90 95
Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr Arg Gly Thr His Ser 100 ~ 105 110
Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp Asn Ser Met lie Leu 115 120 125
lie Gly Lys Val Tyr Thr Ala Gin Asn Pro Ser Ala Gin Ala Leu Gly 130 135 140
Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asp Gly Asp Ala Lys Pro 145 150 155 160
Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr Trp Glu Tyr Cys Asp
165 " 170 175
Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gin Tyr Ser Gin Pro Gin 180 185 190
23 37 9
Phe Arg lie Lys Gly Gly Leu Phe Ala Asp lie Ala Ser His Pro Tro 195 200 205
Gin Ala Ala lie Phe Ala Lys His Arg Arg Ser Pro Gly Glu Arg Phe 210 215 220
Leu Cys Gly Gly lie Leu lie Ser Ser Cys Trp lie Leu Ser Ala Ala 225 230 235 240
His Cys Phe Gin Glu Arg Phe Pro Pro His His Leu Thr Val lie Leu
245 250 255
Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gin Lys Phe Glu 260 265 270
Val Glu Lys Tyr lie Val His Lys Glu Phe Asp Asp Asp Thr Tyr Asp 275 280 285
Asn Asp lie Ala Leu Leu Gin Leu Lys Ser Asp Ser Ser Arg Cys Ala 290 295 300
Gin Glu Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Ala Asp Leu 305 310 315 320
Gin Leu Pro Asp Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys His
325 330 335
Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His Val 340 345 350
Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gin His Leu Leu Asn Arg 355 360 365
Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly Gly 370 375 380
Pro Gin Ala Asn leu His Asp Ala Cys Gin Gly Asp Ser Gly Gly Pro 385 390 395 400
Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly lie lie Ser
405 410 415
Trp Gly Leu Gly Cys Gly Gin Lys Asd Val Pro Gly Val Tyr Thr Lys 420 425 430
Val Thr Asn Tyr Leu Asp Trp lie Arg Asp Asn Met Arg Pro 435 440 445
233796
It was established that, surprisingly, deletion of the other domains which are present in native t-PA had no effect on the thrombolytic efficacy of the protein and that the fibrin-dependent stimulatability of the mutein was the same as that of native t-PA.
A further object of the present invention is a DNA sequence which codes for the t-PA derivative according to the present invention and contains the following sequence:
ATGTCTTACCAAGTGATCGATACCAGGGCCACGTGCTACGAGGACCAGGGCATCAGCTAC
AGGGGCACGTGGAGCACAGCGGAGAGTGGCGCCGAGTGCACCAACTGGAACAGCAGCGCG
TTGGCCCAGAAGCCCTACAGCGGGCGGAGGCCAGACGCCATCAGGCTGGGCCTGGGGAAC
CACAACTACTGCAGAAACCCAGATCGAGACTCAAAGCCCTGGTGCTACGTCTTTAAGGCG .
GGGAAGTACAGCTCAGAGTTCTGCAGCACCCCTGCCTGCTCTGAGGGAAACAGTGACTGC.
TACTTTGGGAATGGGTCAGCCTACCGTGGCACGCACAGCCTCACCGAGTCGGGTGCCTCC '
TGCCTCCCGTGGAATTCCATGATCCTGATAGGCAAGGTTTACACAGCACAGAACCCCAGT
GCCCAGGCACTGGGCCTGGGCAAACATAATTACTGCCGGAATCCTGATGGGGATGCCAAG
CCCTGGTGCCACGTGCTGAAGAACCGCAGGCTGACGTGGGAGTACTGTGATGTGCCCTCC
TGCTCCACCTGCGGCCTGAGACAGTACAGCCAGCCTCAGTTTCGCATCAAAGGAGGGCTC .
TTCGCCGACATCGCCTCCCACCCCTGGCAGGCTGCCATCTTTGCCAAGCACAGGAGGTCG
CCCGGAGAGCGGTTCCTGTGCGGGGGCATACTCATCAGCTCCTGCTGGATTCTCTCTGCC
GCCCACTGCTTCCAGGAGAGGTTTCCGCCCCACCACCTGACGGTGATCTTGGGCAGAACA
TACCGGGTGGTCCCTGGCGAGGAGGAGCAGAAATTTGAAGTCGAAAAATACATTGTCCAT
AAGGAATTCGATGATGACACTTACGACAATGACATTGCGCTGCTGCAGCTGAAATCGGAT |
TCGTCCCGCTGTGCCCAGGAGAGCAGCGTGGTCCGCACTGTGTGCCTTCCCCCGGCGGAC
CTGCAGCTGCCGGACTGGACGGAGTGTGAGCTCTCCGGCTACGGCAAGCATGAGGCCTTG
TCTCCTTTCTATTCGGAGCGGCTGAAGGAGGCTCATGTCAGACTGTACCCATCCAGCCGC
TGCACATCACAACATTTACTTAACAGAACAGTCACCGACAACATGCTGTGTGCTGGAGAC j
ACTCGGAGCGGCGGGCCCCAGGCAAACTTGCACGACGCCTGCCAGGGCGATTCGGGAGGCj
I
CCCCTGGTGTGTCTGAACGATGGCCGCATGACTTTGGTGGGCATCATCAGCTGGGGCCTG I GGCTGTGGACAGAAGGATGTCCCGGGTGTGTACACAAAGGTTACCAACTACCTAGACTGG ATTCGTGACAACATGCGACCG 13 41
2337
The DNA sequence according to the present invention serves to express the t-PA derivative according to the present invention when it is present on an expression plasmid. An expression plasmid of this kind is a further object of the invention as well as an expression plasmid with a different DNA sequence which, however, also codes for the t-PA derivative according to the present invention. Due to the degeneracy of the genetic code sequences which differ from the DNA sequence shown are suitable for this purpose.
Besides the sequence coding for the t-PA derivative the expression plasmid preferably also contains, apart from an origin of replication, a promotor structure which can be regulated (e.g tac promotor), an efficient terminator (e.g. fd) , and a selection marker (e.g. /3-lactamase-gene).
A further object of the present invention is the plasmid pA33. The preparation of this plasmid is described in Example 1; it contains a DNA sequence which codes for the t-PA derivative according to the present invention.
Yet a further object of the invention is a process for the construction of one of the expression plasmids according to the present invention, wherein a DNA sequence which codes for the t-PA protein according to the present invention or a derivative thereof which contains further regions of the t-PA protein in addition to the kringle I, kringle II and the protease domains is incorporated into a plasmid and those domains which code for amino acids which are not present in the t-PA derivative according to the present invention are deleted by site-directed mutagenesis.
23 37
The choice of plasmid, into which the DNA sequence coding for the t-PA derivative according to the present invention is to be incorporated, is dependent on the host cells which are later to be used to express the derivative. Suitable plasmids, as well as the minimum requirements for such a plasmid (e.g. origin of replication, restriction site) are known to the expert. Within the scope of the invention a cosmid, the replicative double-stranded form of phages (A., M13) , and other vectors known to the expert can be used instead of a plasmid. The method of site-directed mutagenesis is described by Morinaga et al., Biotechnolgy 21, (1984), 634, and is carried out essentially as described.
Yet a further object of the invention is a process for the production of a t-PA derivative according to the present invention, which is characterized in that one of the plasmids according to the present invention is expressed in suitable host cells and the product is isolated from the culture medium or, after lysis of the host cells, from the fluid in which the lysis was carried out (e.g. buffer or also the culture medium). Prokaryotic cells are preferably used as the host cells to produce the t-PA derivative according to the present invention. In this connection, it is particularly preferable to first separate the so-called "inclusion bodies" (insoluble protein aggregates) which form during this process from the soluble cell particles, to solubilize the inclusion bodies containing t-PA by treatment with guanidine hydrochloride, subsequently to derivatise them with oxidized glutathione and finally to renature the t-PA derivative by addition of L-arginine and guanidine hydrochloride. Exact instructions for the activation of t-PA from "inclusion bodies" are for example disclosed in the patent applications
23 S7 »€
EP-A 0 219 874 and EP-A 0 241 02 2. According to the present invention any other method for the isolation of the active protein from inclusion bodies can, however, be employed as well.
The process according to the present invention is preferably carried out in the presence of L-arginine, in particular in a concentration of 25 to 1000 mmol/1.
The removal of foreign proteins according to the present invention by affinity chromatography is carried out in a preferred embodiment of the invention over an ETI (Erythrina Trypsin Inhibitor) adsorber column. In this connection, ETI is fixed on a carrier material (adsorber) such as e.g. BrCN-Sepharose. The purification over an ETI adsorber column has the advantage that the ETI adsorber column material can be loaded directly from the concentrated reoxidation preparation even in the presence of such high concentrations of arginine as 0.8 mol/1 arginine. In this way, an aggregation of p-t-PA, which can occur at low arginine concentrations under 25 mmol/1, is avoided. Thus, it is especially preferred to carry out the purification of the p-t-PA preparation over an ETI adsorber column in the presence of 0.2 to 1.0 M, preferably 0.5 to 1.0 M arginine. In this process the solution containing the KlK2P/Pro has preferably a pH of more than 6.5, particularly preferably of more than 7.
The elution from the ETI column is effected by lowering the pH in the presence of arginine under conditions which allow a good solubility of t-PA which was expressed in prokaryotes. Preferably the pH is in the acid range during the elution, particularly preferably in the range of 4 to 6.
23 37 90
A preparation of KlK2P/Pro produced according to the present invention has a specific t-PA activity of >0.4xl06 IU/mg, preferably >0.6xl06 IU/mg whose stimulatability by fibrin cleavage products (activity in the presence of fibrinogen peptides/activity without fibrinogen peptides) is larger than ten-fold and preferably larger than twenty-fold. The purity of the preparation according to the present invention is more than 90 % and preferably more than 95 %, especially more than 98 %.
The t-PA derivative according to the present invention is therefore particularly suitable for use in a pharmaceutical agent for dissolving blood clots which again is a further object of the invention.
The invention is elucidated by the following Example in conjunction with the Figures.
Fig. 1 shows schematically the construction of plasmid pA33.
Fig. 2 shows the time course of the plasma concentration of the t-PA activity after intravenous bolus injection of commercially available t-PA (ActilyseR) in comparison with the t-PA derivative according to the present invention in a linear graph and
Fig.
3
shows the time course of the concentration in a logarithmic graph.
23 37 8r
Example 1
Construction of the plasmid pA33
The plasmid pePa 133 served as the starting plasmid which is described in the application EPA 0 242 836. All experimental steps for the specific mutagenesis i.e. for the deletion of the domains F and E from pePa 13 3 (see Fig. 1) were carried out essentially using the method of Morinaga et al., Biotechnologie 21 (1984), 634. For this, two cleavage preparations were prepared from pePa 13 3. Preparation A was cleaved with EcoRI and the largest fragment was isolated. Preparation B was cleaved with Xhol and in this way the product was linearized. The following oligonucleotide was used for the heteroduplex formation:
' TAC CAA GTG ATC GAT ACC AGG GCC 3•
Those clones which contained the sought-after plasmid pA33 were determined by colony hybridization with the above-mentioned mutagenesis oligonucleotide. This plasmid was characterized by restriction analysis and checked for the absence of the Sspl restriction cleavage site which is located in the part of the t-PA expression cassette coding for the finger domain.
23 37
Example 2
Preparation of active KlK2P/Pro from E. coli a) Cell lysis and preparation of the inclusion bodies (IB1s)
1.6 kg cell wet-weight (E. coli, DSM 3689), transformed with the plasmid pA33 was suspended in 10 1 0.1 mol/1 Tris-HCl, 20 mmol/1 EDTA, pH 6.5, 4°C. 2.5 g lysozyme was added to this and incubated for 3 0 minutes at 4°C; afterwards complete cell lysis was carried out by high pressure dispersion. 5 1 0.1 mol/1 Tris-HCl, 20 mmol/1 EDTA, 6 % Triton X100 and 1.5 mol/1 NaCl, pH 6.5 was added and mixed with the lysate solution and incubated for a further 30 minutes at 4'C. Following this the inclusion bodies (IB's) were separated by centrifugation.
The pellet was suspended in 10 1 0.1 mol/1 Tris-HCl, 20 mmol/1 EDTA, pH 6.5, incubated for 30 minutes at 4°C and the IB-preparation was isolated by subsequent centrifugation.
b) Solubilization of the IB's
8.7 g IB's (wet-weight) were suspended in 100 ml 0.1 M Tris, 6 M guanidine, 0.1 M DTE, pH 7.5 and stirred for 30 minutes at 25°C.
After adjustment of the pH to pH 3 with HCl (25 %), the solution was dialysed against 4 mol/1 guanidine-HCl, pH 2.5 (3x3 1, 24 h, 4#C) .
23 37
c) Derivatization
The above-mentioned dialysate was adjusted to 50 mmol/1 with oxidized glutathione (GSSG) and to 100 mmol/1 with Tris and the pH value was titrated to 7.5 with 5 mol/1 NaOH. The preparation was incubated for 90 min at 25°C. After adjusting the pH value to pH 3 with HC1 (25 %), a dialysis against 10 mmol/1 HCl (3 x 100 1, 48 h, 4°C) was carried out.
d) Renaturation
A 10 1 reaction vessel was filled with 0.8 mol/1 Arg/HCl, pH 8.5, 1 mmol/1 EDTA, 1 mmol/1 GSH (glutathione). The renaturation was carried out at 20°C by a three-fold addition at 24 hour intervals of 100 ml of the derivative which had previously been dialysed against 6 mol/1 guanidine-HCl, pH 2.5 .
After the renaturation a preparation is obtained with a specific activity of 50 - 75 KU/mg (test according to H. Lill, Z. gesamte inn. Med. ihre Grenzgeb. (1987), 42., 478-486)
e) Concentration of the renaturation preparation
The renatured preparation can, if required, be concentrated on a haemodialyzer.
2337S
Example 3
Purification of KlK2P/Pro from E. coli
The purification of KlK2P/Pro from E. coli is carried out by affinity chromatography on Erythrina-Trypsin-Inhibitor (ETI)-Sepharose.
The renaturation preparation was concentrated 1 : 5 on a haemodialyzer (Asahi AM 300) and dialysed overnight against 0.8 mol/1 Arg/HCl, pH 7.5 and centrifuged. 1.8 1 dialysate was applied (4 column volumes (CV)/h) to an ETI-Sepharose column (12 0 ml) which had been equilibrated with 0.8 mol/1 Arg/HCl, pH 7.5 and was washed with buffer (0.8 mol/1 Arg/HCl, pH 7.5, 0.5 mol/1 NaCl) until the absorbance of the eluate at 280 nm reached the blank value for the buffer. After washing for a second time with 5 CV 0.3 mol/1 Arg/HCl, pH 7.0 the elution was carried out with 0.3 mol/1 Arg/HCl, pH 4.5.
Volume Activity cProt. SA F*
(ml) KU/ml mg/ml KU/mg dialysate 1800 74 1.05 70 15
KlK2P/Pro 200 610 0.82 744 28
*F = stimulation by fibrin = activity in the presence of fibrin/activity in the absence of fibrin.
2 3 5 7 0 C
- is -
Example 4
Characterization of purified KlK2P/Pro from E. coli a) Characterization of the protein
- SDS-PAGE and Reversed-Phase HPLC
The homogeneity of the preparation purified by affinity chromatography on ETI-Sepharose was demonstrated by SDS-PAGE and reversed-phase HPLC (RP-HPLC). An apparent molecular weight for K1K2P from E. coli of 50800 Da + 2000 Da was calculated from the relative distance of migration in an electrophoretic analysis of the purified material. The densitometric analysis showed a purity of > 90 %.
RP-HPLC is based on the different interactions of proteins with hydrophobic matrices. This property was used as an analytical method to quantify the degree of purity.
The analysis of the purified KlK2P/Pro from E.coli was carried out on a Nucleosil 300 separation column (Knauer) using a trifluoroacetic acid/acetonitrile gradient (buffer A: 1.2 ml trifluoroacetic acid in 1000 ml H20; buffer B: 300 ml H20, 700 ml acetonitrile, 1 ml trifluoroacetic acid;
0 - 100 %). Integration of the chromatographic analysis yielded a purity of >95 %.
213796
- N-terminal sequence
The N-terminal amino acid sequence was determined using an ABI 47 0 sequencer with a standard programme and on-line PTH detection. The determined sequence S1-Y2-Q3-V4-I5-D6-T7-R8-A9-T10-C11-Y12-E13-D14 agreed with the expected sequence deduced from the DNA-sequence.
b) Activity determination
The in vitro activity of KlK2P/Pro from E. coli was determined according to H. Lill, Z. gesamte inn. Med. ihre Grenzgeb. (1987) , 4.2, 478-486. The specific activity (SA) was 650000 IU/mg + 2 00000 IU/mg. The stimulatability of KlK2P/Pro from E.coli in this test system by BrCN-fibrinogen fragments (activity in the presence of fibrinogen fragments divided by activity in the absence of fibrinogen fragments) was 25-30.
c) In vitro binding to fibrin
The in vitro binding of KlK2P/Pro to fibrin was determined according to the method described by Higgins and Vehar (Higgins, D.L. and Vehar, G.A. (1987), Biochem. 26, 7786-7791).
It shows that KlK2P/Pro compared to t-PA from CHO cells has no significant binding to fibrin.
233796
Example 5
Pharmacokinetics of KlK2P/Pro in the rabbit
The pharmacokinetic properties of KlK2P/Pro were compared to those of ActilyseR (Alteplase, Thoraae GmbH, Biberach, FRG) in New-Zealand white rabbits. Both fibrinolytic agents were injected intravenously for 1 min at a dose of 200000 IU/kg body weight "(bw) . Plasma samples were taken before and at defined times after the injection. The t-PA activity in the plasma was measured with a spectrophotometry test according to J. H. Verheijen et al., (Thromb. Haemostas. 48., 266, 1982), modified according to H. Lill (Z. ges. Inn. Med. 42. 478, 1987).
A computer programme for non-linear regression modified according to H.Y. Huang (Aero-Astronautics-Report 64, Rice University, 1-30, 1969) was used to calculate the pharmacokinetic parameters. When fitting the curves, a 1 or 2 compartment model was assumed which is different from individual to individual. In each case, before the calculation, the value for the endogenous basal concentration was subtracted from the subsequent values.
KlK2P/Pro is eliminated in only 2 of 6 animals with a fast ci and a slow /3 phase. In these 2 animals the alpha phase portion was 53 % of the total elimination. In contrast, all animals in the ActilyseR group show a fast alpha phase whose portion amounts to more than 70 % of the total elimination. KlK2P/Pro is eliminated mainly with only one half-time which is 15.1 + 3.1 min. In contrast, ActilyseR has a fast half-time of 1.63 min and a slow half-time of 10.l min (Tab. 1). The total plasma
23 37
clearance of KlK2P/Pro is 6.3 + 1.5 ml/kg/min and is thus considerably lower than that of ActilyseR (Cltot = 22.9 ± 9.1 ml/kg/min).
All in all, KlK2P/Pro represents a t-PA mutant which, in comparison with ActilyseR as the state of the art, has a clearly improved pharmokinetic profile (Fig. 2 and 3).
Example 6
Pharmaf-oriyn^TTiics of KlK2P/Pro in the rabbit
The rabbit model for jugular vein thrombosis established by D. Collen et al. (J. Clin. Invest. 7l, 368, 1983) was used to examine the thrombolytic efficacy. The fibrinolytic agents or the solvent were injected intravenously over 1 min as a bolus. Afterwards the rate of thrombolysis was determined and selected parameters of the coagulation system as well as the number of platelets were determined (Table 2).
At the same dose (200000 IU/kg body weight) KlK2P/Pro achieved a statistically significantly higher rate of thrombolysis of 50.7 + 6.5 % after intravenous bolus injection than ActilyseR (24.1 + 3.7 %). The dose of ActilyseR with a comparable thrombolysis efficacy to KlK2P/Pro is 800000 IU/kg body weight (Table 2).
With an eguipotent dosage of KlK2P/Pro in comparison with ActilyseR there were less effects on the coagulation parameters fibrinogen, plasminogen and alpha2-antiplasmin compared with the solvent group, which, however, do not differ from the effects of an eguipotent dose of ActilyseR.
2 3 3 7 91
KlK2P/Pro is thus a t-PA mutant which has a thrombolytic efficacy after bolus injection in the rabbit model of jugular vein thrombosis which is greatly increased in comparison with ActilyseR. In this KlK2P/Pro has maintained its fibrin specificity to an extent which also applies for ActilyseR.
J
>
Table l
Pharmacokinetic parameters derived from computer calculations of plasma concentration-time data based on the t-PA activity in anaesthetized rabbits after i.v. bolus injection of 200000 IU/kg body weight KlK2P/Pro or ActilyseR
Fibrinolytic tl/2 a
11/2 0
cinj.
V *
c
C1tot*
AUCextrapol.
agent
(min)
(min)
(iu/ml)
(ml/kg)
(mlxkg~*xmin~1)
(IUxml-1xh)
ActilyseR
1.63
. 1
3051.9
63.2
22.9
161.1
(n=6)
(n=5)
±1318.8
+29. 3
±9 . 1
+49.8
1
KlK2P/Pro
8.9
.1
1695.9
119.1
6.3
556. 4
(n=6)
(n=2)
+ 3.1
+345.4
+ 26.6
+ 1.5
±118.8
Mean ± SEM
*VC = Volume of distribution of the central compartment Cl£0t = Total plasma clearance
AUC = area under the curve; the area under the curve ("AUC") is of particular interest for the application of a fibrinolytic agent as a bolus injection, since it enables a comparison over time of the prevailing plasma concentrations.
Table
Rate of thrombolysis, number of platelets and selected parameters of the coagulation system after i.v. bolus injection (over 1 min) of Actilyse^, KlK2P/Pro or solvent in the rabbit model of jugular vein thrombosis
Solvent
ActilyseR 200000 IU/kg bw
KlK2P/Pro 200000 IU/kg bw
Actilyse^ 800000 IU/kg bw
Thrombolysis rate (%)
12.9 + 0.9
24.1 + 3.7
50.7 + 6.5
44.6 + 4.8
Fibrinogen (%)
89.5 ± 2.1
90.5 + 2.6
81.1 ± 5.1
81.4 ± 3.4
Plasminogen (%)
90.5 ± 2.7
83.8 ± 4.4
60.1 ± 4.3
69.6 ± 3.3
a2-Antiplasmin (%)
90.9 + 4.4
100.8 + 5.3
67.6 + 6.7
74.2 + 5.9
PTT (%)
113.8 ± 4.9
112.9 ± 4.3
113.1 ± 3.0
115.1 ± 5.5
Thrombocytes (%)
86.1 ±12.1
91.4 ± 4.9
84.4 ± 8.3
86.3 ± 2.8
Coagulation parameters and number of thrombocytes in % of the initial value before injection
PTT = partial thromboplastin time
Mean ± SEM each group n = 6 animals bw = body weight
i 3 37 #
Example 7
Optimized expression in E. coli
To increase the yield of expression product, the sequence encoding the KlK2P-gene was subcloned in a plasmid with a high copy number. Plasmid pePa 126.1 described in the patent application P 39 31 93 3.4 was used for this. This plasmid is composed mainly of the vector pKK223-3 and the sequence coding for t-PA as described in the application EP-A 0 242 835.
An fd-terminator sequence was first integrated into this plasmid. For this, the plasmid pePa 126.1 was linearized with the restriction enzyme Hind III. The plasmid cleaved in this manner was separated by gel electrophoresis and isolated preparatively. The plasmid pLBUl (Gentz et al., (1981) PNAS 78 (8):4963) was cleaved with Hind III and a Hind III fragment of about 360 bp which contained the fd-terminator was isolated preparatively by gel electrophoresis and gel elution. The linearized plasmid pePa 126.1 and the 360 bp Hind III fragment from pLBUl were ligated. The ligation preparation was cotransformed with the plasmid pUBS 500, described in the application P 39 31 933.4 in E. coli, DSM 2102. From the clones, those were selected that contained the desired plasmid pePa 126 fd which differs from the starting plasmid pePa 126.1 in that it contains a second Hind III cleavage site.
Two fragments were isolated from the plasmid pePa 126 fd: a BamHI/PvuI-fragment of 3.4 kb size and a Pvul/Xmal fragment of 1.3 kb size. Both these fragments were ligated with a BamHI/Xmal fragment of about 1.6 kb
23 37
from the plasmid pA33 and transformed with the plasmid pUBS 500 into E- coli- The resultant plasmid was named pA33 fd and can be distinguished from pePa 126 fd in that in a restriction digest with EcoRI the second smallest EcoRI fragment from pePa 126 fd of about 610 bp length is about 250 bp shorter in pA33 fd.
Claims (4)
1. Derivative of tissue-type plasminogen activator (t-PA), wherein it is not glycosylated and has the following amino acid sequence: Ser Tyr Gin Val lie Asp Thr Arg Ala Thr Cys Tyr Glu Asd Gin Gly 5 10 15 lie Ser Tyr Arg Gly Thr Trp Ser Thr Ala Glu Ser Gly Ala Glu Cys 20 25 30 Thr Asn Trp Asn Ser Ser Ala Leu Ala Gin Lys Pro Tvr Ser Gly Arg 35 40 45 Arg Pro Asp Ala lie Arg Leu Gly Leu Gly Asn His Asn Tvr Cys Arg 50 55 60 Asn Pro Asp Arg Asd Ser Lys Pro Trp Cys Tyr Val Phe Lvs Ala Gly 65 70 75 80 Lys Tyr Ser Ser Glu Phe Cys Ser Thr Pro Ala Cys Ser Glu Gly Asn 85 90 95 Ser Asp Cys Tyr Phe Gly Asn Gly Ser Ala Tyr Arg Glv Thr His Ser 100 105 " 110 Leu Thr Glu Ser Gly Ala Ser Cys Leu Pro Trp Asn Ser Met lie Leu 115 120 125 lie Gly Lys Val Tyr Thr Ala Gin Asn Pro Ser Ala Gin Ala Leu Gly 130 135 140 Leu Gly Lys His Asn Tyr Cys Arg Asn Pro Asd Gly Asd Ala Lys Pro 145 150 155 * 160 Trp Cys His Val Leu Lys Asn Arg Arg Leu Thr Trp Glu Tyr Cys Asp 165 170 175 Val Pro Ser Cys Ser Thr Cys Gly Leu Arg Gin Tyr Ser Gin Pro Gin 180 185 190 Phe Arg lie Lys Gly Gly Leu Phe Ala Asp He Ala Ser His Pro Trp 195 200 205 Gin Ala Ala lie Phe Ala Lys His Arg Arg Ser Pro Gly Glu Arg Phe 210 215 220 Leu Cys Gly Gly lie Leu lie Ser Ser Cys Trp lie Leu Ser Ala Ala 225 230 235 240 233796 - 25 - His Cys Phe Gin Glu Arg Phe Pro Pro His His Leu Thr Val lie Leu 245 250 255 Gly Arg Thr Tyr Arg Val Val Pro Gly Glu Glu Glu Gin Lys Phe Glu 260 265 270 Val Glu Lys Tyr lie Val His Lys Glu Phe Asp Asp Asp Thr Tyr Asd 275 280 285 Asn Asp lie Ala Leu Leu Gin Leu Lys Ser Asp Ser Ser Arg Cys Ala 290 295 300 Gin Glu Ser Ser Val Val Arg Thr Val Cys Leu Pro Pro Ala Asd Leu 305 310 315 * 320 Gin Leu Pro Asd Trp Thr Glu Cys Glu Leu Ser Gly Tyr Gly Lys His 325 330 335 Glu Ala Leu Ser Pro Phe Tyr Ser Glu Arg Leu Lys Glu Ala His Val 340 345 350 Arg Leu Tyr Pro Ser Ser Arg Cys Thr Ser Gin His Leu Leu Asn Arg 355 360 365 Thr Val Thr Asp Asn Met Leu Cys Ala Gly Asp Thr Arg Ser Gly Gly 370 375 380 Pro Gin Ala Asn Leu His Asp Ala Cys Gin Gly Asp Ser Gly Gly Pro 385 390 395 400 Leu Val Cys Leu Asn Asp Gly Arg Met Thr Leu Val Gly lie lie Ser 405 410 415 Trp Gly Leu Gly Cys Gly Gin Lys Asp Val Pro Gly Val Tyr Thr Lys 420 425 430 Val Thr Asn Tyr Leu Asp Trp lie Arg Asp Asn Met Arg Pro. 435 440 445 DNA sequence, wherein it codes for a t-PA derivative as claimed in claim 1 and contains the following sequence: i JSjuai 1992 233796 - 26 - ATGTCTTACCAAGTGATCGATACCAGGGCCACGTGCTACGAGGACCAGGGCATCAGCTAC AGGGGCACGTGGAGCACAGCGGAGAGTGGCGCCGAGTGCACCAACTGGAACAGCAGCGCG TTGGCCCAGAAGCCCTACAGCGGGCGGAGGCCAGACGCCATCAGGCTGGGCCTGGGGAAC CACAACTACTGCAGAAACCCAGATCGAGACTCAAAGCCCTGGTGCTACGTCTTTAAGGCG GGGAAGTACAGCTCAGAGTTCTGCAGCACCCCTGCCTGCTCTGAGGGAAACAGTGACTGC , TACTTTGGGAATGGGTCAGCCTACCGTGGCACGCACAGCCTCACCGAGTCGGGTGCCTCC ! TGCCTCCCGTGGAATTCCATGATCCTGATAGGCAAGGTTTACACAGCACAGAACCCCAGT GCCCAGGCACTGGGCCTGGGCAAACATAATTACTGCCGGAATCCTGATGGGGATGCCAAG CCCTGGTGCCACGTGCTGAAGAACCGCAGGCTGACGTGGGAGTACTGTGATGTGCCCTCC TGCTCCACCTGCGGCCTGAGACAGTACAGCCAGCCTCAGTTTCGCATCAAAGGAGGGCTC .
TTCGCCGACATCGCCTCCCACCCCTGGCAGGCTGCCATCTTTGCCAAGCACAGGAGGTCG CCCGGAGAGCGGTTCCTGTGCGGGGGCATACTCATCAGCTCCTGCTGGATTCTCTCTGCC GCCCACTGCTTCCAGGAGAGGTTTCCGCCCCACCACCTGACGGTGATCTTGGGCAGAACA TACCGGGTGGTCCCTGGCGAGGAGGAGCAGAAATTTGAAGTCGAAAAATACATTGTCCAT AAGGAATTCGATGATGACACTTACGACAATGACATTGCGCTGCTGCAGCTGAAATCGGAT | i TCGTCCCGCTGTGCCCAGGAGAGCAGCGTGGTCCGCACTGTGTGCCTTCCCCCGGCGGAC j CTGCAGCTGCCGGACTGGACGGAGTGTGAGCTCTCCGGCTACGGCAAGCATGAGGCCTTG TCTCCTTTCTATTCGGAGCGGCTGAAGGAGGCTCATGTCAGACTGTACCCATCCAGCCGC TGCACATCACAACATTTACTTAACAGAACAGTCACCGACAACATGCTGTGTGCTGGAGAC ACTCGGAGCGGCGGGCCCCAGGCAAACTTGCACGACGCCTGCCAGGGCGATTCGGGAGGC CCCCTGGTGTGTCTGAACGATGGCCGCATGACTTTGGTGGGCATCATCAGCTGGGGCCTG GGCTGTGGACAGAAGGATGTCCCGGGTGTGTACACAAAGGTTACCAACTACCTAGACTGG ATTCGTGACAACATGCGACCG 1341.
3. Expression plasmid, wherein it contains the DNA sequence as claimed in claim 2 or a different DNA sequence within the scope of the degeneracy of the genetic code which codes for a protein as claimed in claim 1.
4. Plasmid pA33. «*\ n 2337 - 27 - Process for the construction of an expression plasmid as claimed in claim 3 or 4, wherein a DNA sequence which codes for the whole t-PA protein or a derivative thereof containing further regions of the t-PA protein in addition to the Kringle I, kringle II and the protease domains is incorporated into a plasmid and those domains which code for amino acids which are not present in the t-PA derivative as claimed in claim 1 are removed by site-directed mutagenesis. Process as claimed in claim 5, wherein the corresponding cDNA is used as the DNA sequence for the t-PA protein or a derivative thereof. Process for the production of a t-PA derivative as claimed in claim 1, wherein a plasmid according to claim 3 or 4 is introduced into — suitable host cells and the expression product is isolated from the culture medium or after lysis of the host cells. Process as claimed in claim 7, wherein prokaryotic cells are used as host cells. Process as claimed in claim 8 wherein the prokaryotic cells used as host cells are E. coli. Process as claimed in claim 8 or claim 9 wherein the yield of active protein is increased by isolating the "inclusion bodies" that form and solubilizing them by treatment with guanidine hydrochloride, followed by derivatization with oxidized glutathione and finally renaturation of the t-PA derivative by addition of L-arginine and GSH. 233796 28 12. 13. 14. 15. 16. 17. Process as claimed in claim 10, wherein after renaturation a chromatographic purification with an ETI adsorber column is carried out. Process as claimed in any one of claims 7 to 11, wherein the process is carried out in the presence of 25 to 1000 mmol/1 L-arginine. Process as claimed in any one of claims 10 to 12, wherein after renaturation a concentration step is carried out and the subsequent chromatographic purification with the concentrate, which contains 25 to 1000 mmol/1 L-arginine is carried out over an ETI adsorber column. Process as claimed in claim 13 wherein the concentrate contains 200 to 1000 mmol/1 L-arginine. Process as claimed in claim 13 or claim 14, wherein the concentrate used for the chromatographic purification is adjusted to a pH value of more than 7.0. Process as claimed in any one of claims 11 to 15, wherein the elution from the ETI adsorber column is carried out at a pH of 4 to 6. Agent for dissolving blood clots containing a t-PA derivative as claimed in claim 1. 233796 f* 29 18. 19. 20. 21. 22. 23. 24. 25. Derivative of tissue-type plasminogen activator (t-PA) as defined in claim 1 substantially as herein described with reference to any example thereof or to the accompanying drawings. DNA sequence as defined in claim 2 substantially as herein described with reference to any example thereof or to the accompanying drawings. Expression plasmid as defined in claim 3 substantially as herein described with reference to any example thereof or to the accompanying drawings. Process as defined in claim 5 for the construction of an expression plasmid substantially as herein described with reference to any example thereof or to the accompanying drawings. Process as defined in claim 7 for the production of a t-PA derivative substantially as herein described with reference to any example thereof or to the accompanying drawings. Agent for dissolving blood clots containing a t-PA derivative as defined in claim 17 substantially as herein described with reference to any example thereof or to the accompanying drawings. Expression plasmid when constructed by the process of any one of claims 5, 6 and 21. A t-PA derivative when produced by the process of any one of claims 7 to 16 and 22.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE3917781 | 1989-05-31 | ||
DE3923339A DE3923339A1 (en) | 1989-05-31 | 1989-07-14 | FABRIC PLASMINOGEN ACTIVATOR DERIVATIVE |
Publications (1)
Publication Number | Publication Date |
---|---|
NZ233796A true NZ233796A (en) | 1992-07-28 |
Family
ID=25881452
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NZ233796A NZ233796A (en) | 1989-05-31 | 1990-05-24 | T-pa derivative, recombinant production |
Country Status (17)
Country | Link |
---|---|
EP (1) | EP0400545B1 (en) |
JP (1) | JPH0327286A (en) |
AT (1) | ATE119940T1 (en) |
AU (1) | AU623781B2 (en) |
CA (1) | CA2017636C (en) |
CZ (1) | CZ267690A3 (en) |
DD (1) | DD300109A5 (en) |
DE (2) | DE3923339A1 (en) |
ES (1) | ES2070210T3 (en) |
FI (1) | FI101475B1 (en) |
HU (1) | HU216870B (en) |
IE (1) | IE66006B1 (en) |
IL (1) | IL94539A (en) |
NO (1) | NO902405L (en) |
NZ (1) | NZ233796A (en) |
PT (1) | PT94227B (en) |
ZA (1) | ZA904089B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3942144A1 (en) * | 1989-12-20 | 1991-06-27 | Boehringer Mannheim Gmbh | STABILIZATION OF K1K2P PRO |
US6027888A (en) * | 1996-04-05 | 2000-02-22 | Board Of Regents, The University Of Texas System | Methods for producing soluble, biologically-active disulfide-bond containing eukaryotic proteins in bacterial cells |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MX197183A (en) * | 1982-05-05 | 1994-02-28 | Genentech Inc | HUMAN TISSUE PLASMINOGEN ACTIVATOR |
FR2594845B1 (en) * | 1986-02-21 | 1989-12-01 | Genetica | MICROBIOLOGICAL PREPARATION OF THE HUMAN PLASMINOGEN TISSUE ACTIVATOR (T-PA) AND CONVERSION OF THE ENZYME SO OBTAINED IN ITS ACTIVE FORM |
DE3643158A1 (en) * | 1986-04-21 | 1987-11-19 | Boehringer Mannheim Gmbh | TISSUE PLASMINOGEN ACTIVATOR (TPA) DERIVATIVE AND ITS PRODUCTION |
FI100106B (en) * | 1986-12-05 | 1997-09-30 | Novartis Ag | A process for the preparation of a plasminogen single-stranded recombinant activator |
IL87276A (en) * | 1987-08-03 | 1995-07-31 | Fujisawa Pharmaceutical Co | Analog of tissue plasminogen activator comprising only the kringle 2 and protease domain dna encoding the same processes for the preparation thereof and pharmaceutical compositions containing the same |
US5094953A (en) * | 1988-03-21 | 1992-03-10 | Genentech, Inc. | Human tissue plasminogen activator variants |
DE3903581A1 (en) * | 1989-02-07 | 1990-08-16 | Boehringer Mannheim Gmbh | FABRIC PLASMINOGEN ACTIVATOR DERIVATIVE |
-
1989
- 1989-07-14 DE DE3923339A patent/DE3923339A1/en not_active Withdrawn
-
1990
- 1990-05-22 IE IE184890A patent/IE66006B1/en not_active IP Right Cessation
- 1990-05-24 NZ NZ233796A patent/NZ233796A/en unknown
- 1990-05-28 DE DE59008693T patent/DE59008693D1/en not_active Expired - Fee Related
- 1990-05-28 IL IL9453990A patent/IL94539A/en not_active IP Right Cessation
- 1990-05-28 ES ES90110096T patent/ES2070210T3/en not_active Expired - Lifetime
- 1990-05-28 AT AT90110096T patent/ATE119940T1/en not_active IP Right Cessation
- 1990-05-28 EP EP90110096A patent/EP0400545B1/en not_active Expired - Lifetime
- 1990-05-28 CA CA002017636A patent/CA2017636C/en not_active Expired - Fee Related
- 1990-05-28 AU AU56009/90A patent/AU623781B2/en not_active Ceased
- 1990-05-29 ZA ZA904089A patent/ZA904089B/en unknown
- 1990-05-29 JP JP2139539A patent/JPH0327286A/en active Pending
- 1990-05-30 HU HU903267A patent/HU216870B/en not_active IP Right Cessation
- 1990-05-30 NO NO90902405A patent/NO902405L/en unknown
- 1990-05-30 DD DD341150A patent/DD300109A5/en unknown
- 1990-05-30 CZ CS902676A patent/CZ267690A3/en not_active IP Right Cessation
- 1990-05-30 FI FI902700A patent/FI101475B1/en not_active IP Right Cessation
- 1990-05-31 PT PT94227A patent/PT94227B/en active IP Right Grant
Also Published As
Publication number | Publication date |
---|---|
CZ282035B6 (en) | 1997-04-16 |
FI902700A0 (en) | 1990-05-30 |
CA2017636C (en) | 2000-05-02 |
ATE119940T1 (en) | 1995-04-15 |
PT94227B (en) | 1997-01-31 |
DE59008693D1 (en) | 1995-04-20 |
IE901848L (en) | 1990-11-30 |
HUT54734A (en) | 1991-03-28 |
FI101475B (en) | 1998-06-30 |
CZ267690A3 (en) | 1997-04-16 |
EP0400545B1 (en) | 1995-03-15 |
AU5600990A (en) | 1990-12-06 |
CA2017636A1 (en) | 1990-11-30 |
FI101475B1 (en) | 1998-06-30 |
NO902405L (en) | 1990-12-03 |
IE66006B1 (en) | 1995-11-29 |
DE3923339A1 (en) | 1990-12-06 |
AU623781B2 (en) | 1992-05-21 |
EP0400545A1 (en) | 1990-12-05 |
ES2070210T3 (en) | 1995-06-01 |
JPH0327286A (en) | 1991-02-05 |
ZA904089B (en) | 1991-03-27 |
DD300109A5 (en) | 1992-05-21 |
HU903267D0 (en) | 1990-10-28 |
IL94539A0 (en) | 1991-03-10 |
IL94539A (en) | 1996-08-04 |
PT94227A (en) | 1991-02-08 |
NO902405D0 (en) | 1990-05-30 |
HU216870B (en) | 1999-09-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5223256A (en) | Thrombolytically active non-glycosylated protein | |
JP2631645B2 (en) | Novel compound, production method thereof and pharmaceutical composition containing the same | |
Orsini et al. | Efficient renaturation and fibrinolytic properties of prourokinase and a deletion mutant expressed in Escherichia coli as inclusion bodies | |
US5681721A (en) | Bifunctional urokinase variants with improved fibrinolytic characteristics and thrombin inhibiting effect | |
AU620927B2 (en) | A preparation of plasminogen activator expressed in prokaryotes | |
CA2017636C (en) | Derivative of tissue-type plasminogen activator | |
EP0666920B1 (en) | Thrombin activatable plasminogen derivatives | |
US5908625A (en) | Use of the protease domain of human plasminogen activator for the treatment of thromboembolic diseases | |
CA2262751A1 (en) | Plasminogen activator capable of being activated by thrombin | |
EP0796323A1 (en) | Use of the protease domain of human plasminogen activator for the treatment of thromboembolic diseases | |
CA2017177A1 (en) | Human prourokinase variants, methods of producing same, dna sequences, plasmids and hosts therefor | |
IE861054L (en) | Protease resistant single-chain urokinase | |
MXPA99000966A (en) | Plasminogen activator capable of being activated by thrombin |